IBMC Marta VazMendes, Investigadora Auxiliar Coorientador Faculdade deUniversidade Ciências,do Porto Vitor Coorientador Faculdade deUniversidade Ciências,do Porto Paula Tamagnini, Professora Associada Orientador 2015 Departamento Programa Doutoral em Biologia de Plantas ÂngelaOliveiraMarisaBrito bioactive potential toproduce coast: diversity and from thePortuguese isolated Characterization

M. Vasconcelos, Professor Catedrático -

Instituto de Biologiae CelularMolecular

de Biologia

compounds

of

D

Aos meus pais

One should not pursue goals that are easily achieved. One must develop an instinct for what one can just barely achieve through one’s greatest efforts.

Albert Einstein

FCUP vii Characterization of cyanobacteria isolated from the Portuguese coast

Acknowledgments

The work presented here is the result of a close collaboration of several people (involved directly or indirectly) to whom I would like to express my gratitude.

First, I want to acknowledge my supervisor, Prof. Paula Tamagnini, for this opportunity and for the extraordinary support, guidance and patience (especially during the thesis writing) always expressed over all these years (not only during the PhD). Thank you for sharing your knowledge, for always keeping your door open and for the encouragement throughout this work (not always an easy path). I would like to acknowledge my co-supervisor Marta Vaz Mendes, for all the help, support, and valuable teachings. Thank you for spending time to teaching and helping me with the “PKS and NRPS world”. I would also like to thank my co-supervisor Prof. Vitor Vasconcelos for the opportunity. Thank you for the valuable advices, support and availability always expressed. I want to express my gratitude to Professor William H. Gerwick at the Scripps Institution of Oceanography, University of California San Diego, for giving me the opportunity to spend some time in his lab. It was a pleasure to work and learn so much on cyanobacteria secondary metabolites. Thank you so much for welcoming me in your lab and for showing me the wonderful world of marine natural products. A huge thank you to Vitor Ramos for the precious help and advices that were crucial for the achievement of the results presented in this thesis. Thank you for your support and friendship. I am particularly grateful to all co-authors that contributed to this work. Without you this work would not be possible. Prof. Arlete Santos, as well as Rui Fernandes and Francisco Figueiredo ( and Electron facility, IBMC), for all the help with the transmission electron microscopy. I would like to thank Cristina Vieira and Jorge Vieira for assistance with the phylogenetic analysis. To all present and former members of the Bioengineering and Synthetic Microbiology (BSM) Group, a big thank you for the wonderful work environment, the

viii FCUP Characterization of cyanobacteria isolated from the Portuguese coast

sharing of ideas, help, support, friendship, tips and laughs. Sharing my lab time with you all was a fun and constructive experience. Special thanks to Rita Mota. Thanks for all the help (not only in the work), patience, and for constantly showing me the things in a different way. Thanks for your friendship, and for being with me in all moments (good and bad ones). Everything would be harder without you! To Sara Pereira. Thank you for your help, support and friendship. Thanks for being always there. I will never forget that my “first steps” in the lab were with you! Thanks for everything! To Meritxell Notari. Thanks for your good mood and help either in the lab and at home. I think that you deserve the award for “best housemate”, because I know that it was not easy to share almost 24h per day with me. Thanks for your patience, friendship and all good moments shared. To Filipe Pinto. Thank you for your support and for being always available to help me (and anyone who asks). Thank you for helping me with images, computer problems and I could continue... (quem tem um Filipe tem tudo!). To Catarina Pacheco (thanks for the help and support over all these years), Paulo Oliveira (thanks for constructive discussions about the work and for your help with the GC), Steeve Lima, Eunice Ferreira, Carlos Flores, Marina Santos and José Pereira for the good work environment, the sharing of ideas and help. Thank you all. To the present and former members of the MCA and RCS groups. Thank you for your support and friendship. To all members of the Gerwick Laboratory, especially Evgenia Glukhov, Ozlem Demirkiran, Karin Kleigrewe and Enora Briand. Thank you for your precious help. To all members of LEGE, CIIMAR. Thank you for all the help, support and advices. To all my friends, especially Juliana Oliveira (thank you for being by my side and for your support that encouraged me to never look back) and all members of the “team”: Rita Mota, Meritxell Notari, Sara Pereira, Filipe Pinto, Ricardo Celestino (thanks for your help with the thesis, thank you for everything…except the spiders!), Joana Gaifem, Sérgio Ferreira, Nádia Gonçalves and Nelson Ferreira. Thank you for all the good moments spent together, dinners, parties, laughs. Thank you for being always there (in the good and bad times). Special thanks to Goody and Brian. Thank you for welcoming me in your house during my stay in San Diego, for your care and for all the good moments. You made everything easier; all the words won’t be enough to thank you. I would also like to acknowledge the Fundação para a Ciência e Tecnologia (FCT) for the PhD. Grant SFRH/BD/70284/2010.

FCUP ix Characterization of cyanobacteria isolated from the Portuguese coast

And for last, but for sure not least…

Quero agradecer à minha família, em especial aos meus pais (os meus pilares), pois sem eles nada disto teria sido possível. Não há palavras que descrevam tudo o que são para mim. Muito obrigada por estarem sempre comigo e apoiarem sempre as minhas decisões (mesmo por vezes não estarem totalmente de acordo). Obrigada pelo amor, compreensão, dedicação e pelos valores transmitidos. À minha irmã Sónia (desde sempre a minha melhor amiga) e ao meu cunhado Filipe. Obrigada pelo vosso apoio incondicional, por toda ajuda e por estarem sempre comigo. Vocês foram e são fundamentais para aquilo que sou hoje. Finalmente, como não poderia deixar de ser, aos meus sobrinhos Tiago Filipe e Ana Carolina (que nasceu mesmo na fase final de escrita da tese) que são sem dúvida o melhor do Mundo, são o meu orgulho.

x FCUP Characterization of cyanobacteria isolated from the Portuguese coast

This work was funded by FEDER funds through the Operational Competitiveness Programme - COMPETE and by national funds through FCT - Fundação para a Ciência e a Tecnologia under the projects FCOMP-01-0124-FEDER-010600 (PTDC/MAR/102258/2008), FCOMP-01-0124-FEDER-010568 (PTDC/MAR/099642/2008), FCOMP-01-0124-FEDER- 028314 (PTDC/BIA-MIC/2889/2012) and the PhD grant SFRH/BD/70284/2010 (POPH-QREN).

FCUP xi Characterization of cyanobacteria isolated from the Portuguese coast

List of publications

(Ao abrigo do disposto no número 2 do Artigo 8º do decreto-Lei nº 388/70)

This dissertation is based on the following publications and some unpublished results:

I - Brito Â., Ramos V., Seabra R., Santos A., Santos C.L., Lopo M., Ferreira S., Martins A., Mota R., Frazão B., Martins R., Vasconcelos V., Tamagnini P. 2012. Culture-dependent characterization of cyanobacterial diversity in the intertidal zones of the Portuguese coast: a polyphasic study. Systematic and Applied Microbiology 35: 110-119.

II - Brito Â., Mota R., Ramos V., Lima S., Santos A., Vieira J., Vieira C.P., Vasconcelos V.M., Tamagnini P. 2015. Isolation of cyanobacterial strains from the Portuguese Atlantic coast disclosures novel diversity. (Manuscript).

III - Brito Â., Gaifem J., Ramos V., Glukhov E., Dorrestein P.C., Gerwick W.H., Vasconcelos V.M., Mendes M.V., Tamagnini P. 2015. Bioprospecting Atlantic cyanobacteria for bioactive secondary metabolites reveals untapped chemodiversity. Algal Research 9: 218-226.

Other publications:

Pinho L.X., Azevedo J., Brito Â., Santos A., Tamagnini P., Vilar V.J.P., Vasconcelos V.

M., Boaventura R.A.R. 2015. Effect of TiO2 photocatalysis on the destruction of aeruginosa cells and degradation of -LR and . Chemical Engineering Journal 268: 144-152.

Publications (Chapter II and IV) are reproduced with the permission from the copyright holders.

FCUP xiii Characterization of cyanobacteria isolated from the Portuguese coast

Abstract

Cyanobacteria are photosynthetic prokaryotes with a wide geographical distribution and are present in a broad spectrum of environments, including extreme ones. They play an important role in the global carbon cycle as primary producers and some strains are able to fix atmospheric nitrogen, characteristic that confers them an advantage in nutrient-poor and nitrogen-depleted environments like the marine ones. Cyanobacteria are also recognized as a prolific source of secondary metabolites with biological activities. Some of these compounds are toxic to a wide array of organisms, including humans, but others exhibit promising activities with interest in biotechnological applications, namely in the pharmacological, cosmetic and agricultural fields. Despite the ecological importance of cyanobacteria and their biotechnological potential, little is known about the diversity of these organisms on the Portuguese continental coast. In this work, the diversity of cyanobacteria on the intertidal zones of the Portuguese coast was assessed. For this purpose nine beaches were sampled and 60 of the retrieved isolates were characterized using a polyphasic approach. Based on morphology, 35 morphotypes were identified being the most representative group the non-heterocystous forms, with a predominance of the filamentous Oscillatoriales/Subsection III. The 16S rRNA gene was partially sequenced for all the isolates and phylogenetic analyses were performed. For the majority of the isolates there was a broad congruence between the phenotypic and genotypic based identifications. Moreover, the 16S rRNA gene sequences of nine strains had less 97% similarity compared the ones available in the databases revealing novel cyanobacterial diversity. To further characterize these strains, the remaining part of 16S rRNA gene, the internal transcribed spacer (ITS) and the 23S rRNA gene were sequenced and additional phylogenetic analyses were carried out. Together with the morphological and ultrastructural data, this analysis showed that the unicellular isolate LEGE 07459 is related with the genera Geminocystis and Cyanobacterium (Chroococcales/Subsection I), but presents distinct characteristics indicating that could be a representative of a new genus. The isolate LEGE 07179, previously identified as Hyella sp., clusters with other Pleurocapsales/Subsection II forming a distinct branch. However, since this is the first sequence available for members of this genus it was not possible to further infer phylogenetic relationships. Concerning the filamentous strains, the new data indicated

xiv FCUP Characterization of cyanobacteria isolated from the Portuguese coast

that the isolate LEGE 06188 can, indeed, be assigned to the genus Leptolyngbya, while the strains LEGE 07167, 07176, 07157 and 06111 (previously assigned to L. fragilis, L. mycoidea, and Phormidium/Leptolyngbya, respectively) constitute a distinct cluster that probably should be assigned to a new genus, firstly isolated from the Portuguese coast. The screening for putative diazotrophs indicated that approximately 30% of our

isolates are potential N2-fixers, suggesting that these cyanobacteria may play an

important role in N2 fixation in the intertidal zones. In the PCR screening for producers (presence of the genes encoding involved in the production of microcystin, and ), no amplicons were obtained. However, the primers used were designed based on sequences from freshwater cyanobacteria therefore may not be the most appropriate for marine strains. Moreover, previous studies demonstrated that extracts of cyanobacterial strains also isolated from the Portuguese coast were toxic to marine invertebrates. To further evaluate the potential of these isolates to produce other secondary metabolites, a PCR screening for the presence of genes encoding polyketide synthases (PKS) and non-ribosomal peptide synthetases (NRPS) targeting the ketosynthase (KS) and adenylation (A) domains respectively, was performed. The PKS and NRPS genes were present in the majority of the isolates, with the PKS genes being more ubiquitous than the NRPS genes. The sequences obtained were used in an in silico prediction for PKS and NRPS systems. The sequences encoding for KS and A-domains led to the identification of biosynthetic gene clusters that code for 13 or 10 different compounds, respectively. In general, the identities were low or had no correspondence indicating that the corresponding biosynthetic gene clusters are probably not yet characterized. In addition, RT-PCR analyses revealed that both PKS and NRPS genes were transcribed under routine laboratory conditions in the majority of the isolates tested. To complement the previous results on the potential of our isolates to produce secondary metabolites, crude extracts of 57 of our isolates were analysed by LC- MS/MS. Their MS/MS spectra together with the MS/MS spectra of reference cyanobacterial compounds were used to generate a network. From this analysis it was possible to infer that our samples contained compounds related with naopopeptin and antanapeptin, an analogue of dolastatin 16 as well as malyngamide - type . A connection between microcystin, nodularin and nodes from different isolates was also observed, indicating that some of our strains might be able to produce compounds related with hepatotoxins. Moreover, there were clusters composed by nodes from our samples only, highlighting that our strains are able to produce novel compounds.

FCUP xv Characterization of cyanobacteria isolated from the Portuguese coast

Overall, this work provided new insights on the knowledge of cyanobacteria from the Portuguese Atlantic coast revealing novel biodiversity and highlighting their potential to fix N2. It was also demonstrated that these isolates are an untapped source of secondary metabolites, stressing the importance of exploring the potential of cyanobacterial strains from the temperate regions for the production of novel compounds.

Keywords: biodiversity; cyanobacteria; nitrogen fixation; NRPS; phylogeny; PKS; Portuguese coast; secondary metabolites.

FCUP xvii Characterization of cyanobacteria isolated from the Portuguese coast

Resumo

As cianobactérias são procariontes fotossintéticos com uma ampla distribuição geográfica e que se encontram numa grande diversidade de habitats, incluindo os ambientes extremos. As cianobactérias desempenham um papel importante no ciclo global do carbono como produtores primários e algumas estirpes são capazes de fixar o azoto atmosférico, característica que lhes confere uma vantagem em ambientes pobres em nutrientes e deficientes em compostos azotados como é o caso dos ambientes marinhos. As cianobactérias são também reconhecidas como uma fonte prolífica de metabolitos secundários com atividades biológicas. Alguns destes compostos são tóxicos para uma grande variedade de organismos, incluindo o Homem, enquanto outros têm aplicações biotecnológicas promissoras, em áreas como a farmacologia, a indústria de cosméticos e a agricultura. Apesar da importância das cianobactérias a nível ecológico e do seu potencial biotecnológico, sabe-se muito pouco sobre a sua diversidade na costa continental portuguesa. Neste trabalho, foi avaliada a diversidade de cianobactérias nas zonas intertidais da costa portuguesa. Com este propósito, foram amostradas nove praias e de entre os organismos isolados, 60 foram caracterizados utilizando uma abordagem polifásica. Com base na morfologia foram identificados 35 morfotipos, sendo as formas não- heterocísticas o grupo mais representativo, com predomínio das cianobactérias filamentosas (Oscillatoriales/Subseção III). Para todos os isolados foi sequenciado parcialmente o gene do 16S rRNA e foi realizada a respetiva análise filogenética. Para a maioria dos isolados houve uma grande congruência entre a identificação fenotípica e genotípica. Para além disso, os resultados obtidos mostraram que as sequências do gene do 16S rRNA de nove estirpes tinham menos de 97% de similaridade com as sequências disponíveis nas bases de dados, revelando assim nova diversidade. Para complementar a caracterização molecular destas estirpes foi ainda sequenciado a restante parte do gene do 16S rRNA, o espaçador interno transcrito (ITS) e o gene do 23S rRNA, e foram realizadas análises filogenéticas adicionais. Em conjunto com o estudo da morfologia e ultraestrutura, esta análise mostrou que o isolado unicelular LEGE 07459 está relacionado com os géneros Geminocystis e Cyanobacterium (Chroococcales/ Subseção I), apresentando contudo características distintas que indicam tratar-se de um novo género. O isolado LEGE 07179, anteriormente

xviii FCUP Characterization of cyanobacteria isolated from the Portuguese coast

identificado como Hyella sp., agrupa com outras Pleurocapsales/Subseção II, contudo forma um ramo separado. Como esta é a primeira sequência de um membro do género Hyella a estar disponível nas bases de dados, não foi possível inferir mais sobre as relações filogenéticas. No que diz respeito às estirpes filamentosas, os resultados indicam que o isolado LEGE 06188 pertence ao género Leptolyngbya, enquanto as estirpes LEGE 07167, 07176, 07157 e 06111 (anteriormente identificados como L. fragilis, L. mycoidea, e Phormidium/Leptolyngbya, respetivamente) constituem um grupo distinto, provavelmente um novo género, isolado pela primeira vez do litoral português. O rastreio de possíveis estirpes diazotróficas mostrou que aproximadamente 30% das cianobactérias isoladas são potenciais fixadoras de azoto atmosférico, o que sugere que estes organismos podem desempenhar um papel importante na fixação de

N2 nas zonas intertidais. Os resultados negativos obtidos no rastreio para possíveis produtoras de toxinas (PCR para presença de genes que codificam proteínas envolvidas na produção de microcistina, nodularina e saxitoxina) parecem indicar a ausência de estirpes tóxicas. No entanto, os oligonucleótidos utilizados foram desenhados com base em sequências de cianobactérias de água doce logo, podem não ser os mais apropriados para as estirpes marinhas. Além disso, estudos anteriores demonstraram que extratos de cianobactérias, também isoladas a partir da costa portuguesa, eram tóxicos para os invertebrados marinhos. Para continuar a avaliar o potencial destes isolados para a produção de outros metabolitos secundários, foi realizado um rastreio por PCR para a presença de genes que codificam as sintases de policétidos (PKS) e sintetases de péptidos não ribossomais (NRPS), tendo respetivamente como alvo os domínios de ketosintase (KS) e adenilação (A). Os resultados revelaram que os genes dos PKS e NRPS estão presentes na maioria dos isolados, sendo os genes dos PKS mais ubíquos que os genes dos NRPS. As sequências obtidas foram usadas numa predição in silico dos sistemas de PKS e NRPS. As sequências que codificam os domínios KS e A levaram à identificação de agrupamentos de genes cujos produtos podem sintetizar respetivamente 13 ou 10 compostos diferentes. Regra geral, os valores de identidade foram baixos ou não havia mesmo uma correspondência com as bases de dados indicando que estes agrupamentos de genes provavelmente ainda não foram caracterizados. Análises de RT-PCR revelaram também que os genes dos PKS e dos NRPS são transcritos em condições laboratoriais de rotina na maioria dos isolados testados. Para complementar os resultados obtidos relativamente à produção de metabolitos secundários, foram analisados por LC-MS/MS os extratos brutos de 57 dos isolados. Os espectros obtidos, bem como os espectros de compostos de referência, foram

FCUP xix Characterization of cyanobacteria isolated from the Portuguese coast utilizados para a construção de uma rede molecular (molecular networking). A partir desta análise, foi possível inferir que as nossas amostras continham compostos relacionados com naopopeptina e antanapeptina, um análogo da dolastatina 16, bem como compostos relacionados com malingamidas. Foi também possível observar uma ligação entre a microcistina e a nodularina e os pontos de conexão de diferentes isolados, o que indicam que algumas destas cianobactérias marinhas isoladas da costa portuguesa podem produzir compostos relacionados com hepatotoxinas. Na rede molecular foram, também, observados grupos formados exclusivamente por pontos de conexão relativos aos nossos isolados, o que indica a sua capacidade para produzir novos compostos. Em suma, este trabalho possibilitou a aquisição de novos conhecimentos sobre as cianobactérias da costa atlântica portuguesa, revelando nova biodiversidade e realçando o potencial de algumas estirpes para fixar azoto atmosférico. Foi também demonstrado que estes isolados são uma fonte inexplorada de metabolitos secundários, salientando a importância que a investigação de estirpes de cianobactérias das regiões temperadas pode ter na descoberta e produção de novos compostos.

Palavras-chave: biodiversidade; cianobactérias; costa portuguesa; filogenia; fixação de azoto; metabolitos secundários; NRPS; PKS.

FCUP xxi Characterization of cyanobacteria isolated from the Portuguese coast

Table of Contents

Acknowledgements vii

List of publications xi

Abstract xiii

Resumo xvii

Table of Contents xxi

List of Figures xxv

List of Tables xxix List of Abbreviations xxxi

Chapter I

General introduction 1

1. Introduction 3 1.1. Cyanobacteria 3 1.2. Taxonomy of cyanobacteria 5 1.3. Nitrogen fixation 8 1.4. Cyanobacterial secondary metabolites 10 1.4.1. Prediction of natural product biosynthetic gene clusters 17 1.4.2. (MS) based metabolomics: molecular networking 19 1.5. Cyanobacterial diversity in Portuguese waters and secondary metabolites production 20 1.6. Objectives 21

Chapter II

Culture-dependent characterization of cyanobacterial diversity in the intertidal zones of the Portuguese coast: a polyphasic study 23

Abstract 25 Introduction 25

xxii FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Material and Methods 26 Sampling sites 26 Cyanobacteria sampling, isolation, and culturing 26 Light and transmission electron microscopy (TEM) and morphological identification 26 DNA extraction, purification, PCRs and sequencing 27 Nucleotide sequence aceession numbers 27 Phylogenetic analysis 27

Results and Discussion 27

Morphological characterization 27 DNA sequence and phylogenetic analysis 28

Screening for putative N2 fixers and toxin producers 33 Conclusions 33

Acknowledgments 33

References 33 Supplementary Material I 35

Chapter III

Characterization of novel cyanobacterial strains isolated from the

Atlantic Portuguese coast 43

Abstract 46

Introduction 47

Material and Methods 49 Cyanobacterial strains and culture conditions 49 Light microscopy 49 Transmission electron microscopy (TEM) 49 Scanning electron microscopy (SEM) 50 DNA extraction, PCR amplification, cloning and sequencing 50 Nucleotide sequence accession numbers 51 Phylogenetic analysis 51 Secondary structure of ITS 52 Pigment analysis 52

FCUP xxiii Characterization of cyanobacteria isolated from the Portuguese coast

Nitrogenase activity 53 Results and Discussion 53 Isolate belonging to Chroococcales (Subsection I) 54 Isolate belonging to Pleurocapsales (Subsection II) 56 Isolate belonging to Oacillatoriales (Subsection III) 58 Capacity to fix atmospheric nitrogen and to produce secondary metabolites 65 Conclusions 65

Acknowledgments 66

References 67 Supplementary Material II 73

Chapter IV

Bioprospecting Atlantic cyanobacteria for bioactive secondary metabolites reveals untapped chemodiversity 79

Abstract 81

Introduction 81

Material and Methods 82 Cyanobacterial isolates and culture conditions 82 DNA extraction, PCR amplification and sequencing 82 Sequence analysis and in silico prediction of PKS and NRPS systems 82 Nucleotide sequence accession numbers 82 RNA extraction and RT-PCR 82 Extraction, LC-MS analysis and molecular networking generation 82 Results and Discussion 83 PCR screen for PKS and NRPS encoding genes 83 In silico prediction of PKS and NRPS systems 84 Transcriptional analysis 84 LC-MS and molecular networking studies 85 Conclusions 88

Acknowledgments 88

References 88 Supplementary Material III 91

xxiv FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Chapter V

General Discussion, Conclusions and Future Perspectives 99

5.1. General Discussion and Conclusions 101 5.2. Future perspectives 105

General References

References 107

FCUP xxv Characterization of cyanobacteria isolated from the Portuguese coast

List of Figures

Chapter I

Figure 1 Schematic representation of nitrogenase enzymatic complex. 9

Figure 2 Schematic representation of enzymatic domains in polyketide

synthases and nonribosomal peptide synthetases. 11 Figure 3 Examples of chemical structures of cyanobacterial metabolites. 13

Figure 4 Chemical structures of microcystin-LR, nodularin and saxitoxin. 14 Figure 5 Structural organization of the microcystin biosynthetic gene cluster

in Microcystis aeruginosa. 15 Figure 6 Structural organization of the nodularin biosynthetic gene cluster in Nodularia spumigena. 15 Figure 7 Structural organization of the saxitoxin biosynthetic gene cluster in Cylindrospermopsis raciborskii. 16 Figure 8 Graphical representation of a traditional network generated with cyanobacteria extracts and reference compounds. 20

Chapter II

Figure 1 Distribution of the isolates per taxonomic group. 28

Figure 2 Light micrographs illustrating the diversity of cyanobacterial morphotypes isolated from the intertidal zones of nine beaches on

the Portuguese coast. 30 Figure 3 Transmission electron micrographs of selected isolates from the

sampling sites. 31 Figure 4 Maximum-likelihood phylogenetic tree of partial 16S rRNA gene sequences from the isolates, reference cyanobacterial strains and

the outgroup Chloroflexus aurantiacus J-10-fl. 32

Figure S1 Light micrographs of the cyanobacterial isolates. 40 Figure S2 Light micrographs of the cyanobacterial isolates (cont.). 41

xxvi FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Figure S3 Neighbor-joining phylogenetic tree of the 16S rRNA gene sequences from the isolates, reference cyanobacterial strains and the outgroup Chloroflexus aurantiacus J-10-fl. 42

Chapter III

Figure 1 Micrographs of Geminocysis-like sp. LEGE 07459. 55 Figure 2 Micrographs of Hyella sp. LEGE 07179. 57

Figure 3 Micrographs of Leptolyngbya sp. LEGE 06188. 59

Figure 4 Micrographs of LEGE 07167, previously assigned to Leptolyngbya

fragilis. 60 Figure 5 Micrographs of LEGE 07176, previously assigned to Leptolyngbya fragilis. 60 Figure 6 Micrographs of LEGE 07157, previously assigned to Leptolyngbya mycoidea. 61

Figure 7 Micrographs of LEGE 06111, previously assigned to Phormidium/Leptolyngbya. 62 Figure 8 Absorption spectrum obtained for LEGE 06111, previously assigned to Phormidium/Leptolyngbya. 62

Figure 9 Minimum evolution tree of partial 16S-ITS-23S rRNA gene sequences from the seven isolates and strains retrieved from the BLAST analysis. 64

Figure S1 Minimum evolution (ME) phylogenetic tree of partial 16S-rRNA gene sequences from Geminocysis-like sp. LEGE 07459. 75 Figure S2 Minimum evolution phylogenetic tree of partial 16S rRNA gene sequence from the Hyella sp. LEGE 07179. 76 Figure S3 Minimum evolution phylogenetic tree of partial 16S- rRNA gene sequence from the Leptolyngbya sp. LEGE 06188. 77 Figure S4 Minimum evolution phylogenetic tree of partial 16S rRNA gene sequence from the LEGE 07176 (Leptolyngbya fragilis), LEGE 06111 (Phormidium sp.), LEGE 07167 (Leptolyngbya fragilis) and LEGE 07157 (Leptolyngbya mycoidea). 78

FCUP xxvii Characterization of cyanobacteria isolated from the Portuguese coast

Chapter IV

Figure 1 Frequency of the in silico predicted PKS and NRPS genes in 61 marine cyanobacterial strains from Portugal using the NaPDoS software for PKS genes and the PKS/NRPS analysis tool for the NRPS genes. 85 Figure 2 Transcription of genes encoding the KS and A domains of the PKS and NRPS genes evaluated by RT-PCR. 85

Figure 3 MS/MS-based molecular network of the extracts from 57 cultured cyanobacterial strains seeded with 105 reference compounds using a cosine similarity score cut-off of 0.6. 86

Figure S1 Proposed structure dolastatin16 analogue ion of 760. 97

FCUP xxix Characterization of cyanobacteria isolated from the Portuguese coast

List of Tables

Chapter I

Table 1 General characteristics of the cyanobacterial Orders/Subsections. 7

Table 2 Examples of cyanobacteria secondary metabolites and respective

biological activities. 12

Chapter II

Table 1 Localization and characteristics of the sampling sites. 26

Table 2 Target genes and oligonucleotide primers used in this study. 28 Table 3 Morphological identification and molecular analysis of the

cyanobacterial isolates. 29 Table S1 Morphological identification of the cyanobacteria isolated from

intertidal zones of the Portuguese coast. 37

Chapter III

Table 1 Cyanobacterial strains, culture collection code and sampling sites. 49 Table 2 Oligonucleotide primers used in this study. 51 Table 3 Secondary structure of 16S-23S rRNA internal transcribed (ITS) of Geminocystis-like sp. LEGE 07459. 56

Chapter IV

Table 1 Oligonucleotide primers used for RT-PCR targeting the cyanobacterial sequences encoding the KS (KS primers) and A (AD primers) domains of the PKS and NRPS genes, respectively. 83

xxx FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Table 2 PCR screening for sequences encoding the ketosynthase domain (KS) of PKS genes and the adenylation-domain (A) of NRPS genes in cyanobacterial isolates from intertidal zones of the Portuguese coast. 84 Table S1 Cyanobacterial KS domain sequence based prediction of PKS using the NaPDoS software. 93

Table S2 Cyanobacterial A domain sequence based prediction of NRPS using the PKS/NRPS analysis software. 96

FCUP xxxi Characterization of cyanobacteria isolated from the Portuguese coast

List of Abbreviations

A Adenylation ACP Acyl carrier Adp Anabaenopeptilide antiSMASH Antibiotics and secondary metabolite analysis shell ARA Acetylene reduction assay AT Acyltransferase ATP Adenosine triphosphate Bleom Bleomycin bp base pairs C Condensation

C2H2 Acetylene CCAP Culture Collection of Algae and Protozoa Cch Coelichelin cDNA complementary DNA

CH2Cl2 Dichloromethane

CH3CN Acetonitrile Chl a Chlorophyll a CNI Close-neighbor-interchange Cur Curacin Cy Cyclisation CyanoGEBA Genomic Encyclopedia of Bacteria and Archaea DH Dehydratase Dhoya 2,2-dimethyl-3-hydroxy-7-octynoic acid DNA Deoxyribonucleic acid E Epimerization EDTA Ethylenediaminetetraacetic acid Epo Epothilone EPS Extracellular polymeric substances ER Enoyl reductase F Formlyation GC Gas chromatograph

xxxii FCUP Characterization of cyanobacteria isolated from the Portuguese coast

HMM Hidden Markov Model Hmoya 3-hydroxy-2-methyl-7-octynoic acid HSAF Heat stable antifungal factor ITS Internal transcribed spacer Jam Jamaicamide Kirr Kirromycin KR Ketoreductase KS Ketosynthase LC-MS Liquid - mass spectrometry LEGE Laboratório de Ecotoxicologia Genómica e Evolução Lnm Leinamycin Lovas Lovastatin m/z mass-to-charge ratio Mcy Microcystin ME Minimum Evolution MeOH Methanol ML Maximum likelihood Mo Molybdenium MS Mass spectrometry MS/MS Tandem MS Mt N-methyllation Mta Myxothiazol Mxa Myxalamide Myc Mycosubtilin

N2 Dinitrogen NaCl Sodium chloride NaPDoS Natural product domain seeker NCBI National center for biotechnology information Nda Nodularin

NH3 Ammonia NJ Neighbor - Joining NMR Nuclear magnetic resonance Nos Nostopeptolide NRP Non-ribosomal peptide NRPS Non-ribosomal peptide syntethase

FCUP xxxiii Characterization of cyanobacteria isolated from the Portuguese coast

ORF Open reading frame Ox Oxidoreductase PC Phycocyanin PCP Peptidyl carrier protein PCR Polymerase chain reaction PE Phycoerythrin Phosphitricin PK Polyketide PKS Polyketide synthase PP1 Protein phosphatase 1 PP2A Protein phosphatase 2A PSP Paralytic shellfish Pvd Pyoverdin R Reduction rDNA Ribosomal DNA RNA Ribonucleic acid RP Ribosomal peptide RPS Released polysaccharides RT-PCR Reverse transcription polymerase chain reaction RuBisCO Ribulose-1,5-bisphosphate carboxylase/oxygenase Saf Saframycin SEM Scanning electron microscopy Srf Surfactin SST Sea surface Sti Stigmatellin Sxt Saxitoxin TDC Thermal conductivity detector TE Thioesterase TEM Transmission electron microscopy Tyc Tyrocidine UV Ultra violet V Vanadium Vir Virginiamycin

xxxiv FCUP Characterization of cyanobacteria isolated from the Portuguese coast

CHAPTER I

General Introduction

FCUP 3 Characterization of cyanobacteria isolated from the Portuguese coast

1. Introduction

1.1 Cyanobacteria

Cyanobacteria are ancient photosynthetic prokaryotes that are among the most successful and oldest forms of life (Schopf, 2000). It is widely accepted that they were the first group of organisms with the capacity to perform oxygenic photosynthesis, a process that radically changed the atmosphere and the living conditions on Earth (Whitton & Potts, 2000; Shi & Falkowski, 2008). Geological records indicate that the biochemical capacity to use water as electron donor for photosynthesis arose in our planet’s history at least 2450-2320 million years ago, in a common ancestor of cyanobacteria (Tomitani et al., 2006; Knoll, 2008), and it is estimated that nowadays cyanobacteria still contribute up to 30% of the annual production (Cavalier- Smith, 2006; DeRuyter & Fromme, 2008). Cyanobacteria are also considered the photosynthetic ancestors of chloroplasts, a process that occurred by an endosymbiotic event (Bergman et al., 2008b). This hypothesis has been supported by solid evidences, such as phylogenetic analysis that showed that the chloroplasts form a monophyletic lineage closely related to cyanobacteria in particular to the nitrogen-fixing filamentous strains (Deusch et al., 2008; Falcón et al., 2010; Ochoa de Alda et al., 2014). Cyanobacteria play a key role in the global carbon cycle as important primary producers and the diazotrophic strains are fundamental to the nitrogen cycle, mainly in oceans (Díez et al., 2007; Knoll, 2008; Díez & Ininbergs, 2014). Moreover, they can also form symbiotic associations with a range of eukaryotic hosts including plants, fungi, sponges and protists, providing combined nitrogen and/or carbon to the host (Adams & Duggan, 2008; Bergman et al., 2008a). During evolution, a complexity and variety of morphologies as well as eco- physiological properties emerged, placing cyanobacteria among the more diverse group of prokaryotes (Shi & Falkowski, 2008), occupying a wide variety of environments including freshwater, terrestrial, and marine habitats. They can also be found in extreme habitats such as hot springs, deserts, hypersaline and polar lakes. The ability to colonize these ecosystems can be attributed to their morphological and metabolic versatility (Potts, 1999; Miller & Castenholz, 2000; Whitton & Potts, 2000). Cyanobacteria display different morphologies, including unicellular, colonial and filamentous forms. Some filamentous strains have the ability to produce hormogonia,

4 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

chains of 5-15 cells that can be distinguished from the parent filament by differences in size, shape or motility. Their primary function is short-distance dispersal (migrating phase) but they are also essential for host infection in cyanobacteria symbioses (Whitton & Potts, 2000; Castenholz, 2001; Maldener et al., 2014). Moreover, some filamentous cyanobacteria can differentiate heterocysts, cells specialized in nitrogen fixation, and produce akinetes - “resting cells” (Castenholz, 2001). Cyanobacteria display a wide variety of colours, ranging from blue-green to violet/brown, due to the different combinations of photosynthetic pigments: chlorophyll a, carotenoids and phycobiliproteins (allophycocyanin, phycocyanin, and phycoerythrin) (DeRuyter & Fromme, 2008). Chlorophyll a and phycobiliproteins are the predominant pigments, however, some prochlorophytes (e. g. Prochloron didemni, Prochlorothix hollandica, Prochlorococcus marinus), possess chlorophyll b, and Acaryochloris marina, even contains chlorophyll d (Post, 2006; Swingley et al., 2008). Recently, the presence of chlorophyll f was also reported in a filamentous cyanobacteria isolated from stromatolites (Chen et al., 2010; Chen et al., 2012). Cyanobacteria possess a unique wall that combines characteristics of Gram- negative bacteria, like the presence of outer membrane and lipopolysaccharides, with a thick and highly cross-linked peptidoglycan layer similar to Gram-positive bacteria (Hoiczyk & Hansel, 2000). Furthermore, many strains are able to produce extracellular polymeric substances (EPS) mainly constituted by heteropolysaccharides. These EPS can remain associated with the cell surface as sheaths, capsules and slimes or be released into the surrounding environment as released polysaccharides (RPS) (De Philippis & Micheletti, 2009; Pereira S. et al., 2009). Several roles can be attributed to the EPS such as the protection of the cells against desiccation and UV-radiation, formation of biofilms, and concentration of nutrients and metal ions (Rossi & De Philippis, 2015). In the costal intertidal zones where cyanobacteria are exposed to extremely stressful conditions such as desiccation, temperature and salinity fluctuations and often form cohesive mats, EPS are believe to play both protective and structural roles (Stal, 2000; Díez et al., 2007). Cyanobacteria are also known as a prolific source of secondary metabolites. Some of these compounds are toxic to a wide array of organisms, including humans (Wiegand & Pflugmacher, 2005; Dittmann et al., 2013). Cyanotoxins are mainly produced by cyanobacteria that form water-blooms induced by increased levels of nutrients (phosphorus, nitrogen) in close aquatic ecosystems due to anthropogenic influence. In the aquatic ecosystem these accumulate within cyanobacterial cells, but can be released in high concentrations during cell lysis causing countless among wild and domestic animals all over the world (Sivonen & Jones, 1999).

FCUP 5 Characterization of cyanobacteria isolated from the Portuguese coast

Swimming in water bodies, drinking water or consuming dietary supplements that have accumulated the toxins are also risky to human and animals (Dittmann et al., 2013). The most fatal case of human intoxication was reported from a hemodialysis unit in Caruaru (Brazil), where several patients died with symptoms of neurotoxicity and hepatotoxicity after exposure to contaminated water (Jochimsen et al., 1998). Understandably, the majority of early cyanobacterial metabolites research focused on toxins due to their obvious deleterious effects on ecosystem equilibrium and human health. Nevertheless, cyanobacteria can also produce compounds with potential for biotechnological applications, in particular in the pharmacological field. A wide range of secondary metabolites exhibiting promising activities, such as anticancer, antibacterial, antiviral and antifungal have been reported (Nunnery et al., 2010; Singh et al., 2011; Shishido et al., 2015). Among marine cyanobacteria, the most prolific sources for the discovery of secondary metabolites have been the tropical species. It has been reported that a single genus can produce an array of secondary metabolites with different structures classes and bioactivities, for e.g. the genus Moorea, formally known as Lyngbya (Engene et al., 2012), produces jamaicamides (Edwards et al., 2004), malyngamides (Cardellina et al., 1979) and apratoxins (Gutierrez et al., 2008). From a biotechnological perspective cyanobacteria are receiving a growing attention as promising “low cost” microbial cell factories (e.g. for the sustainable production of secondary metabolites and biofuels) due to their simple nutritional requirements, their metabolic plasticity and availability of tools for their genetic manipulation (Wase & Wright, 2008; Lindblad et al., 2012).

1.2 Taxonomy of cyanobacteria

Traditionally, cyanobacteria were mainly classified based on their morphological characteristics, according to the International Code of Botanical Nomenclature. However, since their prokaryotic nature was revealed, a classification more consistent with prokaryotic systematics was included by Rippka (1979) and later on by Castenholz (2001). Currently, the taxonomy of these organisms is still a controversial subject, with two prevailing approaches, the so-called botanical (Geitler, 1932; Komárek & Anagnostidis, 1989; Komárek & Anagnostidis, 1998; Komárek & Anagnostidis, 2005) and the bacterial (Rippka et al., 1979; Castenholz, 2001). According to the botanical approach, cyanobacteria are classified into five Orders (Geitler, 1932; Komárek & Anagnostidis, 1989; Komárek & Anagnostidis, 1998; Komárek & Anagnostidis, 2005) that broadly coincide with the Subsections of the

6 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

bacterial one (Rippka et al., 1979; Castenholz, 2001): Chroococcales (Subsection I), Pleurocapsales (Subsection II), Oscillatoriales (Subsection III), Nostocales (Subsection IV) and Stigonematales (Subsection V). Briefly, members of Chroococcales (Subsection I) are unicellular cyanobacteria that reproduce by equal binary fission or by budding. Cells are spherical, ellipsoidal or rod- shaped (0.5-30 µm diameter), fission occurs in one or more successive planes and cells are single or in aggregates. Colonial forms are held together by mucilage or multilaminated sheath layers (Castenholz, 2001). Pleurocapsales (Subsection II) comprises the unicellular cyanobacteria that can undergo multiple fission, leading to the formation of small, easily dispersed cells called baeocytes, a feature that distinguishes them from other groups of cyanobacteria (Castenholz, 2001). Oscillatoriales (Subsection III), include filamentous cyanobacteria in which the trichomes are composed only by vegetative cells and are uniseriate since undergo binary fission in a single plane. The terminal cell of the trichome may be tapered, with or without a cap or calyptra. The trichome diameter may range from 1 to >100 µm and it can be surrounded by a sheath (Castenholz, 2001). Nostocales (Subsection IV) comprise filamentous cyanobacteria that divide exclusively by binary fission in one plane and some of the vegetative cells can differentiate into heterocysts or akinetes. In the absence of combined nitrogen a small fraction of the vegetative cells differentiate into heterocysts that can be terminal or intercalar (Castenholz, 2001). Stigonematales (Subsection V) include filamentous cyanobacteria that are able to divide by binary fission in multiple planes, displaying true branching. Longitudinal and oblique cells divisions occur in addition to transverse cell divisions and this results in true branching and in multiseriate trichomes (two or more rows of cells) (Castenholz, 2001) (for a summary see Table 1). Another important discriminatory taxonomic character is the thylakoids arrangement, a feature that can only be visualized using transmission electron microscopy. This arrangement can be parietal, radial or irregular (Liberton & Pakrasi, 2008). The only known cyanobacterium that lacks thylakoids is the unicellular Gloeobacter violaceus (Nakamura et al., 2003). In terms of ultrastructure, different sub-cellular compartments and inclusion bodies can also be observed in cyanobacteria cells, e.g. the carboxyssomes which are polyhedral bodies that contain enzymes involved in carbon fixation (RuBisCO) and a variety of reserve materials can also be visible as cytoplasmatic inclusions, such as glycogen, polyphosphate, and cyanophycin (nitrogen) (Castenholz, 2001). The gas vesicles, occurring mainly in planktonic strains, provide buoyancy allowing the organisms to perform vertical migrations.

FCUP 7 Characterization of cyanobacteria isolated from the Portuguese coast

Table 1. General characteristics of the cyanobacterial Orders/Subsections.

Order/ General characteristics Genera examples Subsection Cyanothece Chroococcales/ Reproduction by binary fission (one Gloeothece Unicelullar Subsection I or more planes) or by budding. Synechocystis Single cells or

colonial Reproduction by multiple fission Chroococcidiopsis Pleurocapsales/ with production of small daughter aggregates Myxosarcina Subsection II cells - baeocytes, or by multiple Pleurocapsa plus binary fission. Leptolyngbya Reproduction by binary fission in Oscillatoriales/ Lyngbya one plane; trichomes composed Subsection III exclusively by vegetative cells. Oscillatoria Pseudanabaena Filamentous Reproduction by binary fission in one plane; trichomes composed of Anabaena Trichome Nostocales/ vegetative cells that can Calothrix (filament) of Subsection IV cells: differentiate into heterocysts or Nostoc uniseriate or akinetes. multiseriate Reproduction by binary fission in more than one plane originating Chlorogloeopsis Stigonematales/ multiseriate trichomes (true branching); trichomes composed of Fisherella Subsection V vegetative cells that can Stigonema differentiate into heterocysts or akinetes.

In the last decades, the advances in molecular biology lead to the use of molecular markers to provide insight into the identification and to infer phylogenetic relationships between cyanobacteria. For cyanobacteria as for other bacteria, the small subunit ribosomal RNA (16S rRNA) gene sequence is the most commonly used as molecular marker (Castenholz, 2001). The 16S rRNA gene is reliable and a vast number of sequences are available for comparisons in the databases. However, this marker have limited resolution at the species level, due to its slow evolution (Konstantinidis & Tiedje, 2007). Consequently, several other less conserved markers providing complementary information to the 16S rRNA gene are also used (Neilan et al., 1995; Rajaniemi et al., 2005; Sherwood & Presting, 2007; Singh et al., 2013), for instance the genes of the phycocyanin operon encoding the two phycobiliprotein subunits (cpcB and cpcA) and the internal transcribed spacer region (ITS) separating the 16S and 23S ribosomal genes (Neilan et al., 1995; Rocap et al., 2002; Haverkamp et al., 2008). The 16S-23S ITS region is highly variable and have demonstrated to be useful for phylogenetic studies and identification of new taxa (Rocap et al., 2002; Casamatta et al., 2006). The 16S-23S spacer region contains many conserved domains (D1-D5, Box A, Box B) and variable regions (V1-V3). In addition, this region often contains one or two tRNA genes (tRNAGlu, tRNAAla or both tRNAAla and tRNAIle) (Iteman et al., 2000). In addition, the

8 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

nitrogenase structural genes (see below), in particular nifH (encoding the dinitrogenase reductase) are also widely used for nitrogen fixing strains/communities (Singh et al., 2013). Overall, the classification of cyanobacteria is still a complex task, since there are several species defined only by morphology, as well as many cyanobacterial gene sequences without a corresponding morphological description (Castenholz, 2001). There are numerous species morphologically indistinguishable but that do not share a common evolutionary history (molecular phylogeny is more diverse than morphological), therefore the biodiversity is underestimated using the criterion of morphological variability only. This discrepancy resulted in “cryptic species” (distinct species classified as a single species) (Casamatta et al., 2003). In addition, the morphological characters can change in different environmental or growth conditions and even be lost during cultivation (morphological plasticity) (Komárek, 2014). Consequently, a polyphasic approach, combining morphological, ecological and molecular data is considered the best one for the determination and description of cyanobacterial taxa (Garcia-Pichel, 2008; Komárek, 2010).

1.3 Nitrogen fixation

In cyanobacteria, as in any diazotrophic bacteria, the reduction of dinitrogen (N2) to

ammonia (NH3) is carried out by an enzymatic complex - the nitrogenase - and the process is coupled with the formation of molecular (Berman-Frank et al., 2003). Nitrogenase is a highly conserved enzyme complex consisting of two components, a dinitrogenase (iron-molybdenum protein) and a dinitrogenase reductase (iron protein) (Figure 1). Dinitrogenase is a α2β2 heterotetramer, and the α and β subunits are encoded by nifD and nifK genes, respectively. The dinitrogenase reductase, encoded by nifH, is a homodimer (Orme-Johnson, 1992; Berman-Frank et al., 2003). In addition, some diazotrophic organisms synthesize alternative dinitrogenases that contain vanadium (V) or iron, instead of molybdenium (Mo) (Eady, 1996). In cyanobacteria the alternative nitrogenases are rare but the presence of a vanadium containing enzyme was demonstrated in some Anabaena strains (Thiel, 1993; Boison et al., 2006). Similarly to others organisms, these cyanobacteria also possess the “conventional” Mo- containing nitrogenase, but under Mo deficiency they express the V-nitrogenase. It is

known that alternative nitrogenases are less efficient than the Mo-enzyme in N2 reduction (Stal & Zehr, 2008).

FCUP 9 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.1 - Schematic representation of nitrogenase enzymatic complex. Adapted from Tamagnini et al. (2007).

Since the nitrogenase is irreversibly inactivated by molecular oxygen, nitrogen fixation occurs in anoxic or microaerobic conditions. Since cyanobacteria are the only diazotrophs that produce O2 as a by-product of the photosynthesis, they had to develop strategies to protect their nitrogenases. The main strategies are usually the temporal and spatial separation, but there are other mechanisms (for more details on this subject see Berman-Frank et al., 2003). Temporal separation (day/night) between photosynthetic oxygen evolution and nitrogen fixation seems to be the most common strategy adopted by non-heterocystous cyanobacteria (Huang et al., 1999; Stal, 2000; Berman-Frank et al., 2003), while spatial separation is achieved in filamentous strains that are able to differentiate heterocysts (Böhme, 1998; Stal, 2000; Berman-Frank et al., 2003). Basically, the heterocyst has a thick cell wall that limits the diffusion of oxygen, and it lacks photosystem II activity (Stal, 2000). In the marine filamentous non- heterocystous Trichodesmium spp., a spatial separation occurs without any obvious cellular differentiation and only a small fraction of cells along the filament are capable of nitrogen fixation (Bergman et al., 1997; Bergman et al., 2013).

There are diverse cyanobacteria in terrestrial and aquatic ecosystems that can fix N2 and generally they are regarded as the major N2-fixing organisms in the open ocean

(Zehr, 2011). In the intertidal zones, cyanobacteria have also an important role in N2 fixation in microbial mats which are often nutrient-poor and nitrogen depleted environments (Severin et al., 2010). The identification of N2-fixing cyanobacteria strictly from morphology is an impossible task, with the obvious exception of filamentous heterocyst-forming cyanobacteria, and for this reason, a genetic approach that target the genes encoding the nitrogenase has been used to detect putative N2-fixing strains (Zehr et al., 1998; Zehr, 2011). As mentioned previously, the structural genes encoding the nitrogenase, nifHDK, with particular focus on nifH are often used as molecular markers (Singh et al., 2013) and its presence and expression is also been used to estimate the contribution of certain microbial mats to N2 fixation (Short & Zehr, 2005).

10 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

1.4 Cyanobacterial secondary metabolites

Cyanobacterial secondary metabolites display a wide range of chemical diversity (peptides, polyketides and alkaloids) and may have different bioactivities, such as anti- cancer, anti-fungal, neurotoxic and hepatotoxic. This diversity possibly reflects the group long evolutionary history and their adaptation to different ecosystems (Méjean & Ploux, 2013). Marine environments remain a major source for an unmeasured biological and chemical diversity and, during the last few decades, marine cyanobacteria have been increasingly recognized as a prolific source of secondary metabolites (Jones et al., 2009; Tan, 2010; Tan, 2013a). Nearly 800 compounds have been identified in marine cyanobacteria, with the filamentous Oscillatoriales (Subsection III) contributing with almost half of the reported compounds (49%), Nostocales (Subsection IV) with 26%, and Stigonematales (Subsection V) with merely 4%. Among the unicellular, the Chroococcales (Subsection I) contribute 15% and the Pleurocapsales (Subsection II) with about 6% (Gerwick et al., 2008; Jones et al., 2010). In part, this can be explained by the fact that the filamentous cyanobacteria grow at relatively high densities in coastal ecosystems forming macroscopic clumps, whereas the unicellular cyanobacteria usually need to be cultivated to produce enough biomass for chemical and biological studies (Leão et al., 2013a). Among the cyanobacterial secondary metabolites, non-ribosomal peptides (NRPs) and polyketides (PKs), synthesized by the modular multienzymatic complexes non- ribosomal peptide syntethases (NRPSs) and polyketide synthases (PKSs), respectively (Barrios-Llerena et al., 2007; Wang et al., 2014), are particularly relevant. PKSs can be divided in three major classes: type I PKSs that are multifunctional enzymes organized in modules, each of one harbouring a set of distinct, non-iteratively acting activities responsible for the catalysis of one cycle of polyketide chain elongation (e.g. erythromycin A); type II PKSs that are multienzyme complexes that carry a single set of iteratively acting activities (e.g. tetracenomycin); and type III PKSs, that are homodimeric enzymes that essentially are iteratively-acting condensing enzymes (e.g. flavolin). Type I and II PKSs use acyl carrier protein (ACP) to activate the acyl-CoA substrates whereas type III PKSs act directly on the acyl-CoA substrates, independent of ACP (Shen, 2003; Cheng et al., 2009). The majority of the bioactive metabolites isolated so far from cyanobacteria are type I PKs, NRPs or a hybrid of these two. Type I PKS and NRPS are characterized by a modular organization in which each module is responsible for the incorporation of a structural or amino acid unit,

FCUP 11 Characterization of cyanobacteria isolated from the Portuguese coast respectively. A minimal type I PKS module consists of a ketosynthase (KS), acyltransferase (AT), and acyl carrier protein (ACP) domains. Additional domains such as ketoreductase (KR), dehydratase (DH) and enoyl reductase (ER) can also be present that will lead to different reduction states of the incorporated keto groups. A minimal NRPS module is composed of an amino acid-activating adenylation (A) domain, a peptidyl carrier protein (PCP) domain for thioesterification of the activated amino acid and a condensation (C) domain for transpeptidation between the aligned peptidyl and amino acyl thioesters. Along with these domains, additional domains [epimerization (E), oxidoreductase (Ox), cyclisation (Cy), N-methyllation (Mt), formlyation (F) and reduction (R)] can also be present, introducing structural diversity by modifying the growing chain (Figure 2) (Barrios-Llerena et al., 2007; Wase & Wright, 2008; Kehr et al., 2011). Although, the majority of the compounds are synthesized from NRPS (or mixed with PKS), cyanobacteria are also known to produce a group of ribosomally synthesized and post translationally modified peptides (ribosomal peptides - RPs), such as cyanobactins and (Sivonen et al., 2010; Ziemert et al., 2010).

Fig.2 - Schematic representation of enzymatic domains in polyketide synthases (a) and nonribosomal peptide synthetases (b). C: Condensation domain; A: Adenylation domain; PCP: Peptidyl carrier protein; MT: Methyltransferase; E: Epimerase; AT: Acyltransferase; ACP: Acyl carrier protein; KS: Ketosynthase; KR: Ketoreductase; DH: Dehydratase; ER: Enoyl reductase; TE: Thioesterase. Adapted from Kehr et al. (2011).

12 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Some examples of secondary metabolites produced by cyanobacteria and their biological activities are given in Table 2. The diversity of their chemical structures is

depicted in Figure 3.

Table 2. Examples of cyanobacterial secondary metabolites and respective biological activities.

Cyanobacteria Compound Bioactivity Reference Genus Aeruginosins Planktothrix Anticancer Ishida et al., 2009 Microcystis Anatoxin-a/ Anabaena Méjean et al., 2010 Homoanatoxin-a Oscillatoria Rantala-Ylinen et al., 2011 Apratoxins Lyngbya Anticancer Grindberg et al., 2011 Aurilide B, C Lyngbya Anticancer Han et al., 2006 Bisebromoamide Lyngbya Anticancer Teruya et al., 2009 Carmaphycins A, B Symploca Anticancer Pereira et al., 2012 Leptolyngbya Anticancer Medina et al., 2008 Cryptophycin Nostoc Anticancer Magarvey et al., 2006 Curacin A Lyngbya Anticancer Chang et al., 2004 Cyanovirin-N Nostoc Anti-viral Boyd et al., 1997 Dolastatin 10 Symploca Anticancer Luesch et al., 2001 Gallinamide A Schizothrix Anti-malarial Linington et al., 2008 Hassalidins Anabaena Antifungal Vestola et al., 2014 Nostoc Hectochlorin Lyngbya Anticancer Ramaswamy et al., 2007 Hoiamides Lyngbya Neurotoxin Pereira A. et al., 2009 Symploca (neuromodelating Choi et al., 2010 Oscillatoria agent) Jamaicamide Lyngbya Neurotoxin Edwards et al., 2004 (neuromodelating agent) Largazole Symploca Anticancer Taori et al., 2008 Lyngbyatoxins Lyngbya Dermatotoxin Edwards & Gerwick, 2004 Malyngamide 2 Lyngbya sp. Anti-inflammatory Malloy et al., 2010 Microcystin Microcystis Hepatotoxin Tillett et al., 2000 Planktothrix Rouhiainen et al., 2004 Anabaena Nodularin Nodularia Hepatotoxin Moffitt & Neilan, 2004 Anabaena Saxitoxin Neurotoxin Kellmann et al., 2008b Aphanizomenon Somoscystinamide A Lyngbya Anticancer Wrasidlo et al., 2008 Symplostatin 4 Symploca sp. Anti-malarial Conroy et al., 2010 Veraguamides Oscillatoria Anticancer Mevers et al., 2011

FCUP 13 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.3 - Examples of chemical structures of cyanobacterial metabolites (for more information see also Table 2).

14 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

As mentioned previously, cyanobacteria can produce a variety of toxins (cyanotoxins) and the characterization of synthetase gene clusters allowed the development of molecular methods to detect and differentiate toxic cyanobacterial strains (Jungblut & Neilan, 2006; Kellmann et al., 2008b). The majority of the cyanotoxins are associated with cyanobacteria from fresh and brackish waters (Sivonen & Börner, 2008) but some marine cyanobacteria are known to produce toxins, namely dermatotoxins (Codd et al., 2005). Moreover, it was also demonstrated that extracts of marine Synechocystis and Synechococcus strains collected from Portuguese waters were toxic to marine invertebrates (Martins et al., 2007). Cyanotoxins can be classified in four functional groups according to their primary target organ or effects, being designated as hepatotoxins (e.g. microcystin, nodularin), (e.g. anatoxin, saxitoxin), cytotoxins (e.g. cylindrospermopsin), and dermatotoxins (e.g. , lyngbyatoxin A) (Wiegand & Pflugmacher, 2005; Dittmann et al., 2013). The hepatotoxins (microcystin and nodularin) and neurotoxins (saxitoxin) are between the most problematic toxins (Codd et al., 2005). Microcystin and nodularin are cyclic peptides (Figure 4a and 4b) and are both inhibitors of the eukaryotic protein phosphatases 1 and 2A (PP1, PP2A) (Runnegar et al., 1995). While microcystin is produced by different genera including Microcystis, Anabaena, Planktothrix and Nostoc (Sivonen & Jones, 1999), nodularin seems to be restricted to the genus Nodularia (Moffitt & Neilan, 2001).

Fig.4 - Chemical structures of microcystin-LR (a), nodularin (b) and saxitoxin (c). Adapted from Dittmann et al. (2013).

Microcystin is the most extensively studied cyanobacterial secondary metabolite, due to its distribution and . About 80 structural variants have been identified, mostly differing in the amino acids positions X and Z (Sivonen & Jones, 1999), being microcystin-LR (L-leucine (X) and L-arginine (Z) as the variable amino acids) the most

FCUP 15 Characterization of cyanobacteria isolated from the Portuguese coast common isoform, whereas only a few variants of have been identified (Beattie et al., 2000). The gene cluster involved in the biosynthesis of microcystin was identified in Microcystis aeruginosa (Nishizawa et al., 2000; Tillett et al., 2000) making it the first cyanobacterial hybrid PKS/NRPS cluster to be characterized. This cluster has also been identified in several strains such as Planktothrix spp. (Christiansen et al., 2003) and Anabaena strain 90 (Rouhiainen et al., 2004). The 55 kilobase (kb) cluster of Microcystis aeruginosa PCC 7806 comprises ten open reading frames (ORF) (mcyA to J) (Figure 5). mcyA to mcyC encode five NRPS modules, mcyD encodes two modules type I PKS, and mcyE and mcyG code for hybrid NRPS-PKS proteins (Tillett et al., 2000). The mcy cluster in Planktothrix agardhii also contains the gene mcyT that encodes a second thioesterase domain (Christiansen et al., 2003).

Fig.5 - Structural organization of the microcystin biosynthetic gene cluster in Microcystis aeruginosa. Genes coding for polyketide synthase (hatched), nonribosomal peptide synthetase (black), and tailoring enzymes (w hite) are indicated. Adapted from Moffitt & Neilan (2004).

Nodularin, other hybrid PKS/NRPS, is structurally closely related to microcystin sharing a highly similar biosynthetic pathway. This cluster has been particularly studied in Nodularia spumigena, 48 kb comprising nine ORFs (ndaA to ndaI) (Figure 6). ndaA and ndaB encode three NRPS modules, ndaD encodes two PKS modules, ndaC and ndaF encode hybrid NRPS-PKS proteins and ndaE and ndaGHI encode tailoring enzymes (Moffitt & Neilan, 2004).

Fig.6 - Structural organization of the nodularin biosynthetic gene cluster in Nodularia spumigena. Genes encoding polyketide synthase (hatched), nonribosomal peptide synthetase (black), and tailoring enzymes (w hite) are indicated. Adapted from Moffitt & Neilan (2004).

16 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Saxitoxin is a neurotoxin alkaloid (Figure 4c), which are also known as paralytic shellfish (PSPs) due to their occurrence and association with seafood (Dittmann et al., 2013). are among the most potent toxins and are considered a serious toxicological health risk to humans, animals and ecosystems worldwide (Kaas & Henriksen, 2000). These toxins block the voltage-gated sodium and calcium channels (Kao & Levinson, 1986; Wiegand & Pflugmacher, 2005), which prevent the transduction of neuronal signals, and thus cause muscular paralysis (Kellmann et al., 2008a). The saxitoxin production has been reported for several cyanobacteria genera, notably Aphanizomenon, Anabaena, and Lyngbya (Dittmann et al., 2013) and more than 30 analogues have been identified (Kellmann et al., 2008a).

The gene cluster involved in the saxitoxin biosynthesis was initially identified in Cylindrospermopsis raciborskii (Kellmann et al., 2008b) and subsequently in several other strains (Mihali et al., 2009). Unlike NRPS and PKS biosynthesis, the saxitoxin cluster encodes a series of monofunctional enzymes responsible for building the saxitoxin core and tailoring enzymes (D'Agostino et al., 2014). In Cylindrospermopsis raciborskii, this cluster (35 Kb) encodes genes involved in the biosynthesis, regulation and export of saxitoxin. This analysis also revealed that it contains a PKS-like structure, sxtA, with four catalytic domains (Kellmann et al., 2008b) (Figure 7).

Fig.7 - Structural organization of the saxitoxin biosynthetic gene cluster in Cylindrospermopsis raciborskii. Adapted from Kellmann et al. (2008b).

Regarding cyanobacterial metabolites with therapeutic potential, most of the research has been focused on compounds with anticancer activity. The cytotoxic effects on human tumour cell lines of a high number of compounds isolated from different strains, in particular from marine cyanobacteria, has been demonstrated (Gutierrez et al., 2008; Mevers et al., 2011; Costa et al., 2012; Costa et al., 2014). Molecular mechanisms of anticancer marine cyanobacterial natural products include the inhibition of microtubule dynamics (dolastatins 10), inhibition of actin filaments (bisebromoamide), histone deacetylase inhibitors (largazole), proteasome inhibitors (carmaphycins A and B) or induction of apoptosis in cancer cells (apratoxins) (Nunnery et al., 2010; Tan, 2010; Tan, 2013a; Tan, 2013b). The recently approved agent for anaplastic large cell lymphoma and Hodgkin’s lymphoma, Brentuximab vedotin, was

FCUP 17 Characterization of cyanobacteria isolated from the Portuguese coast inspired by the marine cyanobacterial metabolite dolastatin 10 (Minich, 2012). Cyanobacteria have also been reported as a source of neuromodulating molecules (hoiamides) (Tan, 2013b), antibacterial (carbamidocyclophanes) (Bui et al., 2007; Singh et al., 2011), and antiviral compounds (cyanovirin-N) (Boyd et al., 1997; Dey et al., 2000; Singh et al., 2011). One of the most potent marine cyanobacterial antimalaria compounds reported is symplostatin 4 (Nunnery et al., 2010; Tan, 2013b) and a number of secondary metabolites have shown anti-inflammatory activity, such as malyngamides F acetate and 2 (Tan, 2013b). In summary, several studies have revealed the metabolic capabilities of cyanobacteria, in particular of the marine strains, for the production of new therapeutic natural products. However, despite the large number of cyanobacterial secondary metabolites identified, there is only a small fraction for which the biosynthetic genes have been identified (e.g. microcystin, nodularin, saxitoxin, aeruginosin, cylindrospermopsin, jamaicamide, curacin A, barbamide, lyngbyatoxin, apratoxin, nostopeptolide, cryptophycin).

1.4.1 Prediction of natural product biosynthetic gene clusters

Synechocystis sp. PCC 6803 was the first cyanobacteria to have the genome fully sequenced (Kaneko et al., 1996) but, subsequently, 265 cyanobacterial genomes sequences become available (Joint Genome Institute (JGI), Integrated Microbial Genomes (IMG) database, June 2015). A recent sequencing project known as CyanoGEBA (Genomic Encyclopedia of Bacteria and Archaea) (Shih et al., 2013) significantly increased the number and diversity of sequences covering the cyanobacteria phylum. Prior to this study, there were no publically available genomes from Pleurocapsales (Subsection II). Moreover, the authors also assessed the genetic potential of these cyanobacteria to produce secondary metabolites (presence of PKS, NRPS and PKS/NRPS hybrids) highlighting their distribution across the phylum (Shih et al., 2013). Recently, a large-scale analysis of cyanobacterial natural product pathways was also performed (Calteau et al., 2014). In this study, 452 biosynthetic gene clusters (190 NRPS, 162 PKS and 100 hybrids gene clusters) from 89 (out of 126) cyanobacteria were identified (Calteau et al., 2014). In total, 286 distinct NRPS/PKS gene cluster families were found, comprising biosynthetic pathways of known cyanobacterial compounds but also revealing a large number of orphan pathways with high drug discovery potential (Calteau et al., 2014). These studies highlighted the exceptional capacity of cyanobacteria to produce a large diversity of

18 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

secondary metabolites, representing a range of distinct and unrelated biosynthetic pathways (Shih et al., 2013; Calteau et al., 2014). The knowledge of the secondary metabolic potential of specific strains can facilitate the process of natural products discovery (Ziemert et al., 2012). The progress in sequencing technologies allowed the development of novel screening methods based on genome sequences. The principle of these genome mining approaches is to identify genes involved in the biosynthesis of such molecules and to predict the products of the identified pathways. Therefore, the development of bioinformatic tools for data analysis was essential, and currently an array of available bioinformatics tools for secondary metabolite biosynthetic gene clusters analysis are available (Weber, 2014). Some softwares identify all the biosynthetic gene clusters in a given genome (e.g. antiSMASH 3, BAGEL3 and SMURF). The Antibiotics and Secondary Metabolite Analysis SHell (antiSMASH) (http://antismash.secondarymetabolites.org/) (Medema et al., 2011; Weber et al., 2015) is the most comprehensive tool for the identification and analysis of secondary metabolite biosynthetic gene clusters in fungi and bacteria. Many algorithms and tools for the specialized analysis of gene clusters are directly implemented within antiSMASH. Other softwares are used to identify specific enzyme classes (e.g. PKS and NRPS pathways). Several bioinformatics tools take advantage of the typical domain architecture presented by modular PKS and NRPS to predict domain organization and biosynthetic products (e.g. NaPDoS, NP.Searcher and SBSPKS), as well as substrate specificities (e.g. PKS/NRPS Analysis and NRPS predictor2) (Weber, 2014). The Natural Product Domain Seeker (NaPDoS) (Ziemert et al., 2012) (http://napdos.ucsd.edu/), employs a phylogeny-based classification system that extracts and classifies KS (PKS) and C (NRPS) domains from a wide range of sequence data. Firstly, the domains are identified in genomic or metagenomic data using a HMM (Hidden Markov Model) and homology based search strategy, and then the identified domains are integrated into a manually curated phylogenetic tree providing conclusions on phylogenetically related enzymes and their products (Ziemert et al., 2012; Weber, 2014). With the PKS/NRPS Analysis tool (Bachmann & Ravel, 2009) (http://nrps.igs.umaryland.edu/) it is possible to investigate the domain type encoded within an NRPS/PKS protein query sequence. PKS/NRPS analysis also implements a BLAST-based substrate prediction of NRPS A domains, based on an extensive database of eight-amino acid specificity-conferring codes extracted from biochemically characterized NRPS A domains (Bachmann & Ravel, 2009). The A domain plays a crucial role in the selection of the building blocks and the active site of the A-domains reveal a “non-ribosomal code” correlating eight amino acids involved in

FCUP 19 Characterization of cyanobacteria isolated from the Portuguese coast building-up the active sites with their cognate substrates. This allowed to understand the specificity of these complex enzymes and the prediction of substrate specificities (Stachelhaus et al., 1999; Challis et al., 2000). The fast-growing availability of sequenced genomes has contributed to the knowledge on the biosynthetic pathways of secondary metabolites and in silico analysis has become an indispensable resource to quickly assess the potential of an organism to produce a certain metabolite, being an important approach in secondary metabolites research and drug discovery.

1.4.2 Mass spectrometry (MS) based metabolomics: molecular networking

MS-based metabolomics has become a powerful tool for the detection of metabolites as well as for the identification of novel ones (Baran et al., 2013). Recently, a powerful tool – molecular networking – has been applied in order to obtain a global view of the secondary metabolome of a given organism (Watrous et al., 2012; Yang et al., 2013; Winnikoff et al., 2014) (Figure 8). Molecular networks are visual representations of mass-spectral data based on MS-fragmentation similarities. MS- based molecular networking relies on the observation that compounds with similar structures share similar MS/MS fragmentation patterns and that molecular families tend to cluster together within the network. For molecular network generation, firstly the MS/MS spectra from samples and known standards are collected and then a molecular network is generated using “cosine scores” which measure relatedness in MS/MS spectra that are visualized using Cytoscape (Shannon et al., 2003). Within the network, one node represents one consensus MS/MS spectrum (merging of MS/MS spectra with nearly identical precursor mass and peak patterns). The relatedness between each node is defined by an edge (line) and the thickness of the edge defines the degree of similarity of the MS/MS spectra. These networks allow a simultaneous view of identical molecules, analogues or compound families. The development of molecular networks from MS/MS data has proven to be a useful tool for screening organisms that produce valuable natural products (Watrous et al., 2012; Yang et al., 2013; Winnikoff et al., 2014).

20 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Fig.8 - Graphical representation of a traditional molecular netw ork generated w ith cyanobacteria extracts and reference compounds, displaying different natural products grouped into clusters w ith chemical relatedness. Green nodes - reference (seed) compounds; pink nodes - samples.

1.5 Cyanobacterial diversity in portuguese waters and secondary metabolites production

The Portuguese Continental coast has a complex and highly dynamic set of intertidal ecosystems, with varied topographies, beach morphologies and wave regimens, exposed to climatic influences from the North Atlantic Ocean and the Mediterranean Sea (Pontes et al., 2005; Lima et al., 2006; Seabra et al., 2011). In the last years, several studies on the diversity of cyanobacteria from Portuguese fresh and estuarine waters have been performed (De Figueiredo et al., 2006; Valério et al., 2009; Galhano et al., 2011; Lopes et al., 2012), and the majority of these studies focused on toxins-producing strains (Vasconcelos, 1999; Martins et al., 2009; Lopes et al., 2010; Martins et al., 2011). In contrast, the diversity of marine cyanobacteria has been unexplored with only a few reports published previous to this work (Araújo et al., 2009; Ramos et al., 2010). However, the bioactive potential of some marine cyanobacterial strains have been investigated, with a couple of studies revealing that extracts of cyanobacteria could be toxic to marine invertebrates (Martins et al., 2007; Frazão et al., 2010), whereas others showed that cyanobacterial extracts have high

FCUP 21 Characterization of cyanobacteria isolated from the Portuguese coast activity in ecologically-relevant bioassays and toxicity against human cancer cell lines (Leão et al., 2013a; Leão et al., 2013b; Costa et al., 2014). Due to the importance that cyanobacteria have in the ecosystems equilibrium as well as to their potential for several biotechnological applications, more studies are needed to better understand the diversity and metabolic potential of isolates from the extensive Atlantic Portuguese coastline.

1.6 Objectives

The general goal of this study was to gather knowledge on the diversity of cyanobacteria isolated from the Portuguese coast as well as to assess their potential to fix atmospheric nitrogen and to produce secondary metabolites. For this purpose, cyanobacterial isolates previously collected from the intertidal zones and deposited at Laboratório de Ecotoxicologia, Genómica e Evolução (LEGE Culture Collection, CIIMAR, Porto) were: (i) Characterized at morphological, ultrastructural and molecular level (16S-ITS- 23S sequences and phylogenetic analysis); (ii) Screened for the potential to fix nitrogen (presence of nif genes and nitrogenase activity); (iii) Screened for the presence of genes involved in the production of the cyanotoxins microcystin (mcyA, mcyE), nodularin (ndaF) and saxitoxin (sxtI); (iv) Screened for the presence of genes encoding non-ribossomal peptide synthetase (NRPS) and polyketide synthase (PKS), targeting the A and the KS domains, respectively; (v) Assessed for their potential to produce secondary metabolites (sequences encoding KS and A domains were used to in silico predict PKS and NRPS systems, and crude extracts were analysed to search for novel or otherwise interesting compounds).

CHAPTER II

Culture dependent characterization of cyanobacterial diversity in the intertidal zones of the Portuguese coast: a polyphasic study

Brito Â., Ramos V., Seabra R., Santos A., Santos C.L., Lopo M., Ferreira S., Martins A., Mota R., Frazão B., Martins R., Vasconcelos V., Tamagnini P. 2012. Systematic and Applied Microbiology 35: 110-119.

Systematic and Applied Microbiology 35 (2012) 110–119

Contents lists available at SciVerse ScienceDirect

Systematic and Applied Microbiology

j ournal homepage: www.elsevier.de/syapm

Culture-dependent characterization of cyanobacterial diversity in the intertidal

zones of the Portuguese coast: A polyphasic study

a,b a,b,c b,c a,b a

Ângela Brito , Vitor Ramos , Rui Seabra , Arlete Santos , Catarina L. Santos ,

a a c a,b b,c

Miguel Lopo , Sérgio Ferreira , António Martins , Rita Mota , Bárbara Frazão ,

c,d b,c a,b,∗

Rosário Martins , Vitor Vasconcelos , Paula Tamagnini

a

IBMC – Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal

b

Faculdade de Ciências, Departamento de Biologia, Universidade do Porto, Rua do Campo Alegre, Edifício FC4, 4169-007 Porto, Portugal

c

Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, 4050-123 Porto, Portugal

d

CISA – Centro de Investigac¸ ão em Saúde e Ambiente, Escola Superior de Tecnologia da Saúde, Instituto Politécnico do Porto, Rua Valente Perfeito 322, 4400-330 Vila Nova de Gaia,

Portugal

a r t i c l e i n f o a b s t r a c t

Article history: Cyanobacteria are important primary producers, and many are able to fix atmospheric nitrogen playing a

Received 15 April 2011

key role in the marine environment. However, not much is known about the diversity of cyanobacteria in

Received in revised form 21 July 2011

Portuguese marine waters. This paper describes the diversity of 60 strains isolated from benthic habitats

Accepted 28 July 2011

in 9 sites (intertidal zones) on the Portuguese South and West coasts. The strains were characterized by

a morphological study (light and electron microscopy) and by a molecular characterization (partial 16S

Keywords:

rRNA, nifH, nifK, mcyA, mcyE/ndaF, sxtI genes). The morphological analyses revealed 35 morphotypes (15

Cyanobacteria

genera and 16 species) belonging to 4 cyanobacterial Orders/Subsections. The dominant groups among

Marine

the isolates were the Oscillatoriales. There is a broad congruence between morphological and molecular

16S rRNA gene

assignments. The 16S rRNA gene sequences of 9 strains have less than 97% similarity compared to the

Nitrogen fixation

Phylogeny sequences in the databases, revealing novel cyanobacterial diversity. Phylogenetic analysis, based on

Toxins partial 16S rRNA gene sequences showed at least 12 clusters. One-third of the isolates are potential N2-

fixers, as they exhibit heterocysts or the presence of nif genes was demonstrated by PCR. Additionally,

no conventional freshwater toxins genes were detected by PCR screening.

© 2012 Elsevier GmbH. All rights reserved.

Introduction different topographies and beach morphologies – rocky beaches,

beaches with sand and rocks and sandy beaches with dispersed

Continental Portugal has an extensive coastline, of about rocks, resulting in diverse levels of exposure to the prevailing wave

940 km, facing the North Atlantic Ocean. It is one of the warmest regimen.

European countries, and its climate is classified as Mediterranean Cyanobacteria are photosynthetic prokaryotes with a wide geo-

type Csa in the south (C – warm temperate; s – summer dry; a – graphical distribution that are present in a broad spectrum of

hot summer) and Csb in the north (C – warm temperate; s – sum- environmental conditions [49]. Taxonomy of cyanobacteria is a

mer dry; b – warm summer), according to the Köppen’s scheme controversial subject, with two prevailing approaches, the “botan-

[23]. The near-shore wave energy has a strong spatial and seasonal ical” and “bacterial”. The reorganized taxonomic revision based on

variability [30]. Western and southern coasts are evidently under the botanical code uses morphological, biochemical and molec-

different wave regimes, with the unsheltered west coast sites expe- ular characters [19–21]. After the recognition of the prokaryotic

riencing higher wave height and power than southern ones, and a features of cyanobacteria, Rippka et al. [36] published a bacterio-

moderate decreasing gradient from north to south can be observed. logical taxonomy based on morphological, biochemical and genetic

Wave height and power in the winter are also much higher than in characters of axenic cultures, while Bergey’s Manual of Systematic

the summer [30], and along the coast it is possible to encounter Bacteriology [5] uses a phylogenetic approach primarily based on

16S rRNA sequence comparisons. In summary, cyanobacteria can

be classified into five Subsections [5,36] that broadly coincide with

∗ Orders of the botanical approach [19–21]. Cyanobacteria belonging

Corresponding author at: IBMC – Instituto de Biologia Molecular e Celular,

to subsections I (Chroococcales) and II (Pleurocapsales) are unicel-

Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal.

lular, but while the organisms in subsection I divide exclusively

Tel.: +351 226074900; fax: +351 226099157.

E-mail address: [email protected] (P. Tamagnini). by binary fission, the ones from subsection II can also undergo

0723-2020/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. doi:10.1016/j.syapm.2011.07.003

Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119 111

Table 1

Localization and characteristics of the sampling sites.

Sampling site latitude/longitude Wave exposure Beach type

1. Moledo do Minho High Rocky

◦   ◦  

N 41 50 58.68 /W 8 52 0.18 (Rivermouth)

2. S. Bartolomeu do Mar High Sand and rocks

◦   ◦  

N 41 34 25.59 /W 8 47 54.81

3. Lavadores High Sand and rocks

◦   ◦  

N 41 07 45.07 /W 8 40 6.88

4. Aguda High Sand and rocks

◦   ◦  

N 41 02 58.35 /W 8 39 19.22

5. Foz do Arelho High Sandy

◦   ◦  

N 39 25 59.79 /W 9 13 48.99 (Rivermouth)

6. Martinhal Intermediate Sandy

◦   ◦  

N 37 01 07.30 /W 8 55 36.17

7. Burgau Intermediate-low Sand and rocks

◦   ◦  

N 37 04 15.84 /W 8 46 34.97

8. Luz Intermediate-low Rocky

◦   ◦  

N 37 05 10.38 /W 8 43 31.35

9. Olhos d’Água

◦   ◦  

N 37 05 23.01 /W 8 11 27.66 Low Sandy

multiple fission producing small easily dispersible cells called baeo- temperature [SST [25]], river runoff and other important climatic

cytes. The subsection III (Oscillatoriales) includes the filamentous variables such as air temperature and precipitation (Instituto de

strains without cell differentiation. Subsections IV (Nostocales) and Meteorologia, IP, Portugal) were also taken into account. In brief,

V (Stigonematales) comprise the filamentous strains that are able West coast sampling sites experience generally higher energetic

to differentiate heterocysts and akinetes. In addition, filaments of wave regimes, lower overall mean SSTs and mean air tempera-

cyanobacteria from subsection V are able to divide in multiple tures [40], and higher fresh water inputs, both from river runoff

planes displaying true branching. and precipitation, than their South coast counterparts.

Benthic cyanobacteria grow along the shore on different sub-

strata, mainly in the intertidal zones, as part of complex multi-taxa Cyanobacteria sampling, isolation, and culturing

communities, often forming cohesive mats and biofilms. In these

habitats, they are exposed to a range of daily stresses such as Biological samples were collected in both summer and autumn

nutrient limitation, high UV-radiation and desiccation [1,6]. The of 2006, and spring of 2007. Sample collection was performed by

successful adaptation to these harsh environments is largely due scraping the surface of a wide range of substrates (e.g. seaweeds,

to their morphological and functional versatility [31]. Cyanobac- rock surfaces, seashells, Sabellaria alveolata reefs) present on bare

teria play a major role in the global carbon cycle as important rocks or shallow puddles tidal pools. For the isolate LEGE 06009 see

primary producers performing oxygenic photosynthesis, and the also [9]. In addition, seawater samples from the surf zone were also

diazotrophic taxa are fundamental to the nitrogen cycle, partic- collected.

ularly in oceans [18]. In addition to their ecological importance, Raw biological samples were screened for cyanobacterial spec-

cyanobacteria are also recognized as being a prolific source of bio- imens using a light microscope (Leica DMLB), and subsequently

logically active natural products; some of these compounds are subjected to liquid culture enrichment, agar plates streaking or

toxic to a wide array of organisms [50]. Nevertheless, little is known micromanipulation. Whenever possible single cells/filaments were

about the diversity of these organisms along the Portuguese coast isolated and transferred to liquid or solid medium using a Pas-

with only a few reports published [e.g. 2,9]. Araújo et al. [2] provided teur pipette [34]. When micromanipulation was found unsuitable,

an updated checklist of the benthic marine algae of the northern aliquots of the enriched liquid cultures were transferred to liquid

Portuguese coast, including 26 species of cyanobacteria. However, medium or streaked on agar plates. Sea water samples were filtered

these authors based their work on new records, literature refer- with sterile glass fiber filters (GF/C – Ø 47 mm, Whatman), and sub-

ences and herbarium data but did not isolate or maintain cultures sequently placed on liquid medium until a visible colony appeared.

of the observed specimens. Single colonies were picked and streaked on agar plates. New

The aim of this work was to identify the cyanobacteria present colonies were transferred into liquid medium. Cultures were main-

in the intertidal zones of the Portuguese coast using a polyphasic tained using the following media: MN [34], BG110, BG11 [44], and

−1

approach. The isolated specimens are kept at LEGE Culture Collec- Z8 [22] supplemented with 25 g L NaCl, further named Z8 25‰.

tion, and available for further studies. In addition to the assessment The media were supplemented with B12 vitamin, and when nec-

of cyanobacterial diversity, a PCR-based screen for putative essary with cycloheximide or amphothericin B [34]. The cultures

−2 −1

diazotrophs and toxin-producers was performed to unveil their were kept under 14 h light (10–30 ␮mol photons m s )/10 h

◦

role(s) in the ecosystem. dark cycles at 25 C. Cyanobacterial isolates are deposited at LEGE

Culture Collection (Laboratório de Ecotoxicologia, Genómica e

Materials and methods Evoluc¸ ão; CIIMAR, Porto, Portugal). Additionally, the isolate LEGE

06123 is also deposited at Culture Collection of Algae and Protozoa

Sampling sites (CCAP 1425/1), for details on this organism see [33].

The sites (Table 1) were selected in order to represent the Light and transmission electron microscopy (TEM) and

diversity of the Portuguese coast. Along the coast it is possi- morphological identification

ble to discriminate between rocky beaches (sampling sites 1 and

8), beaches with sand and rocks (sampling sites 2, 3, 4, 7) and Cells were observed using a Leica DMLB microscope (Leica

sandy beaches with dispersed rocks (sampling sites 5, 6 and 9) Microsystems GmbH), images were captured with a Leica ICCA Ana-

(Table 1). Several relevant variables: wave power [30], sea surface logue Camera System, and the cells were measured using Qwin

112 Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119

Leica software (Leica Microsystems GmbH). Each morphometric Centre for Biotechnology Information (NCBI, March 2011). In order

parameter was measured 20 times in different individuals. to include full-length sequences and to obtain a reliable overall pic-

For TEM studies, cells were collected, centrifuged and processed ture of the cyanobacterial diversity, a number of reference strains

as described by Seabra et al. [39]. Sections were examined using a from each subsections/orders represented in our samples were

Zeiss EM 902. retrieved from GenBank and were included in the following phylo-

The morphological identification was carried out following the genetic analyses. The reference strains were selected according to

criteria of Komárek and Anagnostidis [19–21], Waterbury and the Bergey’s Manual of Systematic Bacteriology (2001), and from

Stanier [47] and by using Bergey’s Manual of Systematic Bacteriol- those the ones closely related to our samples were used. A multiple

ogy [4], i.e. whenever the identification differs in the two systems alignment encompassing 16S rRNA gene sequences from the iso-

(“botanical” and “bacteriological”), the corresponding form-genus lates, the reference strains and Chloroflexus aurantiacus J-10-fl as

in Bergey’s classification is also mentioned. For Pleurocapsales the outgroup was performed using the ClustalW2 algorithm [24],

Waterbury and Stanier [47] classification was followed. with all the default parameters. Due to the size differences in the

amplification products of each isolate, and to avoid the consequent

DNA extraction, purification, PCRs and sequencing bias effect on the tree construction, this alignment was pruned

to an internal core of 655 nucleotides present in all sequences –

Cells were harvested by centrifugation and DNA was extracted corresponding to nucleotides 519 to 1172 in E. coli. The phylo-

®

using the Maxwell 16 System, and the Cell DNA Purifi- genetic tree was computed using the Maximum-likelihood (ML)

cation Kit for Gram-negative bacteria (Promega Corporation) methodology [8]. The alignment was imported to Geneious Pro

according to the instructions of the manufacturer. DNA frag- [7], and the tree was build with the PhyML [12] plugin, using

ments within the following genes were amplified using the the HKY85 as the substitution model and 1000 pseudo-replicates

oligonucleotide primers listed on Table 2: 16S rRNA gene for the bootstrap analysis, and allowing the software to estimate

(small subunit ribosomal gene), nifK (dinitrogenase ␤ subunit), the transition/transversion ratio, the proportion of invariable sites

nifH (dinitrogenase reductase), mcyA and mcyE (microcystin and the gamma distribution parameter with 4 substitution rate

synthetase), ndaF (nodularin synthetase), and sxtI (saxitoxin categories.

biosynthesis). The 16S rRNA gene was amplified using two

primer pairs, each including one universal primer and one spe-

Results and discussion

cific for cyanobacteria [8-27F(universal)/CYA781R(specific), and

CYA361F(specific)/1492R(universal)], this allowed us to amplify a

This work presents a polyphasic study of cyanobacterial iso-

longer fragment, and to avoid unspecific amplifications since the

lates from selected intertidal zones along the Portuguese coast,

cultures are not axenic. For nifK, the first group of primer pairs

combining the isolation of strains, and their characterization by

(see Table 2) was designed for filamentous cyanobacteria, whereas

microscopic observations and molecular analysis.

the second group was designed for unicellular cyanobacteria. PCR

reactions were performed using a thermal cycler MyCyclerTM (Bio-

Rad laboratories Inc., Hercules, CA, USA) following [45]. The PCR Morphological characterization

◦

profiles, after a 2–5 min at 94 C of denaturation step, were the fol-

◦ ◦

lowing: 16S rRNA gene – 35 cycles of 94 C 1 min, 50 C 1 min, and To evaluate the diversity of cyanobacteria, nine beaches that

◦ ◦ ◦

72 C 1 min 30 s; nifK – 30 cycles of 94 C 1 min, 50 C 1 min, and reflect the heterogeneity of habitats present along the conti-

◦ ◦

72 C for 1 min 15 s; mcyA, mcyE, and ndaF – 30 cycles of 95 C 1 min nental Portuguese coast were selected (Table 1). Approximately

◦ ◦ ◦ ◦

30 s, 52 C 30 s, and 72 C 50 s; sxtI – 30 cycles of 94 C 10 s, 52 C 100 cyanobacterial isolates were retrieved, from which 60 were

◦ ◦

20 s, and 72 C 1 min. In all cases a final extension of 7 min at 72 C characterized and shown to belong to 35 different morphotypes.

was performed. Amplification of the nifH fragment was performed Fifteen genera and 16 species belonging to four cyanobacterial

according to the methods described previously [29]. The PCR prod- orders/subsections were identified based on morphological char-

ucts were separated by agarose gel electrophoresis using standard acters (Table S1, supplementary material). In terms of the isolate’s

protocols [38]. DNA fragments were isolated from gels using the spatial distribution no clear pattern was observed, i.e. the dif-

NZYGelpure Kit (NZYtech, Lda. INOVISA, Lisbon, Portugal), accord- ferent cyanobacterial groups are distributed by all the different

ing to the manufacturer’s instructions. Purified PCR products were beaches types. However, one must take into account that the num-

®

cloned into pGEM -T Easy vector (Promega, Madison, WI, USA), and ber of isolates of certain genera is much higher than others, and

transformed into Escherichia coli DH5␣ competent cells following that the different number of isolates obtain for each genus can

the manufacturer’s instructions, and the methodology described in be due to their ubiquity or to the fact that they are easier to

[33]. Some purified PCR products were directly sequenced at STAB isolate. The isolation media were selected due to their different

Vida (Lisbon, Portugal). composition in order to expose the highest possible diversity. MN

medium revealed the highest diversity, Z8 25‰ was particularly

Nucleotide sequence accession numbers successful for coccoids and Leptolyngbya spp., while BG110 and

BG11 did not contribute to a higher diversity than the Z8 25‰,

Novel sequences associated with this study are avail- with the exception of Nostoc sp. LEGE 06158. The most represen-

able in GenBank under the accession numbers FJ589716, tative group among the isolates comprises the nonheterocystous

HQ832895–HQ832951, JF708120 and JF708121. forms, notably the filamentous Oscillatoriales and the unicellular

Chroococcales. Representatives from the unicellular Pleurocapsales

Phylogenetic analysis were also found, as well as heterocystous taxa: Nostocales (Fig. 1).

No true-branching filamentous, Stigonematales, were found. The

In order to integrate the cyanobacterial diversity along the Por- nonheterocystous cyanobacteria are, indeed, reported as the

tuguese coast into a broader phylogenetic context, the 16S rRNA predominant forms in marine environments [3,6,43,46]. This seems

gene sequences were analyzed, compared with the currently avail- to be also the case for Portugal, the Checklist of benthic marine

able databases and used to construct phylogenetic trees. Each algae and cyanobacteria of northern Portugal (“Checklist”) reported

sequence was independently used as the query in a BLAST search 26 species of cyanobacteria, 15 of which are Oscillatoriales [2].

against the non-redundant nucleotide database of the National Strains belonging to the genera Hyella, Myxosarcina, Lyngbya,

Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119 113

Table 2

Target genes and oligonucleotide primers used in this study.

a  

Target genes Primer pair Sequence 5 → 3 PCR product expected size (bp) Reference

16S rRNA 8-27F AGAGTTTGATCCTGGCTCAG [48] b

CYA781R (A) GACTACTGGGGTATCTAATCCCATT 773 [28]

CYA781R (B) GACTACAGGGGTATCTAATCCCTTT [28]

CYA361F GGAATTTTCCGCAATGGG 1131 [27]

1492R GGTTACCTTGTTACGACTT [48]

nifK nifK0F (A) CAAGGTTCTCAAGGTTGCGTT 1139 [33]

nifK1F (B) CAAGGTTCTCAAGGTTGTGTG [33]

nifK4R TGTAAGTGGTGGCGATCAAAGA [33]

nifK0F (A)/nifK1F (B) See above 407 [33]



nifK3 R GGGATGAAGTTGATTTTGCCGTT This work

nifk146F CCTGGGAATATCGGGAA 319 This work

nifk465R GCCATACAAGTTGTACAGACA This work

nifk310F CGTCACTTCAAAGAGCCTT 1084 This work

nifk1394R GGCGATCAAAGATAGGATA This work

nifH4 TTYTAYGGNAARGGNGG [29]

nifH nifH3 ATRTTRTTNGCNGCRTA 361 [29]

nifH2 ADNGCCATCATYTCNCC [29]

nifH1 TGYGAYCCNAARGCNGA [29]

mcyA mcyA-Cd1F AAAAGTGTTTTATTAGCGGCTCAT 297 [14]

mcyA-Cd1R AAAATTAAAAGCCGTATCAAA [14]

mcyE/ndaF HEPF TTTGGGGTTAACTTTTTTGGGCATAGTC 472 [16]

HEPR AATTCTTGAGGCTGTAAATCGGTTT [16]

sxtI sxtI-F2 GGATCTCAAAGAAGATGGCA 991 This work

sxtI-R GGTTCGCCGCGGACATTAAA [17]

a

F (forward) and R (reverse).

b

(A) and (B) – primers used together in a mixture with equimolar concentration.

Pseudophormidium and Calothrix were found in the same area The diversity of our cyanobacterial isolates is depicted in

(north of Portugal) as reported in the Checklist. Cyanobium, Lep- Figs. 2 and 3 (as well as in Figs. S1 and S2), where it is possible

tolyngbya and Pseudanabaena are the most numerous among our to observe genera belonging to the four orders. The Chroococcales

isolates (Table S1 and Table 3). Some genera described by [2] were Synechocystis and Cyanobium dividing in one plane (Fig. 2a and

not found in our study (Chamaecalyx, Dermocarpella, Entophysalis, b, Fig. 3a and b), the Pleurocapsales Chroococcopsis, Myxosarcina

Hydrococcus, Trichocoleus, Porphyrosiphon, Sirocoleum, and Spiro- and Hyella dividing in more than one plane (Fig. 2c–g, Fig. 3d) and

coleus), whereas Xenococcus, Microcoleus, Spirulina morphotypes producing baeocytes (Fig. 2f), the Oscillatoriales Romeria, Phormid-

were present in our field samples but its isolation was not suc- ium, Leptolyngbya, Pseudophormidium, Lyngbya and Plectonema

cessful. On the other hand, genera that are not described by these (Fig. 2h–q, Fig. 3e–f), with Leptolyngbya cf. halophila exhibiting

authors were present in our samples (Aphanothece, Cyanobium, nodule-like structures (Fig. 2m, Fig. 3f) and Plectonema cf. radio-

Synechocystis, Chroococcidiopsis, Chroococcopsis, Leptolyngbya, Pseu- sum geminate false branches (Fig. 2q), and the Nostocales genera

danabaena, Romeria, Schizothrix, Nostoc, and Scytonema), some Nostoc, Calothrix and Scytonema (Fig. 2r–u, Fig. 3g), with intercalar

of them also confirmed by a recent studies on the Portuguese (Fig. 2t) or terminal (Fig. 2s) heterocysts. In Calothrix sp. LEGE 06100

coast: Synechocystis, Cyanobium, and Leptolyngbya [9,26]. However, hormogonia were found (Fig. 2u). Additionally, the ultrastructural

Araújo et al. [2] based their work not only on new records but also images provided information on the size and shape of the sheath

on literature references and herbarium data, and did not isolate the (Fig. 3e, f and i), and the different arrangement of the thylakoids

observed specimens. Representatives of the order Stigonematales (Fig. 3a–c, e, g and h). It was also possible to observe the disrup-

were not found in this study nor reported by Araújo et al. [2]. This tion of the mother sheath leading to disintegration of the colonies

was expected since it is known that these organisms are poorly rep- after (Fig. 3c), and a nodule detail of Leptolyngbya cf.

resented in marine environments [15], and mainly encountered in halophila LEGE 06102 (Fig. 3f). A brief description of each of the iso-

the flowing waters of hot springs and soils [11,36,52]. lates and the morphological characteristics used to taxonomically

affiliate them is depicted in Table S1, as well as their distribution

and habitat description.

DNA sequence and phylogenetic analysis

Partial 16S rRNA gene sequences were obtained for all the iso-

lates. These sequences were compared with the ones available in

the NCBI database (March 2011) using BLASTn, and the results are

shown in Table 3. There was a quite good correlation between the

phenotypic and genotypic based identifications, for more than one-

third of the isolates (Table 3, highlighted in grey). For the remaining

isolates discrepancies were observed between the two identifica-

tions, possibly resulting from limitations of the databases and/or

taxonomical constraints – it is well recognized that cyanobacterial

taxonomy faces several problems, and is currently under revision

[46]. One should point out that 9 of our isolates have less than

Fig. 1. Distribution of the isolates per taxonomic group. 97% similarity to the 16S rRNA gene sequences in the database,

114 Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119

Table 3

Morphological identification (for details see Table S1) and molecular analysis of the cyanobacterial isolates.

Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119 115

Fig. 2. Light micrographs illustrating the diversity of cyanobacterial morphotypes isolated from the intertidal zones of nine beaches on the Portuguese coast. (a) Synechocystis

salina LEGE 06099, (b) Cyanobium sp. LEGE 06184, (c) Chroococcopsis sp. LEGE 07168, (d) Chroococcopsis sp. LEGE 07187, (e) Myxosarcina sp. LEGE 06146, (f) Chroococcopsis

sp. LEGE 07161, (g) Hyella sp. LEGE 07179, (h) Romeria sp. LEGE 06013, (i) Phormidium sp. 1 LEGE 06111, (j) Phormidium laetevirens LEGE 06103, (k) Leptolyngbya mycoidea

LEGE 06126, (l) Leptolyngbya mycoidea LEGE 06118, (m) Leptolyngbya cf. halophila LEGE 06102, (n) Leptolyngbya sp. LEGE 06188, (o) Pseudophormidium sp. LEGE 06125, (p)

Lyngbya cf. aestuarii LEGE 07165, (q) Plectonema cf. radiosum LEGE 06105, (r) Nostoc sp. 1 LEGE 06106, (s) Calothrix sp. LEGE 06122, (t) Scytonema sp. LEGE 07189, (u) Calothrix

sp. LEGE 06100. b – baeocytes; fb – false branching; hg – hormogonia; h – heterocysts; n – nodule. Scale bars – 10 ␮m.

116 Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119

Fig. 3. Transmission electron micrographs of selected isolates from the sampling sites. (a) Synechocystis salina LEGE 06099, (b) Cyanobium sp. LEGE 06097, (c) Gloeocapsopsis

cf. crepidinum LEGE 06123, (d) Chroococcopsis sp. LEGE 07187, (e) Leptolyngbya mycoidea LEGE 06118, (f) Leptolyngbya cf. halophila LEGE 06102, insert – nodule detail (g)

Nostoc sp. 2 LEGE 06158, (h) Calothrix sp. 2 LEGE 06122, (i) Rivularia sp. LEGE 07159. het – heterocyst; sh – sheath; sp – septum; th – thylakoid; veg – vegetative cell. arrow

head – disruption of the mother sheath. Scale bars – 1 ␮m.

emphasizing the presence of novel cyanobacterial diversity in Por- intermixed and dispersed throughout the tree, as previously

tuguese shore waters (Table 3, dashed boxes). described [see for e.g. 10,51]. In general, the phylogenetic distri-

Phylogenetic analyses were performed to assess the relative bution is congruent with the classification results based on the

positioning of the cyanobacteria isolated in this study. An ML morphology. Moreover, the species or genus attributed to the

algorithm was applied to a multiple alignment of partial 16S isolates in the morphological analysis is in agreement with the

rRNA gene sequences (655 bp) of all isolates, reference strains, species/genus of the reference strains they cluster with. Cluster

and C. aurantiacus J-10-fl as the outgroup. The resulting tree A includes two isolates identified as Leptolyngbya mycoidea sup-

revealed 12 consistent clusters (A–L), which were defined as mono- ported by a bootstrap value of 100%. Cluster B comprises one

phyletic groups with bootstrap values equal or higher than 70% isolate identified as Chroococcopsis sp. and the reference strain

(Fig. 4). The heterocystous types form a coherent genetic cluster, Synechocystis sp. PCC 6308. Cluster C includes the Chroococcid-

whereas unicellular and filamentous nonheterocystous forms were iopsis sp. PCC 6712 and an isolate identified as Hyella sp. Cluster

Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119 117

Fig. 4. Maximum-likelihood phylogenetic tree of partial 16S rRNA gene sequences from the isolates, reference cyanobacterial strains and the outgroup Chloroflexus aurantiacus

J-10-fl. Numbers along branches indicate the percentage of bootstrap support considering 1000 pseudo-replicates: only those equal or higher than 50% are indicated. Isolates

are referred by their culture collection code and morphological identification, whereas reference strains are indicated in bold. The 12 recognized clusters (A–L) are indicated

along the tree (see text for details).

D includes 3 isolates belonging to Pleurocapsales, and the refer- 7321 [37]. Chroococcidiopsis PCC 7203, Chroococcidiopsis PCC 6712

ence strains Pleurocapsa sp. PCC 7516, Pleurocapsa sp. PCC 7319, and Stanieria cyanosphaera PCC 7437, appear distant from all the

and Myxosarcina sp. PCC 7325, corroborating the close relation- other baeocyte-forming cyanobacteria, which has been previously

ship between these two genera. This is in agreement with previous reported for Chroococcidiopsis PCC 7203 [37]. Cluster E comprises

findings, where Myxosarcina sp. PCC 7325 clusters with other isolates identified as Leptolyngbya and Phormidium and, although

members of Pleurocapsa-group: Pleurocapsa sp. PCC 7516 and PCC no reference strain is included, it is supported by a bootstrap value

118 Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119

of 100%. Cluster F contains three Synechocystis: Synechocystis sp. mind that a negative PCR result does not exclude the presence of the

PCC 6803, and two isolates identified as Synechocystis salina. The gene and, conversely, the presence of the gene does not translate

reference strain Synechocystis PCC 6308, is unrelated to the above into expression and activity (also valid for the nif genes screen-

isolates. The scattered distribution of Synechocystis strains has been ing), but the primer pairs used in this study have been proven to

described previously; Wilmotte and Herdman [51] showed that work with a wide range of cyanobacterial strains [14,16,17]. Mar-

Synechocystis PCC 6308 did not group with Synechocystis PCC 6803 tins et al. [26] demonstrated that extracts of marine Synechocystis

and Synechocystis PCC 6909. Cluster G includes the genus reference and Synechococcus strains isolated from the Portuguese coast were

strain Lyngbya sp. PCC 7419, and one isolate identified as Lyngbya toxic to marine invertebrates possibly implicating the presence of

cf. aestuarii (Lyngbya PCC 7419 was originally identified as Lyngbya other toxic compounds.

aestuarii) [5]. Cluster H contains the heterocystous cyanobacte-

ria, and within it is possible to distinguish two sub-clusters: the Conclusions

Nostoc and Calothrix/Rivularia. Scytonema hofmanni PCC 7101 is

not included in this cluster due to a low bootstrap value (48.5) This study unveils the cultivated diversity of cyanobacteria

but forms a monophyletic group with the heterocystous types, present in the intertidal zones of the continental Portuguese coast.

which is in agreement with previous reports [10,32,51]. This clus- The isolated cyanobacteria belong to 35 different morphotypes and

ter also contains an isolate identified as Plectonema cf. radiosum. comprise members of all the cyanobacterial orders/subsections,

As it described earlier, members of this “botanical” genus might with the exception of Stigonematales/subsection V. The predom-

be Scytonema individuals that do not exhibit heterocysts even in inant forms among the isolates were nonheterocystous and were

natural samples [35]. Cluster I, constituted mainly of Oscillato- particularly represented by the filamentous Oscillatoriales. The

riales morphotypes, contains isolates identified as Leptolyngbya, 16S rRNA gene sequences of 9 strains have less than 97% similar-

Pseudophormidium, Pseudanabaena and the reference strain Lep- ity compared to the sequences in GenBank, revealing unreported

tolyngbya PCC 7104. Cluster J contains the Leptolyngbya sp. PCC cyanobacterial diversity. The phylogenetic distribution, based on

7375 and the isolate identified as Pseudanabaena cf. frigida. Cluster K the 16S rRNA gene, is congruent with the results obtained with the

comprises isolates identified as Pseudanabaena and the marine uni- morphology-based classification. As expected, the heterocystous

cellular Synechococcus PCC 7335. This has been previously observed cyanobacteria form a coherent genetic cluster, whereas the uni-

by Wilmotte and Herdman [51] who reported a close relation- cellular and filamentous nonheterocystous were intermixed. Most

ship between filamentous cyanobacteria and Synechococcus PCC of the isolates cluster with reference strains of the same species

7335. Cluster L includes cyanobacteria belonging to Chroococcales or genus assigned to the isolates in the morphological identifica-

and Oscillatoriales. Within this cluster it is possible differentiate a tion. One-third of the isolated organisms are putative diazotrophs,

Cyanobium and a Synechococcus sub-cluster. Previously, Herdman suggesting that cyanobacteria may play an important role in N2

et al. [13] reported that Synechococcus WH 8103 was included in the fixation along the continental Portuguese coast, as it is common in

Cyanobium spp. clade, corroborating the data presented here. The the marine environment. Additionally, no conventional freshwa-

same 16S rRNA gene alignment was analyzed by Neighbor-Joining ter toxins genes were detected by PCR screening, indicating a low

(NJ) (Fig. S3), and the computed tree supported all the 12 clusters, probability for the occurrence of producers of these cyanotoxins in

therefore validating the ML approach and reinforcing the described the analyzed zones.

phylogenetic analysis.

It is important to notice that some isolates, identified as the Acknowledgments

same taxon (S. salina, L. mycoidea, Leptolyngbya fragilis), appear in

different branches along the tree, indicating that the phylogenetic This work was financially supported by FCT (POCTI/CTA/

analyses of small coccoids and some filamentous cyanobacteria 46733/2002, PTDC/MAR/102258/2008, SFRH/BD/29106/2006,

offered a higher resolution than the morphological identification. SFRH/BD/70284/2010), ESF (III Quadro Comunitário de Apoio),

COMPETE – Programa Operacional Factores de Competitividade

Screening for putative N2 fixers and toxin producers na sua componente FEDER. We are grateful to Rita Ferreira for the

help with the 16S rRNA gene sequencing.

A survey to evaluate the presence of putative N2 fixers and

toxin producers was carried out. Isolates were screened for the

Appendix A. Supplementary data

presence of the genes nifK, nifH, mcyA, mcyE, ndaF and sxtI (see

“Materials and methods” section). With the exception of the fil-

Supplementary data associated with this article can be found, in

amentous heterocystous strains, it is not possible to identify

the online version, at doi:10.1016/j.syapm.2011.07.003.

N2-fixing cyanobacteria based on morphology; therefore targeting

the structural genes encoding the nitrogenase enzymatic complex References

is a common approach [53,54]. In this work, the presence of nifH,

nifK and/or heterocysts were taken into account to determine the [1] Abed, R.M.M., Kohls, K., de Beer, D. (2007) Effect of salinity changes on the bacte-

rial diversity, photosynthesis and oxygen consumption of cyanobacterial mats

organism’s potential for nitrogen fixation. 33% of the isolates (20

from an intertidal flat of the Arabian Gulf. Environ. Microbiol. 9, 1384–1392.

out of 60, see Table S1) qualify as potential diazotrophs, suggest-

[2] Araújo, R., Bárbara, I., Tibaldo, M., Berecibar, E., Tapia, P.D., Pereira, R., Santos,

ing that cyanobacteria may play an important role in N2 fixation R., Sousa-Pinto, I. (2009) Checklist of benthic marine algae and cyanobacteria

of northern Portugal. Bot. Mar. 52, 24–46.

in these intertidal zones. Intertidal ecosystems are harsh and often

[3] Bauer, K., Díez, B., Lugomela, C., Seppala, S., Borg, A.J., Bergman, B. (2008)

nutrient-limited environments, so the presence of nitrogen fixers

Variability in benthic diazotrophy and cyanobacterial diversity in a tropical

is expected and this ability may confer cyanobacteria a competi- intertidal lagoon. FEMS Microbiol. Ecol. 63, 205–221.

tive advantage [6,41]. Indeed, cyanobacteria are the most important [4] Boone, D.R., Castenholz, R.W., Garrity, G.M. (2001) , Bergey’s Manual of System-

atic Bacteriology – The Archaea and the Deeply Branching and Phototrophic

N2-fixing organisms in the majority of the marine microbial mats,

Bacteria, 1, 2nd ed., Springer, New York, USA, pp. 473–599.

and high rates of nitrogen fixation have been observed [42]. Con-

[5] Castenholz, R.W. (2001) Phylum BX. Cyanobacteria. Oxygenic photosynthetic

cerning the genes encoding proteins involved in toxin production, bacteria, in: Boone, D.R., Castenholz, R.W., Garrity, G.M. (Eds.), Bergey’s Manual

of Systematic Bacteriology, 1, 2nd ed., Springer, New York, USA, pp. 473–599.

no amplification was obtained indicating the absence, among the

[6] Díez, B., Bauer, K., Bergman, B. (2007) Epilithic cyanobacterial communities of

isolates, of cyanobacteria producing the conventional freshwater

a marine tropical beach rock (Heron Island, Great Barrier Reef): diversity and

toxins: microcystin, nodularin and saxitoxin. One should bear in diazotrophy. Appl. Environ. Microbiol. 73, 3656–3668.

Â. Brito et al. / Systematic and Applied Microbiology 35 (2012) 110–119 119

[7] Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, [32] Rajaniemi, P., Hrouzek, P., Kastovska, K., Willame, R., Rantala, A., Hoffmann,

M., Heled, J., Kearse, M., Markowitz, S., Moir, R., Stones-Havas, S., Sturrock, L., Komárek, J., Sivonen, K. (2005) Phylogenetic and morphological evaluation

S., Thierer, T., Wilson, A. (2011) Geneious v5.4, Available from http://www. of the genera Anabaena, Aphanizomenon, Trichormus and Nostoc (Nostocales,

geneious.com/. Cyanobacteria). Int. J. Syst. Evol. Microbiol. 55, 11–26.

[8] Felsenstein, J. (1981) Evolutionary trees from DNA sequences: a maximum [33] Ramos, V., Seabra, R., Brito, Â., Santos, A., Santos, C.L., Lopo, M., Moradas-

likelihood approach. J. Mol. Evol. 17, 368–376. Ferreira, P., Vasconcelos, V.M., Tamagnini, P. (2010) Characterization of an

[9] Frazão, B., Martins, R., Vasconcelos, V. (2010) Are known cyanotoxins involved intertidal cyanobacterium that constitutes a separate clade together with ther-

in the toxicity of Picoplanktonic and filamentous North Atlantic marine mophilic strains. Eur. J. Phycol. 45, 394–403.

cyanobacteria? Mar. Drugs 8, 1908–1919. [34] Rippka, R. (1988) Isolation and purification of cyanobacteria, in: Packer, L.,

[10] Giovannoni, S.F., Turner, S., Olsen, G., Barns, S., Lane, D.J., Pace, N.R. (1988) Evolu- Glazer, A.N. (Eds.), Methods in Enzymology, vol. 167, Academic Press, San Diego,

tionary relationships among cyanobacteria and green chloroplasts. J. Bacteriol. pp. 3–27.

170, 3584–3592. [35] Rippka, R., Castenholz, R.W., Herdman, M. (2001) Subsection IV (formerly

[11] Gugger, M.F., Hoffmann, L. (2004) Polyphyly of true branching cyanobacteria Nostocales Castenholz 1989b sensu Rippka, Deruelles, Waterbury, Herdman

(Stigonematales). Int. J. Syst. Evol. Microbiol. 54, 349–357. and Stanier 1979), in: Boone, D.R., Castenholz, R.W. (Eds.), Bergey’s Man-

[12] Guindon, S., Gascuel, O. (2003) A simple, fast, and accurate algorithm to esti- ual of Systematic Bacteriology, vol. 1, 2nd ed., Springer, New York, pp.

mate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. 562–589.

[13] Herdman, M., Castenholz, R.W., Iteman, I., Waterbury, J.B., Rippka, R. (2001) [36] Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., Stanier, R.Y. (1979)

Subsection I (formerly Chroococcales Wettstein 1924, emend. Rippka, Deru- Generic assignments, strain histories and properties of pure cultures of

elles, Waterbury, Herdman and Stanier 1979), in: Boone, D.R., Castenholz, R.W. cyanobacteria. J. Gen. Microbiol. 111, 1–61.

(Eds.), Bergey’s Manual of Systematic Bacteriology, 1, 2nd ed., Springer, New [37] Rippka, R., Waterbury, J.B., Herdman, M., Castenholz, R.W. (2001) Subsection II

York, pp. 493–514. (formerly Pleurocapsales Geitler 1925, emend. Waterbury and Stanier 1978),

[14] Hisbergues, M., Christiansen, G., Rouhiainen, L., Sivonen, K., Börner, T. (2003) in: Boone, D.R., Castenholz, R.W. (Eds.), Bergey’s Manual of Systematic Bacteri-

PCR-based identification of mycrocystin-producing genotypes of different ology, vol. 1, 2nd ed., Springer, New York, pp. 514–539.

cyanobacterial genera. Arch. Microbiol. 180, 402–410. [38] Sambrook, J., Russell, D.W. 2001 Molecular Cloning: A Laboratory Manual, 3rd

[15] Hoffman, L., Castenholz, R.W. (2001) Subsection V (formerly Stigonematales ed., Cold Spring Harbor Laboratory Press, New York, USA.

Geitler 1925), in: Boone, D.R., Castenholz, R.W. (Eds.), Bergey’s Manual of Sys- [39] Seabra, R., Santos, A., Pereira, S., Moradas-Ferreira, P., Tamagnini, P. (2009)

tematic Bacteriology, 1, 2nd ed., Springer, New York, pp. 589–599. Immunolocalization of the uptake hydrogenase in the marine cyanobacterium

[16] Jungblut, A.-D., Neilan, B.A. (2006) Molecular identification and evolution of Lyngbya majuscula CCAP 1446/4 and two Nostoc strains. FEMS Microbiol. Lett.

the cyclic peptide hepatotoxins, microcystin and nodularin, synthetase genes 292, 57–62.

in three orders of cyanobacteria. Arch. Microbiol. 185, 107–114. [40] Seabra, R., Wethey, D.S., Santos, A.M., Lima, F.P. (2011) Side matters: micro-

[17] Kellmann, R., Michali, T.K., Neilan, B.A. (2008) Identification of a saxitoxin habitat influence on intertidal heat stress over a large geographical scale. J.

biosynthesis gene with a history of frequent horizontal gene transfer. J. Mol. Exp. Mar. Biol. Ecol. 400, 200–208.

Evol. 67, 526–538. [41] Severin, I., Acinas, S.G., Stal, L.J. (2010) Diversity of nitrogen-fixing bacteria in

[18] Knoll, A.H. (2008) Cyanobacteria and earth history. In: Herrero, A., Flores, E. cyanobacterial mats. FEMS Microbiol. Ecol. 73, 514–525.

(Eds.), Cyanobacteria: Molecular Biology, Genomics and Evolution, Caister Aca- [42] Stal, L.J. (2000) Cyanobacterial mats and stromatolites. In: Whitton, B.A., Potts,

demic Press, Norfolk, UK, pp. 1–19. M. (Eds.), The Ecology of Cyanobacteria: Their Diversity in Time and Space,

[19] Komárek, J., Anagnostidis, K. (1989) Modern approach to the classification sys- Kluwer Academic, Dordrecht, The Netherlands, pp. 61–120.

tem of Cyanophytes. 4. Nostocales. Arch. Hydrobiol. Suppl. 82, 247–345. [43] Stal, L.J., Krumbein, W.E. (1985) Isolation and characterization of cyanobateria

[20] Komárek, J., Anagnostidis, K. (1998) Cyanoprokaryota. 1. Teil: Chroococcales, from a marine microbial mat. Bot. Mar. 28, 351–365.

in: Ettl, H., Gartner, G., Heynig, H., Mollenhauer, D. (Eds.), Süsswasserflora von [44] Stanier, R.Y., Kunisawa, R., Mandel, M., Cohen-Bazire, G. (1971) Purification and

Mitteleuropa, vol. 19/1, Gustav Fischer, Stuttgart, p. 548. properties of unicellular blue-green algae (order Chroococcales). Bacteriol. Rev.

[21] Komárek, J., Anagnostidis, K. (2005) Cyanoprokaryota 2 Teil/2nd part: Oscillato- 35, 171–205.

riales, in: Büdel, B., Krienitz, L., Gärtner, G., Schagerl, M. (Eds.), Süsswasserflora [45] Tamagnini, P., Troshina, O., Oxelfelt, F., Salema, R., Lindblad, P. (1997) Hydro-

von Mitteleuropa, vol. 19/2, Elsevier/Spektrum, Heidelberg, p. 759. genases in Nostoc sp. strain PCC 73102, a strain lacking a bidirectional enzyme.

[22] Kotai, J. 1972 Instructions for Preparation of Modified Nutrient Solution Z8 for Appl. Environ. Microbiol. 63, 1801–1807.

Algae, Publication B-11769, Norwegian Institute for Water Research, Blindern, [46] Taton, A., Grubisic, S., Ertz, D., Hodgson, D.A., Piccardi, R., Biondi, N., Tredici,

Oslo. M.R., Mainini, M., Losi, D., Marinelli, F., Wilmotte, A. (2006) Polyphasic study of

[23] Kottek, M., Grieser, J., Beck, C., Rudolf, B., Rubel, F. (2006) World map of the Antarctic cyanobacterial strains. J. Phycol. 42, 1257–1270.

Köppen-Geiger climate classification updated. Meteorol. Z. 15, 259–263. [47] Waterbury, J.B., Stanier, R.Y. (1978) Patterns of growth and development in

[24] Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., pleurocapsalean cyanobacteria. Microbiol. Mol. Biol. Rev. 42, 2–44.

McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., [48] Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J. (1991) 16S

Gibson, T.J., Higgins, D.G. (2007) Clustal W and Clustal X version 2.0. Bioinfor- ribossomal DNA amplification for phylogenetic study. J. Bacteriol. 173,

matics 23, 2947–2948. 697–703.

[25] Lima, F.P., Queiroz, N., Ribeiro, P.A., Hawkins, S.J., Santos, A.M. (2006) Recent [49] Whitton, B.A., Potts, M. (2000) Introduction to the cyanobacteria. In: Whitton,

changes in the distribution of a marine gastropod, Patella rustica Linnaeus, 1758, B.A., Potts, M. (Eds.), The Ecology of Cyanobacteria: Their Diversity in Time and

and their relationship to unusual climatic events. J. Biogeogr. 33, 812–822. Space, Kluwer Academic, Dordrecht, The Netherlands, pp. 1–11.

[26] Martins, R., Fernandez, N., Beiras, R., Vasconcelos, V. (2007) Toxicity assessment [50] Wiegand, C., Pflugmacher, S. (2005) Ecotoxicological effects of selected

of crude and partially purified extracts of marine Synechocystis and Synechococ- cyanobacterial secondary metabolites a short review. Toxicol. Appl. Pharmacol.

cus cyanobacterial strains in marine invertebrates. Toxicon 50, 791–799. 203, 201–218.

[27] Mühling, M., Woolven-Allen, J., Murrell, J.C., Joint, I. (2008) Improved group- [51] Wilmotte, A., Herdman, M. (2001) Phylogenetic relationships among the

specific PCR primers for denaturing gradient gel electrophoresis analysis of the cyanobacteria based on 16S rRNA sequences, in: Boone, D.R., Castenholz, R.W.

genetic diversity of complex microbial communities. ISME J. 2, 379–392. (Eds.), Bergey’s Manual of Systematic Bacteriology, 1, 2nd ed., Springer, New

[28] Nübel, U., Garcia-Pichel, F., Muyzer, G. (1997) PCR primers to amplify 16S rRNA York, pp. 487–493.

genes from cyanobacteria. Appl. Environ. Microbiol. 63, 3327–3332. [52] Wilmotte, A., van der Auwera, A.G., de Watcher, R. (1993) Structure of the

[29] Omoregie, E.O., Crumbliss, L.L., Bebout, B.M., Zehr, J.P. (2004) Comparison of 16S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF

diazotroph community structure in Lyngbya sp. and Microcoleus chthonoplastes (‘Mastigocladus laminosus HTF’) strain PCC 7518, and phylogenetic analysis.

dominated microbial mats from Guerrero Negro, Baja, Mexico. FEMS Microbiol. FEBS Lett. 317, 96–100.

Ecol. 47, 305–318. [53] Zehr, J.P. (2011) Nitrogen fixation by marine cyanobacteria. Trends Microbiol.

[30] Pontes, M.T., Aguiar, R., Pires, H.O. (2005) A nearshore wave energy atlas for 19, 162–173.

Portugal. J. Offshore Mech. Arct. Eng. 127, 249–255. [54] Zehr, J.P., Mellon, M.T., Zani, S. (1998) New nitrogen fixing microorganisms

[31] Potts, M. (1999) Mechanisms of desiccation tolerance in cyanobacteria. Eur. J. detected in oligotrophic oceans by the amplification of nitrogenase (nifH) genes.

Phycol. 34, 319–328. Appl. Environ. Microbiol. 64, 3444–3450.

Supplementary Material I

1

Table S1 Morphological identificationa of the cyanobacteria isolated from intertidal zones of the Portuguese coast Culture collection Morphology ORDER (Subsection) - LEGE code Cell size Habitat/Ecology Genus and species e Description (sampling site ) length  width f CHROOCOCCALES (I) Aphanothece cf. salina oval to cylindrical cells puddle, submerged stone, 06149(1) d 1.5-2.1  1.0 -1.4 µm (Synechococcus) b mucilaginous colonies epilithic 06109(4), 06012(5), 06127(7), 06130(9), Sabellaria alveolata reef, wave- Cyanobium sp. oval cells to rod-shaped 06137(3), 06140(4), 0.6-1.0 μm exposed or sheltered pools; Fig. 2b & 3b picocyanobacteria, 06143(7), 07153(6), epipsamic, epilithic, plankton 06184(7), 06097(6) Gloeocapsopsis cf. crepidinum c 3.5-5.0  3.0-4.5 μm sub-spherical or rounded-polyhedral cells 06123(8) d green macroalgae, epiphytic Fig. 3c Ø colony 10-14 μm colonial rod-shaped cells, straight to slightly curved air-exposed rock surface, (7) d 2.1-2.7  0.6-1.0 µm Synechococcus nidulans 07171 presence of involuted cells epilithic rod-shaped cells, air-exposed rock surface, (9) 0.6-0.8 µm Synechococcus sp. 07172 presence of involuted cells and epilithic pseudofilaments (2-5 cells) (1) (2) tide pool, stone or rock surfaces, Synechocystis salina 06099 , 06155 , 1.7- 1.9 μm spherical cells, in pairs or small groups Fig. 2a & 3a 07173(9) epilithic PLEUROCAPSALES (II) 4.7-6.5 μm Chroococcidiopsis sp. 06174(4) spherical to sub-spherical cells plankton baeocytes 2  3 μm Patella sp. and Gibbula sp. Chroococcopsis sp. 4.0-7.0  5.0-11.0 μm spherical to oval cells shells, brown macroalgae, (Myxosarcina and Pleurocapsa- 07161(6), 07187(1) b sheaths up to 2 μm reddish-brown euendolithic/epizoic and group) Fig. 2c, 2d, 2f & 3d epiphytic 'true borer' cyanobacterium Hyella sp. (Pleurocapsa-group) b Patella sp. shell, 07179(1) 2.2-3.8  3.7-5.0 μm highly differentiated colonies, Fig. 2g euendolithic/epizoic pseudofilaments Myxosarcina sp. binary fission in three planes  cubical wave-exposed pool, rock surface, 06146(1) 3.5 μm (Chroococcidiopsis) b Fig. 2e aggregates, < 8 baeocytes per mother cell epilithic OSCILLATORIALES (III) Leptolyngbya cf. halophila 06102(2), 06110(1), 0.9-1.3  1.1-1.6 μm wavy or coiled trichomes, with nodule-like puddle, submerged stone,

2

Fig. 2m & 3f 06152(3) structures epilithicm, plankton cylindrical shortly narrowed or rounded apical (3) d (4) 2.0-4.0  1.2-2.1 μm wave-exposed rock, epilithic Leptolyngbya fragilis 07167 , 07176 cells very thin trichomes, forming spiral bundles air-exposed rock surface, (1) d 1.6-2.6  0.7-0.9 µm and mats Leptolyngbya minuta 07181 epilithic reddish 06009(5), 06108(8), Leptolyngbya mycoidea long trichomes, motile, forming curved to tide puddle, rock surface, 06118(8), 06126(7), 2.0-3.0  1.4-1.8 μm Fig. 2k, 2l & 3e spiral bundles epilithic, plankton 07157(3) tide puddle, rock surface, (8) d (9) d 2.5-3.8  0.8-1.0 µm very thin trichomes, forming bundles Leptolyngbya saxicola 07132 , 07170 epilithic straight to slightly curved, cylindrical or wave-exposed rock surface, (9) 1.3-1.7  1.1-1.3 μm Leptolyngbya sp. 1 06121 conical rounded apical cell epilithic

Leptolyngbya sp. 2 (3) d long and more or less straight trichomes, 06188 1.5-2.3  1.5-1.9 µm plankton Fig. 2n forming radial aggregates Lyngbya cf. aestuarii 2.5-4.5  12.0-16.0 μm long, straight trichomes, with necridic cells 07165(2) tide pool, rock surface, epilithic Fig. 2p sheath up to 4.5 μm and hormogonia Phormidium laetevirens trichome end shortly hooked, narrowed or tide puddle, rock surface, 06103(8) 2.2  3.0 μm (Oscillatoria) b Fig. 2j rounded conical apical cell epilithic long trichomes straight or curved, irregularly Phormidium sp. 1 (6) b 06111 3.0-6.0  2.2-2.8 μm clustered or in bundles, forming "leathery" emersed rock, epilithic (Leptolyngbya) Fig. 2i mats shortly narrowed trichome ends and often tide pool, submerged stone, b (1) 3.0-4.0  2.5 μm Phormidium sp. 2 (Oscillatoria) 07162 bent, with thickened outer cell walls epilithic Plectonema cf. radiosum slightly narrowing trichomes, with geminate 3.0-5.0  7.0-9.0 μm sheath b (8) d false branches, apical cells widely rounded, green macroalgae, epiphytic (Scytonema) Fig. 2q 06105 up to 5 μm often capitate short trichomes, forming Nostoc-like wave-exposed rock and puddle, (9) (4) 0.7-1.6  0.8-1.4 µm Pseudanabaena aff. curta 07160 , 07169 gelatinous aggregates submerged stone, epilithic long trichomes, straight to curved, cylindrical Pseudanabaena aff. persicina 07163(1) d 3.5-4.1  1.2-1.6 μm cells Mytilus sp. shell, epizoic reddish straight to curved trichomes wave-sheltered zone, sand, Pseudanabaena cf. frigida 06144(7) d 1.5-2.1  0.7-0.9 μm brown culture epipsamic Pseudanabaena sp. 2 06129(4) 1.0-1.4  1.2-1.8 μm irregularly wavy trichomes plankton short trichomes (up to 15 µm), Pseudanabaena sp. 3 06116(6), 07190(3) d 0.8-1.4  0.7-1.5 µm tide pool, rock surface, epilithic with or without sheaths

3

Pseudophormidium sp. c 1.0-1.6  2.0-2.4 μm binary fission, in many planes (may not be tide puddle, rock surface, 06125(2) Fig. 2o sheath up to 0,5 μm perpendicular to the major axis) epilithic Romeria sp. (Pseudanabaena) b small trichomes, 2-7 cells (up to 20) 06013(5) 2.8-1.8  1.2-1.6 µm wave-exposed rock, epilithic Fig. 2h heterogeneous cells filaments composed by helically coiled (rope- Schizothrix aff. septentrionalis c 07164(1) 1.3-1.7  1.1-1.5 µm like) trichomes (2-3 per filament) brown macroalgae, epiphytic reddish-brown NOSTOCALES (IV) 1.5-2.3  6.5-9.5 μm heteropolar narrowing trichomes (more Calothrix sp. 1 (Rivularia) b 06100(3) d heterocysts evident in young), without hair formation wave-exposed rock, epilithic Fig. 2u 3.5-4.0  6.0-7.5 μm one basal hemispherical heterocyst basal vegetative cells submerged stone and green Calothrix sp. 2 (Rivularia) b 06122(2) d, 07177(6) d 2.0-3.0  7.0-9.0 μm heteropolar narrowing trichomes, with hairs macroalgae, epilithic and Fig. 2s & 3h Ø heterocysts 6.5-7.5 μm epiphytic 6.0-8 .0  4.0-5.5 μm densely, irregularly coiled filaments enclosed Nostoc sp. 1 06106(2) d, 06150(2) d Ø akinetes up to 10 μm in a common mucilage (up to 2.5 μm wide), tide pool, rock surface, epilithic Fig. 2r Ø colony12.0-26.0 μm ovoid mature vegetative cells 1.8-2.4  2.3-3.1 μm colony with narrow wavy filaments, enclosed Nostoc sp. 2 in a common mucilage, spherical intercalar 06158(9) d Ø intercalar heterocysts 2.4- wave-exposed puddle, epilithic Fig. 3g heterocysts, young trichomes with conical 3.0 μm terminal heterocysts Rivularia sp. 2.0-3.0  8.0-12.0 µm long heteropolar filaments, low degree of air-exposed rock surface, 07159(7) d Fig. 3i Ø heterocysts 6.5-8.5 µm narrowing, false branching epilithic 4.5-6.2  4.6-5.5 µm false-branching filaments (initially as a hairpin), constricted at cross walls, trichomes intercalar heterocysts air-exposed rock surface, Scytonema sp. (1) d frequently forming two rows, enclosed in a 07189 6.5-7.5  7-8.5 µm epilithic Fig. 2t common sheath, almost exclusively intercalar sheath up to 2.5 µm and terminal heterocysts aCyanobacterial taxa were classified according to Komárek & Anagnostidis [19,20,21], Waterbury & Stanier [47] and/or according to Bergey’s Manual of Systematic Bacteriology [4]. bWhen the identification is different in Bergey’s classification the corresponding form-genus is shown within parenthesis. c No correspondence in Bergey’s classification. dPotential nitrogen fixer (presence of a nif gene and/or heterocysts). e1- Moledo do Minho, 2- S. Bartolomeu do Mar, 3- Lavadores, 4- Aguda, 5- Foz do Arelho, 6- Martinhal, 7- Burgau, 8- Luz, 9- Olhos d’ Água; for details see Table 1. fRange of values within one standard deviation of the mean (n=20).

4

Fig. S1. Light micrographs of the cyanobacterial isolates. CHROOCOCCALES (Subsection I): (a) Aphanothece cf. salina LEGE 06149, (b) Cyanobium sp. LEGE 06137, (c) Cyanobium sp. LEGE 06109, (d) Cyanobium sp. LEGE 06140, (e) Cyanobium sp. LEGE 06012, (f) Cyanobium sp. LEGE 06097, (g) Cyanobium sp. LEGE 07153, (h) Cyanobium sp. LEGE 06127, (i) Cyanobium sp. LEGE 06143, (j) Cyanobium sp. LEGE 06130, (k) Gloeocapsopsis cf. crepidinum LEGE 06123, (l) Synechococcus nidulans LEGE 07171, (m) Synechococcus sp. LEGE 07172, (n) Synechocystis salina LEGE 06155; PLEUROCAPSALES (Subsection II): (o) Chroococcidiopsis sp. LEGE 06174; OSCILLATORIALES (Subsection III): (p) Leptolyngbya cf. halophila LEGE 06110, (q) Leptolyngbya cf. halophila LEGE 06152, (r) Leptolyngbya fragilis LEGE 07167, (s) Leptolyngbya fragilis LEGE 07176, (t) Leptolyngbya minuta LEGE 07181.

5

Fig. S2. Light micrographs of the cyanobacterial isolates (cont.). OSCILLATORIALES (Subsection III): (a) Leptolyngbya mycoidea LEGE 07157, (b) Leptolyngbya mycoidea LEGE 06009, (c) Leptolyngbya mycoidea LEGE 06108, (d) Leptolyngbya saxicola LEGE 07132, (e) Leptolyngbya saxicola LEGE 07170, (f) Leptolyngbya sp. 1 LEGE 06121, (g) Pseudanabaena aff. curta LEGE 07169, (h) Pseudanabaena aff. curta LEGE 07160, (i) Pseudanabaena aff. persicina LEGE 07163, (j) Pseudanabaena cf. frigida LEGE 06144, (k) Pseudanabaena sp.2 LEGE 06129, (l) Pseudanabaena sp. 3 LEGE 07190, (m) Pseudanabaena sp. 3 LEGE 06116, (n) Schizothrix aff. septentrionalis LEGE 07164; NOSTOCALES (Subsection IV): (o) Calothrix sp. 2 LEGE 07177, (p) Nostoc sp. 1 LEGE 06150, (q) Nostoc sp. 2 LEGE 06158, (r) Rivularia sp. LEGE 07159.

6

Fig. S3. Neighbor-joining phylogenetic tree of the 16S rRNA gene sequences from the isolates, reference cyanobacterial strains and the outgroup Chloroflexus aurantiacus J-10-fl. This tree was computed using the MEGA5 software [2], with the Tamura-Nei substitution model, a gamma distributed parameter of 0.4450 (as computed by jModelTest [1]) and considering 10000 pseudo-replicates for the bootstrap analysis (indicated only in those branches with a support equal or higher than 50%). Isolates are referred by their culture collection code, whereas reference strains are indicated in bold. [1] Posada, D. (2008). jModelTest: Phylogenetic Model Averaging. Molecular Biology and Evolution. 25(7), 1253-1256. [2] Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution.

CHAPTER III

Isolation of cyanobacterial strains from the Portuguese Atlantic coast disclosures novel diversity

Brito Â., Mota R., Ramos V., Lima S., Santos A., Vieira J., Vieira C.P., Vasconcelos V.M., Tamagnini P. 2015. (Manuscript).

FCUP 45 Characterization of cyanobacteria isolated from the Portuguese coast

Isolation of cyanobacterial strains from the Portuguese Atlantic coast disclosures novel diversity

Ângela Brito1,2,3, Rita Mota1,2,3, Vitor Ramos3,4, Steeve Lima1,2,3, Arlete Santos1,2,3, Jorge Vieira1,2, Cristina P. Vieira1,2, Vitor M. Vasconcelos3,4 and Paula Tamagnini1,2,3*

1i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto, Portugal 2IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal 3Faculdade de Ciências, Departamento de Biologia, Universidade do Porto, Porto, Portugal 4CIIMAR/CIMAR - Interdisciplinary Centre of Marine and Environmental Research, University of Porto, Porto, Portugal

Keywords: Geminocystis-like sp.; Hyella; Leptolyngbya; marine cyanobacteria; Phormidium; Portugal.

*Correspondence: Paula Tamagnini, IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal, Tel.: +351226074900; fax: +351226099157, e-mail: [email protected]

Running title: Novel cyanobacterial strains from the Portuguese coast.

46 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Abstract

Cyanobacteria, in particular tropical marine strains, have been recognized as a prolific source of secondary metabolites. However, little is known about their counterparts from temperate regions. Previously, we isolated and characterized sixty cyanobacteria from the intertidal zones of the Portuguese coast and their potential to produce secondary metabolites was also evaluated. The 16S rRNA gene sequences of two unicellular and five filamentous strains showed less than 97% similarity to sequences in the databases, revealing novel diversity. In the present study, these strains were further characterized in terms of morphology, ultrastructure and at the molecular level. To determine their relative position in the cyanobacteria phylum, additional phylogenetic analyses were carried out using 16S-ITS-23S rRNA gene sequences. The cyanobacterium belonging to Chroococcales/Subsection I, LEGE 07459 is related to the genera Geminocystis and Cyanobacterium, but shows distinctive characteristics indicating that could be the representative of a new genus. The isolate LEGE 07179 was assigned to Hyella sp. (Pleurocapsales/Subsection II) and the molecular data presented here are the first for members of this genus. Concerning the five isolates belonging to Oscillatoriales/Subsection III, the new data indicate that LEGE 06188 can indeed be assigned to a Leptolyngbya morphospecies (a genus known to be polyphyletic) while the other LEGE 07167, LEGE 07176, LEGE 07157, LEGE 0611 (previously assigned to L. fragilis, L. mycoidea, Phormidium/Leptolyngbya, respectively) and LEGE 07162 (previously assigned to Phormidium/Oscillatoria) constitute a distinct group of filamentous cyanobacteria that probably should be assigned to a new genus.

FCUP 47 Characterization of cyanobacteria isolated from the Portuguese coast

Introduction

Continental Portugal has an extensive coastline with climatic influences from the North Atlantic ocean and the Mediterranean sea and varied topographies, beach morphologies and wave regimens [for details on these subjects see (Pontes et al., 2005; Kottek et al., 2006; Lima et al., 2006; Seabra et al., 2011; Brito et al., 2012)]. Due to their long evolutionary history and metabolic plasticity, cyanobacteria are photosynthetic prokaryotes that can be found in a wide range of habitats including the marine ones (Whitton & Potts, 2000). Marine cyanobacteria play an important role in the global carbon cycle as primary producers and the ability to fix nitrogen confers them an advantage in the often nutrient-poor/nitrogen-depleted marine environments (Knoll, 2008; Zehr, 2011). In the intertidal zones cyanobacteria are exposed to extremely stressful conditions such as desiccation, temperature and salinity fluctuations, and often form cohesive mats held together by extracellular polymeric substances (EPS) that play key structural and protective roles (Stal, 2000; Díez et al., 2007). In these harsh environments, EPS besides contributing to a structurally-stable and hydrated microenvironment, are believed to confer protection against UV-radiation and promote the concentration of nutrients and metal ions (Rossi & De Philippis, 2015). In the last years, several reports on the diversity of cyanobacteria from Portuguese fresh and estuarine waters have been published (De Figueiredo et al., 2006; Valério et al., 2009; Galhano et al., 2011; Lopes et al., 2012), however the diversity of marine cyanobacteria has been relatively unexplored (Araújo et al., 2009; Ramos et al., 2010; Brito et al., 2012). Araújo et al., (2009) produced a checklist of benthic marine algae and cyanobacteria from the north of Portugal that included 26 cyanobacterial species. The majority of these species were filamentous belonging to the order Oscillatoriales (Subsection III), but unicellular strains belonging to Chroococcales (Subsection I) and Pleurocapsales (Subsection II) were also found. Concerning the filamentous heterocystous morphotypes only two species belonging to Nostocales (Subsection IV) were reported. Nevertheless, the work performed by these authors was based on new records, literature references and herbarium data, but did not include the isolation/cultivation of any of the observed specimens. Subsequently, Brito et al. (2012) characterized 60 cyanobacterial strains from the intertidal zones along the west and south coast. The morphological analysis revealed 35 morphotypes (15 genera and 16 species) belonging to the four cyanobacterial Orders/Subsections mentioned above (again no member of Stigonematales/Subsection V was found). The molecular characterization based on partial 16S rRNA gene sequences of these isolates showed that 15% of the sequences obtained had less than 97% similarity compared to the

48 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

sequences available in the databases emphasizing the presence of novel cyanobacterial diversity. The potential of these strains to fix nitrogen and to produce secondary metabolites was also evaluated. Our results showed that three out of seven of the novel strains are putative diazotrophs (presence of nif genes), and that one likely produces a compound related to naopopeptin or antanapeptin while two other might produce compounds related to hepatotoxins (Brito et al., 2012; Brito et al., 2015). Although 16S rRNA gene sequences are the most frequently used to infer phylogenetic relationships within cyanobacteria, this molecular maker has limited resolution at the cyanobacteria species level (Konstantinidis & Tiedje, 2007). Therefore, other less conserved markers can be used to provide complementary information to the 16S rRNA gene (Komárek, 2014). For instance, the internal transcribed spacer region (ITS), between the 16S and 23S ribosomal genes, contains many conserved domains (D1-D5, Box A, Box B) and variable regions (V1-V3) (Iteman et al., 2000) which have demonstrated to be useful for phylogenetic studies and identification of new taxa (Rocap et al., 2002; Casamatta et al., 2006). In addition, RNA secondary structures of this region have been used as discriminatory characters (Siegesmund et al., 2008; Perkerson III et al., 2011). The main goal of this study was to further characterize these seven isolates (two unicellular and five filamentous strains) in terms of morphology, ultrastructure and at the molecular level. To determine their relative position in the cyanobacteria phylum, additional phylogenetic analyses were carried out, using 16S-ITS-23S rRNA gene sequences to obtain a better resolution. This polyphasic study disclosured novel biodiversity, including new putative genera, and contributed to increase the knowledge on cyanobacteria from temperate Atlantic areas.

FCUP 49 Characterization of cyanobacteria isolated from the Portuguese coast

Materials and methods

Cyanobacterial strains and culture conditions The seven cyanobacterial strains studied in this work (Table 1) were previously isolated from the intertidal zones along the Portuguese Atlantic coast and are deposited at the LEGE Culture Collection (Laboratório de Ecotoxicologia Genómica e Evolução; CIIMAR, Porto, Portugal) (Brito et al., 2012). The uni-cyanobacterial Leptolyngbya sp. LEGE 06188 was grown in Z8 medium (Kotai, 1972) supplemented with 25 g L-1 NaCl and the remaining uni-cyanobacterial cultures were maintained in MN medium (Rippka, -1 1988). Both media were supplemented with 10 µg mL B12 vitamin. The cultures were kept at 25 ºC, under 16 h light (~ 10 mol photons m-2 s-1) / 8 h dark regimen.

Table 1. Cyanobacterial strains, culture collection code and sampling sites.

LEGE Order (Subsection) Genus /species Sampling sitea Code

Chroococcales (I) Geminocystis-like sp. 07459 Martinhal

Pleurocapsales (II) Hyella sp. (Pleurocapsa-group) 07179 Moledo do Minho

Leptolyngbya sp. 06188 Lavadores

(Leptolyngbya fragilis)b 07167 Lavadores

Oscillatoriales (III) (Leptolyngbya fragilis)b 07176 Aguda

(Leptolyngbya mycoidea)b 07157 Lavadores

(Phormidium sp./Leptolyngbya)b 06111 Martinhal

a for details see (Brito et al., 2012). b previously assigned to these genera, probably belonging to a new genus.

Light microscopy Cells were stained with Alcian Blue (0.5% (wt/vol) in 50% ethanol) and observed using an Olympus X31 light microscope (Olympus, Japan). Light micrographs were acquired with an Olympus DP25 camera and the CellˆB image software (Olympus, Japan).

Transmission Electron Microscopy (TEM) For negative staining, 10 µl of culture were placed on a Formvar carbon-coated nickel grids (200 mesh) for 2 min, the liquid in excess was removed with a filter paper, stained with 1% uranyl acetate for 5 sec with the excess of liquid removed.

50 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

For TEM, cells were collected, centrifuged and processed as previously described (Seabra et al., 2009) with the exception of the resin used that was EMBed-812 resin (Electron Microscopy Sciences, Hatfield, PA, USA). For the isolate LEGE 07157, the cells were fixed with 2.5% glutaraldehyde and 2% paraformaldehyde in 50 mM sodium cacodylate buffer (pH 7.2) for 72h and postfixed overnight with 2% osmium tetroxide in 50 mM sodium cacodylate buffer (pH 7.2). Subsequently, the cells were washed three times in sodium cacodylate buffer and stained en bloc overnight with 2% uranyl acetate. The samples or ultrathin sections were examined using a JEM-1400Plus (Jeol, MA, USA) electron microscope operating at 80 kV.

Scanning Electron Microscopy (SEM) For SEM analysis, cells were collected by centrifugation and fixed in 2% glutaraldehyde in 50 mM sodium cacodylate buffer (pH 7.2) and washed one time in double-strength buffer. The dehydration was performed in a graded series of ethanol (25–100%; v/v) and dried by critical-point drying. Samples were coated with a gold/palladium thin film, for 100 sec and a 15 mA current by sputtering, using the SPI Module Sputter Coater equipment (Structure Probe, Inc., PA, USA). The SEM analysis were performed using a High Resolution Scanning Electron Microscope (JSM 6301F, Jeol Ltd., Tokyo, Japan), operating at 15 kV.

DNA extraction, PCR amplification, cloning and sequencing Genomic DNA was extracted using the phenol/chloroform method previously described (Tamagnini et al., 1997) and the regions encoding part of 16S rRNA, the internal transcribed spacer (ITS) and most of the 23S rRNA gene were amplified using the oligonucleotide primers listed on Table 2. PCR reactions were performed using a thermal cycler (MyCyclerTM, Bio-Rad laboratories Inc., Hercules, CA, USA) following procedures previously described (Tamagnini et al., 1997). The PCR profiles included an initial denaturation at 94 ºC for 5 min, followed by 35 or 30 cycles (for ITS) at 94 ºC for 1 min, 52 ºC or 60 ºC (for ITS) for 1 min, 72 ºC for 1 min and a final extension at 72 ºC for 7 min. The amplification of nifH was performed following the methodology previously described (Omoregie et al., 2004). The PCR products were separated by agarose gel electrophoresis (Sambrook & Russell, 2001) and DNA fragments were isolated from gels using the NZYGelpure Kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s instructions. Purified products were cloned into pGEM®-T Easy vector

FCUP 51 Characterization of cyanobacteria isolated from the Portuguese coast

(Promega, Madison, WI, USA) following with the methodology earlier described (Ramos et al., 2010).

Table 2. Oligonucleotide primers used in this study.

Target Primer Sequence 5´  3´ Reference gene/sequence

16S rRNA 16SF CGCTAGTAATCGCAGGTCA This work ITSR CGGCTACCTTGTTACGACTT This work rRNA ITS CSIF GYCACGCCCGAAGTCRTTAC Janse et al., 2004 ULR CCTCTGTGTGCCTAGGTATC Janse et al., 2004 23S rRNA ITSF GGAGAACGCCAATACCCA This work ULF GATACCTAGGCACACAGAGG Ramos et al., 2010 23S800F GGTTAGGGGTGAAATGCCAA Ramos et al., 2010 23S867F GTTGGCGGATGAGGTGTGGTTA This work 23S893F GCGGTACCAAATCGAGACAAAC This work 23S1682F CTCTCTAAGGAACTCGGCAAA Ramos et al., 2010 23S819R TTGGCATTTCACCCCTAACC This work 23S1027R GCTGGTGGTCTGGGCTGTTT Ramos et al., 2010 23S1932R CCTTAGGACCGTTATAGTTA Ramos et al., 2010 p23SrV_r1 TCAGCCTGTTATCCCTAGAG Sherwood & Presting, 2007 nifH nifH4 TTYTAYGGNAARGGNGG Omoregie et al., 2004 nifH3 ATRTTRTTNGCNGCRTA Omoregie et al., 2004 nifH2 ADNGCCATCATYTCNCC Omoregie et al., 2004 nifH1 TGYGAYCCNAARGCNGA Omoregie et al., 2004

Nucleotide sequence accession numbers Sequence data were deposited in the GenBank database under the accession numbers KR676346 - KR676352 and KC256766, KC256770, KC256774 (nifH).

Phylogenetic analysis The 16S-ITS-23S rRNA gene sequences obtained in this study were used as query in a megaBLAST, at NCBI (database limited to cyanobacteria, April 2015) and sequences up to 50% sequence coverage were retrieved. A multiple alignment encompassing 16S-ITS-23S rRNA gene sequences was performed using the ClustalW2 algorithm (Larkin et al., 2007), with all the default parameters. The evolutionary history was inferred using the Minimum Evolution method (Rzhetsky & Nei, 1992). The optimal tree

52 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

with the sum of branch length = 2.69316579 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004) and are in the units of the number of base substitutions per site. The ME tree was searched using the Close-Neighbor-Interchange (CNI) algorithm (Nei & Kumar, 2000) at a search level of 1. The Neighbor-joining algorithm (Saitou & Nei, 1987) was used to generate the initial tree. The analysis involved 74 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There were a total of 5526 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013). From this analysis 4 groups were defined. However, due to the limited information available in databases (majority of the sequences obtained were from cyanobacterial genomes), a phylogenetic tree using only the 16S rRNA gene sequences was also performed. For this purpose, the 16S rRNA gene sequences were searched against the NCBI (database limited to cyanobacteria, April 2015) and the closest sequences (ordered by max. identity) that appeared until the delimiting sequence (defined in the 16S-ITS-23S tree) were retrieved as well as all the sequences bellow with the same identity percentage. The ME tree (16S rRNA gene) was constructed for each group using the procedure described above.

Secondary structure of ITS ITS sequence was folded using CLC Genomics Workbench software 8 (CLC Bio- Qiagen, Aarhus, Denmark) and the different regions of the ITS were identified.

Pigment analysis Phycobiliproteins were extracted by disruption of the cells in 1 ml of buffer (50 mM Tris- HCL pH 8.0, 5 mM EDTA and 50 mM NaCl) containing 0.3 g of 0.2 mm-diameter acid washed glass beads (Sigma-Aldrich, St. Louis, USA) using a FastPrep®-24 instrument (MP Biomedicals, CA, USA). Afterwards, samples were centrifuged at 4 °C and 16 000 g for 5 min. The absorbance spectra were recorded using an UV-2401PC spectrophotometer (Shimadzu Corporation, Japan) in the range 350 - 750 nm.

FCUP 53 Characterization of cyanobacteria isolated from the Portuguese coast

Nitrogenase activity For the measurement of the in vivo nitrogenase activity by the acetylene reduction assay (ARA), the cultures were grown in ASNIII0 medium (ASNIII without nitrate) (Rippka et al., 1979) under 12 h light (25 µmol photons m-2 s-1) / 12 h dark cycles at 30 ºC for 5 days. 10 mL of each culture where transferred to Erlenmeyer flasks with a total volume of 130 ml and incubated with 13% acetylene (C2H2) for 12 h in sealed flasks. Afterwards, 1 ml gas samples were withdrawn to determine the amount of acetylene reduced to ethylene. The measurements were performed using the gas chromatograph (GC) Clarus 480® (Perkin Elmer, MA, USA), equiped with a Thermal Conductivity Detector (TDC) and a capillary Porapak N 80/100 column, under the control of the TotalChrom® software (Perkin Elmer, MA, USA). Nitrogen was used as a carrier gas and the following were set for the GC (injector – 120 ºC, detector – 120 ºC and column – 60 ºC). Calibration was performed using a range of different ethylene gas concentrations. The nitrogenase activity was expressed per chlorophyll a and time. Chlorophyll a content was determined as previously described (Meeks & Castenholz, 1971). For positive and negative controls, cells of Anabaena sp. PCC 7120 grown in

BG110 (Stanier et al., 1971) or BG110 supplemented with ammonium chloride, respectively.

Results and discussion

In a previous study we isolated and characterized 60 cyanobacterial strains from the intertidal zones of the Portuguese coast and it was possible to identify 35 morphotypes with a clear preponderance of filamentous non-heterocystous strains (Brito et al., 2012). Among these isolates there was a high degree of novel diversity since nine 16S rRNA gene sequences exhibit less than 97% similarity compared to sequences available in the databases. These sequences were from two unicellular strains (one belonging to Chroococcales/Subsection I and the other to Pleurocapsales/Subsection II) and seven filamentous strains (Oscillatoriales/Subsection III). However, from these nine strains only seven could be maintained for an extended period of time (more than one year) in the LEGE Culture Collection. One of cultures, LEGE 07161, contained in fact two cyanobacterial strains (Chroococcopsis sp. and a Geminocystis-like sp.), being the later initially mistaken for nanocytes (see Fig. 1a). The partial 16S rRNA gene sequence obtained at the time was from the Geminocystis-like isolate to which a new LEGE code was now attributed - LEGE 07459 (sequence details also corrected at GenBank: KR676352). Unfortunately, the Chroococcopsis sp. morphologically

54 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

characterized by Brito et al. 2012 did not survived, so from these two co-cultured strains only the Geminocystis-like sp. LEGE 07459 was characterized in this study. The comprehensive characterization presented here contemplates the following strains: Geminocystis-like sp. LEGE 07459 (Chroococcales/Subsection I), Hyella sp. LEGE 07179 (Pleurocapsales/Subsection II), Leptolyngbya sp. LEGE 06188, L. fragilis LEGE 07167, L. fragilis LEGE 07176, L. mycoidea LEGE 07157 and Phormidium sp. LEGE 06111 (Oscillatoriales/Subsection III).

Isolate belonging to Chroococcales (Subsection I) Chroococcales comprise the unicellular cyanobacteria that reproduce by equal binary fission or by budding. Cells are spherical, ellipsoidal or rod-shaped (0.5-30 µm), and occurring single or in aggregates (Castenholz, 2001). The recently described genus Geminocystis is characterized by solitary, spherical or oval cells (3-10 µm in diameter) that divide by binary fission into two planes. The organization of thylakoids is irregular over the whole cell protoplast (Korelusová et al., 2009). Geminocystis-like sp. LEGE 07459 (aff. Geminocystis sp.) (Fig. 1), isolated from the Martinhal beach (N 37º01´07.30´´/ W 8º55´36.17´´) south of Portugal, displays spherical cells with 2.0 to 3.0 µm in diameter that form aggregates (Fig. 1e) surrounded by slime (Fig. 1c and e). The cell size is smaller than most of Geminocystis members and similar to members of the genus Synechocystis. However, the arrangement of the thylakoids is irregular over almost the whole cell (Fig. 1d) as in Geminocystis and Cyanobacterium, and contrast with the genus Synechocystis in which the arrangement is generally parietal (Korelusová et al., 2009). Using negative staining, long and abundant pilus-like could be observed (Fig. 1f), resembling Synechocystis sp. PCC 6803 type IV pili (Bhaya et al., 2000).

FCUP 55 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.1 - (a) Micrograph of the initial culture containing tw o cyanobacterial strains, one morphologically identified as Chroococcopsis sp. LEGE 07161 (larger cells) and the other as Geminocystis-like sp. LEGE 07459 (cells indicated by arrow s); (b) Light micrograph of the uni-cyanobacterial culture of Geminocystis-like sp. LEGE 07459 and (c) Culture stained w ith Alcian blue, slime (sl); (d) TEM ultrathin section of Geminocystis-like sp. LEGE 07459 show ing the thylakoids (th) arrangement and a forming septum (sp; arrow s); (e) SEM image w here it is possible to observe slime surrounding cell aggregates; (f) Negative staining show ing the presence of pili (pl). Scale bars: (a) = 10 µm; (b, c) = 20 µm; (d) = 0.2 µm; (e) =10 µm; (e – insert) = 3µm; (f) = 0.5 µm.

In the phylogenetic analysis based on 16S-ITS-23S rRNA gene sequences, LEGE 07459 is in a cluster comprising members of the genera Geminocystis and Cyanobacterium (closer to Geminocystis) with a strong bootstrap support, and differs distinctly from members of Synechocystis that are in a different position in phylogenetic tree (Fig. 9, highlighted in grey). In the 16S rRNA gene sequence tree, the isolate LEGE 07459 is closely related to several marine uncultured cyanobacteria strains from very distinct locations (without bootstrap support): marine reef, Oahu, Hawaii (Zheng et al., 2011), Cíes Island, Galicia, Spain (Acosta‐González et al., 2013) and South Atlantic Bight (SAB) off the coast of Savannah (Hunter et al., 2006), and the members of the genera Geminocystis and Cyanobacterium are in a distinct cluster (Fig. S1). It was previously described that Geminocystis differs from Synechocystis by position in the phylogenetic tree, arrangement of thylakoids and ITS secondary structure, sharing these characteristics with Cyanobacterium. Geminocystis differs from Cyanobacterium in cell shape and number of planes of fission (Korelusová et al., 2009). As stated previously, the LEGE 07459 spherical cell shape is similar to Geminocystis but apparently divides in one plane as Cyanobacterium. The 367 nucleotides long 16S-23S rRNA ITS secondary structure of our isolate was also analysed (Table 3) taking into account the conserved and variable regions previously described by Iteman (Iteman et al., 2000). The secondary structure of the region D1-D1´ of LEGE 07459 is short -18

56 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

nucleotides - and similar to those reported for Geminocystis and Cyanobacterium (Korelusová et al., 2009), the boxB is similar to Geminocystis, Cyanobacterium and Synechocystis, and the V3 region could not be determined (as for Geminocystis papuanica). The ITS region of LEGE 07459 contains also the tRNAAla and tRNAIle as Geminocystis and Cyanobacterium contrasting with Synechocystis that only contains tRNAIle (Korelusová et al., 2009). In summary, LEGE 07459 is more related to cyanobacteria of the genera Geminocystis and Cyanobacterium than to genus Synechocystis, but possess some distinctive characteristics that might indicate that this isolate could be the representative of a new genus.

Table 3. Secondary structure of 16S-23S rRNA internal transcribed spacer (ITS) of Geminocystis-like sp. LEGE 07459.

D1-D1´ Box B V3 tRNA

Not determined

Ala Ile

Isolate belonging to Pleurocapsales (Subsection II)

This Order/Subsection comprises unicellular cyanobacteria that can reproduce by multiple fission producing small and dispersible cells - baeocytes. Some members of the cyanobacterial genus Hyella (Bornet & Flahault, 1888) have been described as endoliths penetrating calcareous substrates (e.g. shells) (Al‐Thukair & Golubic, 1991; Castenholz, 2001). Pseudofilaments (uniseriate to multiseriate) grow into the stony substrate enveloped by thin or thickened, firm or mucilaginous, sometimes layered sheaths (Guiry & Guiry, 2015). Cells display different sizes (2.5-5.5 µm in diameter) and are more or less spherical, polygonal-rounded and oval or club- shaped at the ends of pseudofilaments and oldest cells (basal) may divide into baeocytes (reproductive cells) (Komárek, 2003). Most of the described species are

FCUP 57 Characterization of cyanobacteria isolated from the Portuguese coast from marine coastal environments (Lukas & Golubic, 1983; Al‐Thukair & Golubic, 1991). The isolate Hyella sp. LEGE 07179 was collected from Moledo do Minho beach (N 41º50´58.68´´/ W 8º52´0.18´´) north of Portugal, from shells of the marine gastropod mollusc Patella sp.. The isolate was previously described as a “true borer” cyanobacterium with highly differentiated colonies and pseudofilaments (Brito et al., 2012). Cells are more or less spherical with 2.5-5 µm in diameter and form colonies held together by extracellular polymeric substances (EPS) (Fig. 2a) from which the pseudofilaments emerge (Fig. 2c to e). The cells are surrounded by a stratified multi- layered sheath that can be easily observed in the TEM micrographs (Fig. 2b and c). In the TEM images is also evident the parietal arrangement of the thylakoids and the very particular shape of the pseudofilament cells (Fig. 2c).

Fig.2 - Micrographs of Hyella sp. LEGE 07179. (a) Light microscopy showing the presence of slime (sl) surrounding the cells stained w ith Alcian blue; (b) and (c) TEM ultrathin sections of a cell and a pseudofilament, respectively. In these images the arrangement of the thylakoids (th) and the thick stratified sheath (sh) are highlighted; (d) SEM image w here it is possible to observe the colonial morphology and the emerging pseudofilament (pf); (e) Detail of the pseudofilament (pf). Scale bars: (a) = 50 µm; (b, c) = 1 µm; (d) = 60 µm; (e) = 10 µm.

In the phylogenetic analysis based on 16S-ITS-23S rRNA gene sequences, Hyella sp. LEGE 07179 clearly clusters with Stanieria cyanosphaera PCC 7437 a member of Pleurocapsales (Subsection II), but it is a very divergent sequence (Fig. 9, highlighted in green). In the 16S rRNA phylogenetic tree this isolate is within a weakly supported cluster that includes an uncultured cyanobacteria strain (microbial mat from

58 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

stromatolite, Lagoa Salgada, Brazil) and Chroococcidiopsis sp. PCC 6712 (Pleurocapsales/Subsection II), although forming a distinct branch (Fig. S2). In summary, this preliminary analysis clearly showed that this isolate cluster with members of Pleurocapsales but without close relatives. This isolate was assigned as Hyella, a genus belonging to the Pleurocapsales/Subsection II. This is a group of cyanobacteria for which there is a lack of molecular data. At the moment, our 16S rRNA gene sequence is the only one available on the databases for the genus Hyella (Brito et al., 2012; Komárek et al., 2014) and therefore it was not possible to infer the phylogenetic relationship between our isolate and other members of Hyella.

Isolates belonging to Oscillatoriales (Subsection III) Oscillatoriales/Subsection III comprises filamentous cyanobacteria that undergo binary fission in a single plane and with filaments composed exclusively by vegetative cells. The genus Leptolyngbya (Anagnostidis & Komárek, 1988) includes filamentous cyanobacteria that exhibit very thin trichomes (<3 µm), consisting of cylindrical or isodiametric cells that are enclosed in a well-defined sheath. Apical cells are rounded (or exceptionally conical) and the trichome breakage may be trans or inter-cellular. In some members of this genus trichomes can be surrounding by a “mucus-like” matrix (Castenholz, 2001). Four of our strains, isolated from two beaches on the north of Portugal, Lavadores and Aguda (N 41º07´45.07´´/ W 8º39´19.22´´ and N 41º02´58.35´´/ W 8º39´19.22´´, respectively), were assigned to the genus Leptolyngbya (Brito et al., 2012). Leptolyngbya sp. LEGE 06188 has thin trichomes (width less than 3 µm) surrounded by a well-defined sheath and slime (Fig. 3a) and the cells are barrel shaped with sharp constrictions at the cells junctions (Fig. 3b to e). TEM micrographs showed the stratified sheath, the parietal arrangement of the thylakoids, and the presence of carboxysomes and polyphosphate bodies in the cytoplasm (Fig. 3b and c). In SEM micrographs the barrel shape of cells and the breakage of trichome can also be observed (Fig. 3d and e).

FCUP 59 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.3 - Micrographs of Leptolyngbya sp. LEGE 06188. (a) Light micrograph of the filaments stained w ith Alcian blue highlighting the sheath (sh); (b) and (c) TEM ultrathin sections show ing the parietal arrangement of the thylakoids (th) and the stratified sheath (sh); (d) and (e) SEM images w here it is possible to observe the barrel shaped cells and the breakage of a trichome w ith the tw o parts still connected by the sheath (sh). Scale bars: (a) = 50 µm; (b, c) = 0.5 µm; (d) = 6 µm; (e) = 10 µm.

In the phylogenetic analysis based on 16S-ITS-23S rRNA gene sequences, Leptolyngbya sp. LEGE 06188 clusters with a unicellular cyanobacterium isolated from the south Portuguese coast - Gloeocapsopsis crepidinum (Ramos et al., 2010; Brito et al., 2012) (Fig. 9, highlighted in pink). The phylogenetic tree using only the 16S rRNA gene sequences revealed a different topology (Fig. S3). The isolate LEGE 06188 clusters with several marine uncultured cyanobacteria strains from north-eastern Mexico (Sahl et al., 2011). This sub-cluster is within a clade composed by Leptolyngbya members (Fig. S3). In summary, the morphological and ultrastructural data together with the preliminary phylogenetic studies supported the assignment of this isolate to the genus Leptolyngbya, a genus known to be polyphyletic, in contrast with the other four filamentous isolates investigated in this study (see below). The isolates LEGE 07167 and LEGE 07176 were previously assigned to Leptolyngbya fragilis (Brito et al., 2012). Both display thin trichomes (width less than 3 µm) composed by cylindrical cells that are much more elongated (Fig. 4 and Fig. 5) than the ones from the strain described above. In both isolates, the terminal cells are more or less conical (see for e.g. Fig. 4c) and large amount of slime can be observed surrounding the filaments stained with Alcian blue (Fig. 4a and 5a). The thylakoids arrangement is clearly parietal in the isolate LEGE 07167 whereas in LEGE 07176 the thylakoids are more or less parallel over almost the whole cell (Fig. 4b and 5b).

60 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Fig.4 - Micrographs of LEGE 07167, previously assigned to Leptolyngbya fragilis. (a) Beams of filaments surround by slime (sl) stained w ith Alcian blue; (b) Longitudinal section of a filament in w hich is evident the parietal arrangement of thylakoids (th) w ithin each cell; (c) SEM image w here it is possible to observe the cylindrical shaped cells and the conical terminal cell. Scale bars: (a) = 50 µm; (b) = 1 µm; (c) = 4 µm.

In negatively stained LEGE 07176 cells, small spherical structures emerging from the outer membrane could be observed (Fig. 5c and d). It is known that many bacteria can release vesicles that play a role in different processes such as quorum signalling (Mashburn & Whiteley, 2005) and horizontal gene transfer (Kolling & Matthews, 1999; Rumbo et al., 2011). Recently, the formation of extracellular vesicles was reported in the unicellular marine cyanobacteria Prochlorococcus (Biller et al., 2014) and in the filamentous freshwater Anabaena sp. PCC 7120 strain (Oliveira et al., 2015). Overall, these data indicate that a wide range of morphological distinct cyanobacteria have the ability to produce and release vesicles that, most probably, play an important role in the interactions between the microorganisms and between microorganisms and the environment (Biller et al., 2014).

Fig.5 - Micrographs of LEGE 07176, previously assigned to Leptolyngbya fragilis. (a) Aggregated filaments stained w ith Alcian blue highlighting the presence of slime (sl); (b) TEM ultrathin section show ing the arrangement of the thylakoids (th); (c) and (d) Negative staining show ing the presence of vesicles (vs) emerging from the outer membrane and the presence of thin pili (pl). Scale bars: (a) = 50 µm; (b) = 0.2 µm; (c) = 0.1 µm; (d) = 0.2 µm.

FCUP 61 Characterization of cyanobacteria isolated from the Portuguese coast

LEGE 07157 was previously assigned to Leptolyngbya mycoidea and also has thin trichomes with less than 3 µm (Fig. 6a) but, in contrast with the previously described strains, the cells are more or less isodiametric (Fig. 6b). Once again, a large amount of polysaccharidic material can be discerned around the filaments stained with Alcian blue (Fig. 6a) and in between the parallel arranged filaments in the SEM image (Fig. 6d). The terminal cells are rounded with a calyptra-like structure (Fig. 6c), a thick ended cap on apical cells of some filamentous cyanobacteria (Palinska & Marquardt, 2008). In the TEM micrograph the parietal arrangement of the thylakoids can be observed as well as the cytoplasm and cytoplasmatic inclusions (Fig. 6b).

Fig.6 - Micrographs of LEGE 07157, previously assigned to Leptolyngbya mycoidea. (a) Light microscopy of the thin filaments surrounded by large amounts of slime (sl) stained w ith Alcian blue; (b) Ultrastructure of the more or less isodiametric cells w here the parietal arrangement of the thylakoids (th) and several cell inclusions can be observed; (c) and (d) SEM images of the filaments surface w here it possible to observe the calyptra on a terminal cell (arrow head) and slime in betw een the filaments (sl). Scale bars: (a) = 50 µm; (b) = 0.5 µm; (c) = 6 µm; (d) = 3 µm.

The isolate LEGE 06111 was collected from the Martinhal beach (N 37º01´07.30´´/ W 8º55´36.17´´) south of Portugal (Brito et al., 2012). As stated by Brito et al. (2012) this isolate could either be assigned to the genus Phormidium according to Komárek and Anagnostidis (Komárek & Anagnostidis, 2005) or to the genus Leptolyngbya following the Bergey’s Manual of Systematic Bacteriology (Castenholz, 2001). LEGE 06111 displays thin trichomes (2.5 µm wide) composed by elongated cells (Fig. 7a and b), the apical cells are pointed with a calyptra-like structure (Fig. 7d) and some polysaccharidic material (slime) can be discerned around the filaments stained with Alcian blue (Fig. 7a). TEM ultrathin sections showed the cylindrical shape of the cells, the parietal arrangement of thylakoids and the presence of subcellular structures like carboxysomes in the centre of the cell (Fig. 7b). Although the culture is uni-

62 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

cyanobacterial, it is not axenic and it was possible to observe bacteria tightly bound to the thin sheath that surrounds the filament (Fig. 7c).

Fig.7 - Micrographs of LEGE 06111, previously assigned to Phormidium/Leptolyngbya. (a) Light micrograph of the filaments stained w ith Alcian blue dye show ing the presence of slime (sl); (b) TEM ultrathin section highlighting the cells shapes and the parietal arrangement of the thylakoids (th); (c) Negative staining show ing the presence of bacteria (bac) tightly bound to the thin sheath; (d) SEM image exposing the calyptra (arrow head). Scale bars: (a) = 50 µm; (b, c) = 0.5 µm; (d) = 5 µm.

Recently, twenty-nine Phormidium-like strains were analysed concerning their phycobilin pigment composition (Palinska et al., 2011) and the authors showed that they group in three well defined types. Most of the strains (23) contained phycocyanin (PC) but not phycoerythrin (PE), while the other groups contained both PC and PE with a low or a high PE:PC ratio. The absorption spectrum observed for the strain LEGE 06111 (Fig. 8) fits the second type describe by Palinska et al. (Palinska et al., 2011) that contains both phycobiliproteins and a low PE:PC ratio.

Fig.8 - Absorption spectrum obtained for LEGE 06111, previously assigned to Phormidium/Leptolyngbya. Chl a - chlorophyll a; Carot - carotenoids; PE - phycoerythrin; PC - phycocyanin.

In the phylogenetic analysis based on 16S-ITS-23S rRNA gene sequences, the four isolates mentioned above LEGE 07167, LEGE 07176, LEGE 07157 and LEGE 06111 are in a distinct sub-cluster, supported by strong bootstrap value. LEGE 07176 forms a distinct branch and appeared as a “loner sequence”. This sub-cluster is within a clade

FCUP 63 Characterization of cyanobacteria isolated from the Portuguese coast composed by filamentous strains belonging to the genera Microcoleus, Arthospira and Spirulina (Fig. 9, highlighted in blue). In the tree based on the 16S rRNA gene sequences, LEGE 07176 is in a different position compared to the other 3 isolates (Fig. S4), a weakly supported cluster that includes members of Spirulina as well as a filamentous cyanobacteria isolate and several uncultured marine cyanobacteria collected from microbial mats, Elkhorn Slough estuary, CA, USA (Woebken et al., 2012), but constituting a separate branch. The other three isolates, together with another LEGE 07162 previously assigned to the genus Phormidium and characterized in Brito et al. 2012, form a well-supported distinct sub-cluster. In summary, the phylogenetic data presented here indicate that LEGE 06188 can indeed be assigned to the genus Leptolyngbya, a genus known to be polyphyletic, while the isolates LEGE 07167, LEGE 07176, LEGE 07157, LEGE 06111 (previously assigned to L. fragilis, L. mycoidea, Phormidium/Leptolyngbya, respectively) and LEGE 07162 (previously assigned to Phormidium/Oscillatoria) constitute a distinct group of filamentous cyanobacteria that probably could be assigned to a new genus firstly isolated from the Portuguese coast.

64 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Fig.9 - Minimum evolution (ME) tree of partial 16S-ITS-23S rRNA gene sequences from the seven isolates and strains retrieved from the BLAST analysis. Numbers along branches indicate bootstrap support considering 500 pseudo- replicates: only those equal or above 0.5 are indicated. Each isolate is indicated in bold and by the respective GenBank accession number (brackets). The 4 groups defined are highlighted in the tree.

FCUP 65 Characterization of cyanobacteria isolated from the Portuguese coast

Capacity to fix atmospheric nitrogen and to produce secondary metabolites It was previously demonstrated that three of the strains described above, Hyella sp. LEGE 07179, Leptolyngbya sp. LEGE 06188 and L. fragilis LEGE 07167 harboured the genes encoding the nitrogenase complex, notably nifK (nitrogenase beta subunit) and/or nifH (dinitrogenase reductase) (Brito et al., 2012). In this work partial sequences of nifH were obtained (GenBank accession numbers: KC256774, KC256766, KC256770), and the cyanobacteria ability to fix nitrogen was further evaluated by growing the strains in ASNIII medium with decreasing concentrations of combined nitrogen until depletion. Moreover, the nitrogenase activity was evaluated by the acetylene reduction assay (ARA). Although the strains could grow (Leptolyngbya sp. LEGE 06188) or survive (Hyella sp. LEGE 07179, Leptolyngbya fragillis LEGE 07167) in medium without combined nitrogen the nmoles of ethylene produced/chl a/h were residual compared to our control strain Anabaena/Nostoc sp. PCC 7120 (data not show), indicating they may have the ability to fix nitrogen in the environment but that this capacity might have been suppressed during the prolonged period of cultivation in media with combined nitrogen. An in situ assay will help to clarify if these cyanobacterial strains indeed play a role as N2 fixers in the marine environment. Additionally, crude extracts of these seven cyanobacterial strains previously analysed by LC-MS/MS coupled with molecular networking (Brito et al., 2015) revealed that two of the filamentous strains - LEGE 07167 and LEGE 07176 - may produce compounds related to the hepatotoxins generally produced by their freshwater counterparts, microcystin and nodularin. Preliminary LC-MS/MS analysis directed to detect microcystin showed that LEGE 07167 extract had a MS fragmentation pattern coinciding with microcystin-LR (data not shown). Further studies are required to unequivocally demonstrate that these marine cyanobacteria are indeed capable to produce these cyanotoxins.

Conclusions

This polyphasic study allowed a better characterization of the seven isolates from the intertidal zones of the Portuguese coast and unveiled their position within the cyanobacteria phylum. We could demonstrate that although the unicellular isolate LEGE 07459 (Chroococcales/Subsection I) is related to the genera Geminocystis and Cyanobacterium, it possess distinctive characteristics indicative of a different genus. The molecular data reported here for the isolate LEGE 07179, Hyella sp. (Pleurocapsales/Subsection II), were the first for members of this genus. Concerning

66 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

the five filamentous isolates belonging to Oscillatoriales/Subsection III, the new data indicate that LEGE 06188 is a Leptolyngbya morphospecies, while the other four - LEGE 07167, LEGE 07176, LEGE 07157, LEGE 06111 - together with LEGE 07162 constitute a distinct group of filamentous cyanobacteria that probably should be assigned to a new genus firstly isolated from the Portuguese coast. Moreover, our results suggest that the strains Hyella sp. LEGE 07179, Leptolyngbya sp. LEGE 06188

and LEGE 07167 might contribute to N2 fixation in their environment. Furthermore, two of the filamentous strains - LEGE 07167 and LEGE 07176 - may produce cyanotoxins (Brito et al., 2015). If further studies confirm our preliminary work on this subject, this constitutes the first report of microcystin-producing filamentous cyanobacterial strain from the temperate Atlantic region.

Acknowledgments

This work was funded by National Funds through FCT - Fundação para a Ciência e a Tecnologia, grants SFRH/BD/70284/2010 (to AB), SFRH/BD/84914/2012 (to RM) and SFRH/BD/80153/2011 (to VR). To this work also contribute the project MARBIOTECH (reference NORTE-07-0124-FEDER-000047) within the SR&TD Integrated Program MARVALOR - Building research and innovation capacity for improved management and valorisation of marine resources, supported by ON.2 Program and by the European Regional Development Fund (ERDF) through the COMPETE - Operational Competitiveness Programme, through the project NOVOMAR and national funds through FCT – Foundation for Science and Technology, through the project “PEst- C/MAR/LA0015/2013”. We are also grateful to Daniela Silva from Centro de Materiais da Universidade do Porto (CEMUP), Porto, Portugal, for technical assistance with SEM and to Paulo Oliveira, IBMC, for the help with the GC measurements.

FCUP 67 Characterization of cyanobacteria isolated from the Portuguese coast

References

Acosta‐González A, Rosselló‐Móra R & Marqués S (2013) Characterization of the anaerobic microbial community in oil‐polluted subtidal sediments: aromatic biodegradation potential after the Prestige oil spill. Environ Microbiol 15: 77-92. Al‐Thukair AA & Golubic S (1991) New endolithic cyanobacteria from the arabian gulf. I. Hyella immanis SP. NOV. 1. J Phycol 27: 766-780. Anagnostidis K & Komárek J (1988) Modern approach to the classification system of cyanophytes. 3. Oscillatoriales. Arch Hydrobiol Algolog Studies 50-53: 327-472. Araújo R, Bárbara I, Tibaldo M, Berecibar E, Tapia PD, Pereira R, Santos R & Pinto IS (2009) Checklist of benthic marine algae and cyanobacteria of northern Portugal. Bot Mar 52: 24-46. Bhaya D, Bianco NR, Bryant D & Grossman A (2000) Type IV pilus biogenesis and motility in the cyanobacterium Synechocystis sp. PCC 6803. Mol Microbiol 37: 941- 951. Biller SJ, Schubotz F, Roggensack SE, Thompson AW, Summons RE & Chisholm SW (2014) Bacterial vesicles in marine ecosystems. Science 343: 183-186. Bornet E & Flahault C (1888) Note sur deux nouveaux genres d'algues perforantes. J Bot Morot 2: 161-165. Brito Â, Gaifem J, Ramos V, Glukhov E, Dorrestein PC, Gerwick WH, Vasconcelos VM, Mendes MV & Tamagnini P (2015) Bioprospecting Portuguese Atlantic coast cyanobacteria for bioactive secondary metabolites reveals untapped chemodiversity. Algal Res 9: 218-226. Brito Â, Ramos V, Seabra R, et al. (2012) Culture-dependent characterization of cyanobacterial diversity in the intertidal zones of the Portuguese coast: a polyphasic study. Syst Appl Microbiol 35: 110-119. Casamatta DA, Gomez SR & Johansen JR (2006) Rexia erecta gen. et sp. nov. and Capsosira lowei sp. nov., two newly described cyanobacterial taxa from the Great Smoky Mountains National Park (USA). Hydrobiologia 561: 13-26. Castenholz RW (2001) Phylum BX. Cyanobacteria. Oxygenic Photosynthetic Bacteria. Bergey’s Manual of Systematic Bacteriology, Vol. 1 (Boone DR, Castenholz RW & Garrity G, eds.), pp. 473-599. Springer, New York. De Figueiredo DR, Reboleira AS, Antunes SC, Abrantes N, Azeiteiro U, Goncalves F & Pereira MJ (2006) The effect of environmental parameters and cyanobacterial blooms on phytoplankton dynamics of a Portuguese temperate lake. Hydrobiologia 568: 145-157.

68 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Díez B, Bauer K & Bergman B (2007) Epilithic cyanobacterial communities of a marine tropical beach rock (Heron Island, Great Barrier Reef): diversity and diazotrophy. Appl Environ Microb 73: 3656-3668. Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791. Galhano V, De Figueiredo DR, Alves A, Correia A, Pereira MJ, Gomes-Laranjo J & Peixoto F (2011) Morphological, biochemical and molecular characterization of Anabaena, Aphanizomenon and Nostoc strains (Cyanobacteria, Nostocales) isolated from Portuguese freshwater habitats. Hydrobiologia 663: 187-203. Guiry M & Guiry G (2015) AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org; searched on 08 April 2015. Hunter EM, Mills HJ & Kostka JE (2006) Microbial community diversity associated with carbon and nitrogen cycling in permeable shelf sediments. Appl Environ Microb 72: 5689-5701. Iteman I, Rippka R, de Marsac NT & Herdman M (2000) Comparison of conserved structural and regulatory domains within divergent 16S rRNA–23S rRNA spacer sequences of cyanobacteria. Microbiology 146: 1275-1286. Janse I, Kardinaal WEA, Meima M, Fastner J, Visser PM & Zwart G (2004) Toxic and nontoxic Microcystis colonies in natural populations can be differentiated on the basis of rRNA gene internal transcribed spacer diversity. Appl Environ Microb 70: 3979-3987. Knoll AH (2008) Cyanobacteria and earth history. The Cyanobacteria: Molecular Biology, Genomics, and Evolution,(Herrero A & Flores E, eds.), pp. 1-20. Caister Academic Press, Nortfolk, UK. Kolling GL & Matthews KR (1999) Export of virulence genes and Shiga toxin by membrane vesicles of Escherichia coli O157: H7. Appl Environ Microb 65: 1843- 1848. Komárek J (2003) Coccoid and colonial cyanobacteria. Freshwater Algae of : Ecology and Classification, Vol. 3 (Wehr JD & Sheath RG, eds.), pp. 59- 116. Academic Press, New York. Komárek J (2014) Modern classification of cyanobacteria. Cyanobacteria: An Economic Perspective,(Sharma NK, Rai aK & Stal LJ, eds.), pp. 21-39. Willey Blackwell, UK. Komárek J & Anagnostidis K (2005) Cyanoprokaryota-2. Teil/2nd part: Oscillatoriales. Süsswasserflora von Mitteleuropa 19/2,(Büdel B, Krienitz L, Gärtner G & Schagerl M, eds.), pp. 759. Elsevier/Spektrum, Heidelberg.

FCUP 69 Characterization of cyanobacteria isolated from the Portuguese coast

Komárek J, Kaštovský J, Mareš J & Johansen JR (2014) Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. Preslia 86: 295-335. Konstantinidis KT & Tiedje JM (2007) Prokaryotic taxonomy and phylogeny in the genomic era: advancements and challenges ahead. Curr Opin Microbiol 10: 504- 509. Korelusová J, Kaštovský J & Komárek J (2009) Heterogeneity of the cyanobacterial genus Synechocystis and description of a new genus, Geminocystis. J Phycol 45: 928-937. Kotai J (1972) Instructions for preparation of modified nutrient solution Z8 for algae. Publication B-11/69. Norwegian Institute for Water Research, Blindern, Oslo. Kottek M, Grieser J, Beck C, Rudolf B & Rubel F (2006) World map of the Köppen- Geiger climate classification updated. Meteorol Z 15: 259-263. Larkin MA, Blackshields G, Brown NP, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948. Lima FP, Queiroz N, Ribeiro PA, Hawkins SJ & Santos AM (2006) Recent changes in the distribution of a marine gastropod, Patella rustica Linnaeus, 1758, and their relationship to unusual climatic events. J Biogeogr 33: 812-822. Lopes VR, Ramos V, Martins A, Sousa M, Welker M, Antunes A & Vasconcelos VM (2012) Phylogenetic, chemical and morphological diversity of cyanobacteria from Portuguese temperate estuaries. Mar Environ Res 73: 7-16. Lukas KJ & Golubic S (1983) New endolithic cyanophytes from the north atlantic ocean. II. Hyella gigas lukas & golubic sp. nov. from the Florida continental margin. J Phycol 19: 129-136. Mashburn LM & Whiteley M (2005) Membrane vesicles traffic signals and facilitate group activities in a prokaryote. Nature 437: 422-425. Meeks JC & Castenholz RW (1971) Growth and photosynthesis in an extreme thermophile, Synechococcus lividus (Cyanophyta). Arch Mikrobiol 78: 25-41. Nei M & Kumar S (2000) Molecular evolution and phylogenetics. Oxford University Press, New York. Oliveira P, Martins NM, Santos M, Couto NA, Wright PC & Tamagnini P (2015) The Anabaena sp. PCC 7120 Exoproteome: Taking a peek outside the box. Life 5: 130- 163. Omoregie EO, Crumbliss LL, Bebout BM & Zehr JP (2004) Comparison of diazotroph community structure in Lyngbya sp. and Microcoleus chthonoplastes dominated microbial mats from Guerrero Negro, Baja, Mexico. FEMS Microbiol Ecol 47: 305- 318.

70 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Palinska KA & Marquardt J (2008) Genotypic and phenotypic analysis of strains assigned to the widespread cyanobacterial morphospecies Phormidium autumnale (Oscillatoriales). Arch Microbiol 189: 325-335. Palinska KA, Deventer B, Hariri K & Lotocka M (2011) A taxonomic study on Phormidium-group (cyanobacteria) based on morphology, pigments, RAPD molecular markers and RFLP analysis of the 16S rRNA gene fragment. Fottea 11: 41-55. Perkerson III RB, Johansen JR, Kovácik L, Brand J, Kaštovský J & Casamatta DA (2011) A unique pseudanabaenalean (cyanobacteria) genus Nodosilinea gen. nov. based on morphological and molecular data. J Phycol 47: 1397-1412. Pontes MT, Aguiar R & Pires HO (2005) A nearshore wave energy atlas for Portugal. J Offshore Mech Arct 127: 249-255. Ramos V, Seabra R, Brito Â, Santos A, Santos CL, Lopo M, Moradas-Ferreira P, Vasconcelos VM & Tamagnini P (2010) Characterization of an intertidal cyanobacterium that constitutes a separate clade together with thermophilic strains. Eur J Phycol 45: 394-403. Rippka R (1988) Isolation and purification of cyanobacteria. Method Enzymol, Vol. 167 (Packer L & Glazer AN, eds.), pp. 3-27. Academic Press, San Diego. Rippka R, Deruelles J, Waterbury JB, Herdman M & Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111: 1-61. Rocap G, Distel DL, Waterbury JB & Chisholm SW (2002) Resolution of Prochlorococcus and Synechococcus ecotypes by using 16S-23S ribosomal DNA internal transcribed spacer sequences. Appl Environ Microb 68: 1180-1191. Rossi F & De Philippis R (2015) Role of cyanobacterial exopolysaccharides in phototrophic biofilms and in complex microbial mats. Life 5: 1218-1238. Rumbo C, Fernández-Moreira E, Merino M, Poza M, Mendez JA, Soares NC, Mosquera A, Chaves F & Bou G (2011) Horizontal transfer of the OXA-24 carbapenemase gene via outer membrane vesicles: a new mechanism of dissemination of carbapenem resistance genes in Acinetobacter baumannii. Antimicrob Agents Chemoter 55: 3084-3090. Rzhetsky A & Nei M (1992) A simple method for estimating and testing minimum- evolution trees. Mol Biol Evol 9: 945-967. Sahl JW, Gary MO, Harris JK & Spear JR (2011) A comparative molecular analysis of water‐filled limestone sinkholes in north‐eastern Mexico. Environ Microbiol 13: 226- 240.

FCUP 71 Characterization of cyanobacteria isolated from the Portuguese coast

Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425. Sambrook J & Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press New York. Seabra R, Wethey DS, Santos AM & Lima FP (2011) Side matters: microhabitat influence on intertidal heat stress over a large geographical scale. J Exp Mar Biol Ecol 400: 200-208. Seabra R, Santos A, Pereira S, Moradas‐Ferreira P & Tamagnini P (2009) Immunolocalization of the uptake hydrogenase in the marine cyanobacterium Lyngbya majuscula CCAP 1446/4 and two Nostoc strains. FEMS Microbiol Lett 292: 57-62. Sherwood AR & Presting GG (2007) Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria. J Phycol 43: 605-608. Siegesmund MA, Johansen JR, Karsten U & Friedl T (2008) Coleofasciculus gen. nov. (cyanobacteria): morphological and molecular criteria for revision of the genus Microcoleus Gomont. J Phycol 44: 1572-1585. Stal LJ (2000) Cyanobacterial mats and stromatolites. The ecology of cyanobacteria: Their diversity in time and space,(Whitton BA & Potts M, eds.), pp. 61-120. Springer, The Netherlands. Stanier R, Kunisawa R, Mandel M & Cohen-Bazire G (1971) Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol Rev 35: 171. Tamagnini P, Troshina O, Oxelfelt F, Salema R & Lindblad P (1997) Hydrogenases in Nostoc sp. strain PCC 73102, a strain lacking a bidirectional enzyme. Appl Environ Microbiol 63: 1801-1807. Tamura K, Nei M & Kumar S (2004) Prospects for inferring very large phylogenies by using the neighbor-joining method. P Natl Acad Sci USA 101: 11030-11035. Tamura K, Stecher G, Peterson D, Filipski A & Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30: 2725-2729. Valério E, Chambel L, Paulino S, Faria N, Pereira P & Tenreiro R (2009) Molecular identification, typing and traceability of cyanobacteria from freshwater reservoirs. Microbiology 155: 642-656. Whitton BA & Potts M (2000) Introduction to the Cyanobacteria. The ecology of cyanobacteria: their diversity in time and space,(Whitton BA & Potts M, eds.), pp. 1- 11. Springer, The Netherlands. Woebken D, Burow LC, Prufert-Bebout L, Bebout BM, Hoehler TM, Pett-Ridge J, Spormann AM, Weber PK & Singer SW (2012) Identification of a novel

72 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

cyanobacterial group as active diazotrophs in a coastal microbial mat using NanoSIMS analysis. ISME J 6: 1427-1439. Zehr JP (2011) Nitrogen fixation by marine cyanobacteria. Trends Microbiol 19: 162- 173. Zheng G, Xin W, Hannides AK & Sansone FJ (2011) Impact of redox-stratification on the diversity and distribution of bacterial communities in sandy reef sediments in a microcosm. Chin J Oceanol Limnol 29: 1209-1223.

Supplementary Material II

FCUP 75 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.S1 - Minimum evolution (ME) phylogenetic tree of partial 16S- rRNA gene sequences from Geminocysis-like sp. LEGE 07459. Numbers along branches indicate bootstrap support considering 500 pseudo-replicates: only those equal or above 0.50 are indicated. Geminocysis-like sp. LEGE 07459 is indicated in bold.

76 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Fig.S2 - Minimum evolution phylogenetic tree of partial 16S rRNA gene sequence from the Hyella sp. LEGE 07179. Numbers along branches indicate bootstrap support considering 500 pseudo-replicates: only those equal or above 0.5 are indicated. Hyella sp. LEGE 07179 is indicated in bold.

FCUP 77 Characterization of cyanobacteria isolated from the Portuguese coast

Fig.S3 - Minimum evolution phylogenetic tree of partial 16S- rRNA gene sequence from the Leptolyngbya sp. LEGE 06188. Numbers along branches indicate bootstrap support considering 500 pseudo-replicates: only those equal or above 0.5 are indicated. Leptolyngbya sp. LEGE 06188 is indicated in bold.

78 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Fig.S4 - Minimum evolution phylogenetic tree of partial 16S rRNA gene sequence from the LEGE 07176 (Leptolyngbya fragilis), LEGE 06111 (Phormidium sp.), LEGE 07167 (Leptolyngbya fragilis) and LEGE 07157 (Leptolyngbya mycoidea) (highlighted in blue). Numbers along branches indicate bootstrap support considering 500 pseudo-replicates: only those equal or above 0.5 are indicated in bold.

CHAPTER IV

Bioprospecting Atlantic cyanobacteria for bioactive secondary metabolites reveals untapped chemodiversity

Brito Â., Gaifem J., Ramos V., Glukhov E., Dorrestein P.C., Gerwick W.H., Vasconcelos V.M., Mendes M.V., Tamagnini P. 2015. Algal Research 9: 218- 226.

Algal Research 9 (2015) 218–226

Contents lists available at ScienceDirect

Algal Research

journal homepage: www.elsevier.com/locate/algal

Bioprospecting Portuguese Atlantic coast cyanobacteria for bioactive secondary metabolites reveals untapped chemodiversity

Ângela Brito a,b,c, Joana Gaifem a,b, Vitor Ramos d, Evgenia Glukhov e, Pieter C. Dorrestein f,g, William H. Gerwick e,g, Vitor M. Vasconcelos c,d, Marta V. Mendes a,b, Paula Tamagnini a,b,c,⁎ a i3S — Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto, Portugal b IBMC — Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal c Faculdade de Ciências, Departamento de Biologia, Universidade do Porto, Porto, Portugal d CIIMAR/CIMAR — Interdisciplinary Centre of Marine and Environmental Research, University of Porto, Porto, Portugal e Center for Marine Biotechnology and Biomedicine, Scripps Institution of Oceanography, University of California San Diego, La Jolla, CA 92093, USA f Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA 92093, USA g Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla, CA 92093, USA article info abstract

Article history: Continental Portugal has an extensive Atlantic Ocean coastline; however little is known about the diversity of its Received 5 January 2015 marine cyanobacteria, with only a few reports published. Cyanobacteria are a prolific source of bioactive com- Received in revised form 10 March 2015 pounds with promising therapeutic applications. Previously, several cyanobacterial strains (Subsections I–IV) Accepted 23 March 2015 were isolated from the Portuguese Atlantic coast and characterized using a polyphasic approach. Preliminary Available online xxxx screening indicated that these cyanobacteria lacked the genes for proteins involved in the production of conven- tional cyanotoxins. However, it was previously shown that extracts of marine Synechocystis and Synechococcus Keywords: fi Atlantic Ocean were toxic to invertebrates, with crude extracts causing stronger effects than partially puri ed ones. To further Bioactive compounds evaluate the potential of our temperate region Portuguese isolates to produce bioactive compounds, a PCR Marine cyanobacteria screening for the presence of genes encoding non-ribosomal peptide synthetases (NRPSs) and polyketide Molecular networking synthases (PKSs), targeting the adenylation (A) and ketosynthase (KS) domains respectively, was performed. NRPS DNA fragments were obtained for more than 80% of the strains tested, and the results revealed that PKS genes PKS are more ubiquitous than NRPS genes. The sequences obtained were used in an in silico prediction of the PKS and NRPS systems. RT-PCR analyses revealed that these genes are transcribed under routine laboratory conditions in several selected strains. Furthermore, LC–MS analysis coupled with molecular networking, a mass spectrometric tool that clusters metabolites with similar MS/MS fragmentation patterns, was used to search for novel or otherwise interesting metabolites revealing an untapped chemodiversity. © 2015 Elsevier B.V. All rights reserved.

1. Introduction microcystin which is widespread in freshwater ecosystems worldwide. However, cyanobacteria can also produce secondary metabolites with Cyanobacteria are ancient prokaryotes with the capacity to perform promising therapeutic properties such as anticancer, antibiotic and oxygenic photosynthesis, and can be found in a great diversity of habitats, anti-inflammatory [4,9,10]. including extreme environments that are challenging to most of the life Marine cyanobacteria, in particular, are increasingly being recog- forms in Earth. Given their metabolic plasticity, cyanobacteria are a valu- nized as important source of structurally diverse secondary metabolites able and prolific source of biologically active secondary metabolites [1–6], [2,4,11,12]. Nearly 800 compounds have been identified in marine and some of these products can be toxic to higher animals including cyanobacteria, mainly in filamentous strains. Oscillatoriales (Subsection humans. These cyanotoxins can be classified into five functional groups III) contribute to almost half of the reported compounds (49%), according to their primary target organ or effects being designated as Nostocales (Subsection IV) with 26%, and Stigonematales (Subsection hepatotoxins, neurotoxins, cytotoxins, dermatotoxins and irritant toxins V) with merely 4%. Among the unicellular strains, the Chroococcales [7,8]. Understandably, a majority of early cyanobacterial natural products (Subsection I) contribute 15% and the Pleurocapsales (Subsection II) research focused mostly on toxins, particularly on the hepatotoxin about 6% [3,13]. However, the above percentages may be skewed due to selection and/or coverage bias. The majority of the bioactive metabolites isolated from cyanobacteria ⁎ Corresponding author at: IBMC — Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal. are polyketides (PKs), non-ribosomal peptides (NRPs) or a hybrid E-mail address: [email protected] (P. Tamagnini). of these two, and they are synthesized by modular multienzymatic

http://dx.doi.org/10.1016/j.algal.2015.03.016 2211-9264/© 2015 Elsevier B.V. All rights reserved. Â. Brito et al. / Algal Research 9 (2015) 218–226 219 complexes, namely type I polyketide synthases (PKSs) and non- PCR products were separated by agarose gel electrophoresis using stan- ribosomal peptide synthetases (NRPSs). Type I PKS and NRPS dard protocols [29]. DNA fragments were isolated from gels using pathways are characterized by a modular organization in which each the NZYGelpure Kit (NZYtech, Lisbon, Portugal), according to the module is responsible for the incorporation of a structural carboxylic manufacturer's instructions. Purified PCR products were cloned into acid or amino acid unit respectively [5,14,15]. pGEM®-T Easy vector (Promega, Madison, WI, USA), and transformed In a previous study, several cyanobacterial strains were isolated from into Escherichia coli DH5α competent cells following the manufacturer's nine sites in the intertidal zones along the Portuguese Atlantic coast and instructions, and the methodology earlier described [30]. extensively characterized using a polyphasic approach [16]. These strains were shown to be morphologically and phylogenetically very di- 2.3. Sequence analysis and in silico prediction of PKS and NRPS systems verse belonging to orders Chroococcales, Pleurocapsales, Oscillatoriales and Nostocales (Subsections I through IV). In this previous work, the Nucleotide sequences were analysed using the CLUSTAL W algo- genes encoding proteins involved in the production of the conventional rithm for multiple sequence alignments [31]. Sequence comparisons cyanotoxins were not detected by PCR screening. However, it was were carried out using BLAST databases at the National Center for shown that extracts of Synechocystis and Synechococcus, also isolated Biotechnology Information (NCBI). The obtained sequences encoding from the Portuguese coast, were toxic to invertebrates [17].This KS and A domains were submitted to the web-based tools NaPDoS previous study showed that the crude extracts from these two [32], and the PKS/NRPS analysis [33] to in silico predict PKS and NRPS picocyanobacteria had stronger effects than partially purified ones, systems, respectively. Default parameter settings were used in these suggesting the presence of different compounds and synergistic analyses. effect(s). Other recent studies, also using isolates from the Portuguese coast, revealed that extracts from these strains can have high activity 2.4. Nucleotide sequence accession numbers in ecologically-relevant bioassays and toxicity against human cancer cell lines [18–20]. Novel sequences associated with this study are available in GenBank In the current study, a PCR screen for the presence of genes encoding under the accession numbers KC842284–KC842372 (PKS), and type I PKS and NRPS pathways, targeting the ketosynthase (KS) and KC813168–KC813194 (NRPS). adenylation (A) domains, respectively was performed using the cyanobacterial strains previously characterized [16]. Based on the 2.5. RNA extraction and RT-PCR sequences obtained, an in silico prediction of PKS and NRPS type metab- olites was also undertaken. RT-PCR analyses were carried out for several Cells were collected from 48 h and 2 month old cultures, resuspended selected strains to understand if the genes were transcribed under with 1 ml RNAprotect® Bacterial Reagent (Qiagen, GmbH, Duesseldorf, routine laboratory conditions. Furthermore, LC–MS analyses of the Germany), collected again by centrifugation, and frozen at −80 °C. The cyanobacterial extracts coupled with molecular networking, visual cells were disrupted in TRIzol® Reagent (Ambion, Carlsbad, CA, USA) representations of mass-spectral data based on similarities in MS- containing 0.2 g of 0.2 mm-diameter acid washed glass beads (Sigma-Al- fragmentations [21], were used to search for specific metabolites of drich) using a FastPrep®-24 instrument (MP Biomedicals, CA, USA), and interest and their analogues, as well as novel compounds. RNA was extracted with the Purelink™ RNA Mini Kit (Ambion, Carlsbad, CA, USA). For cDNA synthesis 500 ng of total RNA was transcribed with 2. Materials and methods the iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Hercules, CA, USA), following the manufacturer's instructions. The PCRs 2.1. Cyanobacterial isolates and culture conditions were performed using the primer pairs listed in Table 1, and following the methodology previously described [26].ThePCRprofile was: 4 min The cyanobacterial strains used in this study were previously isolated at 94 °C followed by 40 cycles of 1 min at 94 °C, 1 min at 52 °C and from the Portuguese coast and are deposited at the LEGE Culture 45 s at 72 °C, and a final extension at 72 °C for 7 min. Negative controls Collection (Laboratório de Ecotoxicologia Genómica e Evolução; (no template cDNA) and positive controls (genomic DNA) were included CIIMAR, Porto, Portugal) [16]. Additionally, the isolate LEGE 06123 in all RT-PCRs. is also deposited at Culture Collection of Algae and Protozoa (CCAP 1425/1). The uni-cyanobacterial cultures were maintained in the 2.6. Extraction, LC–MS analysis and molecular networking generation following media: MN [22],BG110,BG11[23],Z8[24] supplemented with 25 g l−1 NaCl, further named Z8 25‰ and ASNIII [25]. The media To produce crude extracts, the freeze-dried biomass of each of the 57 were supplemented with B12 vitamin. The cultures were kept at 25 °C, cyanobacterial strains (~30 mg, Table 2) was repeatedly extracted with −2 −1 under a 16 h light (~10 μmol photons m s )/8 h dark regimen. 2:1 CH2Cl2:MeOH (with manual fragmentation of the cyanobacterial clumps), filtered through a Whatman No. 1 filter paper, and dried by 2.2. DNA extraction, PCR amplification and sequencing rotary evaporation. The resulting crude extract was dissolved in 2:1

CH2Cl2:MeOH, transferred to a vial and dried again. Crude extract was −1 Cells were harvested by centrifugation and DNA was extracted using resuspended at ~30 mg ml in 50% acetonitrile (CH3CN) in water the Maxwell® 16 System according to the instructions of the manufac- and passed through a Bond Elut-C18 OH cartridge (Agilent Technolo- turer or by the phenol/chloroform method previously described [26]. gies, USA) that was prewashed with 3 ml of CH3CN. Afterwards, the PCR amplifications of the regions encoding the ketosynthase (KS) and Bond Elut-C18 OH cartridge was washed with 3 ml of CH3CN, the adenylation (A) domains from the polyketide synthase (PKS) and obtained was dried under N2 and the residue was dissolved at −1 non-ribosomal peptide synthetase (NRPS) gene clusters, respectively 20 mg ml in 50% CH3CN in water. A 0.020 ml aliquot of each sample were performed using the degenerate oligonucleotide primer pairs was injected and analysed via LC–MS/MS on a Thermo Finnigan Survey- DKF/DKR [27] and MTF2/MTR [28], respectively. PCR reactions were or Autosampler-Plus/LC–MS/MS/PDA-Plus system coupled to a Thermo performed using a thermal cycler MyCycler™ (Bio-Rad laboratories Finnigan LCQ Advantage Max mass spectrometer with a gradient of

Inc., Hercules, CA, USA) following procedures previously described 30–100% CH3CN in water with 0.1% formic acid. [26]. The PCR profiles included an initial denaturation at 94 °C for The MS/MS spectra of these 57 cyanobacteria along with 105 MS/MS 4 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing spectra of reference cyanobacterial compounds (natural products for 30 s at 58 °C (DKF/DKR) and 48 °C (MTF2/MTR), followed by exten- discovered in various cyanobacterial collections [34]) were used to gen- sion at 72 °C for 1 min, and a final extension at 72 °C for 7 min. The erate a molecular network following previously described methodology 220 Â. Brito et al. / Algal Research 9 (2015) 218–226

Table 1 Oligonucleotide primers used for RT-PCR targeting the cyanobacterial sequences encoding the KS (KS primers) and A (AD primers) domains of the PKS and NRPS genes, respectively.

Organism and target sequencea Primer pair Sequence 5′ → 3′ PCR product expected size (bp)

LEGE 06100 KS4F ACAGTGGTATTGATGCTTACAGTAG 325 KS4R ACAACAATTCCGCAACCTTCC LEGE 06109 (2) KS14-2F CGGATCAGCTACTTCTACG 414 KS14-2R ATAGGCAGTGCGAATGAG LEGE 06109 (4) KS14-4F CTTCGTCGCTGGACTATC 406 KS14-4R CTCTTTGTTCCCTTTGGC LEGE 06111 (1) KS16-1F CACCAATATCGGCATCGC 386 KS16-4F AACGCCTACACCAGTATC 394 KS16-1.4R CCATCATTGTTGCAGTCG LEGE 06111 (3) KS16-3F TGCTCCTCTTCCATCGTC 382 KS16-3R TCGGGTTGATTTCAAGGC LEGE 06146 (1) KS59-1F GACCGACTACGCACTATAC 414 KS59-1R CGAATGACCGCATAGACC LEGE 06146 (2) KS59-2F GCAACTTGTGTGGGAAGC 419 KS59-2R CATAACCGTCGCCATTGG LEGE 06146 (3) KS59-3F ATTATCACCATCGCTTCCTC 302 KS59-3R GAACGCCTGACACAATCC LEGE 06158 (1) KS72-1F CTGTCGAACCGTATTTCC 413 KS72-1R TCAATGAGGCTCTGTTGG LEGE 06158 (2) KS72-2F ATCCTCAGCAGCGACTTC 385 KS72-2R TCAGCCTGATCGAAACTC LEGE 07160 (1) KS74-1F GGATTGGCACGCACGACTAT 451 KS74-1R CTACAGCCGTCTTGATTGAC LEGE 07160 (2) KS74-2F CAAGCCACTGTCGCCAAC 396 KS74-2R TTGACCGCCATCATTGCC LEGE 07160 (3) KS74-3F TGCTGTTAGAGGTCTGCTG 382 KS74-3R TCTGCTGCCATCATCTGC LEGE 07179 (1) KS93-1F GCTATTACTACGATTTCCAC 317 KS93-1R GATGACGGCGATGATGTC LEGE 07179 (1) KS93-2F AACCGCATCAGCTATTTC 328 KS93-2R GAATGACGGCAAGGATCG LEGE 06013 (2) KS118-2F GCCTACAGTGTTCAGACC 413 KS118-2R ATATCCGCAGCAGTTAGAC LEGE 06111 (2) KSF TATCTGGCGTTCAACCTG 419 LEGE 06194 (1) KSR ACCGCATGAATATTGTCG LEGE 06109 AD14F CTTACCTGATTCGGAAGATAC 403 AD14R AAGTTCGCCTGTTACTCC LEGE 06158 (1) AD72-1F CGTATCTTCTCTGAGCAACTTCG 310 AD72-1R GCAAATAAACCTGTGTGTTAGCG LEGE 07179 AD93F GTGTGGCCTACGTCATCTATAC 406 AD93R CGTCTTGCTGTTTGCGATG

a When multiple sequences were obtained for a single cyanobacterial strain they are indicated by numbers in between brackets.

[21] and visualized using Cytoscape (www.cytoscape.org). Algorithms was detected in 85% of the strains, rising to 97% among filamentous assumed a cosine threshold set at 0.6 and nodes were colour-coded cyanobacteria (Oscillatoriales and Nostocales) (Table 2). A-domain se- according to their origin. quences were detected in only 56% of the strains tested, and this percentage fell to 33% in unicellular strains (Chroococcales) (Table 2). 3. Results and discussion Similar to the KS sequences, A-domain sequences were more frequent in filamentous strains (66%). Overall, these data revealed that PKS Continental Portugal has an extensive coastline facing the Atlantic and/or NRPS encoding genes are present in the majority of these Ocean; nevertheless, little is known about the biodiversity of marine cyanobacterial isolates, with PKS genes being more ubiquitous than cyanobacteria from this area with only two recently published reports NRPS. Our results are in agreement with previous reports that detected on this topic [16,35]. However, there have been a few investigations the presence of PKS and NRPS encoding genes in cyanobacteria and aimed at assessing their bioactive potential [18–20,36].Inthis demonstrated the higher frequency of these genes in filamentous current study, 61 isolates belonging to different genera of the orders strains [1,14,39–41]. In this current work and accord with previous Chroococcales, Pleurocapsales, Oscillatoriales and Nostocales (corre- findings [39,42], the only genus for which neither KS- nor A-domain sponding to Subsections I through IV) were tested. These isolates sequences could be detected was Synechococcus (Table 2). However, re- comprise the majority of those previously characterized strains [16] as cent studies found that PKS genes were present in several Synechococcus well as six others deposited at the LEGE culture collection [18,20]. strains, including Synechococcus sp. PCC 7002 [40,41]. Christiansen et al. (2001) could not detect NRPS encoding genes in strains of the genus 3.1. PCR screen for PKS and NRPS encoding genes Synechocystis, while recent studies [40,41] observed the occurrence of NRPS gene clusters in Synechocystis PCC 7509 (cluster 3, [43]) but not To evaluate the potential of these cyanobacterial isolates to produce in another phylogenetically distinct strain Synechocystis PCC 6803 secondary metabolites, a PCR screen was performed for type I polyke- (cluster 2.1, [43]). Interestingly, here we demonstrated the presence tide synthase (PKS) and non-ribosomal peptide synthetase (NRPS) of NRPS and PKS encoding genes in two strains of this genus, genes, targeting the ketosynthase (KS) and adenylation (A) domains. Synechocystis salina LEGE 06099 and LEGE 07173. One should bear in Under the conditions tested, the presence of KS domain sequences mind that a previous study reported that extracts of Synechocystis Â. Brito et al. / Algal Research 9 (2015) 218–226 221

Table 2 strains isolated from the Portuguese coast were toxic towards marine PCR screening for sequences encoding the ketosynthase domain (KS) of PKS genes and the invertebrates suggesting the presence of bioactive compounds within adenylation-domain (A) of NRPS genes in cyanobacterial isolates from intertidal zones of this genus [17]. the Portuguese coast.

Order (Subsection) PKS NRPS 3.2. In silico prediction of PKS and NRPS systems Genus and species (LEGE code) Chroococcales (Subsection I) The DNA fragments obtained by PCR were cloned and sequenced. In − Cyanobium sp. (06012) + total, we obtained 89 sequences from 47 cyanobacteria strains that Cyanobium sp. (06097) + − Cyanobium sp. (06098) + + encoded for KS-domains. For 18 strains a single KS-domain was identi- Cyanobium sp. (06109) + + fied, whereas for the remaining cyanobacteria two or more KS se- Cyanobium sp. (06113) + − quences were revealed (Supplementary Table S1). BLASTp analysis Cyanobium sp. (06127) − + showed identities ranging between 50 and 99% to known KS sequences. Cyanobium sp. (06130) + − Concerning the A-domains, 27 sequences were obtained from 19 Cyanobium sp. (06134) + − fi Cyanobium sp. (06137) −−isolates. A single A-domain was identi ed in 11 strains, while two Cyanobium sp. (06140) − + A-domains were identified for the other 8 cyanobacteria (Supplementary Cyanobium sp. (06143) + − Table S2). BLASTp analysis showed identities ranging between 43 and − Cyanobium sp. (06184) + 87% to known NRPS sequences. Cyanobium sp. (07153) + − Cyanobium sp. (07175) −−Furthermore, these sequences were used for in silico analyses of Cyanobium sp. (07186) + − their PKS and NRPS systems using the following web-based software Gloeocapsopsis cf. crepidinum (06123) − + packages: the NaPDoS [32] for PKS and PKS/NRPS analysis [33] for Synechococcus nidulans (07171) −−NRPS analysis. NaPDoS is a bioinformatic tool for the rapid detection Synechococcus sp. (07172) −− and analysis of secondary metabolite encoding genes. This tool employs Synechocystis salina (06099) + + fi Synechocystis salina (06155) −−a phylogeny-based classi cation system of KS (PKS) and C (NRPS) Synechocystis salina (07173) + + domain sequences which extracts and classifies KS and C domains from a wide range of sequence data; the results can be used to assess Pleurocapsales (Subsection II) Chroococcidiopsis sp. (06174) + + the potential for PKS and NRPS secondary metabolite biosynthesis in a Chroococcopsis sp. (07161) + − given organism [32]. A preliminary candidate screening was performed Chroococcopsis sp. (07187) + + for all 89 KS sequences in NaPDoS and KS domains were confirmed and Hyella sp. (07179) + + identified for all queried sequences. Afterwards, these sequences were Myxosarcina sp. (06146) + + compared against the reference database to identify matches to Oscillatoriales (Subsection III) known PKS and NRPS pathways. This preliminary analysis included a − Nodosilinea nodulosa (06102) + the query identification, best database match, sequence identity and a − Nodosilinea nodulosa (06110) + fi Nodosilinea nodulosaa (06152) + + classi cation of the biosynthetic pathway associated with the best Leptolyngbya fragilis (07167) + − match. From the 89 sequences, biosynthetic gene clusters correspond- Leptolyngbya fragilis (07176) + − ing to 13 different compounds were identified (Fig. 1a, Supplementary Leptolyngbya mycoidea (06009) + − Table S1). BLAST hits for KS domains with more than 85% identity at − Leptolyngbya mycoidea (06108) + the amino acid level indicated that the query domains might be associ- Leptolyngbya mycoidea (06118) + + Leptolyngbya mycoidea (06126) + + ated with the production of the same or a similar compound as those Leptolyngbya mycoidea (07157) −−produced by the reference pathway [32]. In this analysis, all of the iden- Leptolyngbya saxicola (07132) + + tities obtained with the characterized domains in the NaPDoS database Leptolyngbya saxicola (07170) + + were low (less than 80%) indicating that the corresponding biosynthetic Leptolyngbya sp. 1 (06121) + − Leptolyngbya sp. 2 (06188) + − gene clusters are probably not yet characterized and that the encoded Phormidium laetevirens (06103) + + compound may be new. Phormidium sp. 1 (06111) + + For NRPS analysis the PKS/NRPS analysis, one of the specificity Plectonema cf. radiosum (06105) + + prediction tools that have been developed, was used. The 27 A domain Pseudanabaena aff. curta (07160) + + sequences were analysed and the information obtained is shown in Pseudanabaena aff. curta (07169) + − Pseudanabaena aff. persicina (07163) + + Supplementary Table S2. This preliminary analysis comprises the best Pseudanabaena cf. frigida (06144) + + database match, the signature sequence and the predicted amino acid. Pseudanabaena sp. (06194) + + From the 27 sequences in our dataset, biosynthetic gene clusters Pseudanabaena sp. 2 (06129) + + corresponding to 10 different compounds were identified. Five NRPS Pseudanabaena sp. 3 (06116) + − Pseudanabaena sp. 3 (07190) + − A-domains from 5 different cyanobacterial strains had no correspon- Romeria sp. (06013) + + dence in the databases, suggesting that the biosynthetic gene clusters Schizothrix aff. septentrionalis (07164) + + have not yet been characterized (Fig. 1b and Supplementary Table S2). It is important to stress that these are predictions, and therefore, Nostocales (Subsection IV) Calothrix sp. 1 (06100) + + interpretation of these findings should be conservative; however, Calothrix sp. 2 (06122) + + these results unquestionably highlight the potential of these strains to Calothrix sp. 2 (07177) + + produce a diverse range of secondary metabolites. Nostoc sp. 1 (06106) + + Nostoc sp. 1 (06150) + + Nostoc sp. 2 (06158) + + 3.3. Transcriptional analysis Rivularia sp. (07159) + + Scytonema sp. (07189) + + RT-PCR analyses of several of these isolates were performed to de- +, PCR amplification; −, no PCR amplification. For more details on the sampling sites/or- termine if the PKS/NRPS genes were transcribed under routine laborato- ganisms see [16]. ry growth conditions. For this purpose we selected the faster growing a Formerly assigned to Leptolyngbya cf. halophila [37,38]. cyanobacterial strains in order to be able to evaluate transcription in at least two different time points of the growth phase (strains and primer pairs listed in Table 1). The strains and primer pairs for which 222 Â. Brito et al. / Algal Research 9 (2015) 218–226

Fig. 1. Frequency of the in silico predicted PKS and NRPS genes in 61 marine cyanobacterial strains from Portugal using (a) the NaPDoS software for PKS genes and (b) the PKS/NRPS anal- ysis tool for the NRPS genes. Abbreviations for the proposed compound produced by gene clusters: Bleom — bleomycin; Cur — curacin; Epo — epothilone; HSAF — heat stable antifungal factor; Jam — jamaicamide; Kirr — kirromycin; Lnm — leinamycin; Lovas — lovastatin; Mta — myxothiazol; Mxa — myxalamide; Nos — nostopeptolide; Sti — stigmatellin; Vir — virginiamycin; Adp — anabaenopeptilide; Cch — coelichelin; Mcy — microcystin; Myc — mycosubtilin; Phs — phosphinothricin; Pvd — pyoverdin; Saf — saframycin; Srf — surfactin; and Tyc — tyrocidine. we obtained positive RT-PCR results/transcription (Fig. 2) are highlight- the secondary metabolome of a given organism [21,34,44]. Cytoscape ed in grey in Table 1. From these results we found that under routine software provides a visual representation of the molecular network laboratory growth conditions, the PKS encoding genes were transcribed where each node (circle) represents a single consensus MS/MS for three out of the nine strains tested, whereas the NRPS encoding spectrum for a given parent mass, and the relatedness between each genes were transcribed in two out of three strains. node is defined by an edge (lines). The thickness of the edge defines the degree of similarity of the MS/MS spectra. Molecular networks are 3.4. LC–MS and molecular networking studies generated using cosine scores which measure relatedness in the MS/ MS spectra; a cosine value of 1.0 indicates identical spectra [21,44]. LC–MS analysis coupled with molecular networking was carried out The mass-spectral data set used in this work was obtained via LC–MS/ in order to investigate the production by our cyanobacterial strains of MS analysis and the network was generated with the MS/MS spectra known metabolites, their analogues or novel compounds. MS/MS of 57 of the 61 cyanobacterial strains and also the MS/MS spectra of networking analysis is a mass spectrometric technique that clusters 105 reference cyanobacterial metabolites (seed compounds). metabolites on the basis of MS/MS fragmentation patterns [21]. This In the resulting network (Fig. 3) it is possible to discern clusters of tool has been previously applied in order to construct a global view of nodes representing families of structurally related molecules. These

Fig. 2. Transcription of genes encoding the KS and A domains of the PKS and NRPS genes evaluated by RT-PCR. The cells were collected from 2-month old cultures and then cDNAs were produced with random primers and used in PCR amplifications with specific primers (Table 1). 1 and 1′ — Myxosarcina sp. (LEGE 06146) sequences KC842286 and KC842288, respectively; 2 and 2′ — Pseudanabaena aff. curta (LEGE 07160) KC842368 and KC842370; 3 — Calothrix sp. 1 (LEGE 06100) KC842315; 4 — Cyanobium sp. (LEGE 06109) KC813182; 5 — Nostoc sp. 2 (LEGE 06158) KC813190; M — marker, GeneRuler™ DNA Ladder Mix, (Fermentas Waltham, MA, USA); c− — negative controls: no template cDNA; c+ positive controls: genomic DNA. Â. Brito et al. / Algal Research 9 (2015) 218–226 223

Fig. 3. MS/MS-based molecular network of the extracts from 57 cultured cyanobacterial strains seeded with 105 reference compounds using a cosine similarity score cut-off of 0.6. Green nodes — seeded compounds; pink nodes — samples; red nodes — match between seed and samples. Clusters highlighted in network: (a) three-node cluster composed by naopopeptin and antanapeptins B and C; (b) seed dolastatin-16, potential analogue of dolastatin-16 and MS/MS spectra of both compounds; (c) malyngamide family cluster composed by the seeds malyngamide C, malyngamide C acetate, malyngamide H, malyngamide I, malyngamide K, malyngamide L/T and malyngamide U/V/W and nodes from different Portuguese marine cyanobacterial samples; (d) cluster of microcystin, nodularin and nodes from the Portuguese cyanobacterial samples; and (e) cluster composed only of nodes from different extracts of our cyanobacterial strains. Chemical structures retrieved from: naopopeptin [46]; antanapeptins A–C and dolastatin 16 [45]; malyngamides H, K [54]; and microcystin and nodularin [8]. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) results, together with the genetic analysis, confirm the metabolic poten- containing the Hmoya (3-hydroxy-2-methyl-7-octynoic acid) tial of our strains. In the network, nodes are represented by different unit or its derivatives (Hmoea or Hmoaa). Since the isolation of colours depending on their origin: green nodes — seed compounds, kulolide, the first compound reported to contain the 2,2-dimeth- pink nodes — samples, and red nodes — consensus of samples and yl-3-hydroxy-7-octynoic acid (Dhoya) [47], a variety of structur- seed spectra. Inclusion of the MS/MS data of 105 reference compounds ally similar compounds have been isolated from diverse in this analysis was highly useful as 41 formed consensus or were highly cyanobacteria [45,48,49]. The mass we recorded for this node correlated with compounds retrieved from our samples. Some exam- (759.421) was queried against the MarinLit database (University ples are highlighted below: of Canterbury, New Zealand) and there were several possibilities identified, one of which was antanapeptin A. Altogether, these i) A red node with mass m/z 759.421 (Hyella sp. LEGE 07179) resultssuggeststhatHyella sp. LEGE 07179 likely produces a exhibited a consensus with naopopeptin [M + Na]+ (m/z = compound related to naopopeptin or antanapeptin. 759.4) (Fig. 3a); however, despite the fact that they have the ii) The node with mass m/z 929.7 (Chroococcopsis sp. LEGE 07187) is same mass, this result was not confirmed since the retention connected in the network with dolastatin 16 [M + Na]+ (m/z = times and the MS/MS fragmentation patterns were different. 901.4). This node represents a compound 28 Da larger than Moreover, the same node is connected with antanapeptin B dolastatin 16, and the MS/MS fragmentation patterns of our com- [M + Na]+ (m/z 761.39) and antanapeptin C [M + Na]+ (m/z pound and dolastatin are similar (Fig. 3b). This family of bioactive 763.37) forming a three-node cluster (Fig. 3a). Both naopopeptin compounds has been identified in several cyanobacterial taxa and antanapeptins B and C are cyclic depsipeptides [45,46] [45,50,51], and therefore, this node probably represents an 224 Â. Brito et al. / Algal Research 9 (2015) 218–226

Fig. 3 (continued).

analogue of dolastatin 16. A structure of dolastatin 16 analogue malyngamide L/T [M + H]+ (m/z = 467.99) and malyngamide ion of 760 is also proposed (Supplementary Fig. S1). U/V/W [M + H]+ (m/z = 409.95) as well as related nodes deriv- iii) The network also contained a malyngamide cluster comprised of ing from metabolites in our cyanobacterial strains (Fig. 3c). All of the seed compounds malyngamide C [M + H]+ (m/z = 455.92), the new masses appearing in this cluster were also queried malyngamide C acetate [M + H]+ (m/z = 497.95) malyngamide against the MarinLit database; in the m/z 483–484 range (node: H[M+H]+ (m/z = 432.01), malyngamide I [M + H]+ (m/z = m/z 484.05) one known metabolite was malyngamide S. Taken 484.04), malyngamide K [M + H]+ (m/z = 423.97), together, these data strongly suggest that malyngamide-type Â. Brito et al. / Algal Research 9 (2015) 218–226 225

molecules are present in our cyanobacterial samples. A large array Appendix A. Supplementary data of malyngamides has been reported in various cyanobacteria and they are characterized by a fatty acid chain, commonly lyngbic Supplementary data to this article can be found online at http://dx. acid, attached to a cyclic head group with nitrogen and oxygen doi.org/10.1016/j.algal.2015.03.016. functional groups [52–54]. iv) In another case we could observe a molecular network connection References between nodularin, microcystin and nodes from the samples m/z 516.982 (Leptolyngbya fragilis LEGE 07167), m/z 623.33 (L. fragilis [1] I.M. Ehrenreich, J.B. Waterbury, E.A. Webb, Distribution and diversity of natural LEGE 07176) and m/z 350.02 (Cyanobium sp. LEGE 07175, Romeria product genes in marine and freshwater cyanobacterial cultures and genomes, – sp. LEGE 06013) (Fig. 3d), revealing that these cyanobacterial Appl. Environ. Microbiol. 71 (2005) 7401 7413. [2] A.C. Jones, L. Gu, C.M. Sorrels, D.H. Sherman, W.H. Gerwick, New tricks from ancient strains may produce compounds related to these hepatotoxins. algae: natural products biosynthesis in marine cyanobacteria, Curr. Opin. Chem. Biol. 13 (2009) 216–223. [3] A.C. Jones, E.A. Monroe, E.B. Eisman, L. Gerwick, D.H. Sherman, W.H. Gerwick, The unique mechanistic transformations involved in the biosynthesis of modular natural The results shown in Fig. 3 also strongly suggest that our products from marine cyanobacteria, Nat. Prod. Rep. 27 (2010) 1048–1065. cyanobacterial strains produce novel compounds (Fig. 3e). However, [4] J.K. Nunnery, E. Mevers, W.H. Gerwick, Biologically active secondary metabolites the few molecular network connections obtained with the seed from marine cyanobacteria, Curr. Opin. Biotechnol. 21 (2010) 787–793. [5] J.C. Kehr, D. Gatte Picchi, E. Dittmann, Natural product biosyntheses in cyanobacteria: a compounds may result because our isolates are from a temperate region treasure trove of unique enzymes, Beilstein J. Org. Chem. 7 (2011) 1622–1635. and the standards were isolated from tropical cyanobacteria. Indeed, it [6] A. Méjean, O. Ploux, A genomic view of secondary metabolite production in is well known that environmental factors can strongly influence the cyanobacteria, in: F. Chauvat, C. Cassier-Chauvat (Eds.), Genomics of Cyanobacteria, – – Elsevier Academic Press, San Diego, 2013, pp. 189 234. production of secondary metabolites from cyanobacteria [55 57]. [7] C. Wiegand, S. Pflugmacher, Ecotoxicological effects of selected cyanobacterial sec- Furthermore, for each strain the MS spectra were checked for major ondary metabolites: a short review, Toxicol. Appl. Pharmacol. 203 (2005) 201–218. peaks and the masses were queried against the MarinLit database. For [8] E. Dittmann, D.P. Fewer, B.A. Neilan, Cyanobacterial toxins: biosynthetic routes and evolutionary roots, FEMS Microbiol. Rev. 37 (2013) 23–43. some masses, m/z 1785.41 (Cyanobium sp. LEGE 06109), m/z 1957.64 [9] A.M. Burja, B. Banaigs, E. Abou-Mansour, J.G. Burgess, P.C. Wright, Marine (Calothrix sp. LEGE 07177) and m/z 1746.46 (Pseudanabaena persicina cyanobacteria — aprolific source of natural products, Tetrahedron 57 (2001) LEGE 07163) no compound with a corresponding mass was found in 9347–9377. the MarinLit database, suggesting that these strains produce com- [10] R.K. Singh, S.P. Tiwari, A.K. Rai, T.M. Mohapatra, Cyanobacteria: an emerging source for drug discovery, J. Antibiot. (Tokyo) 64 (2011) 401–412. pounds not yet identified and thus deserving of further investigation. [11] L.T. Tan, Filamentous tropical marine cyanobacteria: a rich source of natural Overall, this work reinforces the hypothesis that prospecting new products for anticancer drug discovery, J. Appl. Phycol. 22 (2010) 659–676. fi cyanobacterial diversity is a valid and promising approach for the dis- [12] L.T. Tan, Pharmaceutical agents from lamentous marine cyanobacteria, Drug Discov. Today 18 (2013) 863–871. covery of novel bioactive compounds. Here, we demonstrated by genet- [13] W.H. Gerwick, R.C. Coates, N. Engene, L. Gerwick, R.V. Grindberg, A.C. Jones, C.M. ic and analytical approaches that our set of isolates possess an untapped Sorrels, Giant marine cyanobacteria produce exciting potential pharmaceuticals, source of secondary metabolites and highlight the potential of marine Microbe 6 (2008) 277–284. [14] M.E. Barrios-Llerena, A.M. Burja, P.C. Wright, Genetic analysis of polyketide synthase cyanobacterial strains from temperate regions to produce novel bioac- and peptide synthetase genes in cyanobacteria as a mining tool for secondary tive compounds. metabolites, J. Ind. Microbiol. Biotechnol. 34 (2007) 443–456. [15] N.V. Wase, P.C. Wright, Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery, Expert Opin. Drug Discov. 3 (2008) 4. Conclusions 903–929. [16] A. Brito, V. Ramos, R. Seabra, A. Santos, C.L. Santos, M. Lopo, S. Ferreira, A. Martins, R. The results from this work demonstrated that both PKS and NRPS Mota, B. Frazao, R. Martins, V. Vasconcelos, P. Tamagnini, Culture-dependent characterization of cyanobacterial diversity in the intertidal zones of the Portuguese genes are present in the majority of the 61 cyanobacteria isolated from coast: a polyphasic study, Syst. Appl. Microbiol. 35 (2012) 110–119. the Portuguese Atlantic coast, with the former biosynthetic class being [17] R. Martins, N. Fernandez, R. Beiras, V. Vasconcelos, Toxicity assessment of crude and more ubiquitous than the latter. As expected, a higher frequency of partially purified extracts of marine Synechocystis and Synechococcus cyanobacterial – these genes was detected in the filamentous strains. Furthermore, it strains in marine invertebrates, Toxicon 50 (2007) 791 799. [18] M. Costa, M. Garcia, J. Costa-Rodrigues, M.S. Costa, M.J. Ribeiro, M.H. Fernandes, P. was possible to demonstrate that, under routine laboratory growth con- Barros, A. Barreiro, V. Vasconcelos, R. Martins, Exploring bioactive properties of ditions, some of these genes are transcribed in a set of selected strains. marine cyanobacteria isolated from the Portuguese coast: high potential as a source – Moreover, LC–MS analysis together with molecular networking is a pow- of anticancer compounds, Mar. Drugs 12 (2014) 98 114. [19] P.N. Leão, V. Ramos, P.B. Goncalves, F. Viana, O.M. Lage, W.H. Gerwick, V.M. erful tool that revealed the presence of analogues in known compound Vasconcelos, Chemoecological screening reveals high bioactivity in diverse families as well as novel compounds. Although these latter fi ndings culturable Portuguese marine cyanobacteria, Mar. Drugs 11 (2013) 1316–1335. should be regarded as indicative rather than definitive, they unquestion- [20] P.N. Leão, M. Costa, V. Ramos, A.R. Pereira, V.C. Fernandes, V.F. Domingues, W.H. Gerwick, V.M. Vasconcelos, R. Martins, Antitumor activity of hierridin B, a ably highlight the metabolic potential of these cyanobacterial isolates to cyanobacterial secondary metabolite found in both filamentous and unicellular produce many and diverse natural products. Moreover, these results marine strains, PLoS One 8 (2013) e69562. will allow the selection of the most promising strains for further studies [21] J. Watrous, P. Roach, T. Alexandrov, B.S. Heath, J.Y. Yang, R.D. Kersten, M. van der Voort, K. Pogliano, H. Gross, J.M. Raaijmakers, Mass spectral molecular networking (e.g. isolation and characterization of bioactive molecules) and constitute of living microbial colonies, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) E1743–E1752. a valuable starting point for the use of marine cyanobacteria from tem- [22] R. Rippka, Isolation and purification of cyanobacteria, in: L. Packer, A.N. Glazer perate regions for the discovery of natural compounds with biomedical (Eds.), Method. Enzymol, Academic Press, 1988, pp. 3–27. [23] R. Stanier, R. Kunisawa, M. Mandel, G. Cohen-Bazire, Purification and properties of value. unicellular blue-green algae (order Chroococcales), Bacteriol. Rev. 35 (1971) 171. [24] J. Kotai, Instructions for Preparation of Modified Nutrient Solution Z8 for Algae. Acknowledgements Publication B-11/69, Norwegian Institute for Water Research, Blindern, Oslo, 1972. [25] R. Rippka, J. Deruelles, J.B. Waterbury, M. Herdman, R.Y. Stanier, Generic assignments, strain histories and properties of pure cultures of cyanobacteria, J. This work was funded by FEDER funds through the Operational Gen. Microbiol. 111 (1979) 1–61. Competitiveness Programme — COMPETE and by National Funds [26] P. Tamagnini, O. Troshina, F. Oxelfelt, R. Salema, P. Lindblad, Hydrogenases in Nostoc through FCT — Fundação para a Ciência e a Tecnologia under the project sp. strain PCC 73102, a strain lacking a bidirectional enzyme, Appl. Environ. Microbiol. 63 (1997) 1801–1807. FCOMP-01-0124-FEDER-010600 (PTDC/MAR/102258/2008) and grants [27] M.C. Moffitt, B.A. Neilan, On the presence of peptide synthetase and polyketide SFRH/BD/70284/2010 (to AB) and SFRH/BPD/95683/2013 (to MVM), as synthase genes in the cyanobacterial genus Nodularia, FEMS Microbiol. Lett. 196 well as NIH grants NS053398 and GM107550 (to PCD and WHG). We (2001) 207–214. [28] B.A. Neilan, E. Dittmann, L. Rouhiainen, R.A. Bass, V. Schaub, K. Sivonen, T. Börner, are grateful to Rosário Martins for supplying six of the isolates and Nonribosomal peptide synthesis and toxigenicity of cyanobacteria, J. Bacteriol. 181 Pedro Leão for the valuable discussions and advice. (1999) 4089–4097. 226 Â. Brito et al. / Algal Research 9 (2015) 218–226

[29] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, 3rd ed. Cold [44] J.Y. Yang, L.M. Sanchez, C.M. Rath, X. Liu, P.D. Boudreau, N. Bruns, E. Glukhov, A. Spring Harbor Laboratory Press, New York, 2001. Wodtke, R. de Felicio, A. Fenner, Molecular networking as a dereplication strategy, [30] V. Ramos, R. Seabra, A. Brito, A. Santos, C.L. Santos, M. Lopo, P. Moradas-Ferreira, J. Nat. Prod. 76 (2013) 1686–1699. V.M. Vasconcelos, P. Tamagnini, Characterization of an intertidal cyanobacterium [45] L.M. Nogle, W.H. Gerwick, Isolation of four new cyclic depsipeptides, antanapeptins that constitutes a separate clade together with thermophilic strains, Eur. J. Phycol. A–D, and dolastatin 16 from a Madagascan collection of Lyngbya majuscula,J.Nat. 45 (2010) 394–403. Prod. 65 (2002) 21–24. [31] M.A. Larkin, G. Blackshields, N. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. [46] K.L. Malloy, Structure Elucidation of Biomedically Relevant Marine Cyanobacterial Valentin, I.M. Wallace, A. Wilm, R. Lopez, Clustal W and Clustal X version 2.0, Natural Products, UC San Diego, San Diego, 2011. Bioinformatics 23 (2007) 2947–2948. [47] M.T. Reese, N.K. Gulavita, Y. Nakao, M.T. Hamann, W.Y. Yoshida, S.J. Coval, P.J. [32] N. Ziemert, S. Podell, K. Penn, J.H. Badger, E. Allen, P.R. Jensen, The natural product Scheuer, Kulolide: a cytotoxic depsipeptide from a cephalaspidean mollusk, domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary Philinopsis speciosa 1, J. Am. Chem. Soc. 118 (1996) 11081–11084. metabolite gene diversity, PLoS One 7 (2012) e34064. [48] P.D. Boudreau, T. Byrum, W.T. Liu, P.C. Dorrestein, W.H. Gerwick, Viequeamide A, a [33] B.O. Bachmann, J. Ravel, Methods for in silico prediction of microbial polyketide and cytotoxic member of the kulolide superfamily of cyclic depsipeptides from a marine nonribosomal peptide biosynthetic pathways from DNA sequence data, Complex button cyanobacterium, J. Nat. Prod. 75 (2012) 1560–1570. Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and [49] R. Montaser, V.J. Paul, H. Luesch, Pitipeptolides C–F, antimycobacterial Peptides, Elsevier Academic Press Inc., San Diego, 2009. 181–217. cyclodepsipeptides from the marine cyanobacterium Lyngbya majuscula from [34] J.R. Winnikoff, E. Glukhov, J. Watrous, P.C. Dorrestein, W.H. Gerwick, Quantitative Guam, Phytochemistry 72 (2011) 2068–2074. molecular networking to profile marine cyanobacterial metabolomes, J. Antibiot. [50] H. Luesch, R.E. Moore, V.J. Paul, S.L. Mooberry, T.H. Corbett, Isolation of dolastatin 10 67 (2014) 105–112. from the marine cyanobacterium Symploca species VP642 and total [35] R. Araújo, I. Bárbara, M. Tibaldo, E. Berecibar, P.D. Tapia, R. Pereira, R. Santos, I. Sousa- and biological evaluation of its analogue symplostatin 1, J. Nat. Prod. 64 (2001) Pinto, Checklist of benthic marine algae and cyanobacteria of northern Portugal, Bot. 907–910. Mar. 8 (2009) 1908–1919. [51] G.G. Harrigan, W.Y. Yoshida, R.E. Moore, D.G. Nagle, P.U. Park, J. Biggs, V.J. Paul, S.L. [36] B. Frazao, R. Martins, V. Vasconcelos, Are known cyanotoxins involved in the toxicity Mooberry, T.H. Corbett, F.A. Valeriote, Isolation, structure determination, and biolog- of picoplanktonic and filamentous north Atlantic marine cyanobacteria? Mar. Drugs ical activity of dolastatin 12 and lyngbyastatin 1 from Lyngbya majuscula/Schizothrix 8 (2010) 1908–1919. calcicola cyanobacterial assemblages, J. Nat. Prod. 61 (1998) 1221–1225. [37] Z.K. Li, J. Brand, Leptolyngbya nodulosa sp. nov. (Oscillatoriaceae), a subtropical ma- [52] R.D. Ainslie, J.J. Barchi Jr., M. Kuniyoshi, R.E. Moore, J.S. Mynderse, Structure of rine cyanobacterium that produces a unique multicellular structure, Phycologia 46 malyngamide C, J. Org. Chem. 50 (1985) 2859–2862. (2007) 396–401. [53] J. Orjala, D. Nagle, W.H. Gerwick, Malyngamide H, an ichthyotoxic amide possessing [38] R.B. Perkerson, J.R. Johansen, L. Kovacik, J. Brand, J. Kastovsky, D.A. Casamatta, A a new carbon skeleton from the Caribbean cyanobacterium Lyngbya majuscula,J. unique Pseudanabaenalean (Cyanobacteria) genus Nodosilinea gen. nov. based on Nat. Prod. 58 (1995) 764–768. morphological and molecular data, J. Phycol. 47 (2011) 1397–1412. [54] H. Gross, K.L. McPhail, D.E. Goeger, F.A. Valeriote, W.H. Gerwick, Two cytotoxic ste- [39] G. Christiansen, E. Dittmann, L.V. Ordorika, R. Rippka, M. Herdman, T. Borner, reoisomers of malyngamide C, 8-epi-malyngamide C and 8-O-acetyl-8-epi- Nonribosomal peptide synthetase genes occur in most cyanobacterial genera as ev- malyngamide C, from the marine cyanobacterium Lyngbya majuscula, Phytochemis- idenced by their distribution in axenic strains of the PCC, Arch. Microbiol. 176 try 71 (2010) 1729–1735. (2001) 452–458. [55] M. Kaebernick, B.A. Neilan, T. Börner, E. Dittmann, Light and the transcriptional re- [40] P.M. Shih, D. Wu, A. Latifi, S.D. Axen, D.P. Fewer, E. Talla, A. Calteau, F. Cai, N. Tandeau sponse of the microcystin biosynthesis gene cluster, Appl. Environ. Microbiol. 66 de Marsac, R. Rippka, M. Herdman, K. Sivonen, T. Coursin, T. Laurent, L. Goodwin, M. (2000) 3387–3392. Nolan, K.W. Davenport, C.S. Han, E.M. Rubin, J.A. Eisen, T. Woyke, M. Gugger, C.A. [56] G. Shalev‐Malul, J. Lieman‐Hurwitz, Y. Viner‐Mozzini, A. Sukenik, A. Gaathon, M. Kerfeld, Improving the coverage of the cyanobacterial phylum using diversity- Lebendiker, A. Kaplan, An AbrB‐like protein might be involved in the regulation of driven genome sequencing, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 1053–1058. cylindrospermopsin production by Aphanizomenon ovalisporum, Environ. Microbiol. [41] A. Calteau, D.P. Fewer, A. Latifi, T. Coursin, T. Laurent, J. Jokela, C.A. Kerfeld, K. 10 (2008) 988–999. Sivonen, J. Piel, M. Gugger, Phylum-wide comparative genomics unravel the [57] C.M. Sorrels, P.J. Proteau, W.H. Gerwick, Organization, evolution, and expression diversity of secondary metabolism in Cyanobacteria, BMC Genomics 15 (2014) 977. analysis of the biosynthetic gene cluster for scytonemin, a cyanobacterial UV- [42] E. Dittmann, B.A. Neilan, T. Borner, Molecular biology of peptide and polyketide bio- absorbing pigment, Appl. Environ. Microbiol. 75 (2009) 4861–4869. synthesis in cyanobacteria, Appl. Microbiol. Biotechnol. 57 (2001) 467–473. [43] R.W. Castenholz, Phylum BX. Cyanobacteria. Oxygenic photosynthetic bacteria, in: D.R. Boone, R.W. Castenholz, G.M. Garrity (Eds.), Bergey's Manual® of Systematic Bacteriology, Springer, New York, 2001, pp. 473–599.

Supplementary Material III

Table S1 Cyanobacterial KS domain sequence based prediction of PKS using the NaPDoS software.

Accession Pathway Domain Organism (LEGE code) Database match ID % Identity E value Cluster type Number Product Class Cyanobium sp. (06012) KC842333 CurA_AAT70096_mod 53 3e-56 Curacin KS PKS Cyanobium sp. (06097) KC842336 VirF_BAF50722_5T 47 8e-54 Virginiamycin trans PKS Cyanobium sp. (06109) KC842322 KirAIV_CAN89634_9T 55 1e-69 Kirromycin trans PKS KC842323 LnmJ_AF484556_4T 54 8e-65 Leinamycin trans PKS KC842324 VirF_BAF50722_5T 55 1e-66 Virginiamycin trans PKS KC842325 KirAII_CAN89632_5T 47 1e-54 Kirromycin trans PKS Cyanobium sp. (06113) KC842298 CurA_AAT70096_mod 54 2e-66 Curacin KS PKS Cyanobium sp. (06130) KC842364 LnmJ_AF484556_4T 55 6e-69 Leinamycin trans PKS KC842365 VirF_BAF50722_5T 54 3e-65 Virginiamycin trans PKS Cyanobium sp. (06134) KC842299 CurL_AAT70107_mod 52 9e-63 Curacin modular PKS Cyanobium sp. (06184) KC842354 KirAII_CAN89632_5T 44 3e-48 Kirromycin trans PKS Cyanobium sp. (07186) KC842302 CurL_AAT70107_mod 53 7e-66 Curacin modular PKS KC842303 Strep_ZP_06279092_i 44 5e-50 Unknown iterative Synechocystis salina (06099) KC842284 KirAII_CAN89632_5T 47 2e-50 Kirromycin trans PKS Synechocystis salina (07173) KC842372 CurL_AAT70107_mod 54 3e-67 Curacin modular PKS Chroococcidiopsis sp. (06174) KC842328 LOVAS_Q9Y8A5_i 45 1e-53 Lovastatin iterative PKS KC842329 KirAI_CAN89631_1T 38 4e-44 Kirromycin trans PKS Chroococcopsis sp. (07161) KC842343 KirAII_CAN89632_5T 47 3e-51 Kirromycin trans PKS KC842344 StiG_Q8RJY0_1KSB 55 8e-59 Stigmatellin modular PKS Chroococcopsis sp. (07187) KC842293 CurI_AAT70104_mod 63 3e-74 Curacin modular PKS KC842294 StiG_Q8RJY0_1KSB 65 6e-83 Stigmatellin modular PKS Hyella sp. (07179) KC842291 LnmJ_AF484556_4T 56 8e-67 Leinamycin trans PKS KC842292 LnmJ_AF484556_4T 58 4e-65 Leinamycin trans PKS Myxosarcina sp. (06146) KC842286 MtaF_Q9RFK6_1KSB 55 2e-66 Myxothiazol modular PKS KC842287 KirAIV_CAN89634_9T 48 1e-50 Kirromycin trans PKS KC842288 KirAII_CAN89632_5T 46 1e-49 Kirromycin trans PKS Nodosilinea nodulosa* (06102) KC842304 EpoF_Q9L8C5_1mod 58 3e-63 Epothilone modular PKS KC842305 MxaC_Q93TW9_1KSB 60 2e-65 Myxalamide modular PKS Nodosilinea nodulosa* (06110) KC842285 bleom_AAG02357_H 47 1e-50 Bleomycin hybridKS Hybrid Nodosilinea nodulosa* (06152) KC842316 MxaC_Q93TW9_1KSB 59 9e-74 Myxalamide modular PKS Leptolyngbya fragilis (07167) KC842317 NosB_Q9RAH3_H 50 1e-59 Nostopeptolide hybridKS PKS Leptolyngbya fragilis (07176) KC842330 CurI_AAT70104_mod 58 2e-64 Curacin modular PKS Leptolyngbya mycoidea (06009) KC842331 StiB_Q8RJY5_1KSB 59 3e-71 Stigmatellin modular PKS KC842332 JamP_AAS98787_H 66 2e-74 Jamaicamide hybridKS PKS Leptolyngbya mycoidea (06108) KC842357 NosB_Q9RAH3_H 59 1e-66 Nostopeptolide hybridKS PKS Leptolyngbya mycoidea (06118) KC842358 NosB_Q9RAH3_H 59 1e-64 Nostopeptolide hybridKS PKS Leptolyngbya mycoidea (06126) KC842347 JamP_AAS98787_H 65 2e-61 Jamaicamide hybridKS PKS Leptolyngbya saxicola (07132) KC842359 JamK_AAS98782_mod 61 1e-73 Jamaicamide modular PKS KC842360 JamE_AAS98777_KS1 62 4e-69 Jamaicamide KS PKS KC842361 CurI_AAT70104_mod 59 1e-71 Curacin modular PKS Leptolyngbya saxicola (07170) KC842371 JamM_AAS98784_H 60 9e-82 Jamaicamide hybridKS PKS Leptolyngbya sp. 1 (06121) KC842362 EpoC_Q9L8C8_H 62 1e-71 Epothilone hybridKS PKS KC842363 CurI_AAT70104_mod 74 2e-95 Curacin modular PKS Leptolyngbya sp. 2 (06188) KC842318 CurG_AAT70102_H 57 6e-68 Curacin hybridKS PKS KC842319 CurA_AAT70096_mod 46 3e-50 Curacin KS PKS Phormidium sp. 1 (06111) KC842337 LnmJ_AF484556_4T 46 7e-55 Leinamycin trans PKS KC842338 EpoC_Q9L8C8_H 60 7e-66 Epothilone hybridKS PKS KC842339 KirAII_CAN89632_5T 47 5e-51 Kirromycin trans PKS KC842340 LnmJ_AF484556_4T 47 3e-48 Leinamycin trans PKS Plectonema cf. radiosum (06105) KC842355 JamK_AAS98782_mod 70 5e-95 Jamaicamide modular PKS KC842356 StiC_Q8RJY4_1KSB 67 2e-79 Stigmatellin modular PKS Pseudanabaena aff. curta (07160) KC842368 JamE_AAS98777_KS1 63 4e-70 Jamaicamide KS PKS KC842369 CurG_AAT70102_H 61 1e-82 Curacin hybridKS PKS KC842370 MtaF_Q9RFK6_1KSB 62 2e-78 Myxothiazol modular PKS Pseudanabaena aff. curta (07169) KC842326 CurG_AAT70102_H 61 7e-83 Curacin hybridKS PKS KC842327 NosB_Q9RAH3_H 66 3e-76 Nostopeptolide hybridKS PKS Pseudanabaena aff. persicina (07163) KC842289 MxaB_Q93TX0_1KSB 58 9e-72 Myxalamide modular PKS Pseudanabaena cf. frigida (06144) KC842348 StiB_Q8RJY5_1KSB 52 3e-67 Stigmatellin modular PKS KC842349 JamK_AAS98782_mod 59 4e-67 Jamaicamide modular PKS KC842350 CurA_AAT70096_mod 58 3e-73 Curacin KS PKS EpoC_Q9L8C8_H 60 PKS Pseudanabaena sp. (06194) KC842300 7e-66 Epothilone hybridKS

KC842301 StiC_Q8RJY4_1KSB 62 1e-75 Stigmatellin modular PKS

2

Pseudanabaena sp. 3 (06116) KC842341 EpoC_Q9L8C8_H 59 4e-62 Epothilone hybridKS PKS KC842342 LnmJ_AF484556_4T 46 1e-49 Leinamycin trans PKS Pseudanabaena sp. 3 (07190) KC842320 CurL_AAT70107_mod 63 3e-78 Curacin modular PKS KC842321 LnmJ_AF484556_4T 53 3e-73 Leinamycin trans PKS Romeria sp. (06013) KC842334 KirAI_CAN89631_1T 38 3e-44 Kirromycin trans PKS KC842335 bleom_AAG02357_H 45 6e-51 Bleomycin hybridKS Hybrid Schizothrix aff. septentrionalis (07164) KC842290 NosB_Q9RAH3_H 61 1e-76 Nostopeptolide hybridKS PKS Calothrix sp. 1 (06100) KC842315 StiG_Q8RJY0_1KSB 67 2e-84 Stigmatellin modular PKS Calothrix sp. 2 (06122) KC842309 StiG_Q8RJY0_1KSB 66 4e-83 Stigmatellin modular PKS KC842310 LnmJ_AF484556_4T 54 6e-67 Leinamycin trans PKS KC842311 LnmJ_AF484556_4T 56 5e-71 Leinamycin trans PKS Calothrix sp. 2 (07177) KC842345 CurJ_AAT70105_mod 66 8e-85 Curacin modular PKS KC842346 StiG_Q8RJY0_1KSB 66 9e-82 Stigmatellin modular PKS Nostoc sp. 1 (06106) KC842306 LnmJ_AF484556_4T 56 3e-78 Leinamycin trans PKS KC842307 VirF_BAF50722_5T 56 2e-66 Virginiamycin trans PKS KC842308 LnmJ_AF484556_4T 49 2e-62 Leinamycin trans PKS Nostoc sp. 1 (06150) KC842312 JamK_AAS98782_mod 65 1e-84 Jamaicamide modular PKS KC842313 StiE_Q8RJY2_1KSB 46 3e-53 Stigmatellin modular PKS KC842314 HSAF_ABL86391_i 48 1e-51 HSAFa iterative Nostoc sp. 2 (06158) KC842366 LnmJ_AF484556_4T 45 2e-57 Leinamycin trans PKS KC842367 MtaF_Q9RFK6_1KSB 59 2e-74 Myxothiazol modular PKS Rivularia sp. (07159) KC842351 CurG_AAT70102_H 70 2e-90 Curacin hybridKS PKS KC842352 EpoE_Q9L8C6_1mod 60 2e-75 Epothilone modular PKS KC842353 StiC_Q8RJY4_1KSB 67 2e-78 Stigmatellin modular PKS Scytonema sp. (07189) KC842295 StiG_Q8RJY0_1KSB 68 2e-86 Stigmatellin modular PKS KC842296 LnmJ_AF484556_4T 45 6e-49 Leinamycin trans PKS KC842297 StiE_Q8RJY2_1KSB 57 1e-56 Stigmatellin modular PKS a HSAF: heat stable antifungal factor. * Formerly assigned to Leptolyngbya cf. halophila [1, 2].

.

3

Table S2 Cyanobacterial A domain sequence based prediction of NRPS using the PKS/NRPS analysis software.

Accession Pathway E Signature Organism (LEGE code) Database match ID Predicted aab Number product value sequencea Cyanobium sp. (06098) KC813175 gi||genome sequencing|PvdD-M2-Arg|Pyoverdin synthetase Pyoverdin 0.28 DAEYIGAI PvdD-M2-Arg Cyanobium sp. (06109) KC813182 gi|6563399|gb|AAF17280.1|NosC-M3 Asp/Asn?|Nostopeptolide synthetase Nostopeptolide 0.038 DATKIGEV NosC-M3-Asp/Asn Gloeocapsopsis cf. crepidinum (06123) KC813188 gi|5822841|dbj|BAA83992.1|McyA-M2-Gly|Microcistin synthetase A Microcystin 0.026 DLFNNALT McyA-M2-Gly KC813189 gi|6563397|gb|AAF15891.2|NosA-M2-Ser|Nostopeptolide synthetase Nostopeptolide 0.017 DVWHISLI NosA-M2-Ser Synechocystis salina (06099) KC813168 gi|1805421|dbj|BAA08983.1|SrfAB-M2 Asp|surfactin synthetaseB Surfactin 0.082 DATKVGHV SrfAB-M2-Asp KC813169 gi|5822841|dbj|BAA83992.1|McyA-M2-Gly|Microcistin synthetaseA Microcystin 0.046 DLYNNALT McyA-M2-Gly Synechocystis salina (07173) KC813193 gi||genome sequencing|PvdD-M3-Ser|Pyoverdin synthetase Pyoverdin 0.017 DVWHVSLI PvdD-M3-Ser KC813194 gi|9715734|gb|CAC01604.1|AdpB-M3-Thr|Anabaenopeptilide synthetase B Anabaenopeptilide 0.15 DVWNMGLI AdpB-M3-Thr Hyella sp. (07179) KC813174 gi|5822841|dbj|BAA83992.1|McyA-M2-Gly|Microcistin synthetaseA Microcystin 0.083 DLFNNAL- McyA-M2-Gly Myxosarcina sp. (06146) KC813170 gi|5763943|CchH-M2-Thr|Coelichelin synthetase Coelichelin 0.006 DFWNIGMV CchH-M2-Thr Phormidium sp. 1 (06111) KC813183 gi|6449056|gb|AAF08796.1|MycB-M3-Gln|mycosubtilin synthetase B Mycosubtilin 0.17 DAEDLGTV MycB-M3-Gln Plectonema cf. radiosum (06105) KC813187 NO HIT - NOVEL A-DOMAIN SIGNATURE No hit VDWVVSLA Pseudanabaena aff. curta (07160) KC813192 gi|1171129|gb|AAC44129.1|SafA-M1-3h4mPhe|saframycin Mx1 synthetase. Saframycin 0.47 DILXLGMV SafA-M1-Phe Pseudanabaena aff. persicina (07163) KC813171 gi|2623773|gb|AAC45930.1|TycC-M4-Val|tyrocidine synthetase 3 Tyrocidine 0.015 DAFWLGGT TycC-M4-Val KC813172 gi|6563399|gb|AAF17280.1|NosC-M2-Gly|Nostopeptolide synthetase Nostopeptolide 0.073 DILQLGLI NosC-M2-Gly Pseudanabaena sp. (06194) KC813177 NO HIT - NOVEL A-DOMAIN SIGNATURE No hit DALWLGXX KC813178 gi||genome sequencing|PvdD-M2-Arg|Pyoverdin synthetase Pyoverdin 0.14 DAEDIGTV PvdD-M2-Arg Schizothrix aff. septentrionalis (07164) KC813173 NO HIT - NOVEL A-DOMAIN SIGNATURE No hit VDWVCALA Calothrix sp. 1 (06100) KC813180 gi|2623771|gb|AAC45928.1|TycA-M1-D-/L-Phe|tyrocidine synthetase 1 Tyrocidine 0.050 DAWTIAAV TycA-M1-D/L-Phe KC813181 gi|1171129|gb|AAC44129.1|SafA-M1-3h4mPhe|saframycin Mx1 synthetase Saframycin 1.7 DILFIGVV SafA-M1-Phe Calothrix sp. 2 (07177) KC813184 NO HIT - NOVEL A-DOMAIN SIGNATURE No hit DAIDSGG- Nostoc sp. 1 (06106) KC813176 gi|6563397|gb|AAF15891.2|NosA-M2-Ser|Nostopeptolide synthetase Nostopeptolide 0.017 DVWHISLI NosA-M2-Ser Nostoc sp. 1 (06150) KC813179 NO HIT - NOVEL A-DOMAIN SIGNATURE No hit DPWAIGCI Nostoc sp. 2 (06158) KC813190 gi|5822842|dbj|BAA83993.1|McyB-M1-Leu|Microcistin synthetase B Microcystin 0.008 DAWFLGNV McyB-M1-Leu KC813191 gi|2623772|gb|AAC45929.1|TycB-M2-L-Phe/L-Trp|tyrocidine synthetase Tyrocidine 0.50 DALFVGAV TycB-M2-Phe/Trp Rivularia sp. (07159) KC813185 gi|8250617|PhsB-M1-Ser|Phosphitricin synthetase Phosphitricin 0.009 DVWHFSLI PhsB-M1-Ser KC813186 gi|6449056|gb|AAF08796.1|MycB-M4-Pro|mycosubtilin synthetase B Mycosubtilin 0.019 DVQFIAHV MycB-M4-Pro

a Eight variable amino acids of the signature sequences determined as described [3]. b Nomenclature of the reference compounds as described [4].

4

Fig. S1. Proposed structure dolastatin16 analogue ion of 760.

5

References

[1] R.B. Perkerson, J.R. Johansen, L. Kovacik, J. Brand, J. Kastovsky, D.A. Casamatta, A unique Pseudanabaenalean (Cyanobacteria) genus Nodosilinea gen. nov. based on morphological and molecular data, J. Phycol. 47 (2011) 1397-1412. [2] Z.K. Li, J. Brand, Leptolyngbya nodulosa sp nov (Oscillatoriaceae), a subtropical marine cyanobacterium that produces a unique multicellular structure, Phycologia 46 (2007) 396-401. [3] T. Stachelhaus, H.D. Mootz, M.A. Marahiel, The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases, Chem. Biol. 6 (1999) 493-505. [4] G.L. Challis, J. Ravel, C.A. Townsend, Predictive, structure-based model of amino acid recognition by nonribosomal peptide synthetase adenylation domains, Chem. Biol. 7 (2000) 211-224.

6

CHAPTER V

General Discussion, Conclusions and Future Perspectives

FCUP 101 Characterization of cyanobacteria isolated from the Portuguese coast

General Discussion, Conclusions and Future Perspectives

5.1. General Discussion and Conclusions

The work presented here constitutes a comprehensive study on marine cyanobacteria from the intertidal zones of the Portuguese Continental coast, contributing to overcome the lack of information about this group of organisms in this temperate Atlantic region. It includes the isolation, cultivation and characterization of the cyanobacterial strains and the assessment of their potential to fix atmospheric nitrogen and to produce secondary metabolites. The intertidal zones of nine beaches (five in the west and four in the south) presenting different topographies, morphologies and wave regimens were sampled. More than 100 cyanobacterial strains were retrieved and 60 isolates were characterized using a polyphasic approach (Chapter II). Based on morphological characters, 35 morphotypes (15 genera and 16 species) belonging to all cyanobacterial Orders/Subsections with the exception of Stigonematales/Subsection V (filamentous true-branching cyanobacteria) were identified. This was expected since representatives of this Order/Subsection are mainly encountered in flowing waters of hot springs and soils (Gugger & Hoffmann, 2004; Finsinger et al., 2008; Soe et al., 2011). The most representative groups among the isolates were the filamentous non-heterocystous forms, Oscillatoriales and the unicellular Chroococcales, with a clear predominance of the first. It is worthwhile to notice that the number of isolates belonging to a certain genus is much higher than to others, but that these numbers can be due either to their ubiquity or to the fact that certain strains are easier to isolate. Analysing the strains origin and their geographical distribution, no clear spatial distribution was found. The different genera were distributed by all the beaches types - rocky beaches, beaches with sand and rocks and sandy beaches with dispersed rocks - and they were not restricted to any specific areas of the coast (northwest, southwest or south). To complement the morphological identification, the 16S rRNA gene was partially sequenced for all isolates. For the majority of the isolates there was a quite good

102 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

correlation between the phenotypic and genotypic based identifications. However, some discrepancies were observed, possibly resulting from limitations on the information available in the databases and taxonomic constraints, since that it is well known that the cyanobacterial taxonomy faces several problems (Taton et al., 2006; Komárek et al., 2014). In the phylogenetic analysis, based on the 16S rRNA gene sequences, the heterocystous cyanobacteria formed a coherent genetic cluster (monophyletic group), while the unicellular and filamentous nonheterocystous were intermixed throughout the tree, in agreement with previous phylogenies (Castenholz, 2001; Gugger & Hoffmann, 2004). Our analysis also showed that some isolates morphologically identified as same taxon were in different positions along the tree, highlighting the difficulty to identify cyanobacteria based on morphology only and the importance of polyphasic studies. In addition, nine 16S rRNA gene sequences had less than 97% similarity compared to the sequences available in databases, strongly suggesting novel cyanobacterial diversity. It is widely recognized that although the 16S rRNA gene is the most commonly used molecular marker it lacks resolution at the species level, thus it is often combined with other less conserved molecular markers (e.g. internal transcribed spacer, ITS, between the 16S rRNA and 23S rRNA genes) to achieve a higher taxonomic resolution (Rocap et al., 2002; Casamatta et al., 2006; Komárek, 2014). Therefore, to be able to further characterize our novel isolates, the remaining part of 16S rRNA gene, the ITS and most of the 23S rRNA gene were sequenced and additional phylogenetic analyses were performed (Chapter III). Together with the morphological and ultrastructural data, this analysis showed that the isolate LEGE 07459 is related with the genera Geminocystis and Cyanobacterium (Korelusová et al., 2009), but presents distinct features that indicate that it could be a representative of a new genus. The isolate LEGE 07179 previously identified as Hyella sp. clustered with members of the Pleurocapsales/Subsection II, forming a distinct branch. Since this is the first sequence available for members of this genus it was not possible to further infer phylogenetic relationships. The assignment of the isolate LEGE 06188 to the genus Leptolyngbya was supported by the phylogenetic analysis using both the 16S rRNA gene only and the 16S-ITS-23S gene sequences. In contrast the other four filamentous strains LEGE 07167, LEGE 07176, LEGE 07157 and LEGE 06111, previously assigned to L. fragilis, L. mycoidea, Phormidium/Leptolyngbya, respectively formed a distinct cluster of filamentous cyanobacteria that probably should be assigned to a new genus firstly isolated from the Portuguese coast. The potential of our isolates to fix atmospheric nitrogen was evaluated by the presence of nif genes and/or heterocysts. The presence of nifH was detected in one

third of the cyanobacteria analysed (20 out of 60). The fraction of the putative N2-fixers

FCUP 103 Characterization of cyanobacteria isolated from the Portuguese coast

obtained suggested that these cyanobacteria may play an important role in N2 fixation along the Continental Portuguese coast, as it is common in the marine environment, particularly in the intertidal zones. These zones are harsh and often nutrient-limited and the ability to fix nitrogen gives the cyanobacteria a competitive advantage, allowing these organisms to become the predominant N2-fixers in the majority of the marine microbial mats (Díez et al., 2007; Severin et al., 2010). Additional work, such as growing the strains in medium with decreasing concentrations of combined nitrogen until depletion and the evaluation of the nitrogenase activity using the acetylene reduction assay was initiated for some strains and will be performed for the remaining isolates. The putative presence of toxin producers among our isolates was initially evaluated by assessing the presence of the genes encoding proteins involved in the production of the cyanotoxins microcystin (mcyA, mcyE), nodularin (ndaF) and saxitoxin (sxtI). No amplicons were obtained but this result does not exclude the presence of the genes since the majority of the primers used were designed based on sequences from freshwater cyanobacteria and may not be the most appropriate for marine strains. Moreover, previous studies demonstrated that extracts of cyanobacterial strains, also isolated from the Portuguese coast, were toxic to marine invertebrates suggesting the presence of toxic compounds (Martins et al., 2007; Frazão et al., 2010). Recently, crude extracts of some of our isolates were analysed by LC-MS/MS directed to detect microcystin and the MS fragmentation pattern obtained for the isolate LEGE 07167 (Oscillatoriales) matched the pattern of microcystin-LR (data not shown). Although microcystin is mostly produced by freshwater cyanobacteria, there are a few evidences that marine Synechococcus strains can also produce this hepatotoxin (Carmichael & Li, 2006). Further studies should be performed to validate this preliminary result, but if this is confirmed constitutes the first report of a microcystin-producing filamentous cyanobacterial strain from the temperate Atlantic region and may suggest that marine toxin-producing strains might be more common than previously believed. In addition, the potential of our isolates to produce other secondary metabolites was also evaluated (Chapter IV). Taken into account that the majority of the secondary metabolites produced by cyanobacteria are PKS and NRPS, a PCR screen for the presence of the genes encoding type I PKS and NRPS pathways, targeting the KS and A domains respectively, was performed. The data revealed that PKS and NRPS genes were present in the majority of the cyanobacterial isolates tested, with the PKS genes being more ubiquitous than the NRPS genes. The higher frequency of the genes was found in filamentous strains (about 85%), which is in agreement with previous reports (Ehrenreich et al., 2005). Furthermore, the sequences obtained were used in an in

104 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

silico prediction of the PKS and NRPS systems. The 89 KS-domains encoding sequences led to the identification of biosynthetic gene clusters that code for 13 different compounds. However, all the identities were low (less than 80%) indicating that the corresponding biosynthetic gene clusters are probably not yet characterized. The 27 sequences that coded for A-domains led to the identification of biosynthetic gene clusters responsible for the biosynthesis of ten different compounds. Five NRPS A-domains from five different strains had no correspondence, suggesting once again clusters not yet characterized. It is important to stress that these results are predictions and, although this kind of analysis can have some limitations, it is a useful resource to quickly access the potential of an organism to produce a certain metabolite. Therefore, the interpretation of the data should be conservative but definitely highlight the potential of our strains to produce a diverse range of compounds. Certainly, an increase in the number of characterized cyanobacterial biosynthetic gene clusters that leads to the production of secondary metabolites will improve the accuracy of the bioinformatics predictions (Micallef et al., 2014). To understand if the genes encoding the KS- and A-domains were transcribed under routine laboratory conditions, RT-PCR analyses were carried out in a set of selected strains. The results obtained demonstrated that under the conditions tested both PKS and NRPS encoding genes were transcribed in the majority of the isolates. To complement the previous results on the potential of our isolates to produce secondary metabolites, crude extracts of 57 of our cyanobacterial isolates were analysed by LC-MS/MS. Their MS/MS spectra together with the MS/MS spectra of reference cyanobacterial compounds were used to generate a network. In the obtained network it was possible to discern different clusters and connections between nodes of our samples and reference compounds. Our samples contained compounds related to naopopeptin and antanapeptin, an analogue of dolastatin 16 as well as malyngamide - type molecules. In addition, a connection between microcystin, nodularin and nodes from different isolates was also observed, indicating that some strains might be able to produce compounds related with hepatotoxins. One of these isolates is the filamentous strain LEGE 07167, for which we did an additional LC-MS/MS analysis targeting microcystin (see above) and obtained a MS fragmentation pattern that matched microcystin-LR. It was also possible to observe clusters composed only by nodes from our samples, highlighting that our strains can produce different/novel compounds. Furthermore, all MS spectra were checked for major peaks and the masses were searched against the MarinLit database. For some masses no correspondence were found in MarinLit suggesting once more compounds not yet identified and thus deserving further investigation.

FCUP 105 Characterization of cyanobacteria isolated from the Portuguese coast

Overall, only a few network connections with the reference compounds were found. This can be explained by the fact that our isolates are from a temperate region and the standards used were mainly isolated from tropical cyanobacteria. Moreover, it is widely documented that environmental factors can strongly influence the production of secondary metabolites (Shalev‐Malul et al., 2008; Sorrels et al., 2009; Esquenazi et al., 2011). As in other studies, molecular networking proved to be a valuable tool since it helped to identify families of compounds based on structural and spectral similarities (Yang et al., 2013; Winnikoff et al., 2014). Altogether, these results highlighted the metabolic potential of our strains to produce diverse compounds and it will allow the selection of the most promising strains for further studies. This work also demonstrated that prospecting new cyanobacterial diversity is a valid approach for the discovery of novel compounds.

5.2. Future perspectives

The results obtained in this work provided novel and important information regarding the diversity of cyanobacteria from the Portuguese Atlantic coast as well as defined new questions and unveiled new paths to explore.

(i) The presence of novel cyanobacterial diversity was reported in this study. These results should be complemented with additional phylogenetic analysis and new genera should be proposed based on the results obtained.

(ii) Since about 30% of our isolates are putative N2-fixers it will be interesting to perform in situ assays to verify if these strains play a key role as diazotrophs in the intertidal ecosystems. (iii) In an extract of one of our marine isolates was detected microcystin-LR, and there were indication that other strains might produce hepatoxins. These results should be validated and the sequences obtained for these strains could be used as a template to design primers aiming at improving the molecular methods to detect toxic marine cyanobacteria. (iv) It would also be relevant to use the extracts of a set of selected strains to perform standard bioassays (e.g. cancer cell line cytotoxic assays), and to isolate and structurally characterize the metabolites produced (NMR).

106 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

(v) It will be also interesting to explore the heterologous expression of the cyanobacterial biosynthetic gene clusters (structurally unique and/or interesting biologically active compounds) in cyanobacterial or other bacterial hosts. (vi) Sequence the complete genome of some of our isolates (e.g. Geminocystis-like sp. LEGE 07459, Hyella sp. LEGE 07179 and Leptolyngbya-like sp. LEGE 07167).

General References

FCUP 109 Characterization of cyanobacteria isolated from the Portuguese coast

References

Adams DG & Duggan PS (2008) Cyanobacteria–bryophyte symbioses. J Exp Bot 59: 1047-1058. Araújo R, Bárbara I, Tibaldo M, Berecibar E, Tapia PD, Pereira R, Santos R & Pinto IS (2009) Checklist of benthic marine algae and cyanobacteria of northern Portugal. Bot Mar 52: 24-46. Bachmann BO & Ravel J (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Method Enzymol 458: 181-217. Baran R, Ivanova NN, Jose N, Garcia-Pichel F, Kyrpides NC, Gugger M & Northen TR (2013) Functional genomics of novel secondary metabolites from diverse cyanobacteria using untargeted metabolomics. Mar Drugs 11: 3617-3631. Barrios-Llerena ME, Burja AM & Wright PC (2007) Genetic analysis of polyketide synthase and peptide synthetase genes in cyanobacteria as a mining tool for secondary metabolites. J Ind Microbiol Biotechnol 34: 443-456. Beattie KA, Kaya K & Codd GA (2000) The cyanobacterium Nodularia PCC 7804, of freshwater origin, produces [L-Har 2] nodularin. Phytochemistry 54: 57-61.

Bergman B, Gallon J, Rai A & Stal L (1997) N2 fixation by non-heterocystous cyanobacteria. FEMS Microbiol Rev 19: 139-185. Bergman B, Ran L & Adams DG (2008a) Cyanobacterial-plant Symbioses: signalling and development. The Cyanobacteria: Molecular Biology, Genomics and Evolution (Herrero A & Flores E, eds.), pp. 447-473. Caister Academic Press, Norfolk, UK. Bergman B, Zheng W-W, Klint J & Ran L (2008b) On the origin of plants and relations to contemporary cyanobacterial-plant symbioses. Plant Biotech 25: 213-220. Bergman B, Sandh G, Lin S, Larsson J & Carpenter EJ (2013) Trichodesmium–a widespread marine cyanobacterium with unusual nitrogen fixation properties. FEMS Microbiol Rev 37: 286-302. Berman-Frank I, Lundgren P & Falkowski P (2003) Nitrogen fixation and photosynthetic oxygen evolution in cyanobacteria. Res Microbiol 154: 157-164. Böhme H (1998) Regulation of nitrogen fixation in heterocyst-forming cyanobacteria. Trends Plant Sci 3: 346-351. Boison G, Steingen C, Stal LJ & Bothe H (2006) The rice field cyanobacteria Anabaena azotica and Anabaena sp. CH1 express vanadium-dependent nitrogenase. Arch Microbiol 186: 367-376. Boyd MR, Gustafson KR, McMahon JB, Shoemaker RH, O'Keefe BR, Mori T, Gulakowski RJ, Wu L, Rivera MI & Laurencot CM (1997) Discovery of cyanovirin-N, a novel human immunodeficiency virus-inactivating protein that binds viral surface envelope glycoprotein gp120: potential applications to microbicide development. Antimicrob Agents Chemoter 41: 1521-1530.

110 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Bui HT, Jansen R, Pham HT & Mundt S (2007) Carbamidocyclophanes A-E, chlorinated paracyclophanes with cytotoxic and antibiotic activity from the Vietnamese cyanobacterium Nostoc sp. J Nat Prod 70: 499-503. Calteau A, Fewer DP, Latifi A, Coursin T, Laurent T, Jokela J, Kerfeld CA, Sivonen K, Piel J & Gugger M (2014) Phylum-wide comparative genomics unravel the diversity of secondary metabolism in cyanobacteria. BMC genomics 15: 977. Cardellina JH, Marner FJ & Moore RE (1979) Malyngamide A, a novel chlorinated metabolite of the marine cyanophyte Lyngbya majuscula. J Am Chem Soc 101: 240- 242. Carmichael WW & Li R (2006) Cyanobacteria toxins in the Salton Sea. Saline systems 2: 5. doi: 10.1186/1746-1448-1182-1185. Casamatta D, Vis ML & Sheath R (2003) Cryptic species in cyanobacterial systematics: a case study of Phormidium retzii (Oscillatoriales) using RAPD molecular markers and 16S rDNA sequence data. Aquat Bot 77: 295-309. Casamatta DA, Gomez SR & Johansen JR (2006) Rexia erecta gen. et sp. nov. and Capsosira lowei sp. nov., two newly described cyanobacterial taxa from the Great Smoky Mountains National Park (USA). Hydrobiologia 561: 13-26. Castenholz RW (2001) Phylum BX. Cyanobacteria. Oxygenic Photosynthetic Bacteria. Bergey’s Manual of Systematic Bacteriology Vol. 1 (Boone DR, Castenholz RW & Garrity G, eds.), pp. 473-599. Springer, New York. Cavalier-Smith T (2006) Cell evolution and Earth history: stasis and revolution. Phil Trans R Soc B 361: 969-1006. Challis GL, Ravel J & Townsend CA (2000) Predictive, structure-based model of amino acid recognition by nonribosomal peptide synthetase adenylation domains. Chem Biol 7: 211-224. Chang ZX, Sitachitta N, Rossi JV, Roberts MA, Flatt PM, Jia JY, Sherman DH & Gerwick WH (2004) Biosynthetic pathway and gene cluster analysis of curacin A, an antitubulin natural product from the tropical marine cyanobacterium Lyngbya majuscula. J Nat Prod 67: 1356-1367. Chen M, Schliep M, Willows RD, Cai Z-L, Neilan BA & Scheer H (2010) A red-shifted chlorophyll. Science 329: 1318-1319. Chen M, Li Y, Birch D & Willows RD (2012) A cyanobacterium that contains chlorophyll f – a red - absorbing photopigment. FEBS letters 586: 3249-3254. Cheng YQ, Coughlin JM, Lim SK & Shen B (2009) Type I polyketide synthases that require discrete acyltransferases. Method Enzymol 459: 165-186. Choi H, Pereira AR, Cao Z, Shuman CF, Engene N, Byrum T, Matainaho T, Murray TF, Mangoni A & Gerwick WH (2010) The hoiamides, structurally intriguing neurotoxic lipopeptides from Papua New Guinea marine cyanobacteria. J Nat Prod 73: 1411- 1421. Christiansen G, Fastner J, Erhard M, Börner T & Dittmann E (2003) Microcystin biosynthesis in Planktothrix: genes, evolution, and manipulation. J Bacteriol 185: 564-572.

FCUP 111 Characterization of cyanobacteria isolated from the Portuguese coast

Codd GA, Morrison LF & Metcalf JS (2005) Cyanobacterial toxins: risk management for health protection. Toxicol Appl Pharmacol 203: 264-272. Conroy T, Guo JT, Hunt NH & Payne RJ (2010) and antimalarial activity of symplostatin 4. Org Lett 12: 5576-5579. Costa M, Costa-Rodrigues J, Fernandes MH, Barros P, Vasconcelos V & Martins R (2012) Marine cyanobacteria compounds with anticancer properties: A review on the implication of apoptosis. Mar Drugs 10: 2181-2207. Costa M, Garcia M, Costa-Rodrigues J, Costa MS, Ribeiro MJ, Fernandes MH, Barros P, Barreiro A, Vasconcelos V & Martins R (2014) Exploring bioactive properties of marine cyanobacteria isolated from the Portuguese Coast: High potential as a source of anticancer compounds. Mar Drugs 12: 98-114. D'Agostino PM, Moffitt MC & Neilan BA (2014) Current knowledge of paralytic shellfish toxin biosynthesis, molecular detection and evolution. Toxins and biologically active compounds from microalgae Vol. 1 (Rossini GP, ed.) pp. 251-280. CRC Press. De Figueiredo DR, Reboleira AS, Antunes SC, Abrantes N, Azeiteiro U, Goncalves F & Pereira MJ (2006) The effect of environmental parameters and cyanobacterial blooms on phytoplankton dynamics of a Portuguese temperate lake. Hydrobiologia 568: 145-157. De Philippis R & Micheletti E (2009) Heavy metal removal with exopolysaccharide- producing cyanobacteria. Heavy Metals in the Environment (Wang LK, Chen JP, Hung Y-T & Shammas NK, eds.), pp. 89-122. CRC Press, Boca Raton. DeRuyter YS & Fromme P (2008) Molecular structure of the photosynthetic apparatus. The Cyanobacteria: Molecular biology, genomics and evolution (Herrero A & Flores E, eds.), pp. 217-269. Caister Academic Press, Norfolk, UK. Deusch O, Landan G, Roettger M, Gruenheit N, Kowallik KV, Allen JF, Martin W & Dagan T (2008) Genes of cyanobacterial origin in plant nuclear genomes point to a heterocyst-forming plastid ancestor. Mol Biol Evol 25: 748-761. Dey B, Lerner DL, Lusso P, Boyd MR, Elder JH & Berger EA (2000) Multiple antiviral activities of cyanovirin-N: blocking of human immunodeficiency virus type 1 gp120 interaction with CD4 and coreceptor and inhibition of diverse enveloped viruses. J Virol 74: 4562-4569. Díez B, Bauer K & Bergman B (2007) Epilithic cyanobacterial communities of a marine tropical beach rock (Heron Island, Great Barrier Reef): diversity and diazotrophy. Appl Environ Microbiol 73: 3656-3668. Díez B & Ininbergs K (2014) Ecological importance of cyanobacteria. Cyanobacteria: An Economic Perspective (Sharma NK, Rai AK & Stal LJ, eds.), pp. 41-63. Willey Blackwell, UK. Dittmann E, Fewer DP & Neilan BA (2013) Cyanobacterial toxins: biosynthetic routes and evolutionary roots. FEMS Microbiol Rev 37: 23-43. Eady RR (1996) Structure-function relationships of alternative nitrogenases. Chem Rev 96: 3013-3030.

112 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Edwards DJ & Gerwick WH (2004) Lyngbyatoxin biosynthesis: sequence of biosynthetic gene cluster and identification of a novel aromatic prenyltransferase. J Am Chem Soc 126: 11432-11433. Edwards DJ, Marquez BL, Nogle LM, McPhail K, Goeger DE, Roberts MA & Gerwick WH (2004) Structure and biosynthesis of the jamaicamides, new mixed polyketide- peptide neurotoxins from the marine cyanobacterium Lyngbya majuscula. Chem Biol 11: 817-833. Ehrenreich IM, Waterbury JB & Webb EA (2005) Distribution and diversity of natural product genes in marine and freshwater cyanobacterial cultures and genomes. Appl Environ Microbiol 71: 7401-7413. Engene N, Rottacker EC, Kastovsky J, Byrum T, Choi H, Ellisman MH, Komarek J & Gerwick WH (2012) Moorea producens gen. nov., sp nov and Moorea bouillonii comb. nov., tropical marine cyanobacteria rich in bioactive secondary metabolites. Int J Syst Evol Microbiol 62: 1171-1178. Esquenazi E, Jones AC, Byrum T, Dorrestein PC & Gerwick WH (2011) Temporal dynamics of natural product biosynthesis in marine cyanobacteria. P Natl Acad Sci USA 108: 5226-5231. Falcón LI, Magallón S & Castillo A (2010) Dating the cyanobacterial ancestor of the chloroplast. ISME J 4: 777–783. Finsinger K, Scholz I, Serrano A, Morales S, Uribe‐Lorio L, Mora M, Sittenfeld A, Weckesser J & Hess WR (2008) Characterization of true‐branching cyanobacteria from geothermal sites and hot springs of Costa Rica. Environ Microbiol 10: 460-473. Frazão B, Martins R & Vasconcelos V (2010) Are known cyanotoxins involved in the toxicity of picoplanktonic and filamentous north atlantic marine cyanobacteria? Mar Drugs 8: 1908-1919. Galhano V, De Figueiredo DR, Alves A, Correia A, Pereira MJ, Gomes-Laranjo J & Peixoto F (2011) Morphological, biochemical and molecular characterization of Anabaena, Aphanizomenon and Nostoc strains (Cyanobacteria, Nostocales) isolated from Portuguese freshwater habitats. Hydrobiologia 663: 187-203. Garcia-Pichel F (2008) Molecular ecology and environmental genomics of cyanobacteria. The cyanobacteria: Molecular biology, Genomics and Evolution (Herrero A & Flores E, eds.), pp. 59-88. Caister Academic Press, Norfolk, UK. Geitler L (1932) Cyanophyceae. Rabenhorst´s Kryptogamenflora von Deutschland, Österreich und der Schweiz Vol. XIV (Kolkwitz R, ed.) pp. 1 - 1196. Akademish Verlagsgesellschaft, Leipzig. Reprinted 1971, Johnson, New York. Gerwick WH, Coates RC, Engene N, Gerwick L, Grindberg RV, Jones AC & Sorrels CM (2008) Giant marine cyanobacteria produce exciting potential pharmaceuticals. Microbe 6: 277-284. Grindberg RV, Ishoey T, Brinza D, Esquenazi E, Coates RC, Liu W-t, Gerwick L, Dorrestein PC, Pevzner P & Lasken R (2011) Single cell genome amplification accelerates identification of the apratoxin biosynthetic pathway from a complex microbial assemblage. Plos One 6: e18565.

FCUP 113 Characterization of cyanobacteria isolated from the Portuguese coast

Gugger MF & Hoffmann L (2004) Polyphyly of true branching cyanobacteria (Stigonematales). Int J Syst Evol Microbiol 54: 349-357. Gutierrez M, Suyama TL, Engene N, Wingerd JS, Matainaho T & Gerwick WH (2008) Apratoxin D, a potent cytotoxic cyclodepsipeptide from Papua New Guinea collections of the marine cyanobacteria Lyngbya majuscula and Lyngbya sordida. J Nat Prod 71: 1099-1103. Han B, Gross H, Goeger DE, Mooberry SL & Gerwick WH (2006) Aurilides B and C, cancer cell toxins from a Papua New Guinea collection of the marine cyanobacterium Lyngbya majuscula. J Nat Prod 69: 572-575. Haverkamp TH, Schouten D, Doeleman M, Wollenzien U, Huisman J & Stal LJ (2008) Colorful microdiversity of Synechococcus strains (picocyanobacteria) isolated from the Baltic Sea. ISME J 3: 397-408. Hoiczyk E & Hansel A (2000) Cyanobacterial cell walls: news from an unusual prokaryotic envelope. J Bacteriol 182: 1191-1199. Huang T-C, Lin R-F, Chu M-K & Chen H-M (1999) Organization and expression of nitrogen-fixation genes in the aerobic nitrogen-fixing unicellular cyanobacterium Synechococcus sp. strain RF-1. Microbiology 145: 743-753. Ishida K, Welker M, Christiansen G, Cadel-Six S, Bouchier C, Dittmann E, Hertweck C & de Marsac NT (2009) Plasticity and evolution of aeruginosin biosynthesis in cyanobacteria. Appl Environ Microbiol 75: 2017-2026. Iteman I, Rippka R, de Marsac NT & Herdman M (2000) Comparison of conserved structural and regulatory domains within divergent 16S rRNA–23S rRNA spacer sequences of cyanobacteria. Microbiology 146: 1275-1286. Jochimsen EM, Carmichael WW, An J, et al. (1998) failure and after exposure to at a hemodialysis center in Brazil. New Engl J Med 338: 873-878. Jones AC, Gu L, Sorrels CM, Sherman DH & Gerwick WH (2009) New tricks from ancient algae: natural products biosynthesis in marine cyanobacteria. Curr Opin Chem Biol 13: 216-223. Jones AC, Monroe EA, Eisman EB, Gerwick L, Sherman DH & Gerwick WH (2010) The unique mechanistic transformations involved in the biosynthesis of modular natural products from marine cyanobacteria. Nat Prod Rep 27: 1048-1065. Jungblut A-D & Neilan BA (2006) Molecular identification and evolution of the cyclic peptide hepatotoxins, microcystin and nodularin, synthetase genes in three orders of cyanobacteria. Arch Microbiol 185: 107-114. Kaas H & Henriksen P (2000) Saxitoxins (PSP toxins) in Danish lakes. Water Res 34: 2089-2097. Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M & Sasamoto S (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3: 109-136.

114 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Kao C & Levinson S (1986) Tetrodotoxin, saxitoxin, and the molecular biology of the sodium channel. Annals of the New York Academy of Sciences (Boland B, cullinan J & Cohn T, eds.), pp. 1-445. New York Academy of Sciences, New York. Kehr JC, Gatte Picchi D & Dittmann E (2011) Natural product biosyntheses in cyanobacteria: A treasure trove of unique enzymes. Beilstein J Org Chem 7: 1622- 1635. Kellmann R, Michali TK & Neilan BA (2008a) Identification of a saxitoxin biosynthesis gene with a history of frequent horizontal gene transfers. J Mol Evol 67: 526-538. Kellmann R, Mihali TK, Jeon YJ, Pickford R, Pomati F & Neilan BA (2008b) Biosynthetic intermediate analysis and functional homology reveal a saxitoxin gene cluster in cyanobacteria. Appl Environ Microbiol 74: 4044-4053. Knoll AH (2008) Cyanobacteria and earth history. The Cyanobacteria: Molecular Biology, Genomics, and Evolution (Herrero A & Flores E, eds.), pp. 1-20. Caister Academic Press, Norfolk, UK. Komárek J & Anagnostidis K (1989) Modern approach to the classification system of Cyanophytes 4-Nostocales. Algological Studies/Archiv für Hydrobiologie, Supplement Volumes 247-345. Komárek J & Anagnostidis K (1998) Cyanoprokaryota, Part 1: Chroococcales. Süsswasserflora von Mitteleuropa, Bd 19/1 (Ettl H, Gartner G, Heynig H & Mollenhauer D, eds.), pp. 548. Gustav Fischer: Stuttgart. Komárek J & Anagnostidis K (2005) Cyanoprokaryota-2. Teil/2nd part: Oscillatoriales. Süsswasserflora von Mitteleuropa 19⁄ 2 (Büdel B, Krienitz L, Gärtner G & Schagerl M, eds.), pp. 759. Elsevier/Spektrum, Heidelberg. Komárek J (2010) Recent changes (2008) in cyanobacteria taxonomy based on a combination of molecular background with phenotype and ecological consequences (genus and species concept). Hydrobiologia 639: 245-259. Komárek J (2014) Modern classification of cyanobacteria. Cyanobacteria: An Economic Perspective (Sharma NK, Rai aK & Stal LJ, eds.), pp. 21-39. Willey Blackwell, UK. Komárek J, Kaštovský J, Mareš J & Johansen JR (2014) Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. Preslia 86: 295-335. Konstantinidis KT & Tiedje JM (2007) Prokaryotic taxonomy and phylogeny in the genomic era: advancements and challenges ahead. Curr Opin Microbiol 10: 504- 509. Korelusová J, Kaštovský J & Komárek J (2009) Heterogeneity of the cyanobacterial genus Synechocystis and description of a new genus, Geminocystis. J Phycol 45: 928-937. Leão PN, Costa M, Ramos V, Pereira AR, Fernandes VC, Domingues VF, Gerwick WH, Vasconcelos VM & Martins R (2013a) Antitumor activity of hierridin B, a cyanobacterial secondary metabolite found in both filamentous and unicellular marine strains. Plos One 8: e69562.

FCUP 115 Characterization of cyanobacteria isolated from the Portuguese coast

Leão PN, Ramos V, Goncalves PB, Viana F, Lage OM, Gerwick WH & Vasconcelos VM (2013b) Chemoecological screening reveals high bioactivity in diverse culturable portuguese marine cyanobacteria. Mar Drugs 11: 1316-1335. Liberton M & Pakrasi H (2008) Membrane systems in cyanobacteria. The Cyanobacteria: Molecular Biology, Genomics and Evolution (Herrero A & Flores E, eds.), pp. 271-287. Caister Academic Press, Norfolk, UK. Lima FP, Queiroz N, Ribeiro PA, Hawkins SJ & Santos AM (2006) Recent changes in the distribution of a marine gastropod, Patella rustica Linnaeus, 1758, and their relationship to unusual climatic events. J Biogeogr 33: 812-822. Lindblad P, Lindberg P, Oliveira P, Stensjö K & Heidorn T (2012) Design, engineering, and construction of photosynthetic microbial cell factories for renewable solar fuel production. Ambio 41: 163-168. Linington RG, Clark BR, Trimble EE, Almanza A, Ureña L-D, Kyle DE & Gerwick WH (2008) Antimalarial peptides from marine cyanobacteria: isolation and structural elucidation of gallinamide A. J Nat Prod 72: 14-17. Lopes VR, Antunes A, Welker M, Martins RF & Vasconcelos VM (2010) Morphological, toxicological and molecular characterization of a benthic Nodularia isolated from Atlantic estuarine environments. Res Microbiol 161: 9-17. Lopes VR, Ramos V, Martins A, Sousa M, Welker M, Antunes A & Vasconcelos VM (2012) Phylogenetic, chemical and morphological diversity of cyanobacteria from Portuguese temperate estuaries. Mar Environ Res 73: 7-16. Luesch H, Moore RE, Paul VJ, Mooberry SL & Corbett TH (2001) Isolation of dolastatin 10 from the marine cyanobacterium Symploca species VP642 and total stereochemistry and biological evaluation of its analogue symplostatin 1. J Nat Prod 64: 907-910. Magarvey NA, Beck ZQ, Golakoti T, Ding Y, Huber U, Hemscheidt TK, Abelson D, Moore RE & Sherman DH (2006) Biosynthetic characterization and chemoenzymatic assembly of the cryptophycins. Potent anticancer agents from Nostoc cyanobionts. ACS Chemical Biology 1: 766-779. Maldener I, Summers ML & Sukenik A (2014) Cellular differentiation in filamentous cyanobacteria. The cell biology of cyanobacteria (Flores E & Herrero A, eds.), pp. 263- 291. Caister Academic Press, Norfolk, UK. Malloy KL, Villa FA, Engene N, Matainaho T, Gerwick L & Gerwick WH (2010) Malyngamide 2, an oxidized lipopeptide with nitric oxide inhibiting activity from a Papua New Guinea marine cyanobacterium. J Nat Prod 74: 95-98. Martins A, Moreira C, Vale M, Freitas M, Regueiras A, Antunes A & Vasconcelos V (2011) Seasonal dynamics of Microcystis spp. and their toxigenicity as assessed by qPCR in a temperate reservoir. Mar Drugs 9: 1715-1730. Martins J, Saker ML, Moreira C, Welker M, Fastner J & Vasconcelos VM (2009) Peptide diversity in strains of the cyanobacterium Microcystis aeruginosa isolated from Portuguese water supplies. Appl Microbiol Biotechnol 82: 951-961.

116 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Martins R, Fernandez N, Beiras R & Vasconcelos V (2007) Toxicity assessment of crude and partially purified extracts of marine Synechocystis and Synechococcus cyanobacterial strains in marine invertebrates. Toxicon 50: 791-799. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, Weber T, Takano E & Breitling R (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res 39: doi: 10.1093/nar/gkr1466. Medina RA, Goeger DE, Hills P, Mooberry SL, Huang N, Romero LI, Ortega-Barria E, Gerwick WH & McPhail KL (2008) Coibamide A, a potent antiproliferative cyclic depsipeptide from the panamanian marine cyanobacterium Leptolyngbya sp. J Am Chem Soc 130: 6324-6325. Méjean A, Mazmouz R, Mann S, Calteau A, Médigue C & Ploux O (2010) The genome sequence of the cyanobacterium Oscillatoria sp. PCC 6506 reveals several gene clusters responsible for the biosynthesis of toxins and secondary metabolites. J Bacteriol 192: 5264-5265. Méjean A & Ploux O (2013) A genomic view of secondary metabolite production in cyanobacteria. Genomics of Cyanobacteria Vol. 65 (Chauvat F, Cassier-Chauvat, C., ed.) pp. 189-234. Elsevier Academic Press, San Diego. Mevers E, Liu W-T, Engene N, Mohimani H, Byrum T, Pevzner PA, Dorrestein PC, Spadafora C & Gerwick WH (2011) Cytotoxic veraguamides, alkynyl bromide- containing cyclic depsipeptides from the marine cyanobacterium cf. Oscillatoria margaritifera. J Nat Prod 74: 928-936. Micallef ML, D'Agostino PM, Al-Sinawi B, Neilan BA & Moffitt MC (2014) Exploring cyanobacterial genomes for natural product biosynthesis pathways. Mar Genomics 21: 1-12. Mihali TK, Kellmann R & Neilan BA (2009) Characterisation of the paralytic shellfish toxin biosynthesis gene clusters in Anabaena circinalis AWQC131C and Aphanizomenon sp. NH-5. BMC Biochem 10: 8. Miller SR & Castenholz RW (2000) The evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus. Appl Environ Microbiol 66: 4222-4229. Minich SS (2012) Brentuximab vedotin: a new age in the treatment of Hodgkin lymphoma and anaplastic large cell lymphoma. Ann Pharmacother 46: 377-383. Moffitt MC & Neilan BA (2001) On the presence of peptide synthetase and polyketide synthase genes in the cyanobacterial genus Nodularia. FEMS Microbiol Lett 196: 207-214. Moffitt MC & Neilan BA (2004) Characterization of the nodularin synthetase gene cluster and proposed theory of the evolution of cyanobacterial hepatotoxins. Appl Environ Microbiol 70: 6353-6362. Nakamura Y, Kaneko T, Sato S, Mimuro M, Miyashita H, Tsuchiya T, Sasamoto S, Watanabe A, Kawashima K & Kishida Y (2003) Complete genome structure of Gloeobacter violaceus PCC 7421, a cyanobacterium that lacks thylakoids. DNA Res 10: 137-145.

FCUP 117 Characterization of cyanobacteria isolated from the Portuguese coast

Neilan BA, Jacobs D & Goodman AE (1995) Genetic diversity and phylogeny of toxic cyanobacteria determined by DNA polymorphisms within the phycocyanin locus. Appl Environ Microbiol 61: 3875-3883. Nishizawa T, Ueda A, Asayama M, Fujii K, Harada K-i, Ochi K & Shirai M (2000) Polyketide synthase gene coupled to the peptide synthetase module involved in the biosynthesis of the cyclic heptapeptide microcystin. J Biochem 127: 779-789. Nunnery JK, Mevers E & Gerwick WH (2010) Biologically active secondary metabolites from marine cyanobacteria. Curr Opin Biotechnol 21: 787-793. Ochoa de Alda JA, Esteban R, Diago ML & Houmard J (2014) The plastid ancestor originated among one of the major cyanobacterial lineages. Nat Commun 5: 4937. Orme-Johnson W (1992) Nitrogenase structure: where to now? Science 257: 1639- 1640. Pereira A, Cao ZY, Murray TF & Gerwick WH (2009) Hoiamide A, a sodium channel activator of unusual architecture from a consortium of two Papua New Guinea cyanobacteria. Chem Biol 16: 893-906. Pereira AR, Kale AJ, Fenley AT, Byrum T, Debonsi HM, Gilson MK, Valeriote FA, Moore BS & Gerwick WH (2012) The carmaphycins: new proteasome inhibitors exhibiting an α, β‐Epoxyketone warhead from a marine cyanobacterium. Chembiochem 13: 810-817. Pereira S, Zille A, Micheletti E, Moradas‐Ferreira P, De Philippis R & Tamagnini P (2009) Complexity of cyanobacterial exopolysaccharides: composition, structures, inducing factors and putative genes involved in their biosynthesis and assembly. FEMS Microbiol Rev 33: 917-941. Pontes MT, Aguiar R & Pires HO (2005) A nearshore wave energy atlas for Portugal. J Offshore Mech Arct 127: 249-255. Post AF (2006) The genus Prochlorococcus. The Prokaryotes Vol. 4 (Dworkin M, Falkow S, Rosenberg E, Schleifer K-H & Stackebrandt E, eds.), pp. 1099-1110. Springer, New York. Potts M (1999) Mechanisms of desiccation tolerance in cyanobacteria. Eur J Phycol 34: 319-328. Rajaniemi P, Hrouzek P, Kaštovská K, Willame R, Rantala A, Hoffmann L, Komárek J & Sivonen K (2005) Phylogenetic and morphological evaluation of the genera Anabaena, Aphanizomenon, Trichormus and Nostoc (Nostocales, Cyanobacteria). Int J Syst Evol Microbiol 55: 11-26. Ramaswamy AV, Sorrels CM & Gerwick WH (2007) Cloning and biochemical characterization of the hectochlorin biosynthetic gene cluster from the marine cyanobacterium Lyngbya majuscula. J Nat Prod 70: 1977-1986. Ramos V, Seabra R, Brito Â, Santos A, Santos CL, Lopo M, Moradas-Ferreira P, Vasconcelos VM & Tamagnini P (2010) Characterization of an intertidal cyanobacterium that constitutes a separate clade together with thermophilic strains. Eur J Phycol 45: 394-403. Rantala-Ylinen A, Känä S, Wang H, Rouhiainen L, Wahlsten M, Rizzi E, Berg K, Gugger M & Sivonen K (2011) Anatoxin-a synthetase gene cluster of the

118 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

cyanobacterium Anabaena sp. strain 37 and molecular methods to detect potential producers. Appl Environ Microbiol 77: 7271-7278. Rippka R, Deruelles J, Waterbury JB, Herdman M & Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111: 1-61. Rocap G, Distel DL, Waterbury JB & Chisholm SW (2002) Resolution of Prochlorococcus and Synechococcus ecotypes by using 16S-23S ribosomal DNA internal transcribed spacer sequences. Appl Environ Microbiol 68: 1180-1191. Rossi F & De Philippis R (2015) Role of cyanobacterial exopolysaccharides in phototrophic biofilms and in complex microbial mats. Life 5: 1218-1238. Rouhiainen L, Vakkilainen T, Siemer BL, Buikema W, Haselkorn R & Sivonen K (2004) Genes coding for hepatotoxic heptapeptides (microcystins) in the cyanobacterium Anabaena strain 90. Appl Environ Microbiol 70: 686-692. Runnegar M, Berndt N, Kong S-M, Lee EY & Zhang L (1995) In vivo and in vitro binding of microcystin to protein phosphatase 1 and 2A. Biochem Biophys Res Commun 216: 162-169. Schopf JW (2000) The fossil record: tracing the roots of the cyanobacterial lineage. The ecology of cyanobacteria (Whitton BA & Potts M, eds.), pp. 13-35. Springer, Netherlands. Seabra R, Wethey DS, Santos AM & Lima FP (2011) Side matters: microhabitat influence on intertidal heat stress over a large geographical scale. J Exp Mar Biol Ecol 400: 200-208. Severin I, Acinas SG & Stal LJ (2010) Diversity of nitrogen‐fixing bacteria in cyanobacterial mats. FEMS Microbiol Ecol 73: 514-525. Shalev‐Malul G, Lieman‐Hurwitz J, Viner‐Mozzini Y, Sukenik A, Gaathon A, Lebendiker M & Kaplan A (2008) An AbrB‐like protein might be involved in the regulation of cylindrospermopsin production by Aphanizomenon ovalisporum. Environ Microbiol 10: 988-999. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B & Ideker T (2003) Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13: 2498-2504. Shen B (2003) Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms. Curr Opin Chem Biol 7: 285-295. Sherwood AR & Presting GG (2007) Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria. J Phycol 43: 605-608. Shi T & Falkowski PG (2008) Genome evolution in cyanobacteria: the stable core and the variable shell. P Natl Acad Sci USA 105: 2510-2515. Shih PM, Wu D, Latifi A, et al. (2013) Improving the coverage of the cyanobacterial phylum using diversity-driven genome sequencing. P Natl Acad Sci USA 110: 1053- 1058. Shishido TK, Humisto A, Jokela J, Liu L, Wahlsten M, Tamrakar A, Fewer DP, Permi P, Andreote AP & Fiore MF (2015) Antifungal compounds from Cyanobacteria. Mar Drugs 13: 2124-2140.

FCUP 119 Characterization of cyanobacteria isolated from the Portuguese coast

Short SM & Zehr JP (2005) Quantitative analysis of nifH Genes and transcripts from aquatic environments. Method Enzymol 397: 380-394. Singh P, Singh SS, Elster J & Mishra AK (2013) Molecular phylogeny, population genetics, and evolution of heterocystous cyanobacteria using nifH gene sequences. Protoplasma 250: 751-764. Singh RK, Tiwari SP, Rai AK & Mohapatra TM (2011) Cyanobacteria: an emerging source for drug discovery. J Antibiot (Tokyo) 64: 401-412. Sivonen K & Jones G (1999) Cyanobacterial toxins. Toxic cyanobacteria in water: a guide to their public health consequences, monitoring and management Vol. 1 (Chorus I & Bartram J, eds.), pp. 41-111. WHO, Spon Press, London, UK. Sivonen K & Börner T (2008) Bioactive compounds produced by cyanobacteria. The cyanobacteria: Molecular Biology, Genomics and Evolution (Herrero A & Flores E, eds.), pp. 159-197. Caister Academic Press, Norfolk, UK. Sivonen K, Leikoski N, Fewer DP & Jokela J (2010) Cyanobactins - ribosomal cyclic peptides produced by cyanobacteria. Appl Microbiol Biotechnol 86: 1213-1225. Soe KM, Yokoyama A, Yokoyama J & Hara Y (2011) Morphological and genetic diversity of the thermophilic cyanobacterium, Mastigocladus laminosus (Stigonematales, Cyanobacteria) from Japan and Myanmar. Phycol Res 59: 135- 142. Sorrels CM, Proteau PJ & Gerwick WH (2009) Organization, evolution, and expression analysis of the biosynthetic gene cluster for scytonemin, a cyanobacterial UV- absorbing pigment. Appl Environ Microbiol 75: 4861-4869. Stachelhaus T, Mootz HD & Marahiel MA (1999) The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chem Biol 6: 493-505. Stal LJ (2000) Cyanobacterial mats and stromatolites. The ecology of cyanobacteria: Their diversity in time and space (Whitton BA & Potts M, eds.), pp. 61-120. Springer, Netherlands. Stal LJ & Zehr JP (2008) Cyanobacterial nitrogen fixation in the ocean: diversity, regulation, and ecology. The Cyanobacteria: Molecular Biology, Genomics and Evolution (Herrero A & Flores E, eds.), pp. 423-446. Caister Academic Press, Norfolk, UK. Swingley WD, Blankenship RE & Raymond J (2008) Insights into cyanobacterial evolution from comparative genomics. The cyanobacteria: Molecular Biology, Genomics, and Evolution (Herrero A & Flores E, eds.), pp. 21-43. Caister Academic Press, Norfolk, UK. Tamagnini P, Leitão E, Oliveira P, Ferreira D, Pinto F, Harris DJ, Heidorn T & Lindblad P (2007) Cyanobacterial hydrogenases: diversity, regulation and applications. FEMS Microbiol Rev 31: 692-720. Tan LT (2010) Filamentous tropical marine cyanobacteria: a rich source of natural products for anticancer drug discovery. J Appl Phycol 22: 659-676. Tan LT (2013a) Pharmaceutical agents from filamentous marine cyanobacteria. Drug Discov Today 18: 863-871.

120 FCUP Characterization of cyanobacteria isolated from the Portuguese coast

Tan LT (2013b) Marine cyanobacteria: A prolific source of bioactive natural products as drug leads. Marine Microbiology: Bioactive Compounds and Biotechnological Applications (Kim S-K, ed.) pp. 59-81. Wiley-VCH, Germany. Taori K, Paul VJ & Luesch H (2008) Structure and activity of largazole, a potent antiproliferative agent from the Floridian marine cyanobacterium Symploca sp. J Am Chem Soc 130: 1806-1807. Taton A, Grubisic S, Ertz D, et al. (2006) Polyphasic study of Antarctic cyanobacterial strains. J Phycol 42: 1257-1270. Teruya T, Sasaki H, Fukazawa H & Suenaga K (2009) Bisebromoamide, a potent cytotoxic peptide from the marine cyanobacterium Lyngbya sp.: isolation, stereostructure, and biological activity. Org Lett 11: 5062-5065. Thiel T (1993) Characterization of genes for an alternative nitrogenase in the cyanobacterium Anabaena variabilis. J Bacteriol 175: 6276-6286. Tillett D, Dittmann E, Erhard M, von Döhren H, Börner T & Neilan BA (2000) Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC 7806: an integrated peptide - polyketide synthetase system. Chem Biol 7: 753-764. Tomitani A, Knoll AH, Cavanaugh CM & Ohno T (2006) The evolutionary diversification of cyanobacteria: molecular–phylogenetic and paleontological perspectives. P Natl Acad Sci USA 103: 5442-5447. Valério E, Chambel L, Paulino S, Faria N, Pereira P & Tenreiro R (2009) Molecular identification, typing and traceability of cyanobacteria from freshwater reservoirs. Microbiology 155: 642-656. Vasconcelos V (1999) Cyanobacterial toxins in Portugal: effects on aquatic animals and risk for human health. Braz J Med Biol Res 32: 249-254. Vestola J, Shishido TK, Jokela J, Fewer DP, Aitio O, Permi P, Wahlsten M, Wang H, Rouhiainen L & Sivonen K (2014) Hassallidins, antifungal glycolipopeptides, are widespread among cyanobacteria and are the end-product of a nonribosomal pathway. P Natl Acad Sci USA 111: E1909-E1917. Wang H, Fewer DP, Holm L, Rouhiainen L & Sivonen K (2014) Atlas of nonribosomal peptide and polyketide biosynthetic pathways reveals common occurrence of nonmodular enzymes. P Natl Acad Sci USA 111: 9259-9264. Wase NV & Wright PC (2008) Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery. Expert Opin Drug Discov 3: 903-929. Watrous J, Roach P, Alexandrov T, Heath BS, Yang JY, Kersten RD, van der Voort M, Pogliano K, Gross H & Raaijmakers JM (2012) Mass spectral molecular networking of living microbial colonies. P Natl Acad Sci USA 109: E1743-E1752. Weber T (2014) In silico tools for the analysis of antibiotic biosynthetic pathways. Int J Med Microbiol 304: 230-235. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, Lee SY, Fischbach MA, Müller R & Wohlleben W (2015) antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res doi: 10.1093/nar/gkv1437.

FCUP 121 Characterization of cyanobacteria isolated from the Portuguese coast

Whitton BA & Potts M (2000) Introduction to the Cyanobacteria. The ecology of cyanobacteria: their diversity in time and space (Whitton BA & Potts M, eds.), pp. 1- 11. Springer, Netherlands. Wiegand C & Pflugmacher S (2005) Ecotoxicological effects of selected cyanobacterial secondary metabolites: a short review. Toxicol Appl Pharmacol 203: 201-218. Winnikoff JR, Glukhov E, Watrous J, Dorrestein PC & Gerwick WH (2014) Quantitative molecular networking to profile marine cyanobacterial metabolomes. J Antibiot 67: 105-112. Wrasidlo W, Mielgo A, Torres VA, Barbero S, Stoletov K, Suyama TL, Klemke RL, Gerwick WH, Carson DA & Stupack DG (2008) The marine lipopeptide somocystinamide A triggers apoptosis via caspase 8. P Natl Acad Sci USA 105: 2313-2318. Yang JY, Sanchez LM, Rath CM, Liu X, Boudreau PD, Bruns N, Glukhov E, Wodtke A, de Felicio R & Fenner A (2013) Molecular networking as a dereplication strategy. J Nat Prod 76: 1686-1699. Zehr JP, Mellon MT & Zani S (1998) New nitrogen-fixing microorganisms detected in oligotrophic oceans by amplification of nitrogenase (nifH) genes. Appl Environ Microbiol 64: 3444-3450. Zehr JP (2011) Nitrogen fixation by marine cyanobacteria. Trends Microbiol 19: 162- 173. Ziemert N, Ishida K, Weiz A, Hertweck C & Dittmann E (2010) Exploiting the natural diversity of gene clusters for discovery of novel tricyclic depsipeptides. Appl Environ Microbiol 76: 3568-3574. Ziemert N, Podell S, Penn K, Badger JH, Allen E & Jensen PR (2012) The Natural Product Domain Seeker NaPDoS: A phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. Plos One 7:e34064.