East Tennessee State University Digital Commons @ East Tennessee State University

Electronic Theses and Dissertations Student Works

May 1991 Mouse Mast Cell Proteases: Induction, Molecular Cloning, and Characterization Wei Chu East Tennessee State University

Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biochemistry Commons, Cell Biology Commons, and the Molecular Biology Commons

Recommended Citation Chu, Wei, "Mouse Mast Cell Proteases: Induction, Molecular Cloning, and Characterization" (1991). Electronic Theses and Dissertations. Paper 2656. https://dc.etsu.edu/etd/2656

This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, white others may be from any type of computer printer.

The quality of this reproduction Is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afreet reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material bad to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

University Microfilms International A Bell & Howell Information Company 300 North Zeeb Road. Ann Arbor. Ml <18106-1346 USA 313/761-4700 800/521-0600 Order Number 0124275

Mouse mast cell proteases: Induction, molecular cloning, and characterization

Chu, Wei, Ph.D.

East Tennessee State University, 1091

UMI 300 N. Zccb Rd. Ann Aibor, MI 48106 MOUSE MAST CELL PROTEASES:

INDUCTION, MOLECULAR CLONING, AND CHARACTERIZATION

A Dissertation

Presented to

the Faculty of the Department of Biochemistry

James H. Quillen College of Medicine East Tennessee State University

In Partial Fulfillment

of the Requirements for the Degree

Doctor of Philosophy in Biomedical Sciences

by

Wei Chu May, 1991 APPROVAL

This is to certify that the Graduate Committee of

WET CHU

met on the

thirteenth day of November. 1990 The committee read and examined his dissertation, supervised his defense of it in an oral examination, and decided to recommend that his study be submitted to the

Associate Vice-President for Research and Dean of the

Graduate School, in partial fulfillment of the requirements for the degree Doctor of Philosophy in Biomedical Science.

/S r l c

Signed on behalf of the Graduate Council

ii ABSTRACT

HOUSE MAST CELL PROTEASES:

INDUCTION, MOLECULAR CLONING, AND CHARACTERIZATION

By Wei Chu

Tryptase, a mast cell-specific serine protease with trypsin-like specificity, has been identified in a mouse mast cell line (ABFTL-6) based on it's enzymatic activity, inhibition properties, and cross-reactivity to a human mast cell tryptase antibody.

The effects of fibroblast-conditioned medium and sodium butyrate on ABFTL-6 mast cell differentiation and tryptase expression have been examined. ABFTL-6 mouse mast cells undergo phenotypic changes upon culturing in media supplemented with fibroblast-conditioned media at 50% or 1 mM sodium butyrate. The induced cells increased in size, had larger and more metachromatic cytoplasmic granules, and increased their total cellular protein about four-fold. Tryptase activity increased 13- and 6-fold upon fibroblast- conditioned media and butyrate induction, respectively. However, tryptase antigen levels increased dramatically from 2.3 jxg/106 uninduced cells to 125 (54-fold) and 75 (33-fold) /ig/10* cells induced with fibroblast-conditioned media or butyrate, respectively. A cDNA library was constructed in JLgtlO from ABFTL-6 cell poly (A)+ RNA, and screened with dog mast cell tryptase and rat mast cell chymase cDNAs. Clones encoding two distinct tryptases (mouse tryptases I and II), a chymase (mouse chymase I) and a novel carboxyl terminal chymase (mouse chymase II) were isolated and sequenced.

Mouse tryptases I and II have 75% and 70% sequence identity at the nucleotide and amino acid levels, respectively. The deduced amino acid sequence for the mature active enzyme for each mouse tryptase contains 245 residues and all the characteristics of a serine protease. Asp is found in the substrate binding pockets, consistent with a trypsin-like specificity for Arg-X and Lys-X bonds. It is predicted that tryptases are synthesized with prepropeptides, requiring signal peptidase processing and removal of a three amino acid propeptide for activation.

Mouse chymase I consists of a 226 amino acid catalytic portion and a 21 amino acid preprosequence. An Asn occurs in the substrate binding pocket, a feature that has not been observed in any other serine protease. iii ACKNOWLEDGMENTS

First of all, I wish to express my appreciation to the faculty and staff members of the Biochemistry Department for their support, assistance, and friendship.

I would like to thank my thesis committee mombors, Drs.

David Chi, Margaret Kougland, David Johnson, and Mitaholl

Robinson for their time and valuable advice.

My most sincere appreciation goes to my major advisor,

Dr. Phillip Musich, who provided mo with the ancouragomont and guidance throughout my graduate years.

I also would like to thank those graduate atudants who made my graduate years more memorable and those individuals who have cared and contributed to the completion of this study. Special thanks goes to Mrs. Raymondo Cox for hor final touch of this manuscript.

iv CONTENTS

Page

APPROVAL ...... ii

ABSTRACT ...... * ...... iii

ACKNOWLEDGEMENTS ...... iv

LIST OF TABLES ...... ix

LIST OF FIGURES ...... X

ABBREVIATIONS ...... xii

CHAPTER 1. INTRODUCTION ...... 1 Mast Cell Heterogeneity, Differentiation and Origin ...... 5

Micro-environmental Regulation of Mast Cell Development and Phenotype ...... 10

Mast Cell Granule-Associated Serine Proteases: Tryptase and Chymase ...... 12 2. MATERIALS AND METHODS ...... 23 Materials ...... 23

M e t h o d s ...... 25

Growth of ABFTL-6 Mast Cells and 3T3 Cells ...... 25

Preparation of f c m . , ...... 25 Growth of Mast Cells 3T3 FCM Supplemented Media ...... 26 Sodium Butyrate Treatment of Mast Cells . . . 26

Histochemical Staining ...... 26

Preparation of Mast Cell Extracts ...... 27 Determination of Protein Concentration . . . 27

v Chapter Page

Measurement of Enzymatic Activity ...... 28 Inhibition of Tryptic Activity Assay .... 28

SDS-Polyacrylamide Gel Electrophoresis . . . 29 t3H] DFP Labeling of Serine Froteases and Fluorography ...... 30

Immuno-dot and Western Blotting ...... 30 Poly (A)+—RNA I s o l a t i o n ...... 31

cDNA Synthesis and Library Construction . . . 34

cDNA Library Screening ...... 36 Alcohol Precipitation of DNA ...... 37

DNA Isolation ...... 38

Lambda DNA isolation ...... 38

Plasmid DNA minipred ...... 39

Agarose Gel Electrophoresis DNA ...... 40

DNA Restriction Enzyme Digestion ...... 41

Electroelution of DNA Fragments ...... 41 Ligations ...... 42

Bacterial Transformation ...... 42 DNA Sequencing ...... 43

Denaturation of double-stranded DNA .... 43

DNA dideoxynucleotide sequencing reactions ...... 44

DNA sequencing gel electrophoresis .... 44 * Hybridization of Filter-Bonded DNA ...... 45

Radioisotopic labeling of DNA probes . . . 45

Slot-blotting of nucleic acids ...... 4 6

vi Chapter Page Southern and northern blotting ...... 47 Stripping probe from filters ...... 48

Autoradiography ...... 48

3. RESULTS ...... 50

Morphological Changes of Mouse Mast Cells Induced with FCM and Sodium Butyrate ...... 50 Effects of FCM and Sodium Butyrate Culture on Mast Cell Tryptase Activity and Antigen Levels ...... 50

Both FCM and Sodium Butyrate Increased Total DFP-Binding Proteins ...... 61

Molecular Cloning of Mouse Mast Cell' Tryptases ...... 63

Molecular Cloning of Mouse Mast Cell Chymase ...... 73 Northern and Southern Blot Analysis ..... 82

4. DISCUSSION ...... 87 Growth of ABFTL-6 Mouse Mast Cells in FCM . . 87

Sodium Butyrate Induction of Tryptase Expression in ABFTL-6 Mouse Mast Cells . . 90

Endogenous Tryptase Inhibitor in Mast Cells ...... 92

Tryptase Processing ...... 93

Deduced Tryptase Structures ...... 96

Tryptase Substrate Specificity Predictions . . 100 Charged Residues of Tryptase ...... 101

Characterization of the Predicted Protein Structures of Mouse Mast Cell Chymases . . 104

Genomic Structure of Mouse Protease Genes . . 112

vii Page

Distribution and Expression of Tryptase and Chymase in Mouse Mast Cells ...... 113

BIBLIOGRAPHY ...... 117

APPENDICES ...... 134 APPENDIX A. Buffers and Solutions ...... 135

APPENDIX B. Restriction Enzymes, Recognition Sequences and Reaction Buffers .... 139

VITA 141

viii LIST OF TABLES

Table Page 1. Phenotypic characteristics of mast cell populations in the rat ...... 7 2. The effect of FCM and sodium butyrate on tryptase expression in ABFTL-6 mouse mast cells ...... 57

ix LIST OF FIGURES

FIGURE Page 1. Schematic illustration of selected mast cell secretagogues ...... 3

2. Schematic diagram of rodent mast cell development and differentiation ...... 13 3. Outline of the procedure for cloning the cDNA for mouse mast cell tryptases and chymases ...... 32

4. Schematic diagram of cDNA synthesis ...... 35

5. Morphological changes of ABFTL-6 cells induced by 3T3 FCM and by sodium butyrate . 51 6. In vitro inhibition profile of mouse mast cell tryptase ...... 53

7. The effects of 3T3 FCM and sodium butyrate treatment on tryptic activity and total cellular protein of ABFTL-6 cells ...... 55

8. Immuno-dot blot quantification of total tryptase antigen in the induced and the uninduced ABFTL-6 mast cells ...... 56

9. Western blot analysis for tryptase antigen in induced and uninduced ABFTL-6 mast cells . 59

10. Western blot analysis of sodium butyrate- induced tryptase antigen in ABFTL-6 cell lysates ...... 60

11. Autoradiography of gel-fractionated [3H] DFF- labeled proteins in ABFTL-6 cell lysates . 62

12. Mouse mast cell RNA slot-blot hybridization analysis for tryptase-encoding sequences 64

13. Hybridization analysis of DNA from tryptase- positive clones by slot blotting ...... 66

14. Strategy used to subclone and sequence the cDNAs for the mouse mast cell tryptases . . 68

15. The composite cDNA's nucleotide and derived amino acid sequence of mouse tryptase I . . 69

x FIGURE Page

16. Mouse mast cell tryptase II cDNA's nucleotide and derived amino acid sequences .... 71

17. Mouse mast cell RNA slot-blot hybridization analysis for chymase-encoding s e q u e n c e s ...... 74 18. Strategy for subcloning and sequencing mouse chymase I c D N A s ...... 77

19. Strategy for subcloning and sequencing mouse chymase II cDNAs ...... 78

20. The composite cDNA's nucleotide and derived amino acid sequence of mouse mast cell chymase I ...... 79 21. The consensus nucleotide sequence of mouse mast cell chymase II cDNA and its derived amino acid sequence ...... 81 22. Northern blot hybridization analysis for tryptase and chymase expression ...... 83 23. Southern blot analysis of tryptase genes in mouse genomic DNA ...... 86

24. Alignment of leader sequences of the mouse tryptases and other related proteases 94

25. Comparisons of the amino acid sequences of mouse tryptase active enzymes with the amino acid sequences of related p r o t e a s e s ...... 97

26. Analysis of the distribution of charged residues that are conserved in t r y p t a s e s ...... 102

27. Hydrophobicity analysis of mouse mast cell chymase I ...... 105

28. Comparisons of the mouse chymase I leader sequence with those of other known chymases and granule-associated serine p r o t e a s e s ...... 106

29. Primary structure alignments between the active enzyme portions of the mouse chymases, other known chymases, and bovine chymotrypsin ...... Ill

xi ABBREVIATIONS a-l-PI a-i-protease inhibitor BCIP 5-bromo-4-chloro-3-indolyl phosphate

BME JJ-mercaptoethanol BHMC bone marrow-derived mast cell(s) bp base pair(s)

BSA bovine serum albumin cDNA complementary DNA CIA chloroform-isoamyl alcohol (24/1 : v/v)

CIAP calf intestine alkaline phosphatase CTMC connective tissue mast cell(s)

DEPC diethyl pyrocarbonate

DFP diisopropylfluorophosphate dH20 deionized water

DTT dithiothreitol coli Escherichia coli

EBr ethidium bromide

EDTA ethylenediaminetetraacetic acid

FBS fetal bovine serum

FCM fibroblast-conditioned medium

GTC guanidine isothiocyanate

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

Ig immunoglobulin

XL interleukin kb kilobase(s)

xii LB Luria-Bertani broth

LBTI lima bean trypsin inhibitor

MES 11-(N-morphoinol) ethane sulfonic acid

MMC mucosal mast cell MMCP mouse mast cell protease

mRNA messenger RNA

NbSj 5,5'—dithiobis(2—nitrobenzonic acid) NBT nitro blue tetrazolium OD optical density

PBS phosphate-buffered saline

PEG polyethylene glycol 8000

pfu plaque-forming unit PMSP phenylmethanesulfonyl fluoride RMCP rat mast cell protease

RNase ribonuclease SDS sodium dodecyl sulfate

SDS-PAGE SDS-polyacrylamide gel electrophoresis

SOG sucrose/orange G (3/1 : v/v)

SSC standard saline citrate

SSPE sodium chloride sodium phosphate EDTA

TAE Tris-acetate-EDTA

TBE Tris-boric acid-EDTA TBS Tris-buffered saline

TCA trichloroacetic acid

TEMEDN ,N ,N 1,N 1-tetramethylethylenediamine

TLCK tosyl-L-Lys-chloromethyl ketone

xiii TPCK tosyl-L-Phe-chloromethyl ketone

Tris Tris-(hydroxymethyl)aminomethane

Z-Lys-SBzl CBZ-Lys-thiobenzyl ester

xiv CHAPTER 1

Introduction

Mast cells are wildly distributed throughout the mammalian body, predominantly at the host-environment

interfaces such as the skin, respiratory tract and gastrointestinal systems. Mast cells appe&r primarily in the mucosa and loose connective tissues. Here they are situated most often in the vicinity of blood and lymphatic vessels, near or within peripheral nerves, and beneath epithelial surfaces that are exposed to environmental antigens (Selye, 1965; Metcalfe et al., 1981; Bienenstock et al., 1989). Mast cells are best known for their roles in the IgE-dependent immediate hypersensitivity reactions and the defense against parasitic infection. However, recent studies have revealed a considerably greater complexity of mast cell biological function than previously had been believed to exist (Galli, 1990). Although the precise roles of mast cells in health and disease are not fully understood, they are believed to have important functions in a variety of biological processes. These processes include delayed hypersensitivity (Askenase and van Loveren, 1983), cytotoxicity (Farram and Nelson, 1980; Henderson et al., 1981; Ghiara et al., 1985; Capron et al., 1978), immuno- regulation (Beer and Rocklin, 1984), fibrosis (Broide et al., 1990), and inflammation (Kaliner and Lemanske, 1984).

1 Local or systemic increases in mast cell numbers have been identified in tissues in a variety of clinical situations including inflammation, parasitic infestations (Befus and Bienenstock, 1979), rheumatoid arthritis (Athreya et al., 1979), lymphoproliferative syndromes (Yoo et al., 1978), inflammatory bowel disease {Kirsner and Shorter, 1982), and atopic dermatitis (Mimh et al., 1976).

Mast cells are immunoglobulin (Ig) E receptor-bearing cells. The cross-linkage of these high affinity receptors, which results in mast cell degranulation, is central to the induction of allergic inflammatory responses. However, mast cells can be induced to release their cytoplasmic granules by a wide variety of stimuli (Lagunoff and Chi, 1980). Some of these mast cell secretagogues are schematically summarized in Figure 1. Sensitivity to many of these secretagogues varies greatly depending on the mast cell type. Also, the extent and nature of mast cell granule components released may vary according to the type and concentration of stimulus, reflecting differences in mast cell activation mechanisms and the potential roles of these cells in biological processes not involving Ig E. Thus, the common assumption that mast cell activation is an "allergic" or IgE-dependent event is far too restrictive. Upon activation, mast cells secrete a variety of preformed, biologically-active mediators stored in cytoplasmic granules. These mediators include histamine, 3

Chemicals Neuropeptides Allergen Antibody compound 48/80 somatostatin calcium lonophoro nourotansln A23187 neurokinin K substance P Anaphylatoxins 4 7226 C3a, C4a, COa Drugs muscle rclaxants Histamine Releasing opioids Factors Mast Cell Physical Stimuli nautrophil eosinophil heat lymphocyte I cold macrophago pressure Degranulation

Figure 1. Schematic illustration of selected mast cell

secretagogues. This figure was adopted with modifications

from Friedman and Kaliner (1987). proteoglycans, serine proteases, and many chemotactic factors. In addition, stimulated cells can synthesize and release metabolites of arachidonic acid, such as prostaglandins and leukotrienes. Activated mast cells also increase messenger RNA (mRNA) synthesis and secretion for a group of lymphokines including interleukin-3 (IL-3) (a mast cell growth factor), IL-4 (an IgE-switch factor), IL-5 (an eosinophil differentiation factor) and IL-6 (a factor controlling immunoglobulin secretion) (Plaut et al., 1989).

These peptide factors may account for much of the inflammatory reaction and the late phase allergic reaction.

They may also participate in the regulation of the mast cell's own proliferation and phenotype, especially during immunological and pathological processes. Furthermore, several laboratories have provided evidence for the presence of tumor necrosis factor a-like activities in mast cells.

For example, mast cell cytotoxity and the ability to induce endothelial cell production of endothelial-leukocyte adhesion molecule 1 have been attributed to tumor necrosis factor a located in mast cell granules (Jadus et al., 1986;

Okuno et al., 1986; Klein et al., 1989). These findings may aid in explaining the roles of mast cells in a wide range of tissue responses since tumor necrosis factor a has a number of biological effects. These include stimulation of collagenase and prostaglandin E2 production, stimulation of osteoclasts and bone resorption, and enhancement of eosinophil toxicity (Vilcek et al., 1986; Capron et al.,

1978).

The discovery of mast cells is attributed to Paul Ehrlich (1878) who first identified mast cells in human

connective tissues on the bases of the metachromatic staining properties of their prominent cytoplasmic granules. Because of the large granules, the cells were originally

thought to be phagocytic and given the name "mast" which in

German means "to eat". In the century since their

discovery, considerable effort has been devoted to

understanding the biology and function of mast cells.

Recently, breakthroughs have made possible new and more definitive approaches for analyzing the development and

regulation of mast cell phenotypes and for studying mast cell functions. One important achievement was the

establishment of the mast cell- and hemopoietic stem cell-

deficient mutant mouse strain WBBGFj-W/W7 (Kitamura et al.,

1978; Kitamura and Go, 1979; Geissler and Russell, 1983). A

second major development was the generation of rodent mast

cells in vitro from hematopoietic tissues (Ginsburg, 1963;

Ginsburg and Lagunoff, 1967). These advancements have helped clarify many long-standing issues in mast cell biology.

Hast Cell Heterogeneity. Differentiation and Origin

The regulation of mast-cell heterogeneity has attracted wide-spread interest. It is believed that mast cells of different phenotypes may have different roles in health and

disease. The initial observations that mast cells at different histological locations exhibit distinctive morphologies were made nearly 100 years ago. Maximow (1905)

first noticed that certain mast cells in the rat intestinal mucosa were atypical in their histochemical staining characteristics, differing from mast cells located in other tissues. Beginning in the 1960s, EnerbSck (1966a, 1966b,

1966c, 1981) greatly extended these observations by describing the distinctive properties of mast cells in

connective tissue and in the mucosa of the gastrointestinal tract. These results were confirmed by numerous

investigators (Bienenstock et al., 1982; Shanahan et al.,

1984; Barrett and Metcalfe, 1984). There are two clearly distinguishable populations of mast cells characterized in rodents based principally on their location and their different morphological, immunological, biochemical, and

functional properties (reviewed by Galli, 1990). The terms

"mucosal mast cell" and "connective tissue-type mast cells"

(i.e., MMC and CTMC, respectively) are now the most widely accepted designations for rodent mast cell subclasses. The heterogeneity of mast cells is best defined in the rat. The major phenotypic differences between these two rodent mast cell subclasses are listed in Table 1, In comparison with the CTMC, the MMC are smaller, have fewer cytoplasmic granules, possess a different serine protease composition, 7 Table 1. Phenotypic characteristics of mast cell populations in the rat*

Characteristics MMC CTMC

4 Location mucosa skin, submucosa connective tissue

Size 9.7 ± 2.2 pm 19.6 ± 2.7 pm

Granules Few and small Many and large

Proteoglycan Lower sulfation, Higher sulfation, chondroitin heparin sulfate £

Serine protease RMCP II RMCP I Histamine < 1 pg/cell > 15 pg/cell

Life span £ 4 0 days > 4 0 days Histamine release + by compound 48/80

IL-3 dependency of + proliferation

Metachomasia with + formalin fixation Staining with + safranin

Staining with + berberine sulfate

‘Adopted with modification from Bienenstock et al.,

(1982). \ depend on IL-3 for proliferation, and are found most prominently in the gastrointestinal tract. In addition, MMC contain chondroitin sulfate E glycosaminoglycans rather than heparin and have a lower histamine content. MMC are nonresponsive to agents such as compound 48/80 and polymyxin which degranulate CTMC. Also, MMC differ histochemically from CTMC in that MMC can be detected in tissue sections only if acidified formaldehyde fixative or Carnoy's fixative is used. Both MMC and CTMC stain positive with alcian blue, but only CTMC could be stained with safranin (EnerbSck,

1986). Berberine sulfate, a fluorescent dye with an affinity to heparin, has been used to distinguish CTMC from

MMC (Enerback, 1974).

Mammalian mast cells are known to be derived from hematopoietic precursors which originated in the bone marrow. This was conclusively established in the mouse by

Kitamura et al. (1978). They demonstrated that mast cell deficient WBB6Ft-W/Wv mice can develop both CTMC and MMC populations if they receive bone marrow cells from normal donor mice. In vitro studies also have confirmed their hematopoietic origin. Hasthorpe (1980) and others (Nagao et al., 1981; Razin et al., 1981; Schrader, 1981; Tertian et al., 1981) discovered that apparently pure mast cell populations could be generated by culturing cells from normal rodent hematopoietic tissues such as bone marrow, spleen, lymph node, or fetal liver in media containing IL-3. Nakano et al. (1985) have shown that in vitro-cultured,

IL-3-dependent mouse bone marrow-derived mast cells (BMMC) can give rise to both CTMC and MMC because both populations are reconstituted in W/Wv mice by the transplantation of IL- 3-dependant BMMC. This observation suggests that both MMC and CTMC populations are derived from a common precursor cell.

Human mast cells also exhibit variation in multiple aspects of their phenotype, including the content of granule-associated serine proteases, cytoplasmic granule ultrastructure, histochemical properties, quantity of stored histamine, and sensitivity to stimulation by various secretogogues and drugs. Like rat mast cells, human mast cell subclasses also differ in serine protease content, which distinguish human mast cell subclasses. Some human mast cells contain both tryptase and chymase (designated as

TC mast cells), whereas other human mast cells contain tryptase but no detectable chymase (designated as T mast cells) (Irani et al., 1986). TC and T mast cells appear analogous in some respects, but not all, to rodent CTMC and

MMC, respectively. Unlike rodent mast cells, human mast cells can not be classified based on tissue location alone.

T mast cells predominate in the lung and small intestinal mucosa; TC mast cells predominate in skin and small intestinal submucosa. However, these anatomical sites 10 contain representatives of both mast cell subtypes

(Schwartz, 1989).

Micro-environmental Regulation of Mast Cell

Development and Phenotype

It is well established that rodent mast cells could be generated in vitro by culturing cells from hemopoietic tissues in the presence of IL-3 (Nakahata et al., 1986).

These in vitro-derived. IL-3-dependent mast cells have been cloned, and many cell lines have been established. Thus, these cells can be obtained in large quantities, providing a good source of mast cells for a variety of biochemical and functional studies. This approach usually results in the generation of basophils in humans rather than mast cells; however, a recent report indicates that it is possible to generate mast cell-like cells from human bone marrow under certain culture conditions (Kirshenbaum et al., 1989).

Reasons for such difference among species are not clear.

These in vitro-differentiated, IL-3-dependent mast cells are considered as the in vitro counterpart of the in vivo-differentiated MMC, as assessed by ultrastructure, histochemical staining, and IL-3 dependency for proliferation. Similar to MMC, mast cells derived from hemopoietic tissues contain fewer granules which stain alcian blue+/safrain‘, synthesis lower levels of histamine, and chondroitin sulfate E proteoglycans rather than heparin (sredni et al., 1983; Razin et al., 1982). Moreover, rat 11

BMMC carry rat mast cell protease II {RMCP II) which is specifically expressed in rat MMC (Haig et al., 1982, 19B6).

As discussed in the previous section, IL-3 dependent BMMC populations whose phenotype resembles that of MMC give rise to both CTMC and MMC populations in different anatomical sites of W/Wv recipients. This result suggests that different mast cell subclasses are derived from cells of a single lineage, and also that BMMC can undergo the phenotypic change from MMC-like to CTMC; this was later confirmed by biochemical characterization (Otsu et al., 1987). Similar findings were obtained with peritoneal mast cells, a classical example of CTMC, which could give rise to mast cells phenotypically similar to either the CTMC or MMC

(a CTMC MMC-like change) (Nakano et al., 1987). Thus, it appears that the tissue micro-environment determines the phenotypic characteristics of mast cells.

In vitro it was demonstrated that by co-culturing with a 3T3 fibroblast monolayer, BMMC could be induced to differentiate and undergo phenotypic changes to resemble

CTMC. The co-cultured mast cells increase their content of cellular granules, which stain with safranin, raise their histamine content 50-fold and carboxypeptidase A 100-fold, and initiate the synthesis of heparin proteoglycans (Levi- Shaffer et al., 1986; Dayton et al., 1988). Also, sodium butyrate increases BMMC cytoplasmic granule-associated serine protease levels 4-fold and histamine content 10-fold 12 (DuBuske et al., 1984). The sodium butyrate-treated mast cells, however, remained alcian blue+/safranin', and did not synthesize detectable quantities of heparin (Galli et al.,

1982). Sodium butyrate is a pharmacologic agent that causes hypermethylation and acetylation of cellular histones and differential expression of mRNA (Riggs et al., 1977). Dexamethasone has been found to have a similar effect on

BMMC (Pitton et al., 1988).

Xn vivo and in vitro studies have confirmed that mast cells can change phenotype from "MMC CTMC-like" and "CTMC

-+ MMC-like". Recent evidence using cloned mast cell populations indicate that at least some of these changes are reversible (i.e. "MMC -* CTMC-like -* MMC» or "CTMC -♦ MMC-like CTMC") upon changes of the micro-environment (Kanakura et al., 1988). It seems likely that T-lymphocyte factors (i.e.

IL-3) are needed to induce progenitor cells to differentiate and proliferate along the mast cell lineage. However, the subsequent micro-environment which the mast cells settle into determines their final phenotypic properties. This scheme is illustrated in Figure 2.

Mast Cell Granule-Associated Serine Proteases: Trvotase and Chvmase

One characteristic feature of mast cells is the presence of high levels of proteolytic enzymes in the secretion granules. These granules are known to contain proteases with both trypsin-like and chymotrypsin-like 13

Primary Differentiation MMC Stimulus I .ymphocyte

Bone Marrow Circulating Stem Cell Mast Cell ibroblast Precursor

CTMC

Figure 2. Schematic diagram of rodent mast cell development and differentiation, circulating mast cells are derived from precursor cells originating from bone marrow. Further differentiation of precursor cells into mature mast cells is under the influence of the microenviroment where the precursor cells settle. The mature mast cells (CTMC and MMC) are not end-staged cells and are able to undergo further phenotypic changes if the tissue microenviroment or culture conditions change. specificities, referred to as tryptase and chymase, respectively. Both enzymes are exclusively expressed in mast cells. Tryptase and chymase are stored in fully active form in association with acidic proteoglycans, mainly heparin, within the cytoplasmic granules. They are secreted with other preformed mediators upon the coupled activation- degranulation response of mast cells (Schwartz et al.,

1981b; Caughey et al., 1988b). This secretion process differs from that for trypsin and chymotrypsin, which are stored in pancreatic acinar cell granules as inactive trypsinogen and chymotrypsinogen zymogens, respectively, and are proteolytically activated after their release.

The serine proteases comprise a large group of enzymes which are characterized by possessing a catalytic charge relay system, including a reactive serine residue in the active site. They are also known as neutral protease since they are most active in the physiological pH range. The distinguishing feature of these enzymes is their susceptibility to inhibition by interaction of the active site serine with diisopropylfluorophosphate (DFP). This group of enzymes (represented by trypsin, chymotrypsin, and elastase) are classified as endopeptidases and cleave peptide bonds on the carboxyl side of preferred amino acid residues which define the enzyme’s substrate specificity.

Benditt and Arase (1959) first detected a protease with a chymotryptic activity, now called RMCP I, in CTMC isolated from the peritoneal cavity of rats. Later, a second chymotryptic protease designated as RMCP IX was localized exclusively in rat MMC (Woodbury et al., 1978). RMCP I and RMCP II have substantial amino acid sequence homology with one another (Benfey et al., 1987; Woodbury et al., 1978) but are distinct gene products that can be distinguished from one another with polyclonal antibodies. A complementary DNA (cDNA) that encodes RMCP II and its corresponding genomic clone have been isolated (Benfey et al., 1987). This work also provided evidence that RMCP II is synthesized as a precursor molecule, with an amino terminus signal peptide and additional residues at the carboxyl terminus. Mast cell chymases from several other species, including mouse (Le Trong et al., 1989), dog (Caughey et al., 1988b; Schechter et al., 1988), sheep (Huntley et al.,

1986), and human (Schechter et al., 1983, 1986; Wintroub et al., 1986; Sayama et al., 1987), have been isolated and partially characterized.

Glenner and Cohen (i960) first discovered high levels of intracellular tryptic activity in mast cells by enzyme histochemical staining. Since then, similar enzymes have been isolated and characterized from human (Schwartz et al,, 1981a; Smith et al., 1984; Cromlish et al., 1987; Harvima et al., 1988; Butterfield et al., 1990), dog (Caughey et al., 1987; schechter et al., 1988) and rat (Kido et al., 1985) mast cells or mast cell-rich tissues. While chymase is the major granule-associated serine protease of rat mast cells,

tryptase seems to be the predominant protein component of

human mast cells. Tryptase is estimated to comprise as much

as 23% of mast cell total protein (Schwartz et al., 1981b). Tryptase polypeptides appear heterogenous on SDS-

polyacrylamide gel electrophoresis (SDS-PAGE) with two major bands of Hr = 30,900 and 31,600 (smith et al., 1984). The active enzymes appear to exist as tetramers of subunits with

a Mr = 135,000 (Schwartz et al., 1981a; Cromlish et al.,

1987; Caughey et al., 1987; Harvima et al., 1988; Kido et al., 1988). The observed electrophoretic heterogeneity

seems to be due in part to differences in glycosylation (Cromlish et al., 1987), but differences in primary

structure can not be ruled out. The recent report of multiple tryptase cDNAs in human mast cells supports the

latter hypothesis. Functional heterogeneity has been

observed regarding the specificities of human lung and skin tryptases toward synthetic substrates (Tanaka et al., 1983).

Tryptase is stabilized and possibly regulated by the binding of heparin which also resides in secretory granules. The affinity of human mast cell tryptase for heparin has been used as a purification step (Schwartz et al., 1981a) and differences in this property were used to partially separate the two predominant forms of human lung tryptase (Smith et al., 1984). Tryptase has a trypsin-like substrate specificity, and

therefore hydrolyses peptide bonds on the carboxyl terminal side of the basic residues Arg and Lys. But unlike trypsin,

tryptase has a marked subsite preference and a correspondingly high degree of substrate selectivity (Tanaka

et al., 1983). These enzymes seem to make only selective

cleavages in protein substrates and have little if any

activity against denatured protein substrates such as

casein. Another characteristic feature of human and dog tryptases is resistance to inhibition by plasma serine protease inhibitors, such as a-l-proteinase inhibitor (a-1-

Pl) (Smith et al., 1984; Caughey et al., 1987; Alter et al., 1990). This feature may not be shared by rat mast cell tryptase (Kido et al., 1985). In rat, tryptase is associated with and, therefore, may be regulated by an endogenous tryptase inhibitor, which has been called trypstatin (Kido et al., 1985, 1988).

The presence of high levels of tryptase and chymase in mast cells suggests that this enzyme must be an important component of mast cell function. The biological roles of tryptase remain to be defined. In vitro, human tryptase cleaves C3 to generate biologically active C3a (Schwartz et al., 1983), destroys high molecular weight kininogen (Maier et al., 1983), and inactivates fibrinogen as a coagulable substrate for thrombin (Schwartz et al., 1985). Increased numbers of mast cells have been found in arthritic joints (Malone et al., 1986), and, because trypsin is known to activate collagenase, it was suspected that tryptase might

also. Although tryptase failed to activate very pure

preparations of procollagenase (Johnson and Cawston, 1985),

Gruber et al. (1988) reported findings to the contrary, subsequently, it was found that tryptase activates

prostromalysin but not procollagenase and the stromalysin,

which is often a contaminant of procollagenase preparations

actually activates procollagenase to collagenase. More

recent studies indicate that tryptase rapidly hydrolyzes

vasoactive intestinal peptide (Caughey et al., 1988a; Franconi et al., 1989), a neuropeptide that relaxes airway

smooth muscle (Said, 1984), and calcitonin gene-related peptide, which is a potent vasodilator and bronchoconstrictor. The latter findings may suggest a possible role for tryptase in modulating the biological

effects of neuropeptides.

In vitro, chymase converts angiotensin I to angiotensin

XI (Wintroub et al., 1984) and cleaves and inactivates both substance P and vasoactive intestinal peptide (Caughey et al., 1988a). Chymase is able to degrade type IV collagen and basement membrane components at the dermal-epidermal junction and facilitate separation of these cutaneous regions (Briggaman et al., 1984; Sage et al., 1979). In addition, chymase inhibitors and antibodies against chymase prevent histamine release from stimulated mast cells, 19 suggesting that chymase may be involved in certain processes triggering mast cell degranulation (Kido et al., 1988;

Dietze et al., 1990). The first primary structure data of tryptase resulted from the cloning and sequencing of a cDNA from a dog mastocytoma cell line (Vanderslice et al., 1989). This work also resulted in the cloning of a related enzyme's cDNA, termed dog mast cell protease, which is 53.4% homologous with dog tryptase. Both enzymes appear to share a novel activation mode, requiring cleavage at a Gly residue prior to the Ile-Val-Gly-Gly amino terminus normal for active serine proteases. Subsequently, a human tryptase cDNA, which had 84% amino acid sequence identity with dog tryptase, was isolated from lung mast cells (Miller et al.,

1989). More recently, three different but highly related tryptase cDNAs from human skin and a gene coding for one of the skin tryptase cDNAs have been isolated and characterized

(Vanderslice et al., 1990).

Rat mast cell proteases I and IX are used as selective markers for distinguishing rat CTMC and MMC populations, respectively. While most mast cell granule-associated mediators can be produced by other cell types, the serine proteases may represent constituents restricted to the mast cells. Thus, they may provide important insights into the unique functions of these cells. Also, elevated levels of tryptase or chymase in serum or other biological fluids may 20

serve as clinically useful indicators of mast cell

activation and degranulation.

Although little is known concerning mouse tryptase, there have been several reports dealing with chymases in mouse mast cells. It has been shown that serine proteases

comprise the major protein components of mouse BMMC

secretory granules and four granule-associated, [3H] DFP-

binding proteins, ranging in molecular weight from 27 to 31 KDa, were identified (Dubuske et al., 1984). These proteins

were secreted along with other granule-associated mediators during mast cell activation (Serafin et al., 1986). The first mouse mast cell protease isolated, a chymase

designated as mouse mast cell protease I (MMCP-l), was from the small intestine of mice infected with Trichinella

spiralis. Its amino acid sequence has been determined (Newlands et al., 1987; Le Trong et al., 1989). In

addition, a second chymase, designated as mouse mast cell

protease II (MMCP-2), has been identified, and its cDNA has

been cloned and characterized from Kirsten sarcoma virus-

immortalized mouse mast cells (Serafin et al., 1990). MMCP-

2 has 65% amino acid sequence identity to MMCP-l. Similar to RMCP II, cDNA sequence data predict that MMCP-2 is synthesized as a preproenzyme which contains a 19-amino acid hydrophobic signal peptide and a two-amino acid propeptide.

More recently, four additional distinct serine proteases have been identified in mouse serosal mast cells, and their 21 amino-terminal amino acid sequences have been reported

(Reynolds et al., 1990). These data indicate that different mouse mast cell subclasses can express various combinations of at least six distinct serine proteases. Preliminary data from enzymatic activity assays and immuno-dot blot experiments indicated that mouse tongue and lung tissues and the in vitro-derived ABFTL-6 mouse mast cells contained tryptase-like enzyme (Pierce et al., 1985).

Positive immunological cross-reactions were observed with antibodies to human mast cell tryptase, and both mouse tissues and ABFTL-6 cell lysates were found to contain tryptase activity (Chu and Smith, unpublished observations). To gain insight into mast cell functions in health and disease, it is important to understand the regulation of mast cell development and differentiation. It is also necessary to clarify and understand the nature of the granule-associated proteases. In this study, a tryptase activity in the ABFTL-6 mouse mast cell line has been identified. The effects of fibroblast-conditioned media

(FCM) and sodium butyrate on cell differentiation and tryptase expression in the ABFTL-6 mast cells were examined.

In addition, cDNAs for two distinct tryptases and two chymases from ABFTL-6 cells have been successfully cloned, characterized, and sequenced. This work should provide reagents for studying the expression and regulation of these enzyme classes. Also, It is now possible to explore the relationship(s) between the primary structures and the unique properties of these important proteases in mouse mast cells. CHAPTER 2

Materials and Methods

MsltqKJLaJls RFMX 1640; penicillin/streptomycin; sodium butyrate; 5- bromo-4-chloro-3-indolyl phosphate (BCIP); CBZ-Lys- thiobenzyl ester (Z-Lys-SBzl); tosyl-L-Lys-chloromethyl ketone (TLCK); tosyl-L-Phe-chloromethyl ketone (TPCK); lima bean trypsin inhibitor (LBTI); benzamidine; antipain; phenyl-methanesulfonyl fluoride (PMSF); 5,5'-dithiobis(2- nitrobenzonic acid) (Nbs2) ; Tween-20; sodium dodecylsulfate

(SDS); Coomassie Brilliant Blue G-250; dithiothreitol (DTT);

N,N,N'/H ,-tetramethylethylenediamine (TEMED); Tris-

(hydroxymethyl) aminomethane (Tris); IJ-(N-morphoinol) ethane sulfonic acid (MES); B-mercaptoethanol (BME); ribonuclease (RNase) A; protease K; formamide; and ethidium bromide (EBr) were purchased from Sigma Chemical Company.

Ethylenediaminetetraacetic acid (EDTA), ammonium sulfate, urea, nitro BT, acrylamide, polyethylene glycol 8000 (PEG), guanidine isothiocyanate (GTC), bovine serum albumin (BSA), nitro blue tetrazolium (NBT), 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), toluidine blue, and safranin were purchased from Fisher Scientific.

Diisopropylfluorophosphate was a product of Aldrich Chemical

Company. Bactoagar, bactotryptone, and yeast extract were purchased from Difco Laboratories. Fetal bovine serum (FBS)

23 was obtained from GIBCO Laboratories. [3H] diisopropyl-

fluorophosphate, deoxycytidine [a-3ZP] 5'-triphosphate, and

deoxyadenosine [a-3SS] 5'-triphosphate were purchased from New England Nuclear. Adenosine [y-32P] triphosphate was obtained from 1CN Chemicals. M13 reverse sequencing primer

(17-mer) and the cDNA synthesis kit were purchased from

Pharmacia. Seguenase DNA sequencing kit was from United States Biochemical Corporation. Polynucleotide kinase from

T4, T4 DNA ligase, calf intestinal alkaline phosphatase

(CIAP), reverse transcriptase, and reagents for primer

extension were obtained from Promega. The nick translation

reagent kit was purchased from Bethesda Research Laboratories. A random primer DNA labeling kit was purchased from Boehringer Mannheim. Lambda in vitro packaging extract and predigested lambda gtio DNA/EcoRl

cloning kit were purchased from Stratagene. Alkaline

phosphatase-conjugated goat anti-rabbit IgG was from Bio-

Rad. Nitrocellulose membrane (sheet and disc, 0.22 micron) was purchased from Schleicher and Schuell. Agarose was purchased from the Marine Colloids Division of the FMC

Corporation. The prestained standards were products of

Diversified Biotech.

A mouse mast cell line, ABFTL-6, was a generous gift of

Dr. Jacalyn Pierce (National Institutes of Health, Bethesda,

MD). A contact inhibited, Swiss-albino mouse embryo-derived

3T3 fibroblast cell line was obtained from American Type 25

Culture Collection (ATCC # CCL 92). A dog mast cell tryptase cDNA clone and a rat mast cell protease XI cDNA clone were kindly provided by Dr. Peter Vanderslice (Univ. of Calif. San Francisco) and Dr. Philip Leder (Harvard Medical School), respectively. Mouse tryptase II oligonucleotide was kindly synthesized by Dr. Kent Lohman

(Southwest Foundation for Biomedical Research, San Antonio,

TX). Mouse tissue poly(A)+ RNAs, human tryptase, tryptase antibody, and a-l-PI were provided by Dr. David Johnson. Mouse genomic DNA and chicken a-tubulin cDNA were supplied by Dr. Phillip Musich.

The composition of solutions and buffers used in this study and their abbreviations are listed in Appendix I.

Methods

Growth of ABFTL-6 Mast Cells and 3T3 Cells

Both ABFTL-6 mouse mast cells and the 3T3 fibroblasts were cultured in RPMI 1640 media supplemented with 10% heated-inactivated FBS, 100 unit/ml penicillin and 100 jug/ml streptomycin. All cell cultures were maintained at 37°C in a humidified atmosphere of 5% C02.

Preparation of FCM

After the 3T3 cells formed a confluent monolayer, the culture supernatant was collected by centrifugation at 1,000 x g for ten minutes. The cell-free supernatant was 26

carefully aspirated off and used immediately as FCM in

ABFTL-6 cell induction experiments. Then, fresh culture media was added to the 3T3 cell culture flask to cover the

cell monolayer (i.e. 50 ml for a T-150 flask). FCM was prepared every other day for each culture.

Growth of Mast Cells in 3T3 FCM Supplemented Media

ABFTL-6 cells were grown to a density of 0.5-0.6 x 10fi cells/ml. Then, the normal culture media was replaced with 1:1 mixture of fresh RPMI 1640 media and 3T3 FCM. This .culture was maintained for up to 12 days with media being changed every other day. Cells stopped dividing in the presence of 3T3 FCM.

Sodium Butvrate Treatment of Mast Cells

ABFTL-6 cells at 0.3-0.4 x 104 cells/ml, were treated with sodium butyrate by diluting a 100 mM sodium butyrate stock solution to a final concentration of 1 mM in fresh culture media. This culture was maintained for 4 days with daily replacement of the butyrate-supplemented medium.

Histochemical Staining

For metachromatic staining, ABFTL-6 cells were collected by centrifugation at 100 x g and washed with PBS buffer once in a 1.5 ml microfuge tube. The cells were suspended in 300 pi of Zamboni fixative solution (Stefanini et al., 1967) for 1-3 minutes, pelleted by centrifugation and stained in 300 pi of 0.5% (w/v) tpluidine blue in 0.5 N 27

HC1 for 30-60 minutes. The stained cells were washed twice with deionized water (dH20), smeared, and air dried on microscope slides for microscopic examination. Alcian blue staining with a safranin counterstain was performed as described (Ishizaka et al., 1976). The mast cells1 pellets were smeared, air dried on microscope slides, and stained for 5 minutes in 0.5% alcian blue in 0.3% acetic acid. After rinsing with dH2o, the cells were counter­ stained with 0.1% safranin in 1% acetic acid for 5 minutes.

Preparation of Hast Cell Extracts cultured cells were harvested by centrifugation at 100 x g for 5 minutes. The cells were washed with phosphate- buffered saline (PBS) and resuspended in an appropriate volume (usually at 20 x 10s cells/ml) of 10 mM MES buffer, pH 6.1, containing 2 M NaCl. The cell suspension was frozen immediately in a dry ice-ethanol bath, and the cells were lysed by repeated thawing and freezing four times, resulting in complete lysis as judged by trypan blue exclusion. The extract was clarified by centrifugation in a microfuge at

12,000 x g for 10 minutes to remove insoluble cell debris.

Determination of Protein Concentration

The protein concentration of the cell extract was determined by the method of Bradford (1976). Three ml of Bradford reagent was added to 0.1 ml TBS buffer containing

10-50 )Ltl of cell extract and mixed by vortexing. The 28 absorbance at 595 nm was measured in a 1 ml cuvette against a reagent blank prepared from 0.1 ml TBS buffer and 3 ml of Bradford reagent. Dilutions of a 1 mg/ml BSA solution, prepared based on a 280 nm extinction coefficient for 1% protein solution of 6.6, were used to construct a standard curve to determine the protein concentration in unknown samples.

Measurement of Enzymatic Activity Tryptic activity was determined by hydrolysis of the chromogenic substrate Z-Lys-SBzl. one unit of activity was defined as that amount of enzyme resulting in an absorbance at 410 nm increase of one absorbance unit per minute when the initial rate was linear. Reactions were carried out at room temperature in a 1 ml volume containing 10-50 (tl of cell extract, 0.1 mM Z-Lys-SBzl, 0.65 mM DTNB, 0.15 M NaCl,

0.05% Brij-35, and 0.1 M HEPES, pH 7.5. The rates of absorbance increase were measured with a Beckman Model 35 Spectrophotometer.

Inhibition of Tryptic Activity Assay

The effects of various serine protease inhibitors on the tryptic activity in the mast cell extracts were tested by preincubating 10 fil of extract with each of the inhibitors for 60 minutes at room temperature. For protease inhibitors TLCK (1 mg/ml), TPCK (1 mg/ml), benzamidine

(2 mM), and antipain (0.1 mg/ml), the preincubation volume was 400 III; FMSF (2 mM), a-l-PI (0.1 mg/ml), DFP (2.7 mM),

and LBTI (o.l mg/ml) were preincubated in a volume of 100

/zl. The concentration of inhibitors indicated in parentheses were the final concentration in the preincubation mixture. The tryptic activity remaining after a 60 minute preincubation period was measured by following the hydrolysis of Z-Lys-SBzl in a 1 ml reaction as described above. Residual activity was expressed as a percentage of similarly incubated controls containing the same amount of cell lysate, but no inhibitors. The control values were set at 100% activity.

SBS^PoJLv_acgy_lamid e_G_eI_Ele ct rophore si s

Protein samples were precipitated with 20% trichloroacetic acid (TCA) at 4°C for 30 minutes. The protein precipitate was collected by centrifugation for 15 minutes in a microfuge (12,000 x g) at 4°C, washed sequentially with cold 10% TCA and twice with 100% acetone, and air dried. The protein pellets were resuspended in

25-50 fil sample buffer and boiled for 3 minutes to denature proteins. Electrophoresis was performed using a Bio-Rad

Model 360 slab gel electrophoresis apparatus and the amidiol buffer system of Bury (1981). Proteins were separated on a 10% SDS-polyacrylamide gel (acrylamide/bis : 19/1).

Electrophoresis was carried out at a constant current of

15 mA in the stacking gel and 20 mA through the resolving gel until the bromphenol blue dye front ran off the bottom 30

of the gel. Following electrophoresis, gels were stained with Coomassie Brilliant Blue G-250 by the method of Steck et al. (1980) and destained with a solution containing methanol, water, and acetic acid at a ratio of 5:5:1.

r3Hl DFP Labeling of Serine Proteases and Fluoroqraphv Cell extracts equivalent to 0.7 x 106 cells were incubated with 45 (id [3H] DFP in a volume of 200 fil for

60 minutes at 22°C. The labeled proteins were then precipitated with 20% TCA at 4°C for 30 minutes and prepared for SDS-polyacrylamide gel electrophoresis (SDS-PAGE).

After electrophoresis, the gel was soaked in 1 M sodium salicylate for 30 minutes and dried on Whatman 3 MM paper under vacuum before autoradiographing at -70°C using Kodak

X-AR film. In another experiment, the lysates were incubated with an excess of TPCK, which is known to inhibit chymotrypsin, but not trypsin, for 60 minutes prior to incubation with

[3H] DFP. Thus, the binding of [3h ] DFP to chymotryptic proteases was presumably blocked, resulting in the preferential labeling of other serine proteases.

Immuno-dot and Western Blotting

Immuno-dot blots were accomplished as described by

Smith et al. (1989) using the Bio-Rad Bio-Dot 96 well filtration apparatus. Cell extracts were diluted, and an amount of extract equivalent to a fixed number of cells was 31 applied to a nitrocellulose membrane by gravity filtration. Each well was then washed with 200 pil TBS by vacuum

filtration. For Western blots, proteins separated by SDS-

PAGE were blotted onto a nitrocellulose membrane using a Milliblot-SDS system (Millipore) according to the manufacture's instruction.

The membranes were blocked with 3% BSA £w/v) in TBS for

4 hrs and incubated with a 500-fold dilution of a rabbit antisera to human mast cell tryptase in TBS containing

3% BSA and 0.05% Tween-20, usually for overnight. After

washing the membranes three times for 10 minutes each in TBS

containing 0.1% Tween-20, they were incubated for 6 hours with a 2000-fold dilution of the alkaline phosphatase-

conjugated goat anti-rabbit IgG secondary antibody. The membranes were developed in carbonate buffer (0.1 M NaHC03,

1.0 mM MgCl2, pH 9.8) containing o.is mg/ml BCIF and 0.3 mg/ml NBT with gentle shaking. After the appropriate

intensity of the color developed, the reaction was stopped by rinsing the filter with water.

F o l v m 4—HNA Isolation

This is the first step for cDNA cloning of mouse mast cell proteases. The procedure for molecular cloning are outlined in Figure 3. Total RNA was isolated using the GTC/Csd density gradient centrifugation method of Chirgwin et al. (1979). Frozen cell pellets of uninduced ABFTL-6 cells (1.7 x 10a cells) were suspended in 9 ml of 5.5 M GTC Mast Cell Culture I Poly (A)+ mRNA Isolation I cDNA Library Construction

1 cDNA Library Hybridization Screening for Tryptase

1 Recombinant DNA Isolation and Characterization I DNA Subcloning I DNA Sequencing

Figure 3. Outline of the procedure for cloning the cDNA for mouse mast cell tryptases and chymases. Cultured ABFTL- 6 mast cells were used as the source for poly(A)+ RNA. A cDNA library was constructed in AgtlO from the ABFTL-6 poly(A)+ RNA and screened for tryptases or chymase by plaque hybridization with dog tryptase or rat chymase cDNA as probes, respectively. The recombinant DNA of positive clones was isolated and characterized by restriction cleavage analysis. The inserts and their restricted subfragments were subcloned into pTZ19U plasmid for sequencing. buffer to lyse the cells, followed by passage though an 18 gauge needle (approximately 6 times) attached to,a 10 ml syringe until the viscosity decreased due to shearing of the DNA. The lysate was centrifuged at 5000 x g for 10 minutes at 4°C to remove cell debris, then one half of the supernatant was layered over 2 ml of 5.7 M CsCl in each of two 13 ml tubes. The RNA was pelleted by centrifugation in a Du Pont AH650 swinging bucket rotor for 24 hours at 35,000 rpm at 18°c. After centrifugation, the liquid in each tube was carefully removed by aspiration, followed by inversion and draining on a paper towel for 5 minutes. The RNA pellet was redissolved in 2 ml solution containing 0.5 mM EDTA,

0.5% sodium lauryl sarcosinate, and 5% BME and extracted sequentially with phenol/chloroform (1:1) and chloroform. The RNA was precipitated twice with ethanol and stored at

-80°C as a dried pellet.

The poly (A)* RNA was purified from total RNA by two cycles of chromatography on oligo(dT)-cellulose (Aviv and

Leder, 1972). After washing sequentially with a 0.1 N

NaOH/5 mM EDTA solution and water, the oligo(dT)-column was equilibrated with loading buffer (20 mM Tris-HCl pH 7.6, 0.5

M LiCl, 1 mM EDTA, 0.1 % sodium lauryl sarcosinate). The RNA sample was dissolved in RNase-free HzO, heated at 65°C for

5 minutes, and mixed with one volume of twice-concentrated loading buffer before application to the column. Then, the column was washed sequentially with loading buffer and low 34 salt buffer (same as loading buffer except containing 0.1 M

NaCl instead of 0.5 M LiCl) until the absorbance at 260 nm

of the eluent reached zero with each buffer. The poly(A)+

RNA was eluted with 10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.05% SDS. The low salt wash and the eluted poly(A)+ fractions

were combined and rechromatographed on the column. After elution, the poly(A)+ RNA containing fractions, based on the

absorbance at 280 nm, were ethanol precipitated.

cDNA Synthesis and Library Construction

Double-stranded cDNA was synthesized from the mouse

mast cell poly (A)+ RNA by the method of Gubler and Hoffman

(1983), and a cDNA library was constructed in AgtlO from the

cDNA as described by Hyunh et al. (1985). The cDNA library

was prepared using the Pharmacia cDNA Synthesis Kit and the Stratagene AgtlO Cloning Kit and Gigapack Packaging Extract; the manufacturers' instructions were followed. A schematic

diagram for cDNA synthesis is shown in Figure 4. Briefly,

poly (A)+ RNA (4 fig) was primed with oligo <3(T)12.ie which was

extended with reverse transcriptase to synthesize the first

strand. The RNA-cDNA duplex was partially hydrolyzed with

RNase H, and the resulting nicked RNA was used to prime second-strand synthesis employing E. coli DNA polymerase I.

The double-stranded cDNA mix was extracted with

phenol/chloroform, made blunt-ended by fill-in synthesis with Klenow fragment DNA polymerase, and then size-selected

using a Sephacryl S-3 00 spin column with a 260 bp void 35

3 ’ mRNA po!y(A)

Rovorso transcriptaso IdNTPs, Oligo(dT) mRNA: cDNA duplex DNA polymerase I RNaso H, dNTPs Klonow fragment Size soloction Double- stranded cDNA

T4 DNA ligaso, HcoRl/Notl adaptors Kinaso, ATP EcoRI-ended ___ I cDNA ' EH li I Ugato into EcoRI - cleaved Lambda gt10 vector

Figure 4. Schematic diagram of cDNA synthesis. cDNA was synthesized by the method of Gubler and Hoffman (1983), using a cDNA synthesis kit from Pharmacia. See text for details. exclusion limit. Following attachment of an EcoRI/Notl linker, the cDNA was phosphorylated with T4 polynucleotide kinase and extracted with phenol/chloroform. The free linkers were removed using another Sephacryl S-300 spin column. Then the cDNA was ligated to EcoRI pre-cleaved, undephosphorylated AgtlO DNA in a 5 |il reaction volume. One raicroliter of the ligation mix was packaged in vitro with intact A phage particles, resulting in a cDNA library containing 2 x 106 independent recombinants. The titer of the recombinant phage in the unamplified library was 4600 pfu//xl. cDNA Library Screening

The unamplified cDNA library was screened by hybridization of plaque lifts to a dog mast cell tryptase (Vanderslice et al., 1989) or a rat chymase cDNA (Benfey et al., 1987). All probes were labeled with a3ZP-dCTP by the random priming method (Feinberg and Vogelstein, 1984). The recombinant phage were propagated in Escherichia coli (E. coli) C600 Hfl for first round screening to eliminate background of wild type lambda phage, and in C600 for subsequent screening, one single colony of host cells from a NZY agar plate was inoculated into SO ml TB broth containing 0.2% maltose and 10 mM MgSO^. The culture was incubated overnight with shaking at 37°C. The cells were pelleted at 1,000 x g for 10 minutes and gently resuspended in 10 ml of 10 mM MgSO^. The library was initially screened at a density of 2 X 104 plaques/ 150-mm plate. Plaques were

lifted onto nitrocellulose filters, denatured in 0.5 N

NaOH/1.5 M NaCl and neutralized in 1 M Tris-HCl, pH 7.0, 1.5

M NaCl. The filters were baked at 80°C for 30 minutes in a

vacuum oven. Hybridizations at standard stringency were carried out in 3 X ssc , 10 mM Tris-HCl (pH 7.4), 50%

formamide, 1% nonfat dry milk, and 0.1% SDS at 42°C for 12- 16 hours, standard stringency hybridizations allowed for 29% mismatch with a probe containing 68% G + C (McCanaughy

et al., 1969). After hybridization, the filters were washed

3 times for 30 minutes in 3 X SSC/0.1% SDS at 65°C.

Positive recombinants were detected by overnight

autoradiography at **70°C using Kodak XAR film with two Du Pont Cronex Lightning Plus intensifying screens and isolated

by repeated cycles of plaque purification. Recombinant phage DNA was obtained as described below and slot-blotted

onto a Nytran membrane (Schleicher & Schuell) for further

hybridization analysis. High stringency hybridizations were

carried out at 52°c in the same hybridization solution, with a final post-hybridization, high stringency wash at 65°C for 30 min in 0.1 X SSC-0.1% SDS. High stringency

hybridizations allowed for 7.6% mismatch.

Alcohol Precipitation of DNA

Alcohol precipitation was frequently used for recovery

and concentration of DNA or for removal of protein, salt,

and/or unincorporated nucleotides from DNA samples. Either ammonium acetate (5.0 M) was added to a final concentration of 2-2.5 M or sodium acetate (3.0 M) was added to 0.3 M, and then 2.5 volumes of 95% ethanol or 1 volume of isopropanol were added. If ethanol was employed, the solution was chilled for 10 minutes in an ethanol-dry ice bath; whereas, for isopropanol precipitation the solution was placed in an ice-water bath for 10 minutes. The DNA precipitate was collected by centrifugation at 12,000 x g for 15 minutes at room temperature in a microcentrifuge. The DNA pellets were rinsed with 70% ethanol and dried under vacuum.

DNA Isolation

Lambda DNA isolation. E. coli strain C600 cells were used as host cells for making a recombinant AgtlO phage plate lysate for DNA isolation according to the method of Verma (1989) with minor modifications. Three hundred microliters of competent cells were infected with 50,000 phage by incubating at 37°C for 30 minutes. The infected cells were mixed with 6 ml of top agarose at 48°C and plated out on a 150-mm NZY agar plate. The plates were incubated at 37°C to obtain confluent lysis, usually requiring 6-8 hours. Phage was eluted from the top agarose with 10 ml SM buffer by shaking for two hours on an orbital shaker at room temperature. The lysate was pipetted off, and cleared by centrifugation at 1,000 x g and then mixed with an equal volume of saturated ammonium sulfate to precipitate the phage. The suspension was kept on ice for 20 minutes and then centrifuged at 25,000 x g for 15 minutes at 4CC. The phage pellet was suspended in 0.5 ml of 3 M guanidine isothiocyanate containing 2.5% sarkosyl and 10 mM EDTA, pH

7.5. Protease K was added to a final concentration of 1.0 pg/pl and the solution was incubated at 52°C for 30 minutes.

The released phage DNA was alcohol precipitated and suspended in 0.5 ml of T^E, buffer. DNA was treated with RNase A at a final concentration of 50 pg/pl for 20 minutes at 37°C, The DNA was extracted once with one volume of T10E1 buffer-saturated phenol/chloroform (1:1) and once with chloroform. After extraction, the DNA was alcohol precipitated and resuspended in the appropriate volume of

T 1E0.1*

Plasmid DNA minioreu. Recombinant plasmid DNA was isolated using a modified alkaline lysis method of Birnboim and Doly (1979). Cells from a transformed single colony were inoculated into 20 ml LB broth with 50 pg/ml ampicillin and grown overnight at 37°C with agitation. Cultures were centrifuged for 10 minutes at 1,000 x g at room temperature.

The cell pellets were resuspended by vortexing before adding 1.5 ml SET buffer, transferred to a 1.5 ml microfuge tube, then pelleted by a 20-second spin in a microfuge. The cell pellet was vortexed until creamy and resuspended in 250 pi

SET buffer. To lyse the cells and degrade the RNA molecules, 0.5 ml freshly-prepared alkaline lysis solution was added and the tube was gently inverted several times

then incubated at 65°C for 30 minutes. Three hundred and

seventy microliters of 5 M potassium acetate, pH 4.8, was added, and the solution was mixed and kept on ice for 20

minutes. The precipitated material was removed from the solution by centrifugation in a microfuge for 15 minutes' at

room temperature. The plasmid DNA was precipitated by adding 300 fil 27% PEG/3.3 M NaCl and incubating at 4°C for

two hours. The DNA was collected by centrifugation for 15

minutes, rinsed with l ml 70% ethanol, and resuspended in 400 fil TE buffer. After loading 8 jxl onto an assay agarose

gel, 400 (il 5 M NH^AC were added, and the DNA was

precipitated with isopropanol.

Agarose Gel Electrophoresis of DNA

Agarose gels were prepared in 50 mM TBE buffer with EBr

(0.5 jug/ml) at final agarose concentrations ranging between

0.7-1.8%, depending upon the size of the DNA fragments to be

separated. The agarose was melted by boiling in buffer in a

microwave oven and allowed to cool to 65°C before being

poured into an appropriate mold with a well-forming comb. DNA samples were mixed with 1/5 volume of SOG loading buffer

prior to loading. Gels were electrophoresed in 50 mM TBE

buffer containing 0.5 Mg/ml EBr at constant voltage (50 or

loo volts) until the tracking dye reached the desired position. The DNA was visualized by uv-transillumination 41 and photographed with Polaroid type 55 positive/negative or type 667 high speed positive films.

DMA Restriction Enzvme Digestion

The restriction enzymes used in this study, their recognition sequences, and their reaction buffers are listed in Appendix XX. The DMA subjected to restriction enzyme digestion was diluted into the appropriate enzyme buffer.

Restriction enzyme was added at 1 unit//xg of DNA. Nuclease- free BSA and BME were added to all reactions at concentrations of 100 ^g/ml and 6 mM, respectively. The samples were incubated at 37°C for 2-16 hours (65°C for

TaqI).

Electroelution of DNA Fragments DNA restriction fragments were separated by electrophoresis through an appropriate agarose gel. The DNA band of interest was located with long-wavelength ultraviolet illumination. A slice of agarose gel containing the desired DNA fragment was excised with a razor blade and placed into elution wells of an electroeluter (International

Biotechnologies, Inc.). Then, 150 /il of 7.5 M ammonium acetate/0.01% xylene cyanol solution was placed in the V- shaped channels of the electroeluter, and the DNA was eluted from the gel at 50 volts for one hour in 1 X TAE buffer.

The eluted DNA in the ammonium acetate was recovered by alcohol precipitation. 42

Ligations The pTZl9U plasmid vector DNA was digested with the appropriate restriction enzyme to generate ends compatible with those of the DNA fragment to be inserted. The digested

vector DNA was treated with CIAP to remove the 5'-terminal

phosphates to prevent self-ligation. The inserts of the

cDNA clones or their restriction enzyme fragments of

interest were mixed in about equal molar amounts (0.2 pmole)

with plasmid vector DNA. The DNA mixture was heated at 65°C for 5 minutes and brought up to a final volume of 10 pi in 1

X ligation buffer containing 1-2 units of T4 DNA ligase. The reaction was incubated at room temperature for 30 minutes, and then at 16°c for 16 hours.

Bacterial Transformation Transformations were carried out using a modified

procedure of Maniatis et al. (1982). Competent cells were

prepared by growing E. coli (strain JM101 or MV1304) in LB

broth at 37°C to an OD60(J of 0.4-0.6. The cells were chilled

on ice, collected by centrifugation at 5000 x g for 10 minutes, resuspended in 1/4 the culture volume of ice-cold,

sterile 0.1 M MgCl2, and allowed to stand on ice for 20 minutes. After a second centrifugation at 5000 x g, the cells were resuspended in 1/50 the original culture volume of 50 mM CaCl2, and kept on ice for one hour.

Transformations were performed by adding 1-5 pi of ligation mix to 100 pi of competent cells in a sterile, 13-ml glass test tube and incubating on ice for a minimum of 30 minutes. The transformation mixtures were heat-shocked at 42°C for

2.5 minutes and cooled to room temperature before adding 0.5 ml LB broth. The cells were incubated at 37°c for 30 minutes with shaking; another 0.5 ml LB broth containing 100

/ig/ml ampicillin was added, and the incubation was continued for another 30 minutes. The cells were plated onto LB agar plates containing 50 jil/ml ampicillin. Only transformed cells which obtained ampicillin resistance were able to grow on these plates.

DMA Sequencing DNA nucleotide sequences were compiled and analyzed using the Hitachi DNASIS computer software (version 5.02).

Amino acid sequences were deduced from their cDNA and analyzed using the Hitachi PROSXS software (version 5.02).

Denaturation of double-stranded DMA. Double stranded recombinant pTZ19U plasmid DNA (2-3 (ig), prepared by the standard alkaline minipreparation procedure, was denatured in 0.2 N NaOH for 5 minutes at room temperature. The sample

•was neutralized by adding 0.4 volume of 5 H ammonium acetate

(pH 7.0), and then the DMA was precipitated with 4 volumes of 95% ethanol at -45°c for 10 minutes. After washing the pelleted DNA with 70% ethanol and vacuum drying, the DNA was redissolved in 7 |tl of dH20. DNA dideoxvnuclaotide sequencing reactions. All nucleotide sequencing was performed by the dideoxynucleotide sequencing method (Sanger et al., 1977) using the Sequenase DNA sequencing kit according to the manufacture's protocols.

The denatured DNA (2-3 /ig) was primed with either M13 universal or reverse primer in a total volume of 10 til in 1 X Sequenase buffer. The molar ratio of primer to template was 1:1 (0.5 pmol). The reaction was completed by incubating the mixture at 65°C for 2 minutes, placing in a beaker of 65°C water, and allowing to cool slowly to room temperature over a period of 30 minutes. To the annealed

DNA, 1 jtl of 0.1 H DTT, 2 til of labeling mix (1.5 fiH of dGTP, dCTP and dTTP), 0.5 /il of [35S)dATP (10 ftC) , and 2 fil of 1:8 diluted Sequenase were added. The labeling reaction was carried out at room temperature for 5 minutes before aliquoting 3.5 jliI of the mix into a set of 4 tubes which contained 2.5 fil of the appropriate termination mix

(containing 80 /iM deoxynucleotides and 8 of the appropriate di-deoxynucleotide). The termination reactions were incubated at 37°C for 5 minutes and stopped by adding 4 fil of stop solution (95% form amide, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol FF). The samples were heated at 80°C for 2 minutes and chilled on ice just before loading onto the assay gels.

DNA sequencing ael electrophoresis. An IBI model STS

45 apparatus with a 64 well comb was used to perform the DNA sequencing gel electrophoresis. The sequencing gels

contained 6-8% polyacrylamide (acrylamide/bis : 19/1) and

8.3 M urea in 50 mM TBE buffer. The gel solution was filtered and vacuum degassed. Just before pouring, ammonium

persulfate and TEMED were added to 0.07% (w/v) and 0.03%

(v/v), respectively. The gel solution was poured between

two glass plates with 0.4-0.8 mm wedge spacers and allowed

to polymerize for at least one hour. The gel was pre-

electrophoresed at 1600 volts for a minimum of 30 minutes in

50 mM TBE buffer. Aliquots of 3.5-6 jxl of each sequencing mix were loaded into wells, and electrophoresis was continued until the tracking dye had reached the desired positions. After the gel was soaked in 10% acetic acid-12% methanol for 45 minutes to precipitate the DNA and to remove the urea, it was then dried onto Whatman 3 MM paper at 80°C

and subjected to autoradiography.

Hybridization of Filter Bbnded DNA

Radioisotopic labeling of DNA probes. Radioactive DNA

fragments were prepared for use as hybridization probes

either by random primer labeling (Feinberg and Vogelstein,

1984) or nick translation (Maniatis et al., 1982). For both methods, approximately 0.1-0.5 fig of DNA and either [a-

3aP]dATP or [a-32P]dCTP, as radioactive nucleotide, were used

in each labeling reaction. For random primer labeling, the DNA was denatured by heating for 10 minutes at 90°C and subsequent cooling on ice. A mixture of random sequence hexadeoxynucleotides, all deoxynucleotides except the one which was to be used in radioactive form, reaction buffer (Promega), and 10 pci radioactive nucleotide were added.

The reaction was started by adding 2 units of Klenow enzyme, and, after incubating at 37°C for 30 minutes, was stopped by adding 2 pi of 0.2 M EDTA and heating to 65°C for 10 minutes. Nick translation was done by diluting DNA into a reaction mix containing nick translation buffer (Bethesda Research Laboratories), deoxynucleotides, and about 10 pCi radioactive nucleotide. Labeling was started by the addition of 2 units of DNA polymerase I and 0.2 ng of DNase

I; the reaction was incubated at 15°C for 60 minutes and terminated by adding 0.5 M EDTA to 30 mM. DNA labeled by either procedure was precipitated twice with ethanol and resuspended in an appropriated volume of hybridization buffer.

The synthetic oligonucleotide probe was radiolabeled at its 5'-terminus 37°C for 30 minutes with 166 pci [y -3zP]ATP.

A total volume of 15 pi of 1 X kinasing buffer containing

100 ng oligonucleotide and 8 units of T4 polynucleotide kinase. Then, the enzyme was inactivated at 65°C for 5 minutes. The labeled oligonucleotide was ethanol precipitated.

Slot-blotting of nucleic acids. Slot-blotting was performed by using a Bio-Rad 48 slot filtration apparatus. 47

A DNA sample for slot-blotting was denatured in 0.2 N NaOH at 65°C for 30 minutes and then neutralized with 3.5 volume of 1 M Tris-HCl/2 M NaCl (pH 7.0). Hybridization membranes

(either nitrocellulose or Nytran) were wetted sequentially

in dHz0, then 12 X SSC. Aliquots of 20-200 fil of the DNA solution were slotted onto the membrane by vacuum filtration. RNA samples were prepared in 6 X SSC/7% formaldehyde and heated at 65°C for 15 minutes before applying to a nitrocellulose membrane. The NaOH-treated control RNA samples were made in 0.2 N NaOH, heated at 65°C for 30 minutes, and neutralized by adding 2 volumes of 1 M

Tris-HCl (pH 6.0). The membranes were baked at 80°C for 30 minutes.

Southern and northern blotting. Samples of mouse genomic DNA were digested with several restriction endonucleases. After agarose gel electrophoresis to separate the DNA fragments, the gel was stained in 50 mM TBE buffer containing 0.5 jig/ml EBr for 15 minutes and photographed using transmitted UV light. The gel was then soaked in 0.25 N HCl for 20 minutes, rinsed with dHzO, and soaked in 0.4 N NaOH twice for 15 minutes each to denature and cleave the DNA backbone at the acid-depurinated sites. The gel was neutralized by soaking in 1 M Tris-HCl (pH 7.4) for 20 minutes. After a brief rinse with 10 X 5SPE, DNA in the gel was transferred onto a nitrocellulose or Nytran membrane with 10 X SSPE employing either a standard 48 capillary blotting apparatus (Southern, 1975) or using a

VacuBlot apparatus (American Bionetics) according to manufacture's directions. Northern blotting was performed according to Maniatis et al. (1982). Poly(A) + RNA samples were precipitated with ethanol. After resuspending in dH2Of the RNA samples were denatured for 15 minutes at 65°C in formaldehyde (2.2

M)/formamide (50%), loaded onto and electrophoresed in a 2.2

M formaldehyde-1.5% agarose gel. The gel was soaked sequentially in dHao and 20 X ssc and the RNA was transferred to a nitrocellulose membrane by capillary blotting.

Stripping probe from filters. Previously hybridized probes were stripped off Nytran membranes by boiling the filter for 20 minutes in 0.01 X SSPE/0.5% SDS. Probes bound to nitrocellulose filters were stripped by two 20-minute washes at 65°c in 50% formamide, 2 X SSC, and 0.5% non-fat skin milk. After stripping, the filters were rinsed in 2 X SSPE or SSC and exposed to X-ray film to check for complete removal of the probe.

Autoradioqraphv. Membranes and gels containing 3ZP- labeled DNA were sealed in plastic bags or cover with plastic wrap, respectively, and directly exposed to Kodak

XAR-5 film with two Du Pont cronex Lightning Plus intensifying screens at -85°c for several hours to three 49 weeks. Gels with 35S-labeled DNA were dried onto Whatman 3

KM paper before exposure to XAR-5 film at room temperature. All films were developed up to 7 minutes in Kodak GBX developer, fixed for 10 minutes in Kodak GBX Fixer, and then rinsed in running water for 15 minutes before air drying. CHAPTER 3

Results

Morphological changes of Mouse Hast Cells Induced with FCM or Sodium Butvrate

ABFTL-6 cells contain a relatively low amount of small

cytoplasmic granules. When the cells were cultured in the media containing 50% FCM for 10 days or in the presence of 1 mM sodium butyrate for 4 days, the majority of the cells

increased in size as well as in cytoplasmic granulation. The results shown in Figure 5 are representative of mast

cell populations in each category of a typical experiment. The photographs were taken at the same magnification and at

random field positions of cells stained with either

toluidine blue or alcian blue. By comparison to the untreated mast cells {Panel A), the mast cells induced with either FCM (Panel C) or butyrate {Panel B) significantly

increased their average cell volumes. This increase in cell size was evident after four days for FCM, or two days for

sodium butyrate treatment, respectively. Also, the granules were larger and were stained more intensely with the metachromatic dye toluidine blue upon induction.

Effects of FCM and Sodium Butvrate Culture on

Mast Cell Trvotase Activity and Antigen Levels

Tryptic activity was identified in high salt extracts of the mast cells by enzymatic assays using synthetic substrates.

50 51

Figure 5. Morphological changes of ABFTL-6 cells induced by 3T3 FCM and by sodium butyrate. (A) Uninduced control cells stained with toluidine blue. (B) Cells were grown for 4 days in the media containing 1 mM sodium butyrate and stained with alcian blue, (C) Cells were grown for 10 days in the media containing 50% FCM and stained with toluidine blue. Photographs were taken from random fields of stained slides with Kodak Ektachrome 50 slide film. (Magnification X576). In order to clarify the tryptic activity identified in these

mast cells, several serine proteinase inhibitors were tested for their effect on the observed tryptic activity. A unique

biochemical property of mast cell tryptase, which

distinguishes it from other serine proteases (i.e.

pancreatic trypsin), is its resistance to trypsin inhibitors

such as a-1 protease inhibitor (a-l-PI) and lima bean

trypsin inhibitor (LBTI). The inhibition profile obtained

is presented in Figure 6. The tryptic activity was almost totally abolished by the strong serine protease inhibitors PMSF and DFP, and

significantly inhibited by antipain and benzamidine. An

irreversible chymotrypsin inhibitor that alkylates the active site histidine TPCK, showed partial inhibition (40%).

A trypsin inhibitor with the same mechanism as TPCK, TLCK, caused 77% inhibition. It seems likely that some of the tryptic activity in the cell extract may be due to chymotryptic enzyme. However, TPCK also partially inhibited purified mast cell tryptases from human lung (70% activity), and dog mastocytoma (80% activity) (Caughey et al., 1987;

Smith et al., 1984). TLCK had a similar effect on the tryptase isolated from a human mast cell line (24% activity, Butterfield et al., 1990). Like other tryptases, this activity was not affected by either a-l-PI or LBTI. It was less susceptible to inhibition by benzamidine

(63% inhibition) than tryptases from human lung PMSF

20 40 60 80 100 % Activity

Figure 6. In vitro inhibition profile of mouse mast cell tryptase. A single lysate from FCM induced ABFTL-6 cells was used for all inhibition studies. The residual tryptic activity presented was calculated relative to the control, which contained no inhibitor (100% activity). 54

(96.5% inhibition) and dog (95% inhibition). However, the tryptase isolated from human mast cells was more resistant to benzamidine inhibition (20% activity). The inhibition profile in Figure 6 is similar to those of purified dog mast cell tryptase and human tryptases, indicating that the tryptase activity of the ABFTL-6 cells is due primarily to similar tryptase(s).

Furthermore, a tryptase antigen was identified in the

ABFTL-6 cell extracts, which reacted with antibodies against human mast cell tryptase. Both immuno-dot and Western blots analyses were positive and suggested structural similarities between mouse and human tryptases (see Figure 8 and 9 below). The evidences provided by the inhibition study and the immuno-blotting analyses support the conclusion that the ABFTL-6 tryptic activity was due to the mast cell tryptase.

Upon treatment with FCM or sodium butyrate, there was an increase in total cellular protein (Figure 7). Tryptase activity and antigen levels in the cell extracts also increased strikingly. The mean of tryptic activity of induced ABFTL-6 mast cells was 1.66 units/106 cells for the FCM culture (n=5) and 0.82 units/106 cells for sodium butyrate treatment (n=7) (Table 2). These levels were about 13- and 6-fold higher than the control level (0.13 units/106 cells, n=7) upon induction with FCM and sodium butyrate, respectively. 55

rv 2.50 0.55 M o U CJ a o 2.00* ‘ *0.44-

3 1,50* • ‘03 3 w b 3 > d oi * o 1.00- • **a22 «-* < o & mu m 0.50*- o, o £ 0.00 H Ni-Butjxmtc F 7 7 ) 3T 3-C M Control

Figure 7. The effects of 3T3 FCM and sodium butyrate treatment on tryptic activity and total cellular protein of

ABFTL-6 cells. Data are presented as mean + SD of three separate experiments, each carried out in duplicate. 56

* * * £ 4 «-C i

Figure 8. Immuno-dot blot quantification of total tryptase antigen in the induced and the uninduced ABFTL-6 mast cells. Cell lysates were diluted and the amount of lysate equivalent to a fixed number of cells (as indicated in the right margin of the figure) was applied to each row of the blot. Human mast cell tryptase was used as standard and was shown to the left of the figure. A rabbit IgG against human tryptase was used as the primary antibody. The tryptase antigen was detected by using goat anti-rabbit IgG-alkaline phosphatase conjugate as a secondary antibody. Panel A, human mast cell tryptase standard. Panel B, 10-day FCM culture of ABFTL-6 mast cells. Column B1 and B2 represent different preparations of induced cells. Panel C, uninduced

ABFTL-6 cells. 57

Table 2. The Effect of FCM and Sodium Butyrate on Tryptase

Expression in ABFTL-6 Mouse Mast Cells

Treatment1

FCM Butyrate Control

Total Protein 0.33 ± 0.20 0.27 ± 0.13 0.09 ± 0.02 (mg) (n=5) (n=6) (n=5)

t Tryptic 1.66 ± 0.39 0.82 ± 0.51 0.13 ± 0.08 Activity (unit) (n=5) (n=7) (n=7)

Total Tryptase 125 75 2.3 Antigen2 (Mg)

Tryptase 38% 28% 2.7% Antigen to Total Protein

1 The data were expressed as the mean ± standard deviation

for 106 cells. N is the number of individual cell

cultures measured.

2 Total tryptase antigen was calculated from the data in the

dot-blot immunoassay based on a standard of human

tryptase. This determination was performed once. Immuno-dot blots were used to quantify the tryptase protein in cell extracts and to monitor the tryptase antigen

levels upon induction (Figure 8). A data summary table of tryptase induction of FCM and butyrate is shown in Table 2.

The value for tryptase concentration in cell extracts is a

relative value since purified human tryptase was used as the

standard under the assumption that mouse tryptase is 100%

reactive to human tryptase antibody. Statistical analysis (pared t test) revealed that the increases of both total

cellular protein and tryptic activity induced by FCM or

sodium butyrate are significant (p < 0.1). Figure 9 shows a Western blot analysis with an antibody against human

tryptase. significant increases in tryptase antigens were

observed in both FCM and sodium butyrate treated cells; the highest increase was found in the cells induced with FCM.

To check whether the increased tryptic activity was due to the frequent media changes, the following control was performed. ABFTL-6 cells were grown in unsupplemented media which was replaced by fresh media when the media was changed on the induced cells. Cells were seeded at the same density and maintained for the same length of time as the induced cells. There was no statistical difference between the tryptic activity of these control cells and the starting cells. As seen in Figures 9 and 11, there was no significant visual difference in the tryptase antigen level between these cell populations and the starting cells. 59

‘-4%£

Figure 9. Western blot analysis for tryptase antigen in induced and uninduced ABFTL-6 mast cells. The proteins in a cell lysate equivalent to 0.7 x 106 cells were precipitated by 20% TCA, resuspended, and separated by electrophoresis on a 10% SDS-polyacrylamide gel. The separated proteins were electroblotted to a nitrocellulose membrane which was then probed with an affinity-purified antibody against human tryptase. (A) Molecular weight standards; (B) starting

ABFTL-6 cells; (CJ control ABFTL-6 cells for sodium butyrate treatment; (D) sodium butyrate treated ABFTL-6 cells; (E) control ABFTL-6 cells for FCM treatment; (F) FCM induced

ABFTL-6 cells; (G) human mast cell tryptase. 60

Figure 10. Western blot analysis of sodium butyrate- induced tryptase antigen in ABFTL-6 cell lysates. Fifty micrograms of lysate protein were precipitated by 20% TCA and separated by electrophoresis on a 7.5% SDS- polyacrylamide gel and blotted to a nitrocellulose membrane.

Rabbit anti-human tryptase antibody and goat anti-rabbit IgG antibody conjugated to alkaline phosphatase were used as primary and secondary antibodies, respectively. (A) Lysate of ABFTL-6 control cells; (B) lysate of ABFTL-6 cells grown in 2 raM sodium butyrate for four days; (C) lysate of ABFTL-6 cells grown in 1 mM sodium butyrate for four days; (D) human tryptase standard (l ug). 61 The effect of different concentrations of sodium butyrate on the induction of tryptase was examined. As shown in Figure 10, 1 mM butyrate-supplemented media induced more tryptase expression than 2 mM butyrate-supplemented media. A notable feature of this blot is that the band in lane C seems to contain two closely spaced bands, indicating tryptase heterogeneity.

Both FCM and Sodium Butyrate Increased Total DFP-Bindino Proteins

DFP is a strong serine protease inhibitor which is able to irreversibly bind to the active site serine residue of all serine proteases. Figure 11 shows an autoradiograph of

[3H] DFP-labeled proteins from induced and uninduced ABFTL-6 mouse mast cells. The cell extracts were incubated with an excess of TPCK, a chymotrypsin inhibitor, before reaction with [3H] DFP to abolish the possible binding of the [3H]

DFP to chymase. Therefore, the bands observed in this autoradiogram are most likely due to tryptases, but could represent other serine proteases. As shown in this figure, the intensity of the bands corresponding to a Mr of 35 KDa in sodium butyrate or FCM induced mast cells increased significantly from those found in uninduced mast cells. The degree of the increases of "DFP-binding protein” is comparable to the increases of tryptase antigen observed by

Western blot analysis (see Figure 9). Some high molecular weight bands were seen in some extract preparations. 62

KDa.

95.5

55 ! 44 36 29

• w’* ' .

Figure IX. Autoradiography of gel fractionated [3H] DFP- labeled proteins in ABFTL-6 cell lysates. A lysate equivalent to 0.7 x 106 cells of each cell sample was incubated with excess [3H] DFP, as described in Materials and Methods, and separated on a 10% SDS-polyacrylamide gel.

(A) The positions of the prestained standards were marked on the dried gel with radioactive ink. (B) Human lung mast cell tryptase (1 ug). (C) ABFTL-6 cell grown in 1 mM sodium butyrate. (D) ABFTL-6 control cells for sodium butyrate treatment. (E) 3T3 FCM induced ABFTL-6 cells. (F) ABFTL-6 control cells for 3T3 FCM treatment. (G) Starting ABFTL-6 cells. Possibly, they are enzyme aggregates or non-specific DFP- binding proteins. Differences in the molecular weight of mouse tryptase observed between the Western blot and the autoradiography of DFP-binding study were noticed.

Molecular Cloning of House Mast Cell Trvptases

The yield of total RNA isolation from ABFTL-6 cells was 2.8 /jig/106 cells. The poly (A)* RNA was isolated from the total RNA at 4.2% recovery rate. A RNA slot blot hybridization analysis was performed using RNA from ABFTL-6 cells to determine whether RNA homologous to the dog tryptase cDNA exists in these mouse mast cells. As shown in

Figure 12, RNA slot-blot hybridizations revealed that the 900 bp dog tryptase cDNA strongly hybridized under standard stringency conditions to the poly(A)* RNA isolated from ABFTL-6 cells, indicative of a high level of tryptase expression in these cells. The hybridization in the poly(A)+ RNA fraction was due to RNA since there was no apparent DNA contamination in that fraction, as evidenced by the lack of hybridization in the corresponding NaOH-treated

RNA sample. The NaOH treatment, which completely degrades

RNA, but not DNA, demonstrated that the positive result was due to hybridization to RNA and not to contaminating DNA. The strongest hybridization was found in the low salt wash fraction which contains mostly short, poly(A)+-tailed RNA, unable to bind tightly to the oligo(dT) column, suggesting that most tryptase messengers only bear short poly(A)* 64

Figure 12. Mouse mast cell RNA slot-blot hybridization analysis for tryptase-encoding sequences. Poly(A)+ RNA of mouse mast cells was isolated by two cycles of oligo (dT) cellulose chromatography. The poly (A)+, low salt wash and poly(A)' RNA fractions were collected and slot-blotted onto a nitrocellulose membrane. Hybridization was carried out at standard conditions, with dog mast cell tryptase cDNA as probe. (A) Formaldehyde-denatured RNA; (B) NaOH-treated

RNA; (C) NaOH-treated mouse genomic DNA as control. Lane 1 and 2 contain 1 and 3 /ig RNA, respectively. Row a and b contain 0.4 and 2 /ig of DNA, respectively. 65 tails. Only very faint bands were seen in the denatured mouse genomic DNA, suggesting the number of tryptase genes may be small. A cDNA library was constructed from the poly(A)+ RNA isolated from mouse mast cells. Initial screening of the mouse mast cell cDNA library with the dog tryptase clone yielded several hundred (0.5% frequency) hybridization- positive plaques. Twenty positive clones were arbitrarily selected for further studies and were plaque purified prior to isolating their DNA. Digestion of the recombinant phage

DNAs with EcoRI released inserts that ranged in size from 950 to 1200 bp. The isolated recombinant phage DNAs were slot-blotted onto a nitrocellulose membrane for rescreening with the dog tryptase cDNA probe under defined conditions.

These included highly stringent hybridization conditions which allowed for approximately 7.6% mismatch. The blot was made in duplicate. One was hybridized to dog tryptase DNA; the other to lambda DNA to determine the relative amount of recombinant vector DNA loaded in each slot. Also included were samples of the cDNAs for dog tryptase and RMCF II. Figure 13 shows the autoradiograms of the DNA slot-blot hybridization patterns under highly stringent conditions.

Although all the clones hybridized to dog tryptase cDNA at the standard conditions (data not shown), some of them hybridized poorly at highly stringent condition. For example, clone #4 6 and #24 had little hybridization 66

l

Figure 13. Hybridization analysis of DNA from tryptase- positive clones by slot blotting. DNA of tryptase-positive lambda clones was isolated, denatured and slot-blotted onto a nitrocellulose membrane at two different concentrations,

20 ng and 200 ng (based on ethidium bromide staining intensity in agarose gels). A and B are duplicate blots and were hybridized at highly stringent conditions requiring

92.4% sequence complementary. DNA samples are numbered at their left, Trp - dog tryptase cDNA, Chy - RMCP II cDNA.

(A) Blot hybridized with lambda DNA probe; (B) Blot hybridized with dog tryptase cDNA probe. 67 (Panel B), although they contained equivalent amounts of DNA as judged from their hybridization to lambda DNA (Panel A). The figure also shows that there was no cross-hybridization between dog tryptase and RMCP II (chymase) cDNAs, or between dog tryptase and lambda DNA.

Five clones (ATI, AT4, AT26, AT55 and AT85) showed

strong hybridization under these highly stringent conditions, clone AT86 hybridized less intensely, but

contained the longest insert. The inserts in these six clones were subcloned into pTZ19U plasmid and their nucleotide sequences were determined. The subcloning and

sequencing strategy are presented in Figure 14. The

sequences obtained fell into two groups each of which coded

for a distinct tryptase. The first group consisted of clones pAT4, pATl and pAT86, designated as mouse tryptase I; the second group contained pAT26, pAT55 and pAT85, and was designated as mouse tryptase II. clones pAT4 and pAT26 were chosen as representatives of mouse tryptase I and tryptase

II, respectively. These cDNAs were cleaved into subfragments by PstI and Sau3A for subcloning in order to obtain sequence data from both strands.

The cDNA's composite nucleotide sequence for mouse tryptase I and its derived amino acid sequence are presented in Figure 15. Tryptase I cDNA is 1086 bp long, contains an open reading frame of 822 bp, and a 3 '-noncoding region of

264 bp. The putative sequence for the polyadenylation 68

Mouse Tryptase I Mouse Tryptase II.

Q CO Q P) ir nj 1/5 fa nl tSnj q 17 Off _ (A)n q °

P ^ T 8 6 i pXT55 n 1—

pAT1 m 1 pAT85 EE

Figure 14. strategy used to subclone and sequence the cDNAs for the mouse mast cell tryptases. The rectangles represent the open reading frames of the cDNA clones. The hatched and open areas show the regions encoding the putative signal/activation peptide and the active tryptase, respectively. The intron found in clone p>,T86 is denoted as a dotted box below the open reading frame. The thick lines designate the 3 '-noncoding region. The thin lines with arrows indicate the length and direction of nucleotide sequences obtained by dideoxnucleotide sequencing of the cDNAs and their subclones. All sequence data was verified by sequencing both strands of the cDNA. Figure 15. The composite cDNA's nucleotide and derived amino acid sequence of mouse tryptase X. The numbers on the right and left sides of the sequence indicate the nucleotide positions. The amino acid sequence deduced from the cDNA is shown in single-letter code above the first nucleotide of each codon, and are numbered above every tenth residue.

Amino acid residues -29 to -1 represent the signal/activation peptide. The amino acid residues which comprise the catalytic triad (Hisw , Asp91 and Ser194) are marked with stars. The solid square labels the substrate- binding pocket Asp188 residue. The potential N-linked glycosylation site, Asn102, is marked with a dot. The solid arrow indicates the location of the intron found in clone plT86. The putative polyadenylation signal sequence is underlined. Mouse Mast C ell Tryptaso I -20 -10 LKRLLLLWALSLLASLVYSA 1 CTGAAGCGGCTGCTGCTGCTGTGGGCACTGTCCCTCCTGGCTAGTCTGGTGTACTCAGCC 60 -1 +1 10 PRPANQRVGIVGGHEASESK 6 1 C CTCG CC CAG C CAATCAG CGAGTGG G CATCGTGG G A GGACATGAGGCTTCTGAGAGTAAG 1 2 0

2 0 3 0 WPWQVSLRFKLNYWIJIFCGG 121 TGGCCCTGGCAGGTGAGCCTGAGATTTAAATTAAACTACTGGATACATTTCTGCGGAGGC 1 0 0

4 0 ★ • 5 0 SLXHPQWVLTAAHCVGPIIXK 101 TCTCTCATCCACCCA CAGTCG GTG CT CACTGCGG CA C A CTGTGTG G C A CCW CACATCAAA 2 4 0

6 0 ' 7 0 SPQLFRVQLREQYLYYGDQL 241 AGCCCACAGCTCTTCCGGGTGCAGCTTCGTGAGCAGTATCTATACTATGGGGACCAGCTC 3 0 0 00 90 -A- LSLNRXVVHPI1YYTAEGGAD 3 0 1 . CTCTCTTTGAACCGGATCGTGGTGCACCCCCACTATTACACGGCCGAGGGTGGGGCAGAC 3 6 0 100 • 110 VALLELEGPVNVSTHIHPIS 3 6 1 GTTGCCCTGCTGGAGCTTGACGGTCCTGTGAATGTCTCCACCCATATCCACCCCATATCC 4 2 0

1 2 0 1 3 0 LPPASETFPPGTSCWVTGWG 4 2 1 CTGCCCCCTGCCTCCGAGACCTTCCCCCCTCGGACATCGTGCTGGGTGACAGGCTGGGGC 4 0 0

1 4 0 1 5 0 D1DNDEPLPPPYPI.KQVKVP 4 0 1 GACATTGATAATGACGAGCCTCTCCCACCTCCTTATCCTCTGAAGCAAGTGAAGGTTCCC 5 4 0

1 6 0 1 7 0 XVENSXtCDRKYllTGLYTGDD 5 4 1 ATTGTGGAAAACAGCCTGTGTGACCGGAAGTACCACACTGGCCTCTACACGGGAGATGAT goo

1 0 0 H 1 9 0 FPIVHDGMLCAGHTRRDSCQ 6 0 1 TTTCCCATTGTCCATGATGGCATGCTGTGTGCTGGAAATACCAGGAGAGACTCCTGCCAG G60

At 200 210 GDSGGPLVCKVKGTWLQAGV 6 6 1 GGCGATTCAGGGGGGCCACTGGTCTGCAAACTGAAGGGTACCTGGCTGCAGGCAGGAGTG 7 2 0

2 2 0 2 3 0 V5WGEGCAQPNKPGIYTRVT 7 2 1 GTCAG CTG GGGTGAGGC CTG CG CACAG C CCAACAAG C CTG G CATCTACACCCGGGTGACA 7 0 0

2 4 0 YYLDWIItRYVPEIIS End 7 0 1 TACTACTTAG A CTG C AT CCACCG CTATGTCCCTG AG C ATTC CTG AG ACCTATCC A GGGTC 0 4 0

0 4 1 AGGCAAGAACCAGGG CCGTCGTGT CTTTAA CTCACTG CTTCCTG GTCAGGTGGAACC CTT 9 0 0 9 0 1 GCCTTCCTTGTCCTCTGTCTCCCCTGTCTACTAAATGTCCCTCTGAGGCCCCCACCCCCC 9 6 0 9 6 1 AG TTCCGTCTTGAGTC C CTAG CCATT CG GTTC CCTCTTG C CT CC CACCACATAATAGTTG 1 0 2 0 1021 CATTGTGTGGCTCCCTCTCTTCTGTCGCTCATTAAAGTACTTGAAAACAGCTATTGGAAA 1 0 0 0 1 0 8 1 AAAAAA 70 signal, ATTAAA, is present 21 bases upstream from the poly(A) tail. The open reading frame encoded a peptide of 274 amino acids and terminated at a TGA stop codon. The nucleotide and derived amino acid sequences of mouse mast cell tryptase II is given in Figure 16. The compiled nucleotide sequence of tryptase II is 986 bp long, consisting of an open reading frame of 801 bp and a 185 bp 3'-untranslated region. The presumed polyadenylation signal, AATAAA, begins 18 nucleotides 5* to the poly(A) tall. The two mouse tryptases share 75% and 70% sequence identities at their nucleotide and amino acid levels, respectively. The base composition of the mouse tryptase cDNAs are high in G and C. The percentage of overall G + C content for both mouse tryptase cDNAs is 56%, compared to 41% for average mouse genomic DNA (Arrighi 6t al., 1970). Both ipouse tryptases I and II contain a short poly (A) * tail of only 9 bases. This is consistent with the results of RNA slot-blot hybridization showing high levels of tryptase RNA in the low salt fraction, which contained short poly(A)* tails (see Figure 12).

The apparent functional domains of mouse mast cell tryptase I and II, like dog tryptase, consist of 245 amino acid residues. Each enzyme exhibits all the features characteristic of a serine protease. The functional domains start with the typical Ile-Val-Gly-Gly sequence and have the active site charge-relay residues His44, Asp91, and Ser194 Figure 16. Mouse mast cell tryptase IX cDNA's nucleotide and its derived amino acid sequences. The amino acid sequence deduced from the cDNA is shown in single-letter code above the first nucleotide of each codon, and numbered above every tenth residue. Amino acid residues -22 to -1 represent the signal/activation peptide. The labeling and notations are the same as in Figure 14. Notice that the putative glycosylation site at Asn21 does not exist in mouse tryptase I. 71

House Hast Coll Tryptase II -20 -10 LT&PLtiSSLVHAAPGPAMTR 1 CTCACGCTGCCCCTCCTGTCCAGCCTGGTGCATGCAGCCCCCGGTCCAGCTATGACACGA 60 -1 +1 10 E G IVGGQEA1IGNKWPWQVSL G1 GAAGGCATTGTGGGGGGACAGGAGGCACATGGGAACAAGTGGCCCTGGCAGGTGAGCCTG 120

2 0 » 3 0 RANDTYWMHFCGGSLIHPQW 1 2 1 CGTGCCAATGACACCTACTGGATGCATTTCTGCGGTGGCTCCCTCATCCACCCACAGTGG 1 8 0

4 0 Ar 5 0 VLTAAHCVGPDVADPNKVRV 1 0 1 GTGCTCACTGCGGCACACTGTGTGGGACCGGATGTTGCTGACCCCAACAAGGTCAGAGTA 2 4 0

6 0 7 0 QLRKQYLYYHDIILMTVSQII 2 4 1 CAGCTCCGTAAGCAGTACCTCTATTACCATGACCACCTGATGACTGTGAGCCAGATCATC 3 0 0

00 9 0 Ar THPDFYIVQDGADIALLKLT 3 0 1 ACACACCCCGACTTCTACATCGTCCAGGATGGGGCAGACATTGCCCTGCTGAAACTCACA 3 6 0

100 O 110 NPVHISDYVHPVPLPPASET 3 6 1 AACCCTCTGAACATTTCTGACTATGTCCACCCTGTCCCCCTACCTCCTGCCTCAGAGACC 4 2 0

1 2 0 1 3 0 FPSGTLCWVTGWGNIDNGVH 4 2 1 TTCCCCTCAGGAACGTTGTGCTGGGTGACAGGCTGGGGTAACATCGACAATGGTGTAAAC 4 0 0

1 4 0 1 5 0 LPPPFPLKEVQVPIIENHLC 4 0 1 CTGCCGCCACCATTTCCTTTGAAGGAGGTGCAAGTTCCCATTATAGAAAACCACCTTTGT 5 4 0

1 6 0 1 7 0 DLKYHKGLITGDNVHIVRDD 5 4 1 GACTTGAAGTATCACAAAGGTCTCATCACAGGTGACAATGTCCACATTGTCCGAGATGAC GOO

100 ri 1 9 0 Ar HLCAGHEGIIDSCQGDSGGPL 6 0 1 ATG CTGTGTGCTGGGAATGAAGGACATGACTCCTGCCAGGGCGACTCCGGAGGACCTCTG 6 6 0

200 210 VCKVEDTWLQAGVVSWGEGC 6 6 1 GTCTGCAAGGTAGAAGACACCTGGCTGCAGGCACGCGTGGTCAGCTGGGGTGAGGGCTGT 7 2 0

2 2 0 2 3 0 AQPHRPGIYTRVTYYLDWIH 7 2 1 GCACAGCCCAACAGGCCTGGCATCTACACCCGGGTCACCTATTACTTGGACTGGATCCAC 7 8 0

2 4 0 H Y V P K D F End 7 0 1 CACTACGTCCCCAAGGACTTCTGAGTCACATCCAGGATGACCTCCGTTCCTCCCAGCATG 8 4 0

0 4 1 CTGCTTCCTGCCCGCGTGGCATCCCTCCCTTCCTCTCCTGCTCCCCATCCTGAGTCCCAA 9 0 0 9 0 1 TTCTTCTGCCTTCCACTCAAGTAGCTACACTGAGCAGGCGCCGCTCTCTGCTATGCCTCA 9 6 0 9 6 1 ATA A AATG CGTTAAAGCAAAAAAAAA 72 corresponding to His57, Asp102 and Ser195 in chymotrypsin. The residues surrounding the active sites are highly conserved in serine protease, which is also true of the mouse tryptases.

The partial seguence of clone plT86, coding for tryptase I, is identical to the corresponding regions of plT4, except that an additional 119 nucleotides are present within the codon for Pro

1987), human neutrophil cathepsin G (Salvesen et al., 1987), human glandular kallikrein (schedlich et al., 1987) and human tryptase (Vanderslice et al., 1990). The total 119 bp additional nucleotide seguence is shown below:

5'-GTGAGTCTCCCTGGGCCTGGCATGGTGGGACGGGATCTAGATTATTCCCACCATCCC

CAGTGTTCCCGAGGATGTGCCCATCCTGGCTGGAGCTTCTGAGCATGATTATACTCTTCT

AG-3'.

The double- and single-underlined hexanucleotide sequences at the 5' and 3* termini, respectively, of this region are consensus sequences for intron/exon splicing junctions 73

(Breathnach and chambon, 1981). This suggests that this seguence most likely represents an unspliced intron or an intron remnant. Neither of the cDNAs for the tryptases were isolated as full length. The 5 1 nucleotide sequence of tryptase I did not contain an ATG codon for a Met residue, which could have served as a translation initiation signal. Although an in­ frame ATG codon exists in the -5 position in tryptase II, it is doubtful that it serves as a translation initiation site.

By analogy to the signal peptides of dog and human tryptases

(Vanderslice et al., 1989; Miller et al., 1989), the mouse tryptases are expected to have signal peptides of 30 amino acids. Therefore, the 29 and 22 amino acid peptides at the 5* ends of tryptase I and tryptase II, respectively, represent partial leader peptide sequences for the mouse tryptases. These leader peptides are only 55% identical to each other with regard to amino acid sequence as compared to

70% identity for the catalytic region. The nucleotides coding for the leader peptide sequence of tryptase II are

69% identity with the corresponding sequence of tryptase I.

Molecular Cloning of Mouse Mast Cell Chvmase

Chymotryptic activity in ABFTL-6 cell extracts was detected at a very low level using the synthetic chymotryptic substrate Boc~(Ala)2-Pro~Phe-pNA (data not shown). However, the ABFTL-6 cell RNA slot-blot probed with a rat mast cell chymase II (RMCP II) cDNA revealed a high 74

Figure 17. Mouse mast cell RNA slot-blot hybridization

analysis for chymase-encoding sequences. This RNA slot blot

is the same used for dog tryptase cDNA hybridization as described in Figure 12. Hybridization was carried out at standard stringency with labeled RMCP II cDNA as probe. (A)

Formaldehyde denatured RNA; (B) NaOH-treated RNA; (c) NaOH- treated mouse genomic DNA. Lane 1 and 2 contain 1 and 3 fig

RNA, respectively. Row a and b contain 0.4 and 2 fig DNA, respectively. level expression of chymase RNA (Figure 17). These results indicate that ABFTL-6 cells may contain significant chymase activity and that better enzyme substrates are needed for detecting and measuring this activity. The strategy used for cloning mouse chymase cDNA was the same as that employed for the tryptase cDNA (see Figure 3). Initial screening of the cDNA library was with the insert of RMCP II, which identified 15 hybridization-positive clones. Eight of these were plague-purified and their DNA isolated. The inserts, released by EcoRI cleavage, ranged in size between 400 and 600 bp. Seven clones (/2, 3, 4, 5, 8, 9, and 10) were subcloned into pTZ19U plasmid for sequence analysis. The compiled sequences revealed that the inserts code for a carboxyl terminal sequence of a novel chymase. Clone #3 insert DNA was then used as a probe in rescreening the original cDNA library (1 X 105 recombinant phages).

Hybridization-positive chymase plaques were found at a frequency of -0.5%, which is similar to that found for the tryptase cDNA. Of the 120 partially plaque-purified positives, nineteen were selected for detailed analysis based on plaque hybridization intensity. The size of their inserts ranged from 600-1500 bp. Seven of the larger inserts were subcloned for sequence analysis. Similar to the tryptase cDNAs, the sequences obtained fell into two groups each encoding a previously undescribed mouse mast cell chymase. The first group consisted clones plC19, 26, 76 and 51.1, and was designated as mouse mast cell chymase I.

The second group included plC51, 127.1, and 102, with sequences identical to those of the previously isolated group of chymase clones including plC3. This second group was designated as mouse mast cell chymase XI. Clones pA,C26 and pAci02 are the representatives of mouse chymase I and II, respectively. The Hindlll and PstI restriction fragments of chymase I and the AccI, Rsal and Hindlll restriction fragments of chymase II were subcloned for sequencing. Ninety five percent of the sequence data were verified by sequencing the complementary strand or independent recombinants. The subcloning and sequencing strategies for these two chymase cDNAs are presented in

Figures 18 and 19. The consensus nucleotide and the derived amino acid sequences of mouse chymase I are shown in Figure 20. Translation starts at an ATG initiation site codon (base 6), and stops at the TAG stop codon (base 747) in the same reading frame. The open reading frame is preceded by 5 bases of a 5' untranslated region. There are 211 untranslated bases located after the stop codon. The translated form of mouse chymase I consists of 247 amino acids including a characteristic hydrophobic signal peptide of 21 amino acids. The mature form of the enzyme contains 226 amino acids with a calculated Mr of 25.4 kd. Hisw ,

Asp89, and Ser182 of the deduced chymase sequence correspond 77

Mouse Chymase I

- - o - 200 bp CO ~ CO _____ CL X CL . . . -H -- 1----- Mn pxC26 *•----- H

P>jC51.1 f

pXC19

Figure 18. Strategy for subcloning and sequencing mouse chymase I cDNAs. The rectangle represents the open reading frame of the cDNA. The hatched and open areas show the regions encoding the putative signal/activation peptide and the active chymase, respectively. The lines attached to rectangles designate the 5* or 3'-noncoding region. The

lines with arrows indicate the length and direction of nucleotide sequences obtained by dideoxnucleotide sequencing of the cDNAs and their subfragments. 78

Mouse Chymase 11

ES ' 2 0 0 b P 8 . e 8 8 ------lu X CC < / a \ 1------1—I— I------n pxC102

p X C 5 1

p X C 3 ------I 1- (pXC 1 - 9) ~

Figure 19. Strategy for subcloning and sequencing mouse chymase II cDNAs. The open rectangle represents the open reading frame of the cDNA. The shadowed areas show the regions encoding for the putative intron sequence. The lines attached to rectangles represents the 3'-noncading region. The lines with arrows indicate the length and direction of nucleotide sequences obtained by dideoxnucleotide sequencing of the cDNAs and their subfragments. Notice that the EcoRI site at the 5' end of the sequence is an internal site. The nucleotide sequences of pic 1 through 9 are identical to plC3. Figure 20. The composite cDNA's nucleotide and derived amino acid seguence of mouse mast cell chymase I. The numbers on both sides of the sequence indicate nucleotide positions. The amino acid sequence deduced from the cDNA is shown in single-letter code above the first nucleotide of each codon, and are numbered above every tenth residue. Amino acid residues -21 to -1 represent the signal/activation peptide. The amino acid residues which comprise the catalytic triad (Hisw , Asp89 and Ser182) are marked with stars. The solid square labels the residue

(Asn176) in the substrate-binding pocket. The potential N- linked glycosylation site (Asnw ) is marked with a dot. The putative polyadenylation signal sequence is underlined. 79

Houso c h y m a s e - I

-20 -10 MWLLTLIILLLLLLGSSTKA 1 AGAGGATGCATCTTCTTACTCTTCATCTG CTG CTCCTTCT CCTGGGTTCCflGCACCAAAG 60 -1 +1 10 GEIIGGTECIPIISRPYMAYL C1 CTGGAGAGATCATTGGAGGCACGGAGTGCATACCACACTCCCGCCCCTACATGG CCTATC 120

2 0 3 0 EIVTSENYLSACSGFLIRRN 1 2 1 TGGAAATTGTCACTTCTGAGAACTACCTGTCGGCCTGCAGTCGCTTCCTGATAAGAAGAA 100 40 ★ SO FVLTAAIICAGR5ITVLLGA11 1 0 1 ACTTTGTCCTGACTC CAG CTCACTGTCCCCGAACGTCTATAACAGTCCTCCTAGGAGCCC 2 4 0

• 6 0 7 0 NKTSKEDTWQKLEVEKQPLH 2 4 1 ATAACAAAACATCTAAAGAAGACACGTGGCAGAAGCTTGAGGTGGAAAAGCAATTCCTTC 3 0 0

0 0 ★ 9 0 PKYDENLVVIIDIMLLKLKEK 3 0 1 AT C CAAAATATGATG AGAATTTG GTTGTCCACGACATCATGCTACTGAAGTTGAAGGAGA 3 6 0

100 110 AKLTLCVCTLPLSANFNFXP 3 6 1 AAGCCAACCTAAC C CTAGGTGTGGGAACCCTCCCACTCTCTGCCAACTTCAACTTTATCC 4 2 0

1 2 0 1 3 0 FCRMCRAVGWGRTNVNEPAS 4 2 1 CACCCGGGAGAATGTGCAGCGCAGTTCGCTGGGGCAGAACAAACCTGAATGAGCCAGCCT 4 0 0

1 4 0 1 5 0 DTLQEVKMRLQEPQACXHFT 4 0 1 CCG ACACA CTG CAG GAAGTAAAGATGAGACTCCAGGAGC C CCAAG C CTG CAAACACTTCA 540

1 6 0 1 7 0 B SFRIIHSQLCVGNPKXHQHVY 5 4 1 CCAGTTTTCGACACAATTCCCAGCTGTGTGTGGGCAACCCCAAGAAGATGCAAAATGTAT 6 0 0

1 0 0 ★ 1 9 0 KGDSGGPLLCAGIAQGIASY 6 0 1 ACAAGGGAGACTCTGGAGGACCTCTGCTGTGTGCTGGGATAGCCCAAGGCATTGCATCCT 6 6 0

200 210 VHRHRKPPAVFTRISHYRPW 6 6 1 ATGTACATCG GAAT CGAAAC CC CC CTG CTGTCTTTA C CAGAATCTCC CATTACAGGCCCT 7 2 0

220 INKILREW End 7 2 1 GGATCAATAAGATCTTGAG G GAG AATTAACTCTG GAG CTTTTG C CAG C CTGTGAG G AAAT 7 0 0 7 0 1 CTGGAACTGGAATAGTGCAGGTTTTGTGTGCCATGCGATCTGGCCTGTCTGTAGTTCCTG 0 4 0 0 4 1 CTGAAGCCCTGCCTGGTCCCTGAGCTTCCAGAAGGTTCTTACAAGTCACAGAATGTTCCT 9 0 0 9 0 1 AAAAGCCACCATCTTCATTAACCTCAATAAAGACCCAGATTCTCAACTGCAAAAAAAAAA 9 6 0 to the active-site residues His57, Asp102, and Ser195 in chymotrypsinogen which are essential for the proteolytic activity of all serine proteases (Fersht, 1977). Residue Asn176 is present in the substrate binding pocket suggesting an unusual substrate specificity, because this residue has not been found at this position in other serine proteases.

A potential N-linked glycosylation site is present at amino acid residue Asn59. Based on the number of basic (Arg + Lys

=23) and acidic (Asp + Glu = 20) amino acids, the mature enzyme is positively charged at pH 7.4. The consensus nucleotide seguence obtained from mouse chymase II clones consists of 1009 nucleotides and includes an exceptionally long poly (A)+ tail of 46 bases. The seguence contains 227 and 253 bases of 5' and 3* untranslated regions, respectively. Amino acid seguence analysis of the long open reading frame revealed that it represents the carboxyl terminal of a different chymase which shares 52% seguence identity with the corresponding region mouse chymase I. The nucleotide and derived amino acid sequences of chymase II are presented in Figure 21.

The protein seguence comprises 175 amino acid residues and begins at the third exon of most known serine proteases.

Most likely the 5'-end 227 base noncoding region represents an unspliced intron sequence since there is a highly conserved intron/exon junction at this location in the serine protease superfamily (Benfey et al., 1987; Figure 21. The consensus nucleotide seguence of mouse mast cell chymase II cDNA and its derived amino acid seguence. The numbers on both sides of the seguence indicate the nucleotide positions. The amino acid seguence deduced from the cDNA is shown in single-letter code above the first nucleotide of each codon, and are numbered above every tenth residue. The underlined nucleotides represents the putative intron seguence. The active site amino acid residues Asp89 and Ser182 are marked with stars. The solid square labels the residue (Ser176) in the substrate-binding pocket. The two potential N-linked glycosylation sites (Asn82 and Asn100) are marked with a dot. The amino acid residue numbering follows that for mouse chymase I (Figure 20) under the assumption that mouse chymases I and II have similar primary structure. * 81

House Chymaso II

1 AAGACATCGCAAAGCACTGAAGCATGCTCGGAAATGGGTCCTTTCCCAGTHNTCCTTAAT GO 6 1 CACATAGAATTCAGGATTGGGTTCTGAGGAAAAGGATTGGGCAAGAOAGAATTCAAAGAC 1 2 0 1 2 1 CCGAGTCGGGACGAGAGTTAAGCATGGGAGACTTAACCAGGGCAAAATAAGGCCACCTTG 1 0 0 SI M T V T 1 0 1 AG TA ACATG ATGT CATGG AG CTTGGA A G AG A A GTTGTATTTTGGAAGAATGACTGT CACT 2 4 0

6 0 7 0 LGAHNVRKRECTQQKIKVEK 2 4 1 CTTG GAG CTCATAATGTG AG AAAGAGAGAATG CACACAG CAGAAGATAAAAGTTGAAAAG 3 0 0

0 0 o ★ 9 0 YIIiPPNYNVSSKFNDIVLLK 3 0 1 TACATCTTG C CT CCAAATTACAATGTGT CTTCCAAGTTCAATGACATCGTATTA CTG AAG 3 6 0

100 110 LEKQANLTSAVDVVPLPAPS 3G 1 CTTGAAAAG CAAGCTAACTTGACTTCTGCTGTGGATGTAGTTCCCCTGCCTGCCCCCTCT 4 2 0

1 2 0 1 3 0 DFAKPGTMCWAAGWGRTGLK 4 2 1 GACTTTGCCAAGCCTGGGACGATGTGCTCGGCAGCTGGCTGGGGGCGAACTGGATTGAAA 4 0 0

14 0 1 5 0 K S XSRTLREVEIiRXMGKKAC 4 0 1 AAAAGTATCTCACGTACCCTGAGAGAGGTAGAACTGAGAATCATGGGGAAAAAGGCCTGT 54 0

1 6 0 1 7 0 KXFKHVKDSLQICVGSSTKV 5 4 1 AAAATATTTAAG CATTACAAGGATA GCCTCCAGATCTGTGTGGG CAGTTCCACAAAGGTG GOO

■ 100 ★ 190 ASVYMGDSGGPLX.CAGVAIIG 6 0 1 G CATCAGTATACATG G GAG A CTCTGGAGGACCTCTACTGTGTG CTGGGGTGGCCCATGGT 6 6 0

200 210 IVSSGRGHAKPPAIFTRISP 6 6 1 ATTGTAT CTTCTGGACG CG GAAATG CAAAG CCCC CTG CAAT CTT CAC CCGAATCTCCCCA 7 2 0

220 HVPWINRVIEGK End 7 2 1 CATGTGCCCTGGATTAA CAG AGT CATAGAG G G CAAGTAGTG AAAA G CCTGACCTGCGTGC 7 0 0

7 0 1 ATCAGAGTCTTCAAGCCAGAGCTCTTCTGATAACCCTTGGGTTCAACAAAGGATGTGTCC 0 4 0 0 4 1 ATCCTGTCCCCTGCCTGCCCCCAGCATGTCCCTAGCATGTCCCCCGCCTGCCCTCAGCCT 9 0 0 9 0 1 GCCCCCAGTCTGTCCCCAAGATGATCTGAJVAAATAAAGTCTGTGATGATGGACTGTTCCC 9 6 0 9 6 1 TGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1 0 0 9 82 Vanderslice et al., 1990). Introns at this position, 4 amino acid residues after the active site histidine, are found in all known serine proteases. In the exact same position, an intron has been found in one mouse tryptase I clone, pJLT85 (see Figure 15) , Furthermore, a putative intron/exon junction sequence (TGGAAG) is located at the 3' end of the proposed intron sequence. DNA sequence analysis shows that there is no EcoRI/Notl adopter sequence at the 5' end of the plasmid insert. This indicates that the EcoRI site used to subclone this segment from the original 1C102 cDNA insert is an internal restriction site within the intron sequence (see Figure 19). Therefore, this subcloning step eliminated the 5 1 end of this cDNA from subsequent analysis.

Northern and Southern blot analysis To study the tissue specific expression of tryptase and chymase in mouse tissues and mast cells, and to investigate the size of their primary transcripts, a Northern blot hybridization analysis was performed as shown in Figure 22. Poly(A+) RNA from ABFTL-6 mouse mast cells, tongue and intestine tissues were prepared and blotted onto a Nytran membrane. When this blot was probed with a chicken o- tubulin cDNA as a control hybridization, positive signals were present in all three samples (Figure 22, panel A).

However, hybridization of the same blot with the plT4/DraI

5' fragment of tryptase I (see Fig. 14) revealed that A B C

Figure 22. Northern blot hybridization analysis for

tryptase and chymase expression. Purified poly(A)+ RNA from

mouse tongue (6 fig, lane a), intestine (6 fig, lane b), and

ABFTL-6 mouse mast cells (2.4 fig, lane c) were fractionated

on a formaldehyde-containing 1.5% agarose gel and blotted

onto a nitrocellulose membrane. The blot was sequentially hybridized with a chicken a-tubulin (Panel A) , plT4/DraI 5 1

fragment (tryptase I; Panel B), and pAC3 insert DNA (mouse chymase II; Panel C). All probes were ^P-labeled by the random primer method and hybridized to the filter under

standard hybridization conditions. The size of molecular weight markers are indicated to the left. tryptase RNA was detectable only in the mast cells and, at much lower levels, in the tongue tissue. No hybridization was detectable from the intestine RNA (Figure 22, panel B). Using piC3 insert (chymase II) as a probe, strong hybridizations were found in both the mast cells and tongue tissue. A barely detectable level of chymase hybridization to the intestine RNA was noticed also (Figure 22, panel c).

Tongue is known as a CTMC-rich tissue, and has been used as a good source for mast cell chymase isolation (Kido et al.,

1984). However, tongue also contains many other cell types. Thus, the intensive hybridization observed in tongue poly(A)+ RNA indicates that the relative level of chymase expression in the tongue is extremely high, chymase expression is much higher than that of tryptase in tongue tissue as judged by comparing the tryptase and chymase hybridization intensities with those of ABFTL-6 poly(A)+ RNA. The average sizes for tryptase and chymase primary transcripts, estimated from the Northern blot, are 1250 and

1150 bases, respectively. This suggests that the cDNA clones isolated for mouse tryptases and chymases lack a portion of 5* region. A Southern blot hybridization analysis was performed to study mouse tryptase gene structures. The plT4/DraI 5' fragment and a mouse tryptase II synthetic oligonucleotide were used as probes of a mouse genomic DNA blot as shown in in Figure 23. These two probes are gene specific for mouse

tryptase I and II, respectively. Comparison to the dog tryptase gene structure suggests that these probes should

not contain an intron/exon junction site (Vanderslice et al., 1990). The plT4/DraI 5' fragment is 90 bp long,

corresponding to nucleotides from bases 57 to 147 of mouse

tryptase I cDNA (see figure 15). Although this fragment has 72% sequence identity to mouse tryptase II in the corresponding region, it will not cross-hybridize to tryptase II since 83% sequence identity is required for positive hybridization under the standard conditions. The mouse tryptase II oligonucleotide sequence was derived from base 19 to 45 of mouse tryptase II cDNA and shares 67% sequence identity to tryptase I in the corresponding region.

As shown in Figure 23, a single band was detected in each lane, regardless of which restriction enzyme was used.

Moreover, the two mouse tryptase gene-specific probes exhibited different hybridization patterns. These results suggest that each mouse tryptase is probably encoded by a single gene. 86

Figure 23. Southern blot analysis of tryptase genes in mouse genomic DNA. House genomic DNA (15 fig) was digested with restriction enzyme and separated on a 1.0% agarose gel. The gel was stained with EBr to display the fragment distribution pattern of the total DNA (panel A), and the DNA was blotted onto a Nytran hybridization membrane. The blot was hybridized sequentially with the [a-32P]-labeled plT4/Dral 5' fragment of tryptase I under standard hybridization conditions (panel B) and [y-32P]-5'-end- labeled mouse tryptase II specific oligonucleotide in 3 X SSPE, 1% SDS and 20% formamide at 42°C (panel C). The size (kb) and location of molecular weight markers are indicated to the right of the panels. The restriction enzymes used to digested the DNA are indicated on the top of each figure. They are: E, EcoRI; H, Hindlll, K, Kpnl; P, PstI; T, TaqI; B, BamHI; R, Rsal; X, Xbai; The sequence of neither probe contains any restriction site for those restriction enzymes used to digest the mouse genomic DNA. CHAPTER 4 Discussion

Growth of ABFTL-6 Mouse Mast Cells in FCM

The ABFTL-6 mouse mast cell line used in these studies was derived from fetal mouse liver in the presence of IL-3 and transformed with Abelson murine leukemia virus (Pierce

et al., 1985). Although the transformed cells no longer require IL-3 for growth, they retain other characteristics of mast cells derived from hemopoietic tissues. They are

small in size, contain few cytoplasmic granules and a low level of histamine (Pierce et al., 1985). They are considered representative of the MMC in vivo (Katz et al.,

1985; Katz and Austen, 1987). It has been reported that the viability and the CTMC phenotype of purified rat peritoneal mast cells and human lung mast cells could be maintained for prolonged periods in vitro if the mast cells were co-cultured solely with mouse

3T3 fibroblast cells (Levi-Schaffer et al., 1985; Levi-

Schaffer et al., 1987a). Co-culture with 3T3 fibroblasts also induced in vitro-differentiated. IL-3-dependent mouse mast cells to change phenotype from mucosal-like to connective tissue-like mast cells (Dayton et al., 1988;

Levi-Schaffer et al., 1986; 1987b). More recently, Jarboe et al. (1989) have identified mast cell-committed progenitor cells from the mesenteric lymph node of mice infected with

87 88 Nippostroncrvlus brasillensis. These progenitors are able to proliferate and differentiate into CTMC-like cells when cultured on a fibroblast monolayer or in conditioned media, and into MMC-like cells when cultured in the presence of ID-3, The results of this study have shown that cell-free,

3T3 FCH can induce phenotypic change of the ABFTL-6 mast cells. No direct contact between fibroblasts and mast cells was necessary. The results have also demonstrated that, like mast cells from other species, these mouse mast cells contain a tryptase which exhibits an inhibition profile similar to that of dog and human tryptases (smith et al., 1984? Caughey et al., 1987; Butterfield et al., 1990).

Also, the mouse tryptase is immunoreactive to human tryptase antibody suggesting a similarity between their primary structures.

ABFTL-6 mouse mast cells undergo phenotypic changes upon culturing in media supplemented with FCM. The induced mast cells increased in size, had larger and more cytoplasmic granules which stained intensely with toluidine blue, and increased the total cellular protein about four­ fold. FCM induced an increase in tryptase enzymatic activity in ABFTL-6 cells about 13-fold. However, immuno­ reactive tryptase protein increased by 54-fold. The induced cells contained 125 fig tryptase per 106 cells based on immunoassay using antibodies to human tryptase, which is much higher than the 35 /ig/106 cells found in human mast cells from adult foreskin (Schwartz et al., 1987). Total DFP-binding proteins were also increased to much higher levels (Figure 11). Most interestingly, the ratio of tryptase to the total cellular protein has increased dramatically, from 2.7% in uninduced cells to 38% in induced cells. This tryptase level in the induced cells is considerably higher than previously estimated for human lung mast cells (23%) and for chymase, the predominant neutral protease in rat mast cells (25%) (Schwartz et al., 1981a).

At present, the data does not allow a determination of whether these changes reflect the maturation process or the further differentiation of ABFTL-6 cells from MMC-like to CTMC-like. However, the latter possibility is more likely since the importance of fibroblasts or a connective tissue micro-environment in the development and maintenance of CTMC is well established (Galli, 1990).

Several mast cell growth factors have been identified in recent years. Survival and growth of in vitro- differentiated hemopoietic tissue "MMC-like" mast cells strictly depends on IL-3. IL-4 acts in synergy with IL-3 in the proliferation of "MMC-like" mast cells and also appears to be essential for "CTMC-like" mast cell growth in vitro

(Hamaguchi et al., 1987; Ihle et al., 1983; Nakahata et al., 1986). The 3T3 fibroblasts do not produce detectable IL-3 or IL-4 (Fujita et al., 1988). The nature of the fibroblast factors involved in the induction of mast cell phenotypic changes remains to be determined. However, a soluble factor

in FCM responsible for mast cell-1 committed progenitor cell differentiation and proliferation has been partially characterized (Jarboe et al., 1989). It appears to be a novel cytokine secreted by fibroblasts since its mast cell

proliferation activity could not be mimicked by a wide variety of other growth factors, whether this is the same

factor which promoted the observed differentiation of ABFTL-

6 mouse mast cells is currently unknown. Recently, a new

hematopoietic growth factor with a broad range of biological activity has been defined (Witte, 1990). This growth factor is known to influence hematopoietic stem cell development, including those for mast cells.

Sodium_Butvrate_lnduction of Tryptase. Expression in ABFTL-6 Mouse Mast Cells

Sodium butyrate has been known to increase the

development of cytoplasmic granules and the storage of

granule-associated mediators in mouse mastocytoma cells. In the presence of butyrate, histamine content increased

concomitant with cytoplasmic granule maturation and exceeded that of untreated mast cells by 140-fold (Mori et al., 1980). This effect of butyrate has been confirmed in mouse BMMC (DuBuske et al., 1984). In addition, butyrate-treated mast cells increased the cellular levels of [3H] DFP-binding protein twofold and cytoplasmic granule-associated tryptic 91 activity fourfold. However, variation of the effectiveness of butyrate induction has been noticed among different clones of mast cells (Mori et al., 1980). Sodium butyrate failed to induce synthesis of heparin in vitro-cultured MMC- like mast cells (DuBuske et al., 1984). This is a major difference between butyrate and FCM induction.

Sodium butyrate exhibited a tryptase induction effect on ABFTL-6 mouse mast cells similar to the FCM. Besides the morphologic changes, the butyrate-induced cells increased total cellular protein content three-fold and tryptase activity six-fold. Surprisingly, tryptase protein content measured by immunoassay using antibodies to human tryptase increased from 2.3 /ig/106 cells to 75 fig/106 cells, a 32- fold increase (refer to Table 2 in Results). The ratio of tryptase to the total cellular protein increased to 28% from

2.7%. This result is in agreement with those previously reported concerning the effect of butyrate on cultured mast cell granules-associated serine proteases. However, it also indicated that tryptase production by ABFTL-6 mast cells was more sensitive to butyrate induction than that reported by the BMMC (DuBuske et al., 1984).

While the precise mechanism by which butyrate induced tryptase synthesis and other phenotype changes is obscure, it is known that butyrate causes hyperacetylation of histone protein by inhibiting the deacetylase enzyme (Riggs et al.,

1977; Candido et al., 1978). This modification of histones 92 is coupled with an increased transcription (Allfrey et al., 1964). Butyrate can increase methylation of histone, and increase the activity of cell membrane-bound enzymes including alkaline phosphatase and adenylate cyclase (Simmons et al., 1975; Henneberry and Fishman, 1976).

Endogenous Tryptase inhibitor in Hast Cells

Since tryptase is stored and released in its fully active form, unlike pancreatic proteases, it is a potential hazard to its host cells. Thus, it is reasonable to assume that tryptase activity may be regulated by certain protease

inhibitors which co-exist with tryptase within mast cell granules. An endogenous rat serine protease inhibitor, named trypstatin, has been well characterized and its amino acid sequence determined (Kido et al., 1985 and 1988). Trypstatin associates with tryptase in granules of rat peritoneal mast cells and forms a complex in a molar ratio of 1:1 with each subunit of tryptase. Trypstatin strongly inhibits tryptase and blood coagulation factor Xa. It also inhibits porcine pancreatic trypsin and rat chymase (Kido et al., 1988). Although one would expect that the expression of trypstatin may be a universal feature of mast cells, this type of inhibitor has not been identified in mast cells of any other species.

Whether there is a trypstatin-like tryptase inhibitor present in mouse mast cells and how it would be affected by tryptase-inducing agents are entirely unknown. However, the results of our induction experiments revealed that the increases in tryptic activity and tryptase antigen levels were not directly proportional. For example^ while tryptase antigen increased about 54-fold in FCM induced cells, the tryptic activity only increased 13-fold. These results invite speculation that there may be a tryptase inhibitor in ABFTL-6 mouse mast cells, and that this inhibitor may be induced in parallel with the tryptase. An alternative explanation may be that FCM or butyrate might induce the synthesis of proteins that share some antigenicity with tryptase, but lack proteolytic activity, or have different substrate specificities.

Trvotase Processing Both mouse tryptases clearly have leader sequences which must be removed prior to the generation of active enzymes with the classic N-terminal sequence Ile-Val-Gly-Gly found in many serine proteases (Figure 24). As noted by Vanderslice et al. (1989), the tryptases are the first family of proteins to have Gly in the -1 position. While the active enzyme could be generated via signal peptidase cleavage after Gly'1, this is doubtful because there are no reported instances of signal peptidase cleavage with Arg or

Lys in the -3 position (von Heijne, 1986). Another possible signal peptidase cleavage site is Ala'6 which is conserved in the four known tryptases and is Leu in dog mast cell protease. However, this would also result in an Arg residue 94

— leader sequence— -3 0 -20 -10 -5 -1 +1 i i ! i ! i M. Tryptase I LKRLLLLWAL SLLAS LVY S APRPANQ RVG IVGG»«« M. Tryptase II LTLPLLSSLVHAAPGPAMT REG IVGG••• Dog Tryptase MPSPLVLALALLGSLVPVS PAPGQALQ RVG IVGG••• Human Tryptase MLSLLLLALPVLASRAYAAPAPVQALQ QAG IVGG••• Dog MC Protease MAPLIRMLDLLGTLSP KVG IVGG«««

-10 -5 -1 -signal— ■t-prot-active-

Figure 24. Alignment of leader sequences of the mouse tryptases and other related proteases. The proposed sites for cleavage of the signal and activation peptides are shown by arrows. Numbering across the top refers to the leader peptide sequences, whereas numbering across the bottom refers to the proposed signal peptide sequences. (Arg'9) in the -3 position relative to Ala"6 of mouse tryptase I. This diminishes the likelihood of Ala'6 being the processing site. A more likely site of cleavage is the -4 position which contains Gin in three of the sequences, with Thr'* in mouse tryptase II and Pro'* in dog mast cell protease. Gin, Thr, and Pro residues have served as processing sites in eukaryotes and this choice results in Ala*6 being in the -3 position of all four tryptases. Ala is the most favored residue in this position

(von Heijne, 1986). Dog mast cell protease has a Leu'6 in the -3 position relative to the proposed signal peptidase cleavage site, which is not as highly favored as Ala in the -3 position. However, this places Ser'5 in the -2 position and Ser is the most favored residue in the -2 position (von Heijne, 1986). Signal peptidase processing at the -4 positions in the leader peptide sequences as shown in

Figure 22 would leave zymogens with propeptides of three residues consisting of Arg-X-Gly, Lys-X-Gly in all cases, except for Gln-X-Gly in human tryptase. Although human tryptase would not have a basic residue for its zymogen form amino terminus, a polar Gin residue with a charged alpha amino group would seem to be a plausible substitution at this position. A propeptide consisting of only two amino acids has been found in the leader sequences of the human neutrophil proteases cathepsin G and elastase (Salvesen et al., 1987; 1990). These are granule-associated, active 96 enzymes also. Of course, it is possible that the processing and activation of the tryptase family involves unique cleavages and additional studies are needed to clearly understand these events.

Deduced Trvotase Structures

Analysis of the deduced amino acid sequence of mouse tryptase 1 revealed that it encoded the entire catalytic portion of the protease. The active enzyme consists of 245 amino acids with a calculated molecular weight of 27,395 Da.

A 29 amino acid-long partial leader peptide precedes the active enzyme. Tryptase II also contains a catalytic region of 245 amino acids with a calculated molecular weight of 27,410 Da, and a partial signal peptide of 22 amino acids.

The lengths of the catalytic region of the mouse tryptases are equivalent to that of dog tryptase (Vanderslice et al.,

1989), but they are one amino acid residue longer than human tryptase (Miller et al., 1989). The 280 nm extinction coefficients for 1% protein solutions calculated by the method of Gill and von Hippel (1989) are 25.1 and 24.2 for mouse tryptase I and mouse tryptase II, respectively. Human tryptase was found to have a value of 28.1 based on amino acid analysis data (Smith et al., 1984).

There is little doubt that these two groups of cDNA clones code for two distinct mouse mast cell tryptases.

They share extensive sequence identity with the dog and human tryptases (Figure 25) and their leader peptides end Figure 25. comparisons of the amino acid sequences of mouse tryptase active enzymes with the amino acid sequences of related proteases. The residue numbering follows the standard chymotrypsinogen notation. A single small dot represents an amino acid residue at that position identical to that of mouse tryptase I, and dashes indicate gaps introduced in order to achieve maximum homology. Stars indicate the active site residues His57, Asp102, and Ser195 which compose the catalytic triad. The putative N-linked glycosylation sites are underlined, and the Asn linkage residue is marked with a dot. The number of residues in each enzyme is listed at the end of its sequence. Homology percentages relative to each mouse tryptase are given in parentheses. The sources of the sequence data are as follows: dog tryptase and dog mast cell protease (DHP) (Vanderslice et al., 1989), human tryptase (Miller et al., 1989), bovine trypsin (Hartley, 1970) and bovine chymotrypsin (Blow et al., 1969). 97

M. T r y p t. I XVGGHEASES KWPWQVSLRF I— YWIII FCGGSLXIIPQ WVLTAAHCVG PHIKSPQLFR K. T r y p t. II . . . .Q . .HGH HPT----- . .K. . DVAD.MKV. Dog T r y p t. . . . .R..PC...... * • *L * gq—• .lit I...... • * • * I 4 4 4 • 4 .HWC.EEI. Human T r y p t . * * . Q. . PR. • 4*44 • *.V n on — • . m. * • • . * . • . » • * • . . . . . L. . DV.DLATL. DHP ____ CKVPAR RY... • ■41 IIGMGSGQ.Q. LEGLEAATL. TrypoJLn . . . . YTCGAH TV .Y. . • 1~t T' —— • “5G + — • • 4 4 4 . .M S. ..VS . . . . YK SGIQ------C hym otryp. . .H.E..VPG s • * . ..QD .TCP------. • • * * . . HEM . .V . TTSDVWAGE r 1 f I I i i 1 i I I t 20 30 40 SO 60 70

M. T r y p t. i VQLREQYLYY GDQLLSL HRIWHPHYY TAECG— AD VALLELEVPV HVSTHIHPIS H. Trypt. II ....K.. 11.H.MTV S Q .I T ..D F . IVQD,---- .. 1...K.TH.. 7T7DYV..VP Dog T r y p t...... II*. * Q.H..PV . .P .I I .---- .. I ...... D...... A.VQ.VT Human T r y p t. .H-SGTIJ. . . Q....PV S..M...QP. IIQ T .---- .. I ...... E. . .I.SRV.TVM DMP ..VGQLR..D U...CHV TELIR..NFH MSHY.WDT.. 1 . . .K..A.L TL.EDVHLV. T r y p s in .R.G.DHIHV VECHE.FI.A SKSX...S.H SHTL----- HH. IK.IK.K5AA SLHSRVAS,, C hym otryp. FDQGSSSEKI — QKLKIAKV FKHSK . K SLTI----- HH. IT..K.STAA SF.QTVSAVC I I ! I 8 0 90 1 00 110 120

M. T r y p t. I LPPASETFPP GTSCWVTCWG DIDHDEPLPF PYPLKQVKVP IVEHSLCDRK YHTGLYTGDD M. T r y p t. I I ...... S ■ N* » # CVW * * + *F« • *E*Q« t >X«ill* ■ tL» • *K« * X* • Dog T r y p t. .... 143* . *T tfP*4**t*« # V] ISGT■•* * tF itiiitt* t * »< »H* »VQ * f L* *S«** G Human T r y p t. • ••••*•••• * MP* • • « i * i «P»t«*44»» *M« «!1I« fA* •»Ii* A« »•« i DMP . .SP.LIV.. • ML...... DIET ILQE.E* » ♦♦G.HE.H— C»YQTXLEQ+ T r y p s in ..T-.CA-SA . .Q*LXS.,. NTKSSGTSY. D V -^ C L .A . .L SD .S.K SA .P -.Q I.5 N M C hym otryp. * * S ♦*DD.AA ♦ .T.VT**.. LTHYTNANT. DR-.Q .ASL* L L S .T N .K -. .WGTKI— K* I I I I I 130 1 4 0 ISO ICO 170

■ ★ M. T r y p t. I FPIVHDGMLC AG— HTRRDS CQGD5GGPLV CKVKGTWLQA GWSWG-ECC AQPHKPG2YT M. T r y p t. I I VII..R.D. * . . *■■ . EGlt. . * • . • 44 ISO • t 4 1 » I • . *...R.«... Dog T r y p t. VR..RED.. . .. —.SKS.. 1 4 4 I 4 4 * ■ * + R 4 It • V ■ * 4 * ...... R.*... Human T r y p t. VR.IR.D. . . ..""»5Q... .K____ * 4 4 * • tH* ■ 4 4 r • ... . »D“ ...... R ..... DHP DEVIKQD... ..--SEGH.. * • * .UW.C..X.V • * * . . . -Y.. GY-.L..V.A Trypsin ♦ —“ — • ..YLEGGK.. .5— *K—*4- .1. .* *" S . . t.K .ii.V.i ch y m o try p . AM.------. ..—ASGVS. •M.... 4 4 4 • . KN.A.TLV . 1 . ...SET. STST-..V.A 1 1| I 1 I 1 1 8 0 190 2 0 0 210 2 2 0

K. Trypt. I M. T r y p t . I I M. T r y p t. I RVTYYLDWIH RYVPEIIS 245 (7 0 * ) M. T r y p t. I I H.. .KDF 245 ( 7 0 t) Dog T r y p t. ..A...... Q...KEP 24S (7 4 1 ) (7 0 * ) Human T r y p t. ...S...... 11. . .KKP 244 (7 2 * ) (7 3 * ) DMP K.C.VS.. .Q HI.LSPGP 250 (5 2 * ) (5 3 * ) T r y p s in M----- .VS..K QTIASH 223 (4 1 * ) (4 1 * ) C hym otryp. . . .ALVM.VQ QTLAAH 230 (4 0 * ) (4 1 * ) I I 2 3 0 24 0 98 with a Gly residue prior to their Ile-Val-Gly-Gly sequences, as previously noted for mast cell tryptases (Vanderslice et

al., 1989). A comparison of the derived amino acid sequences of the active enzyme regions of the mouse tryptases to dog and human tryptases, dog mast cell protease, trypsin, and chymotrypsin is shown in Figure 25. Mouse tryptase I is most identical to dog tryptase at 74%, while mouse tryptase II is most identical to human tryptase at 73%. Mouse tryptases I and II are 41% identical to bovine trypsin, but if equivalent residues are considered the homology increases to 64 and 61%, respectively. The mouse tryptases are only distantly related to the proteases present in mouse cytotoxic T lymphocytes. For instance, mouse cytotoxic T cell protease I (Lobe et al., 1988) has only 36% and 35% sequence similarity to mouse tryptase I and II, respectively.

Both mouse mast cell tryptases have a potential N- linked glycosylation site at residue Asn113, the same location as in dog and human tryptases. Tryptase II, however, has an additional putative glycosylation site at Asn36. Human skin tryptases also shows differences in glycosylation. Human skin tryptases I and II contain two consensus N-glycosylation sites, whereas skin tryptase III only has one such site (Vanderslice et al., 1990). Assuming that the tertiary structures of mouse tryptase II approximate the general topography o£ trypsin and

chymotrypsin, both of these glycosylation sites would be positioned near each other at the top of the molecule when viewed with the substrate binding pocket facing and extending down to the right (Dickerson and Geis, 1969). Such a finding provides additional support for the idea that tryptase heterogeneity, as seen on SDS-PAGE, is due in part to the extent of glycosylation (Cromlish et al., 1987). The catalytic regions of these two tryptases both begin with Ile-Val-Gly-Gly and exhibit all of the features characteristic of serine proteases. The active site "charge-relay" residues Hisw , Asp91 and Ser,M, corresponding to His57, Asp102 and Ser195 in chymotrypsin, are conserved.

The residues surrounding the active sites are highly conserved in serine proteases, which is also true of the mouse tryptases. Eight cysteine residues are found in both tryptases I and IX, all of which are present in positions identical to eight of the ten cysteine residues of bovine trypsin.

Presumably, these form disulfide linkages in the same arrangement as in trypsin. The absence of two disulfide linkages in these and other tryptases may result in decreased stability relative to trypsin. Interestingly, the mouse tryptases share the same eight cysteine residues with human tryptase; whereas, dog tryptase has nine cysteine 100 residues. Dog mast cell protease differs considerably from the tryptases with twelve cysteine residues.

Trvntase Substrate Specificity Predictions

The mouse tryptases are predicted to have trypsin-like specificities for Lys or Arg residues in the P., position of substrates, since an Asp is present in their substrate binding pocket (residues 188}, corresponding to the substrate binding pocket Asp189 in trypsin (Figure 26). The sidewalls of both mouse tryptase substrate binding pockets are lined with residues of Asp1B9-Ser190-Cys191-Gln192 and Ser2K-

Trpzis-Glyz16 (chymotrypsinogen numbering system), an identical situation to that of dog tryptase and trypsin. In contrast, human tryptase has a Lys residue in position 192 and an Asp instead of a Gly in position 216. Thus, the substrate specificities of the mouse tryptases may be in closer agreement with those of dog tryptase (or bovine trypsin) and may differ from the rather unusual specificities of the human skin and lung tryptases (Tanaka et al., 1983). Interestingly, residues in position 99 based on the chymotrypsin numbering system are Gly for tryptase I and Asp for tryptase II. This position influences substrate specificity with regard to the amino acid in position P2.

The differences at position 99 in the mouse tryptases suggest substrate specificity differences with respect to substrate specificity. An interesting feature of mouse tryptase I is that the lie103 in the highly conserved region 101 around active site Asp102 is substituted by an equivalent

amino acid Val103 (tryptase residue 92) in mouse tryptase I. While this substitution may not affect the enzyme's tertiary structure or function, Val in this position has never been observed in other members of the serine protease family.

Charged Residues of Tryptase

Mouse tryptase I is predicted to have a net charge of -5 at neutral pH, since it contains 23 acidic residues (Asp + Glu) but only 18 basic residues (Arg + Lys). Surprisingly, tryptase II is much more negatively charged than tryptase I, with a net negative charge of -10 at neutral pH (Asp + Glu *= 25, Arg + Lys 15). The estimated isoelectric points for mouse tryptases I and II are 6.2 and

5.6, respectively. The charges on human and dog tryptases are -4 and -3, respectively, which are in closer agreement with mouse tryptase I than with mouse tryptase II. Thus, the tryptases are acidic proteins in contrast to the much more basic trypsin and chymotrypsin molecules with net charges of +3 and isoelectric points above 9. These charge differences probably account for the loss of activity noted with human tryptase at low pH (Smith et al., 1984); whereas, trypsin and chymotrypsin are quite stable at low pH. Human tryptase activity is stabilized by heparin glycosaminoglycan (Smith and Johnson, 1984) and in the absence of heparin, tryptase subunits dissociate into inactive monomers (Schwartz and Bradford, 1986). Since the Figure 26. Analysis of the distribution of charged residues that are conserved in tryptases. Two charged clusters are predicted. Near the top face of the molecule is a closely-associated, positively-charged cluster consisting of residues Lys26, Arg34, and Arg70 (shown in red) . Another cluster comprised of negatively charged residues Glu164, Asp169, and Asp177, forms a large patch along the lower face of the enzyme (shown in yellow). The active site residues His57, Asp102, and Ser159 are shown in green. 102

,115.

IOC 113 245

113

230.

,135. 213’)./ ju t) /fch

7 2 0) '• ■jm: ,215); 213 22c )> /i 100. 227. ,213.

,182. 223

171, 171 170 .ICC, interactions necessary for the formation of a tetramer may rely on the distribution of charge on the surface of the molecules, charged residues conserved among tryptases have been examined based on the tertiary structure of i chymotrypsin (Dickerson and Geis, 1969). Twelve charged residues (five positive and seven negative) are found to be conserved within the four tryptases shown in Figure 25, but are not found in the corresponding position of bovine trypsin. Assuming a folding pattern similar to that of chymotrypsin two charged clusters are predicted (Dickerson and Geis, 1969) as shown in Figure 27. One near the top face of the molecule is a closely-associated, positively- charged cluster consisting of residues 26, 34, and 70. The other, comprised of negatively charged residues 164, 169, and 177, forms a large patch along the lower side of the enzyme. Most of these charged residues seem to be displayed on the surface of the molecules. Of course, such charge distributions will require x-ray diffraction analysis for conformation, but these charges may be involved in the interactions among tryptase subunits or between tryptase and heparin. Interestingly, charge-switching of residues between mouse tryptase I and mouse tryptase II is observed in four positions. Glu residues in positions 75, 107, and 244, in mouse tryptase I are substituted by oppositely charged Lys residues in mouse tryptase II, and Lys residue 204 of mouse 104

tryptase I is substituted by a negatively charged Glu in

mouse tryptase II. The charge switching also occurs between

tryptases and other serine proteases such as trypsin. For example, Lys60 of trypsin, which is believed to form a salt bridge with Asp1 of soybean trypsin inhibitor in the trypsin-inhibitor complex (Sweet et al., 1974), is substituted with Gly in dog tryptase and mouse tryptases.

This may be one of the reasons why tryptases are resistant

to inhibition by soybean trypsin inhibitor (Vanderslice et

al., 1989). An unusual charge switching between tryptases and

pancreatic serine proteases such as trypsin and chymotrypsin occurs at position 169. Lys residue is present at position

169 in trypsin and chymotrypsin, while an oppositely charged Asp is found in the identical location in all known

tryptases. This significant charge difference may

contribute to the unique biochemical properties of tryptase,

such as resistance to inhibition by a-l-FI and selectivity for natural substrates. Further investigation is needed to

understand the significance of this charge-switching.

Characterization of the Predicted Protein structures of Mouse Mast Cell Chvmases

All .of the active enzymes of the chymase class start with residues Ile-Ile-Gly-Gly. Thus, the 21 amino acids

prior to this sequence in mouse mast cell chymase I is

expected to be a complete leader peptide. This is supported 105

twin 2 r • i...... i I < Mlm. Bi■ *1 ■■'I ,1 t LL.It ■M I at MB mB ■1 ■□ I ii^m ill HI 1

fI- *------i * Jr • £4 12B .101 241 3*

Figure 27. Hydrophobicity analysis of mouse mast cell chymase I. Hydrophobicity analysis was performed by the

Hopp and Woods method (1981), using the Hitachi PROSIS protein analysis program. Each amino acid is assigned a numerical hydrophobicity value. The more hydrophobic an amino acid is, the more negative its value. The x-axis indicates the position of amino acid in the protein sequence. The y-axis represents the hydrophobicity index ranging from 2 to -2. The full length of mouse chymase I is 247 amino acid residues, including a 21 amino acid leader peptide. 106

leader sequence---- -21 -3 -1 +1 ! | | j M. Chymase I MHLLTLHLLLLLLGSSTKA GE IIGG*« Dog Chymase MHCLPLTLLLLLLCSRAEA EE IIGG*« MMCP XI MQALLFLMALLLPSGAGA EE IIGG»* RMCP II MQALLFLMALLLPSGAGA EE IIGG»« H. Cat. G MQPLLLLLAFLLPTGAEA GE IIGG«« H. Elastase MTLGRRLACLPLACVLPALLLGGTALA SE IVGG»« M. Granzyme C MPPVLILLTLLLPLRAGA EE IIGG»« M. Granzyme G MPPILILLTLLLPLRAGA EE IIGG»* Mouse CCP I MKILLLLLTLSLASRTKA GE IIGG** Mouse CCP II MPPVLILLTLLLPLRAGA EE IIGG*» I i -18 -1 •signal------t-pro-t-active-

Figure 28. Comparison of the mouse chymase I leader sequence with those of other known chymases and granule- associated serine proteases. Numbering across the top refers to the leader peptide sequences, and numbering across the bottom indicates the signal/activation sequence. The source of the sequence data is as follows: dog chymase

(Caughey et al., 1990)? MMCP II (Serafin et al., 1990); RMCP

II (Benfey et al., 1987); human cathepsin G (Salvesen et al., 1987); human elastase (Takahashi et al., 1988); mouse granzyme c (Jenne and Tschopp, 1988); mouse granzyme G

(Jenne et al., 1989); mouse CCP-I and CCP-II (Lobe et al.,

1988). The abbreviations used are: M, mouse? H, human; cat. G, cathepsin G; CCP, cytotoxic cell protease. 107 by the amino acid hydrophobicity analysis. As shown in Figure 27, a large hydrophobic domain is present within that leader sequence. The length of this leader peptide is identical to that of dog chymase, but one amino acid longer than that of MMCP II, RMCP II, and other granule-associated serine proteases listed in Figure 28. As shown in this figure, the leader sequence of mouse chymase I contains many features common to those enzymes, and has 57% sequence identity to that of dog chymase.

Based on the "-3, -I1' rule of von Heijne (1986), it is predicted that the signal peptidase cleavage site for mouse chymase I signal peptide would be between Ala*3~Gly*2, since

Ala is the most favored residue in -1 position for peptidase cleavage. After removal of the signal peptide, mouse chymase I exists as a zymogen form containing a "pro" peptide of two amino acids (Gly-Glu). This predicted preprosequence is very similar for all the known chymases, human cathepsin G, elastase and mouse lymphocyte granule serine proteases (granzymes) listed in Figure 26. The highly conserved residues Glu‘z and Ala*5 within the leader sequence were replaced with Gly*z and Thr*5 in mouse chymase

I, respectively. However, Gly in -2 position is also found in human cathepsin G and mouse cytotoxic cell protease (CCP) I. Threonine, a preferred residue in -5 position for cleavage, is located at the identical position in mouse CCP II. Recently, the existence of a dipeptide prosequence in 108 human cathepsin G and elastase has been demonstrated by biosynthetic radio-labeling and radio-sequencing techniques (Salvesen and Enghild, 1990). The "pro" peptide is possibly removed during the packaging of the enzyme. The similarity between the potential preprosequences among these enzymes indicates that they may share a common activation mechanism. The mature active enzyme of mouse chymase I consists of

226 amino acids with a calculated Mr. of 25.4 kdr identical to that of dog chymase and MMCP-1 but two amino acids longer than MMCP-2. Sequence analysis reveals that mouse chymase I contains many characteristic features of a chymotrypsin-like enzyme, including the Ile-Ile-Gly-Gly amino terminal sequence and the residues comprising the catalytic "charge- relay" system (His, Asp and Ser) with their highly conserved adjacent sequences. An interesting feature of mouse chymase I is that an

Asn residue occurs in position 189 of the substrate binding pocket, rather than a Ser which is typically present in the substrate binding site of chymotryptic enzymes with substrate preferences for aromatic amino acids in the Pt position. In the corresponding position of MMCP-1 and

RMCP—II Thr and Ala were found, respectively, Asn at position 189 has not been previously identified in another serine protease. Asn molecule is larger than Ser, and contains a terminal amide group rather than a hydroxyl group. How such substitution affects substrate preferences 109

of the chymases enzyme is unknown. However, it has been

shown that mutant trypsin with Ser189 or Lys189 has an altered

substrate specificity and catalytic efficiency (Graf et al.,

1988). Moreover, the size of the substrate binding pocket of

mouse chymase I differs from those found in pancreatic

chymotrypsin and trypsin, and most of the mast cell granule- associated proteases. The size of the pocket is related to

residues 216 and 226 which form the neck of the binding

pocket. Gly residues are present at these positions in both

chymotrypsin and trypsin. This small amino acid permits the pockets to accommodate large aromatic amino acids in

chymotrypsin, or Arg and Lys residues in trypsin. This feature is conserved in both mouse tryptase I and II (see

Figure 26). However, Gly216 is replaced by a much bulkier residue Val in mouse chymase I. A similar substitution at

this position is also found in MMCP II. Gly226 is replaced

by a sightly larger residue Ala in mouse chymase I, which is

consistent with other mast cell chymases (see Figure 29).

These changes in mouse chymase I presumably will make the substrate binding pocket much smaller. The combined effects of the alterations of ‘the substrate binding pocket of mouse chymase I require biochemical characterization of the purified enzyme. However, very low chymotryptic activity was found in the lysate of these cells as assayed with common synthetic chymotrypsin substrates, suggesting that 110 the typical chymotryptic substrate-binding specificity is altered. A better substrate and purification of the enzyme may be required for testing and measuring whether mouse chymase I truly has an unusual substrate specificity. Mouse chymase I is a basic protein with a net charge of +13 at neutral pH, which is comparable to dog chymase (+16) and

RMCP I (+18). In contrast, the MMC-derived RMCP II and

MMCP-1 have net charges of +3 and +4 at physiological pH.

The derived partial amino acid sequence of mouse chymase II consists of 175 amino acids with a novel COOH- terminal. It starts at the position corresponding to residue 50 of mouse chymase I and contains active site residues Asp and Ser. A Ser residue occurs in the substrate-binding pocket in agreement with a chymotryptic specificity. One of the major differences between the two mouse chymase primary structures is that chymase I contains only one potential glycosylation site (Asn59), whereas chymase II has at least two such sequences (Asn82 and Asn100) .

A sequence comparison between mouse chymases I and II with that of other chymases and bovine chymotrypsin is shown in Figure 27. Surprisingly, mouse chymases I and II only share 52% sequence identity, with 54% and 57% sequence homology to MMCP-I, respectively. This contrasts with the two tryptases cloned from these cells which shared 70% sequence identity. Mouse chymase I has its highest sequence similarity (72%) to dog chymase, suggesting that they may be Figure 29. Primary structure alignments between the active enzyme portions of the mouse chymases, other known chymases, and bovine chymotrypsin. The residue numbering follows the standard chymotrypsinogen notation. A single small dot represents an identical amino acid residue at that position to that of mouse chymase I; gaps are introduced as dashes in order to achieve the maximal homology, stars indicate the active site residues His57, Asp102, and Ser195 which compose the catalytic triad. The putative N-linked glycosylation sites are underlined and its Asn is marked with a dot. The'**' number of residues in each enzyme are listed at the COOH end of its sequence. Identity percentages relative to each mouse tryptase are given in parentheses. The sources of the sequence data are as follow: mouse chymases I and II (this study), MMCP I (Le Trong et al., 1989), MMCP II (Serafin et al., 1990), RMCP I (Le Trong et al., 1987), RMCP II (Benfey et al., 1987), dog chymase (caughey et al., 1990), and bovine chymotrypsin (Blow et al., 1969). Ill

M. C h y ra .-l MIILLTLIILLLLLLG5STKAGE IIGGTECIPH SRPYKAYLEI VTSEHYLSAC SGFLIRRItFV H. Chym .- 2 MMCP-l ....V.AR.* ..... *11*K. I.DRGSEDR. G....APQ.. MHCP-2 MQALLFLMALLLPSGAGAEE . . . .V.AK...... ICE T.KHGSKER. G....APQ.. RMCP-I ....V.SR...... II... T.ERG.KAT, G.. .VT.Q.. RMCP-II MQALLFU1ALLLPSGAGAE E . , . .V.S, . . II. D. . . EKGLRVI• G____ S.Q.. Dog Chym. MiiCLPLTMLLLLLCSRAEAEE SK...... II... Xj * U t »K* AS • Chymotrypsin CGVPAIQPVLSGLSR IVHGEEAVPG SWPWQVSL— -QDKTGFHFC GGSLTHEKWV I I1 I I 20 30 40 50 •k • ★ M. C h y ra .-l LTAA1ICAGRS ITVLL-GAlIti KTSKEDTWQK LEVEKQFLHP KYDEHLW1ID IMLLKLKEKA M. C hyra.-2 + *7+**+ • + « VRKR• C• Q• » IK...VI.P. H.HVSSKFH. . . .EKQ. MMCP-1 ...... K* •£ * * —* »iD V5K5 * S * Q * It IK___II. K H.HVSFHLY. . .. E.. . MMCP-2 M...... R.SE + INKW.P.Q*! IKT..T.V.. .FQYLSGFN. . . . QK » . RMCP—I H...... K# * E T*«T.-.V.D VSKT.S^Q*. I ...... IV.. H.ttFYSHL. . + * . QK. * RMCP-II • » • • • «Kt *E *•*!•**• «*D VHXR* StQt * IK....II.E S.HSVPNL.. . . .EK.V Dog chym . • f**t»«A*P 1 *• IQK11 *•* 1« ...I...P.. . . .DI.TLR. . Chymotrypsin VTAAHCGVTT SDWVAGEFD QGSSSEKIQK LKIAKVFKNS KYHSLTIHHD ITLLKLSTAA l l 1 I I I GO 70 SO 90 100 110

M. C h y m .-l KLTLGVGTLP LSANFHFIPP GRMCRAVGWG RTH-VHEPAS DTLQEVKMRL QEPQACKIIFT M. Chym .- 2 M. .S A .D W . .P.PSD.AK. .7 ..H.A..* ..G-LKKSI. R..R..EL.I MGKK...I.K MMCP-1 E..PT.DVI. .PGPSD..D. .K..WTA... K.G-EK..T. E ..R. .EL.I MDKE.. .MYK MMCP-2 E.H5D.DVIS . PSSSD. . K. .K..WTA... K.G-K.H.L. V. .R..EL.I MDQE...DKH RMCP-I .V.PA.DVI. .PQPSD.LK. * K.. • . A* . . Q.G-.TK.T. H..R...Q.I MDKE.. .MYF RMCP-II E. .PA.IJW. . PSPSD. .It. •A..W.A... K.G-.RD.T. Y..R..EL.I MDEK. .VDYIl Dog Chym. M *«.A...... PQ...V...... *VA... KRQ-. . GSG...... L. . MD------R.YM Chymotrypsin SF5QTVSAVC LPSASDDFAA GTTCVTTGWG UTRYTHAHTP DRLQQASLPL LSHTHCKKYW I I 1 1 I 1 I 1 120 1 3 0 140 150 160 170 ■ * M. C h y m .-l SFR-IIHSQLC VGNPKKMQNV YKGDSGGPLL CAGIAQ------GIASYVIIIUIR --KPPAVFTR M. Chym.- 2 HYK-DSL.I.'..SST.VAS. 1K1 * 1 * * »< • ...V.II------..V.SGRG.A —....I... MMCP-1 H Y D -Y .F.V . ..SST.LKTA ..V..GDSHG ——...... MMCP-2 DYD-YQL.V. A.S.TTLKSI GQ**• + * + * V • D.V.II ------...S..-E— ——A* A .... . RMCP-I HYH-YNF.V. . .S.R.IRSA ...V.II------. .V..GRGDA ——...... RMCP-II VYE-YKF.V. ..S.TTLRAAFH...... LV..G.PDA ——.. . . I . . . Dog Chym. A.D—■.L...... R.TKSA ...V.. ------. .V..GQHDA ••••••*# C h y m o try p sin GTKIKDAMIC AGAS— GVSS CMGDSGGPLV CKKHGAWTLV GIVSWGSSTC 5TSTPGVYAR 1 I f i l 1 1 1 100 191 20c 2 1 0 22C 230

M. c h y m .- l M .chym.-2 M. C h y ra .-l ISIIYRPHINK ILREH (2 2 6 ) 52% M. Chym .- 2 ..PHV....R VIEGK (226 ?) 52% MMCP-1 . .A.V...KT VIMGK (226) 54% 57% MMCP-2 ...Y.L...Y .V.KSK (224) 51% GQ% RHCP-I ..P.V VIKGKD (2 2 7 ) 55% RMCP-II V.T.V....A VIM (2 2 4 ) 60% Dog Chym...... V.KQ. KA (220) 72% 54% chynotrypsin VTALVHWVQQ TLAAH (2 4 5 ) 34%

240 112 analogues In different species. Mouse chymase II has its highest homology (68%) with MMCP-II in the corresponding region. There are seven cysteine residues located in mouse chymase I. Six of them occur at the identical position as in other known chymases and six of the nine cystienes of chymotrypsin. These may form disulfide bridges in the same pattern as in chymotrypsin, suggesting a conservation of the general tertiary structure among this enzyme superfamily.

However, analysis of the three-dimensional structure of RMCP

II, revealed a lack of the one disulfide bond near the active site seryl residue (Cys'l9t to cys*220 in chymotrypsin). This unique structural feature of the mast cell chymases may account for their distinctive substrate preferences (Le

Trong, 1989).

Genomic Structure of Mouse Protease Genes

The mammalian serine protease superfamily is believed to be derived from a common ancestor by gene duplication during divergent evolution. The finding of an intron in both mouse tryptase and chymase in the position corresponding to a known intron in this gene superfamily * suggests that the conserved organization and structure of the serine protease gene family extends to the mouse serine protease gene(s).

The mouse DNA Southern blot analysis revealed that only one genomic DNA restriction enzyme fragment hybridized to , . 1X3

mouse tryptase I- or II-specific probes regardless of which

enzyme was used to digest the genomic DNA. This result

indicates that both probes hybridize to only a single locus

in the mouse genome, suggesting that there is only one mouse

gene for each mast cell tryptase. Mouse tryptases I and II seem to be encoded by different genes. These are located at separate loci because each tryptase gene-specific probe displayed a distinct hybridization pattern. A similar

result was observed with rat chymases RMCP I and II which

are encoded by separate genes (Benfey et al., 1987).

Distribution and Expression of Tryptase and Chvmase in Mouse Mast Cells

Although mast cell differentiation and development is

not fully understood, two different types of mast cells have been noted in mammalian species (reviewed in Stevens et al.,

1986). Rat and human mast cell subpopulations carry different combinations of proteases. In rat, CTMC and MMC contain the distinct chymases RMCP I and RMCP II, respectively (Woodbury et al., 1978). Rat connective tissue mast cells also contain tryptase (Kido et al., 1985), but structural variants of this rat enzyme are not known. In humans both TC and T mast cell types contain tryptase, whereas only the TC mast cells contain detectable amounts of chymase (Irani et al., 1986).

The expression pattern of serine proteases in different subpopulations of mouse mast cells seems much more complicated than in the rat and human. To date, six

different serine proteases have been identified in mouse

mast cells. However, their distribution in MMC and CTMC is still unknown. Two chymases, MMCP-1 and MMCP-2, were well

characterized and shown to be selectively expressed in

different MMC populations (Serafin et al., 1990; Le Trong et

al., 1989}. In addition, three distinct chymases (MMCP-3,

MMCP-4 and MMCP-5) and a putative tryptase (MMCP-6) were identified in mouse serosal mast cells, representatives of CTMC, and their amino terminal sequences were determined

(Reynolds et al., 1990). By comparing their limited amino- terminal amino acid sequences with that derived from our tryptase and chymase clones, it seems likely that mouse tryptase I is identical to MMCP-6, and mouse chymase I is the analogue of MMCP-5. Since mouse chymase II lacks the amino-terminal sequence, it remains to be determined whether mouse chymase II is a novel protease of mouse mast cells.

In contrast, mouse tryptase II has not been previously described. Thus, different mouse mast cell subpopulations can express at least seven distinct serine proteases in different combinations.

Both MMCP-6 (mouse tryptase I) and MMCP-5 (mouse chymase I) are granular constituents of mouse CTMC (Reynolds et al., 1990). This is consistent with our Northern blot hybridization results since both tryptase and chymase expressions were detected in mouse tongue. Tongue tissue has been a good source of rat CTMC for enzyme purifications

(Kido et al., 1984). In contrast, a barely detectable level of chymase was observed in the intestine which contains mainly MMC. The relationship of the two cloned mouse mast cell tryptases and the two cloned chymases to particular mast cell types can not be addressed at present. It is possible that a well-differentiated mast cell line can express proteases of both CTMC and MMC, The Kirsten sarcoma virus-immortalized mast cell line contained three of the CTMC- and one MMC-derived serine proteases (Reynolds et al., 1990). Unfortunately, the in vivo-differentiated mouse MMC has not been successfully purified; no direct comparison between these culture- and in vivo-derlved mast cells has been possible. Mast cell studies still largely rely on immunohistochemical techniques which may limit our knowledge of mast cell diversity.

The two mouse tryptases appear to be expressed at a high level in the ABFTL-6 mast cell line, based on 0.5% positive plagues in the cDNA library and the isolation of four clones for each tryptase type. At present, we can only speculate concerning the finding of two different tryptases in ABFTL-6 mast cells* The cloning of the two enzymes in an apparently equal ratio suggests that mouse tryptase I and mouse tryptase II may comprise different subunits of an active tryptase tetramer, as for human tryptase (Schwartz et al., 1981a; Smith et al., 1984). A second possibility is that the ABFTL-6 mast cells might be stuck at an intermediate stage in mast cell differentiation, displaying phenotypes of both immature and mature MMC. Another possibility is that viral transformation has resulted in the expression of tryptases representative of mucosal and connective tissue mast cells. Finally, both mouse tryptases may have diverged from a common ancestor during evolution for carrying out different biological functions. Clarification of these issues will reguire additional studies including the isolation and characterization of each active enzyme.

The structural information presented provides a sound basis for future work on these clearly different mouse tryptases and will aid in our understanding of mast cell function. BIBLIOGRAPHY

117 118

Allfrey, V.; Faulkner, R. M.; Mirsky, A. E. 1964. Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc. Natl. Acad. Sci. USA 51:786-794.

Alter, S. C.; Kramps, J. A.; Janoff, A.; Schwartz, L. B. 1990. Interactions of human mast cell tryptase with biological protease inhibitors. Arch. Biochem. Biophys. 276:26-31. Arrighi, F. E.; Mandal, M.; Bergendahl, J.; Hsu, T. C. 1970. Buoyant densities' of DNA of mammals. Biochem. Genetics. 4:367-376.

Askenase, P. W.; Van Loveren, H. 1983. Delayed-type hypersensitivity: activation of mast cells by antigen- specific T-cell factors initiates the cascade of cellular interactions. Immunol. Today 4:259-264. Athreya, B. M.; Moser, G.; Schumacher, H. R.; Hanson, V.; Dahms, B.; Thompson, D. M. 1979. Role of basophils and mast cells in juvenile rheumatoid arthritisin. In: Fepys, J.; Edwards, A. M., eds. The Mast Cells: Its Role in Health and Disease. London: Pittman, pp.127-136.

Aviv, H.; Leder, P. 1972. Purification of biologically active globin messenger RNA by chromatography on oligo thymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69:1408-1412. Barrett, K. E.; Metcalfe, D. D. 1984. Mast cell heterogeneity: Evidence and implication. J. Clin. Immunol. 4:254-261. Beer, D. J.; Rocklin, R. E. 1984. Histamine-induced suppressor-cell activity. J. Allergy Clin. Immunol. 73:439- 452.

Befus, A. D.; Bienenstock, J. 1979. Immunologically mediated intestinal mastocytosis in Ninpestronavlus brasiliensis infected rats. Immunol. 38:95-101.

Benditt, E. F.; Arase*, M. 1959. An enzyme in mast cells with properties like chymotrypsin. J. Exp. Med. 110:451- 460.

Benfey, P. N.? Yin, F. H.; Leder, P. 1987. Cloning of the mast cell protease. RMCP II: evidence for cell-specific expression and a multi-gene family. J. Biol. Chem. 262:5377-5384. 119

Bienenstock, J*; Befus, A. D.; Pearce, F.; Denbury, J.; Goodacre, R. 1982. Hast cell heterogeneity: derivation and function, with emphasis on the intestine. J. Allergy Clin. Immunol. 70:407-412.

Bienenstock, J.; Blennerhassett, M.; Kakuta, Y.; MacQueen, G.; Marshall, J.; Perdue, M.; Siegel, S.; Tsuda, T.; Denburg, J.; Stead, R. 1989. Evidence far central and peripheral nervous system interaction with mast cells. In Galli, S. J.; Austen, K. P., eds. Mast Cell and Basophil Differentiation and Function in Health and Disease. Hew York: Raven Press, p. 275.

Birnboim, H. C.; Doly, J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DHA. Nucleic. Acid Res. 7:1513-1523.

Blow, D. M.; Bicktoft, J. J.; Hartley, B. S. 1969. Role of a buried acid group in the mechanism of action of chymotrypsin. Nature (London) 221:337-340.

Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.

Breathnach, R.; Chambon, P. 1981. Organization and expression of eucaryotic split genes coding for proteins. Annual Rev. Biochem. 50:349-383.

Briggaman, R. A.; Schechter, N. M.; Fraki, J. E.; Lazarus, G. S. 1984. Degradation of the epidermal-dermal junction by proteolytic enzymes from human skin and human polymorphonuclear leukocytes. J. Exp. Med. 160:1027-1042.

Broide, D. H.; Smith, C. M.; Wasserman, S. I. 1990. Mast cells and pulmonary fibrosis: Identification of a histamine releasing factor in bronchoalveolar lavage fluid. J. Immunol. 145:1838-1844.

Bury, A. F. 1981. Analysis of protein and peptide mixtures, evaluation of three sodium dodecyl sulfate polyacrylamide gel electrophoresis buffer systems. J. Chromatog. 213:491- 500.

Butterfield, J. H.; Weiler, D. A.; Hunt, L. W.; Wynn, S. R.; Roche, p. c. 1990. Purification of tryptase from a human mast cell line. J. Leuko. Biol. 47:409-419.

Candido, E. P. M.; Reeves, R.; Davie, J. R. 1978. Sodium butyrate inhibits histone deacetylation in cultured cells, cell 14:105-113. 120

Capron, M . ; Rousseaux, J.; Mazingue, c . ; Bazin, H. ; Capron, A. 1978. Rat mast cell-eosinophil interaction in antibody- dependent eosinophil cytotoxicity to Schistosoma mansoni schistosomula. J. Immunol. 121:2518-2525.

Caughey, G. H. ,* Raymond, W. W.; Vanderslice, P. 1990. Dog mast cell chymase: Molecular cloning and characterization. Biochemistry 29:5166-5171. Caughey, G. H.; Leidig, F.; Viro, N. F,; Nadel, J. A. 1988a. Substance P and vasoactive intestinal peptide degradation by mast cell tryptase and chymase. J. Pharmacol. Exp. Ther. 244:133-137.

Caughey, G. H.; Lazarus, S. C.; Viro, N. F.; Gold, W. M.; Nadel, J. A. 1988b. Tryptase and chymase: Comparison of extraction and release in two dog mastocytoma lines. Immunology 63:339-344. Caughey, G. H.; Viro, N. F.; Ramachandran, J.; Lazarus, S. C.; Borson, D. B.; Nadel, J. A. 1987. Dog mastocytoma tryptase: affinity purification, characterization and amino- terminal sequence. Arch. Biochem. Biophys. 258:555-563.

chirgwin, J. M.; Przybyla, A. E.; MacDonald, R. J.; Rutter, W. J. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299. Craik, c. S.; Choo, Q.; Swift, G. H.; Quinto, c.; MacDonald, R. J.; Rutter, W. J. 1984. Structure of two related rat pancreatic trypsin genes. J. Biol. Chem. 259:14255-14264.

Cromlish, J. A.; Seidah, N. G.; Marcinkiewicz, M.; Hamelin, J.; Johnson, D. A.; Chretien, M. 1987. Human pituitary tryptase: molecular forms, NHj-terminal sequence, immunocytochemical localization and specificity with prohormone and fluorogenic substrates. J. Biol. Chem. 262:1363-1373. Dayton, E. T .; Pharr, P.; Ogawa, M.; Serafin, W. E.; Austen, K. F.; Levi-Schaffer, F.; Stevens, R. L. 1988. 3T3 fibroblasts induce cloned interleukin 3-dependent mouse mast cells to resemble connective tissue mast cells in granular consistency. Proc. Natl. Acad. Sci. USA 85:569-572. Dickerson, R. E.; Geis, I. 1969. In The Structure and Action of Proteins Molecular Catalysts. New York: Harper, p. 67. 121

Dietze, S. C.; Sommerhoff, C. P.; Fritz, H. 1990. Inhibition of histamine release from human mast cells ex vivo by natural and synthetic chymase inhibitors. Biol. Chem. Hoppe-Seyler 371:75-79. Dubuske, L.; Austen, K. F.; Czop, J.; Stevens R. L. 1984. Granule-associated serine neutral proteases of the mouse bone marrow-derived mast cell that degrade fibronectin: Their increase after sodium butyrate treatment of the cells. J. Immunol. 133:1535-1541. Ehrlich, P. 1878. BeitrSge zur Theorie und Praxis der histologischen FSrbung. Leipzig; Thesis.

EnerbSck, L. 1966a. Mast cells in rat gastrointestinal mucosa. III. Reactivity towards compound 48/80. Acta Pathol. Microbio. Scand. 66:313-322. EnerbSck, L. 1966b. Mast cells in rat gastrointestinal mucosa. II. Dye-binding and metachromatic properties. Acta Pathol. Microbio. Scand. 66:303-312.

EnerbSck, L. 1966c. Mast cells in rat gastrointestinal mucosa. I. Effects of fixation. Acta Pathol. Microbio. Scand. 66:289-302. EnerbSck, L. 1986. Mast cell heterogeneity: The evolution of the concept of a specific mucosal mast cell. In: Befus, A. D.; Bienenstock, J.; Denburg, J. A., eds. Mast cell Differentiation and Heterogeneity. New York: Raven Press, p. 1.

EnerbSck, L. 1981. The gut mucosal mast cell. Monogr. Allergy 17:222-232. EnerbSck, L. 1974. Berberine sulphate binding to mast cell polyanions: A cytofluorometric method for the quantitation of heparin. Histochemistry 42:301-305. Farram, E.; Nelson, D. S. 1980. Mouse mast cells as anti­ tumor effector cells. Cell Immunol. 55:294-301.

Feinberg, A. P.; Vogelstein, B. 1984. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137:266-267.

Fersht, A. R. 1977. Enzyme Structure and Mechanisms. W. H. Freeman and Co., San Francisco, 302-325. 122

Franconi, G. M.; Graf, P. D.; Lazarus, S. C.; Nadel, J. A.; Caughey, G. H. 1989. Mast cell tryptase and chymase reverse airway smooth muscle relaxation induced by vasoactive. J. Pharmacol. Exp. Ther. 248:947-951. Friedman, M. M.; Kaliner, M. A. 1987. Human mast cells and asthma. Am. Rev. Respir. Dis. 135:1157-1164. Fujita, J.; Nakayama, H.; Onoue, H.; Kanakura, Y.; Nakano, T.; Asai, H.; Takeda, S.; Honjo, T.; Kitamura, Y. 1988. Fibroblast-dependent growth of mouse mast cells in vitro: Duplication of mast cell depletion in mutant mice of W/W* genotype. J. Cell Physiol. 134:78-84.

Galli, 5. J.; Dvorak, A. M.; Marcum, J. A.; Xshizaka, T.; Nabel, G.; Der Simonian, H.; Pyne, K.; Goldin, J. M.; Rosenberg, R. D.; Cantor, H.; Dvorak, H. D. 1982. Mast cell clones: A model for the analysis of cellular maturation. J. Cell Biol. 95:435-444. Galli, S. J. 1990. Biology of disease, New insights into "the riddle of the mast cells": Microenvironmental regulation of mast cell development and phenotypic heterogeneity. Lab. Invest. 62:5-33.

Geissler, E. N.; Russell, E. S. 1983. Analysis of hematopoietic effects of new dominant spotting (W) mutants of the mouse. XI.,Effects on mast cell development. Exp. Hematol. 11:461-466.

Ghiara, P.; Boraschi, D.; Villa, L.; Scapigliati, G.; Taddei, c.; Tagliabue, A. 1985. In vitro generated mast cells express natural cytotoxicity against tumor cells. Immunol. 55:317-324.

Gill, S. c.; von Hippel, P. H. 1989. Calculation of protein extinction coefficients from amino acid sequence data. Anal. Biochem. 182:319-329.

Ginsburg, H.; Lagunoff, D. 1967. The in vitro differentiation of mast cells. Cultures of cells from immunized mouse lymph nodes and thoracic duct lymph on fibroblast monolayers. ■ J. Cell Biol. 35:685-697.

Ginsburg, H. 1963. The in vitro differentiation and culture of normal mast cells from mouse thymus. Ann. N.Y. Acad. Sci. 103:20-39.

Glenner, G. G.; Cohen, L. A. 1960. Histochemical demonstration of a species-specific trypsin-like enzyme in mast cells. Nature (London) 185:846-847. 123

Graf, L.; Jancso, A.; Szilagyi, L.; Hegyi, G.; Pinter, K.; Naray-Szabo, G.; Hepp, J.; Medzihradszky, K.; Rutter, w. J. 1988. Electrostatic complementarity within the substrate- binding pocket of trypsin. Proc. Natl. Acad. Sci. USA 85:4961-4965. Gruber, B. L.; Schwartz, L. B.; Ramamurthy, N. S.; Irani, A. M.; Marchese, M. J. 1988. Activation of latent rheumatoid synovial collagenase by human cell tryptase. J. Immunol. 140:3936-3942.

Gubler, U.; Hoffman, B. J. 1983. A simple and very efficient method for generating cDNA libraries. Gene 25:263-2694.

Haig, D. M.; McKee, T. A.; Jarrett, E. E. E.; Woodbury, R.; Miller, H. R. P. 1982. Generation of mucosal mast cells is stimulated in vitro by factors derived from T cells of helminth infected rats. Nature (London) 300:188-190.

Haig, D. M.; McMenamin, C.; Jarrett, E. E. E. 1986. Mast cell development in the rat. In: Bufus, A. D.; Bienenstock, J.; Denburg, J. A., eds. Mast Cell Differentiation and Heterogeneity. New York: Raven Press, pp. 55-62. Hamaguchi, Y.; Kanakura, Y.; Fujita, J.; Takeda, s.-I.; Nakano, T.; Tarui, S.; Honjo, T.; Kitamura, Y. 1987. Interleukin 4 as an essential factor for in vitro clonal growth of murine connective tissue-type mast cells. J. Exp. Med. 165:268-273.

Hartley, B. S. 1970. Homologies in serine proteases. Philos. Trans. R. Soc. (London) part B 257:77-87.

Harvima, I. T.; Schechter, N. M.; Harvima, R. J.; FrSki, J. E. 1988. Human skin tryptase: Purification, partial characterization and comparison with human lung tryptase. Biochim. Biophys, Acta 957:71-80.

Hasthorpe, S. 1980. A hemopoietic cell line dependent upon a factor in pokeweed mitogen-stimulated spleen cell conditioning medium. J. Cell Physiol. 105:379-384.

Henderson, W. R.; Chi, E. Y.; Jong, E. C.; Klebanoff, S. J. 1981. Mast cell-mediated tumor-cell cytotoxicity. J. Exp. Med. 153:520-533.

Henneberry, R. C.; Fishman, P. H. 1976. Morphological and biochemical differentiation in HeLa cells. Exp. Cell Res. 103:55-62. 124

Hopp, T. P.; Woods, K. R. 19B1. Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. sci. USA 78:3824-3828. Huntley, J. F.; Gibson, S.; Knox, D.; Miller, H. R. P. 1986. The isolation and purification of a protease with chymotrypsin-like properties from bovine mucosal mast cells. Int. J. Biochem. 18:673-6B2. Hyunh, T. V.; Young, R. A.; Davis, R. W. 1985. Constructing and screening cDNA libraries in lambda gtlO and lambda gtll. In: Glover, D., ed. DNA cloning Techniques. A practical approach, Vol. 1, Oxford: IRL Press, pp. 49-78.

Ihle, J. N.; Keller, J.; Oroszlan, S.; Henderson, L. E.; Copeland, R. D.; Fitch, F.; Prystowsky, M. B.; Goldwasser, E.; Schrader, J . W.; Palaszynski, E.; Dy, M.; Lebel, B. 1983. Biological properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth-factor activity and histamine-producing factor activity. J. Immunol. 131:282- 287. Irani, A. A.; Schechter, N. M.; Craig, S. S.; DeBlois, G.; Schwartz, L. B. 1986. Two human mast cell subsets with distinct neutral protease compositions. Proc. Natl. Acad. Sci. USA 83:4464-4468.

Ishizaka, T.; Ishizaka, K. 1984. Activation of mast cell for mediator release through IgE receptors. Prog. Allergy 34:188-235. Ishizaka, T.; Okudaira, H.; Mauser, L. E.; Ishizaka, K. 1976. Development of rat mast cells in vitro I. Differentiation of mast cells from thymus cells. J. Immunol. 116:747-754.

Jadus, M. R.; Schmunk, G.; Djeu, J. Y,; Parkman, R. 1986. Morphology and lytic mechanisms of interleukin 3-dependent natural cytotoxic cells: Tumor necrosis factor as a possible mediator. J. Immunol. 137:2774-2783.

Jarboe, D. L.; Marshall, J. S.; Randolph, T. R.? Kukolja, A.; Huff, T. F. 1989. The mast cell-committed progenitor. I. Description of a cell capable of IL-3-independent proliferation and differentiation without contact with fibroblasts. J. Immunol. 142:2405-2417.

Jenne, D. E,; Rey, C.; Masson, D.; Stanley, K. K.; Plaetinck, G.; Tschopp, j. 1988. cDNA cloning of granzyme C. A granule-associated serine protease of cytolytic T lymphocytes. J. Immunol. 140:318-323. 125

Jenne, D. E.; Masson, D.; Zimmer, M.; Haefliger, J-A.; Li,W- H.; Tschopp, J. 1989. Isolation and complete structure of the lymphocyte serine protease granzyme G, a novel member of the granzyme multigene family in murine cytolytic T lymphocytes. Biochemistry, 28:7953-7961.

Johnson, D. A.: Cawston, T. E. 1985. Human lung mast cell tryptase fails to activate procollagenase or degrade proteoglycan. Biochem. Biophy. Res. Commu. 132:453-459.

Kaliner, M . ; Lemanske, R. 1984. Inflammatory responses to mast cell granules. Fed. Proc. 43:2846-2851.

Kanakura, Y.; Thompson, H.; Nakano, T.; Yamamura, T.; Asai, H.; Kitamura, Y.; Metcalfe, D. D.; Galli, S. J. 1988. Multiple bidirectional alterations of phenotype and changes in proliferative potential during the in vitro and in vivo passage of clonal mast cell populations derived from mouse peritoneal mast cells. Blood 72:877-885.

Katz, H. R., and Austen, K. F. 1987. Biochemical characterization of a mast cell plasma membrane antigen shared by mouse serosal, culture-derived, and virally transformed mast cells. J. Immunol. 138:1196-1200. Katz, H, R.; Schwarting, G. A.; LeBlanc, P. A.; Austen, K. F.; Stevens, R. L. 1985. Identification of the neutral glycosphingolipids of murine mast cells: Expression of forssman glycolipid by the serosal but not the bone marrow- derived subclass. J. Immunol. 134:2617-2623.

Kido, H.; Fukusen, N.; Katunuma, N. 1984. A simple method for purification of chymase from rat tongue and rat peritoneal cells. Anal. Biochem. 137:449-453.

Kido, H.; Fukusen, N.; Katunuma, N. 1985. chymotrypsin- and trypsin-type serine prateases in rat mast cells: Properties and functions. Arch. Biochem. Biophys. 239:436-443.

Kido, H.; Yokogoshi, Y.; Katunuma, N., 1988. Kunitz-type protease inhibitor found in rat mast cell: purification, properties, and amino acid sequence. J. Biol. Chem. 263:18104-18107. Kirshenbaum, A. S.; Goff, J. P.; Dreskin, S. C.; Irani, A- M.; Schwartz, L. B.; Metcalfe, D. D. 1989. XL 3-dependent growth of basophil-like cells and mast-like cells from human bone marrow. J. Immunol. 142:2424-2429. 126 Kirsner, J. B.; Shorter, R. G. 1982. Recent developments in "non-specific" inflammatory bowel disease. N. Eng. J. Med. 306:775-785.

Kitamura, Y.; Go, S. 1979. Decreased production of mast cells in sl/sld anemic mice. Blood 53:492-497.

Kitamura, Y. ,* Go, S.; Hatanaka, S. 1978. Decrease of mast cells in W/W* mice and their increase by bone marrow transplantation. Blood 52:447-452.

Klein, L. M.; Lavker, R. M.; Matis, W. L.; Murphy, G. F. 1989. Degranulation of human mast cells induces an endothelial antigen central to leukocyte adhesion. Proc. Natl. Acad. Sci. USA 86:8972-8976.

Kops, S. K.; Ratzlaff, R. E.; Meade, R., Iverson, G. M.; Askenase, P. W. 1986. Interaction of antigen-specific T cell factors with unique "receptors" on the surface of mast cells: Demonstration in vitro by an indirect rosetting technique. J. Immunol. 136:4515-4524.

Lagunoff, D.; Chi, E. Y. 1980. Cell biology of mast cells and basophils. In: Glynn, L. E.; Houch, C.; Weissmann, G., eds. The Cell Biology of Inflammation. Amsterdam: Elsevier/North-Holland Biomedical Press, pp. 217-266.

Le Trong, H.; Parmelee, D. C.; Walsh, K. A.; Neurath, H.; Woodbury, R. C. 1987. Amino acid sequence of rat mast cell protease I (chymase). Biochemistry 26:6988-6994.

Le Trong, H.; Newlands, G. F. J.; Miller, H. R. P.; Charbonneau, H.; Neurath, H.; Woodbury, R. G. 1989. Amino acid sequence of a mouse mucosal mast cell protease. Biochemistry 28:391-395.

Levi-Schaffer, F.; Austen, K. F.; Caulfield, J. P.; Hein, A.; Bloes, W, F.; Stevens, R. L. 1985. Fibroblasts maintain the phenotype and viability of the rat heparin-containing mast cells in vitro. J. Immunol. 135:3454-3462.

Levi-Schaffer, F.; Austen, K. F.; Gravallese, P. M.; Stevens, R. L. 1986. Coculture of interleukin 3-dependent mouse mast cells with fibroblasts results in a phenotypic change of the mast cells. Proc. Natl. Acad. Sci. USA 83:6485-6488. 127

Levi-Schaffer, F.; Austen, K. F.; Caulfield, J. P.; Hein, A.; Gravallese, P. M.; Stevens, R. L. 1987a. Co-culture of human lung-derived mast cells with mouse 3T3 fibroblast: morphology and IgE mediated release of histamine, prostaglandin D2, and leukotrienes. J. Immunol. 139:494- 500.

Lobe, C. G.; Upton, C.; Duggan, B.; Ehrman, N.; Letellier, M.; Bell, J.; McFadden, G. 1988. Organization of two genes encoding cytotoxic T lymphocyte-specific serine proteases CCP I and CCP II. Biochemistry 27:6941-6946.

Maier, M.; Spragg, J.; Schwartz, L. B. 1983. Inactivation of human high molecular weight kininogen by human mast cell tryptase. J. Immunol. 130:2352-2356.

Malone, D. A.; Irani, A. M.; Schwartz, L. B.; Barrett, K. E.; Metcalfe, D. D. 1986. Mast cell numbers and histamine levels in synovial fluids from patients with diverse arthritides. Arthritis Rheum. 29:956-961. Maniatis, T.; Fristsch, E. F.; Sambrook, J. 1982. Cold Spring Laboratory. In: Molecular Cloning. (New York: Cold Spring Harbor).

Maximow, A. 1905. tiber die Zellformen des lockeren Bindegewebes. Arch, mikrosk. Anat. Entw. Mech. 67, p. 680.

McConaughy, B. L.; Laird, C. D.; McCarthy, B. J. 1969. Nucleic acid reassociation in formamide. Biochemistry 8:3289-3295.

Metcalfe, D. D.; Kaliner, M.; Donlon, M. A. 1981. The mast cell. CRC Crit. Rev. Immunol. 3:23-74.

Miller, J. S.; Westin, E. H.; Schwartz, L. B. 1989. Cloning and characterization of complementary DNA for human tryptase. J. Clin. Invest. 84:1188-1195.

Mimh, M. G.; soter, N. A.; Dvorak, H. F.; Austen, K. F. 1976. Structure of normal skin and the morphology of atopic eczema. J. Invest. Dermatol. 67:305-312.

Mori, Y.; Akedo, H.; Tanigaki, Y.; Tanaka, K. M.; Okada, M.; Nakamura, N. 1980. Effect of sodium butyrate on the production of serotonin, histamine and glycosaminoglycans by cultured murine mastocytoma cells. Exp. Cell Res. 127:465- 470.

Nagao, K.; Yokoro, K.; Aaronson, S. A. 1981. Continuous lines of basophil/mast cells derived from normal mouse bone marrow. Science, 212:233-235. 4

12 S

Nakahata, T.; Kobayashi, T.; Ishiguro, A.; Tsuji, K.; Naganuma, K.; Ando, 0.; Yagi, Y.; Tadokoro, K.; Akabane, T. (1986). Extensive proliferation of mature connective tissue type mast cells in vitro. Mature (London) 324:65-67.

Nakano, T.; Sonoda, T.; Hayashi, C.; Yamatodani, A.; Kanayama, Y.; Yamamura, T.; Asai, H.; Yonezawa, Y.; Kitamura, Y.; Galli, S. J. 1985. Fate of bone marrow- derived cultured mast cells after intracutaneous intraperitoneal and intravenous transfer into genetically mast cell-deficient W/Wv mice: Evidence that cultured mast cells can give rise to both connective tissue-type and mucosal mast cells. J. Exp. Med. 162:1025-1034.

Nakano, T.; Kanakura, Y.; Makahata, T.; Matsuda, H.; Kitamura, Y. 1987. Genetically mast cell-deficient W/W* mice as a tool for studies of differentiation and function of mast cells. Fed. Proc. 46:1920-1923.

Newlands, G. F. J; Gibson, S.; Knox, D. P.; Grencis, R.; Wakelin, D.; Miller, H. R. P. 1987. Characterization and mast cell origin of a chymotrypsin-like proteinase isolated from intestines of mice infected with Trichinella spiralis. Immunology 62:629-634. Okuno, T.; Takagaki, Y.; Pluznik, D. H.; Djeu, J. Y. 1986. J. Immunol. 136:4652-4658. Otsu, K.; Nakano, T.; Kanakura, Y.; Asai, H.; Katz, H. R.; Austen, K. F.; Stevens, R. L.; Galli, S. J.; Kitamura, Y. 1987. Phenotypic changes of bone marrow-derived mast cells after intraperitoneal transfer into W/Wv mice that are genetically deficient in mast cells. J. Exp. Med. 165:615- 627.

Pierce, J. H.; Di Fiore, P. P.; Aaronson, S. A.; Potter, M.; Pumphrey, J.; Scott, A.; Ihle, J. N. 1985. Neoplastic transformation of mast cells by Abelson-MuLV: Abrogation of IL-3 dependence by a nonautocrine mechanism. Cell 41:685- 693.

Pitton, C.; Michel, L.; Salem, P.; Benhamou, M.; Mencia- Huerta, J. M.; Maclouf, J.; Prost, C.; Burtin, C. ,* Dubertret, L.; Benveniste, J. 1988. Biochemical and morphological modifications in dexamethasone-treated mouse bone marrow-derived mast cells. J. Immunol:141, 2437-2444. 129 Plaut, M . ; Pierce, J. H.; Watson, C. J .; Hanley-Hyde, J,; Nordan, R. P.; Paul, W. E. 1989. Mast cell lines produce lymphokines in response to cross-linkage of FceRI or to calcium ionophores. Nature (London) 339:64-67. Razin, E.; Cordon-Cardo, C.; Good, R. A. 1981. Growth of a pure population of mouse mast cells in vitro with conditioned medium derived from concanavalin A-stimulated splenocytes. Proc. Natl. Acad. Sci. USA 78:2559-2561.

Razin, E.; Stevens, R. L.; Akiyama, F.; Schmid, K.; Austen, K. F. 1982. Culture from mouse bone marrow of a subclass of mast cells possessing a distinct chondroitin sulfate proteoglycan with glycosaminoglycans rich in N- acetylgalactosamine-4,6-disulfate. J. Biol. Chem. 257:7229- 7236.

Reynolds, D. S.; Stevens, R. L.; Lane, W. S.; Carr, M. H. 1990. Different mouse mast cell populations express various combinations of at least six mast cell serine prateases. Proc. Natl. Acad. Sci. USA 87:3230-3234.

Riggs, M. G.; Whittaker, R. G.; Nevmann, J. R.; Ingram, V. M. 1977. n-Butyrate causes histone modification in HeLa and Friend erythroleukaemia cells. Nature (London) 268:462-464. Sage, H.; Woodbury, R. G.; Bornstein, P. 1979. structural studies on human type IV collagen. J. Biol. Chem. 254:9893- 9900.

Said, S. I. 1984. Vasoactive intestinal peptide (VIP): current status. Peptides 5:143-150.

Salvesen, G.; Farley, D.; Shuman, J.; Przybyla, A.; Reilly, c.; Travis, J. 1987. Molecular cloning of human cathepsin G: Structural similarity to mast cell and cytotoxic T lymphocyte proteinases. Biochemistry 26:2289-2293.

Salvesen, G.; Enghild, J. 1990. An unusual specificity in the activation of neutrophil serine proteinase zymogens. Biochemistry 29:5304-5308, Sanger, F.; Nicklen, S.; Coulson, A. R. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.

Sayama, s.; lozzo, R. v.; Lazarus, G. S.; Schechter, N. M. 1987. Human skin chymotrypsin-like proteinase chymase. J. Biol. Chem. 262:6808-6815. 130 Schechter, N. M.; Choi, J. K.; Slavin, D. A.; Deresienski, D. T.; Sayama, S.; Dong, G.; Lavker, R. M.; Proud, D.; Lazarus, G. S. 1986. Identification of a chymotrypsin-like protease in human mast cells. J* Immunol. 137:962-970. Schechter, N. M.; Fraki, J. E.; Geesin, J. C.; Lazarus, G. 1983. Human skin chymotryptic proteinase. J. Biol. Chem. 258:2973-2978.

Schechter, N. M . ; Slarin, D.; Fetter, R. D.; Lazarus, G. s.; Fraki, J. E. 1988. Purification and identification of two serine class proteinases from dog mast cells biochemically and immunologically similar to human proteinases tryptase and chymase. Arch. Biochem. Biophys. 262:232-244. Schedlich, L. J.; Bennetts, B, H.; Morris, B. J. 1987. Primary structure of a human glandular kallikrein gene. DNA 6:429-43716. Schrader, J. W. 1981. The in vitro production and cloning of the P cell, a bone marrow-derived null cell that expresses H-2 and Ia-antigens, has mast cell-like granules, and is regulated by a factor released by activated T cells. J. Immunol. 126:452-458.

Schwartz, L. B.; Irani, A-M. A.; Roller, K.; Castells, M. C.; Schechter, N. M. 1987. Quantitation of histamine, tryptase, and chymase in dispersed human T and t c mast cells. iT. Immunol. 138:2611-2615.

Schwartz, L. B,; Lewis, R. A.; Austen, K. F. 1981b. Tryptase from human pulmonary mast cells: Purification and characterization. J. Biol. Chem. 256:11939-11943.

Schwartz, L. B. 1989. Heterogeneity of mast cells in human. In: Galli, S. J.; Austen, K. F., eds. Mast Cell and Basophil Differentiation and Function in Health and Disease. New York: Raven Press, p. 93.

Schwartz, L. B.; Bradford, T. M. 1986. Regulation of tryptase from human lung mast cells by heparin: Stabilization of the active tetramer. J, Biol. Chem. 261:7372-7379.

Schwartz, L. B.; Lewis, R. A.; Seldin, D.; Austen, K. F. 1981a. Acid hydrolases and tryptase from secretory granules of dispersed human lung mast cells. J. Immunol. 126;1290- 1294. 131 Schwartz, L. B.; Kawahara, M. s.; Hugli, T. E.; vik, D.; Fearon, D. T.; Austen, K. F. 1983. Generation of C3, anaphylatoxin from human C3, by human mast cell tryptase. J. Immunol. 130:1891-1895.

Schwartz, L. B.; Bradford, T. R.; Littman, B. H.; Wintroub, B. U. 1985. The fibrinogenolytic activity of purified tryptase from human lung mast cells. J. Immunol. 135:2762- 2767.

sekizawa, K.; Caughey, G. H.; Lazarus, s. C,; Gold, W. M.; Nadel, J. A. 1989. Mast cell tryptase causes airway smooth muscle hyperresponsiveness in dogs. J. Clin. Invest. 83:175-179.

Selye, H. 1965. In The Mast Cells. Butterworths, Washington, D. C.

Serafin, W. E.; Reynolds, D. S.; Rogel J, S.; Lane, W. S.; Conder, G. A.; Johnson, S. S.; Austen, K. F.; Stevens, R. L. 1990. Identification and molecular cloning of a novel mouse mucosal mast cell serine protease. J. Biol. Chem. 265:423- 429.

Serafin, W. E.; Katz, H. R. ,* Austen, K. F.; Stevens, R. L. 1986. Complexes of heparin proteoglycans, chondroitin sulfate E proteoglycans, and [3H]diisopropyl fluorophosphate-binding proteins are exocytosed from activated mouse bone marrow-derived mast cells. J. Biol. Chem. 261:15017-15021.

Shanahan, F.; Denburg, J. A.; Bienenstock, J,; Befus, A. D. 1984. Mast cell heterogeneity. Can. J. Physiol. Pharmacol. 62:734-738.

Simmons, J. L.; Fishman, P. H.; Freese, E.; Brady, R. O. 1975. Morphological alterations and ganglioside sialyltransferase activity induced by small fatty acids in HeLa cells. J. Cell Biol. 66:414-424.

Smith, E. C.; Musich, R. P.; Johnson, 0. A. 1989. Sodium dodecyl sulfate enhancement of quantitative immunoenzyme dot-blot assays on nitrocellulose. Anal. Biochem. 177:221- 219.

Smith, T. J.; Johnson, D. A. 1984. Human lung tryptase activity is stabilized by heparin. Fed. Proc. 48:1760 (Abstract). 132

Smith, T. J.; Hougland, M. W.; Johnson, D. A. X984. Human lung tryptase: Purification and characterization. J. Biol. Chem. 259:11046-11051.

Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 79:503-517. ' "

Sredni, B.; Friedman, M. M.; Bland, C. E.; Metcalfe, D. D. 1983. Ultrastructural biochemical, and functional characteristics of histamine-containing cells cloned from mouse bone marrow: Tentative identification as mucosal mast cells. J. Immunol. 131:915-922.

Steck, G.; Leuthard, P.; Burk, R. R. 1980. Detection of basic proteins and low molecular weight peptides in polyacrylamide gels by formaldehyde fixation. Anal. Biochem. 107:21-24. Stefanini, M.; Martino, C. D.; Zamboni, L. 1967. Fixation of ejaculated spermatozoa for electron microscopy. Nature 216:173-174. Stevens, R. L.; Katz, H. R.; Seldin, D. S.; Austen, K. F. 1986. Biochemical characteristics distinguish subclasses of mammalian mast cells. In: Befus, A.K.; Bienenstock, J.; Denburg, J., eds. Mast Cell Differentiation and Heterogeneity. New York: Raven Press, pp. 183-203.

Sweet, R. M.; Wright, H. T. ,* Janin, J.; Chothia, C. H.; Blow, D. M. 1974. Crystal structure of the complex of porcine trypsin with soybean trypsin inhibitor (Kunitz) at 2.6-A resolution. Biochemistry 13:4212-4228.

Takahasi, H.; Nukiwa, T.; Yoshimura, K.; Quick, C. D.; States, D. J.; Holmes, M. D.; Whang-Peng, J.; Knutsen, T.; Crystal, R. D. 1988. structure of the human neutrophil elastase gene. J. Biol. Chem. 263:14739-14747.

Tanaka, T.; McRae, B. T.; Cho, K.; Cook, R.; Fraki, F. E.; Johnson, D. A.; Powers, J. C. 1983. Mammalian tissue trypsin-like enzymes: Comparative reactivities of human skin tryptase, human lung tryptase, and bovine trypsin with peptide 4-nitroanilide and thioester substrates. J. Biol. Chem. 258:13552-13557.

Tertian, G.; Yung, Y. P.; Guy-Grand, D.; Moore, M. A. s. 1981. Long term in vitro culture of murine mast cells. I. Description of a growth-factor dependent culture technique. J. Immunol. 127:2788-794. 133 Vanderslice, P.; Craik, C. S.; Hadel, J. A.; Caughey, G. H. 1989. Molecular cloning of dog mast cell tryptase and a related protease: Structural evidence of a unique mode of serine protease activation. Biochemistry 28:4148-4155. Vanderslice, P.; Ballinger, S. M.; Tam, E. K.; Goldstein, S. M.; Craik, c. s.; Caughey, G. H. 1990. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family. Proc. Natl. Acad. Sci. USA 87:3911-3815.

Verma, M. 1989. Use of ammonium sulfate precipitation and guanidine isothiocyanate lysis to isolate lambda DNA. BioTechniques 7:230-232.

Vilcek, J.; Palombella, V. J.; Hendrikson-DeStefano, D.; Swenson, C.; Feiman, P.; Hirai, M.; Tsujimoto, M. 1986. Fibroblast growth enhancing activity of tumor necrosis factor and its relationship to other polypeptide growth factors. J. Exp. Med. 163:632-643. von Heijne, G. 1986. A new method for predicting signal sequence cleavage sites. Nucleic Acid Res. 14:4683-4690. Wintroub, B. U.; Kaempfer, C. E.; Schechter, N. M.; Proud, D. 1986. A human lung mast cell chymotrypsin-like enzyme. Identification and partial characterization. J. Clin. Invest. 77:196-201. Wintroub, B. U.; Schechter, N. B.; Lazarus, G. S.; Kaempfer, c. E.; Schwartz, L. B. 1984. Angiotensin I conversion by human and rat chymotryptic proteases. J. Invest. Dermatol. 83:336-339.

Witte, 0. N. 1990. Steel locus defines new multipotent growth factor. Cell 63:5-6.

Woodbury, R. G.; Everitt, M.; Sanada, Y.; Katunuma, N.; Lagunoff, D.; Neurath, H. 1978. A major serine protease in skeletal muscle. Evidence for its mast cell origin. Proc. Natl. Acad. Sci. USA 75:5311-5313.

Yoo, D.; Lessin, L. S.; Jensen, W. 1978. Bone marrow mast cells in lymphoproliferative disorders. Ann. Inter. Med. 8:753-757. APPENDICES APPENDIX A 136

Buffers and Solutions

Alkaline lysis solution

0.2 N NaOH, 1% SDS {make fresh) Antibody solution Tris-Saline containing 0.05% Tween-20, 1% BSA

Bradford reagent

0.01% (w/v) Coomassie Brilliant Blue G-250, 4.7% ethanol, and 8.5% phosphoric acid CIA chloroform/isoamyl alcohol (24:1 v/v)

GTC buffer

5.5 M GTC, 25 mM sodium citrate, 0.5% sodium lauryl sarcosine, pH 7.0, add B-mercaptoethanol to 0.2 M immediately prior to use

Kinasing buffer 40 mM Tris-HCl pH 7.6, 20 mM MgCl2, 10 mM DTT, 0.2 mM spermidine, loo /ig/ml BSA, 0.2 mM EDTA

LB broth 10 g bactotryptone, 5 g bacto-yeast extract, 5 g NaCl, add dH20 to 1 liter, autoclave to sterilize

Ligation buffer

50 rnM Tris-HCl pH 7.4, 10 mM MgClj, 10 mM DTT, 0.5 mM ATP, 0.1 mg/ml BSA

Loading Buffer

20 mM Tris-HCl pH 7.6, 0.5 M LiCl, 1 mM EDTA, 0.1 % sodium lauryl sarcosinate

M9 salt (10 X)

60 g NajHPOj, 30 g KHjHPO.,, 50 g NaCl, 100 g NH4C1, add dHjO to 1 liter, autoclave to sterilize 137

Minimal medium 100 ml 10 X M9 salt, 10 ml 20% glucose, 0.1 ml 1% thiamine solution, 1.0 ml 0.1 M CaCl1# 2.0 ml 1 M MgS04, add dH20 to 1 liter

NZY broth 5 g NaCl, 2 g MgS04, 5 g yeast extract, 10 g NZ Amine (Casein hydrolysate), add dH20 to l liter, autoclave to sterilize

PEG solution

27% PEG (W/V) 8000 in 3.3 M NaCl

PBS 0.14 M NaCl, 50 mM sodium phosphate, pH 7.4

Prehybridization solution

3 X SSC (or SSPE), 10 mM Tris-HCl (pH 7.4), 1% dried non-fat milk, 0.1% SDS, 50% formamide

Protein sample buffer (8 ml)

4.7 ml dHjO, 1.0 ml 0.5 M Tris-HCl pH 6.8, 1.0 ml glycerol, 1.0 ml 10% SDS, 0.1 ml B- mercaptoethanol, 0.2 ml 0.05% bromophenol blue

Protein staining solution 500 ml 95% ethanol, 100 ml acetic acid, 400 ml HjO, and 2.0 g Coomassie brilliant blue, add dHjO to 1 liter

RNclS6 A 20,000 U/ml in 10 mM Tris-HCl pH 7.5, 15 mM NaCl, boiled for 15 minutes

# Seguenase buffer 40 mM Tris-HCl pH 7.5, 20 mM MgCl2/ 50 mM NaCl.

Sequencing stop buffer 80% deionized formamide, 10 mM NaOH, 1 mM EDTA 0.1% xylene cyanol, 0.1% bromophenol blue

SET solution 20% sucrose, 50 mM Tris-HCl pH 8.0, 50 mM EDTA 138

SM buffer 20 mM Tris-HCl pH 7.4, 10 mM MgS04, 100 mM NaCl, 0.01% gelatin SOG loading buffer

60% sucrose, 0.1% Orange G

SSC (IX) 0.15 M NaCl, 15 mM sodium citrate, pH 7.0

SSPE (IX)

0.18 M NaCl, 10 mM NaP04, 1 mM EDTA, pH 7.7

Ti0E, 10 mM Tris-HCl pH 8.4, 1 mM EDTA

T,E,1* 0.1 1 mM Tris-HCl pH 8.4, 0.1 mM EDTA TAE

50 mM Tris pH 8.4, 40 mM acetic acid, 1 mM EDTA TB broth 5 g NaCl, 10 g Bactotryptone, add dH20 to 1 liter, autoclave to sterilize

THE

50 mM Tris pH 8.3, 50 mM boric acid, 1.25 mM EDTA

TBS

50 mM Tris-HCl pH 8.0, 150 mM NaCl APPENDIX B Restriction Enzymes, Recognition Sequences and Buffers

Enzyme Cleavage Restriction Endonuclease Buffer*’1

EcoRX GAATTC 100 Mm Tris-HCl, pH 7.2, 50 mM NaCl, 5 mM MgCl2

Hinfl GAANTC 6 mM Tris-HCl, pH 7.5, 50 mM NaCl, 6 mM MgCl2

Pstl CTGCAG 20 mM Tris-HCl, pH 7.4, 10 mM MgClj, 50 mM(NH4)S04

Not I GCGGCCGC 3 mM Tris-HCl, pH 7.4, 150 mM NaCl, 6 mM MgCl2

Dr a I TTTAAA 6 mM Tris-HCl, pH 7.6, 50 mM NaCl, 6 mM MgCl2

BamHI GGATCC 20 mM Tris-HCl, pH 7.4, 100 mM NaCl, 7 mM MgCl2

Sau3AI GATC 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 7 mM MgCl2

Kpnl GGTACC 6 mM Tris-HCl, pH 7.5, 6 mM NaCl, 6 mM MgCl2

HindiII AAGCTT 50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 10 mM MgCl2

*A11 restriction digestion mixtures contained 6 mM B-Mercaptoethanol and 100 /ig/ml acetylated BSA (nuclease free). bLSS restriction enzyme buffer: 20 mM Tris-HCl pH 7.4, 0.05 mM spermine, 0.125 mM spermidine, 20 mM KCl, 70 mM NaCl, 10 mM MgCl2 (This buffer was used for multi-digestion reactions since it works for many enzymes including EcoRI, BamHI, Hinfl, Mbol, Hindlll, Kpnl, HaelX, Haelll, Mspl, TaqI, Rsal, Sau3A, Sail, Smal, and SacI).

H O VITA

WEI CHU

Personal Data: Date of Birth: June 13, 1959 Place of Birth: suzhow, China

Education: Suzhow Medical School, Jiangsu Province, China, M.D., 1983 East Tennessee State University, J. H. Quillen College of Medicine, Johnson City, Tennessee, 'Biomedical Sciences with emphasis in Biochemistry, Ph.D*, 1991

Professional Graduate Assistant, Department of Experience: Biochemistry, East Tennessee State University, J. H. Quillen College of Medicine, Johnson City, Tennessee, 1986-1990 Resident, Department of Surgery, Nanjing Children's Hospital, Nanjing, China, 1983-1985

Publications: Chu, W., Johnson, D. A., and Musich, P. R. Tryptase Induction in Mouse ABFTL-6 Mast Cell Line. East Tennessee State University, College of Medicine Research Forum, Abstract, 1988 Chu, W., Johnson, D. A., and Musich, P. R. Mouse Mast Cell Tryptase and Chymase: Induction and cDNA Cloning. Annual Meeting of the Southeastern Section of the Society for Experimental Biology and Medicine, Abstract, 1989 Chu, W., Johnson, D. A., and Musich, P. R. Identification and Molecular Cloning of Mouse Mast Cell Tryptase. FASEB J. 4. A2698, 1990 Chu, W., Musich, P. R., and Johnson, D. A. Molecular Cloning of Two Distinct Mouse Mast Cell Tryptases and Predictions for Processing. J. Immunology (April, 1990 revised)

Honors and Honorable Mention: Southeastern Section Awards: of the Society for Experimental Biology and Medicine, 1989 Second Place Award: ETSU, College of Medicine Research Forum, Biomedical Sciences Category, 1990

141