BIOPROSPECTING OF ENDOPHYTIC FUNGI FROM CERTAIN MEDICINAL PLANTS
THESIS SUBMITTED TO
BHARATI VIDYAPEETH DEEMED UNIVERSITY, PUNE
FOR THE AWARD
OF
DOCTOR OF PHILOSOPHY (Ph. D.)
IN
MICROBIOLOGY
UNDER FACULTY OF SCIENCE
BY
MONALI GULABRAO DESALE
UNDER THE GUIDANCE
OF
DR. MUKUND G. BODHANKAR
DEAN, FACULTY OF SCIENCE BHARATI VIDYAPEETH DEEMED UNIVERSITY YASHWANTRAO MOHITE COLLEGE PUNE
May 2016
CERTIFICATE
This is to certify that the work incorporated in the thesis entitled “Bioprospecting
of Endophytic Fungi From Certain Medicinal Plants” submitted by Monali G. Desale
for the award of the Degree of Doctor of Philosophy in Microbiology under the Faculty of
Science of Bharati Vidyapeeth Deemed University, Pune was carried out in the
Microbiology laboratory of Bharati Vidyapeeth Deemed University Yashwantrao
Mohite College, Pune.
Date:- ( Dr. K. D. Jadhav ) Principal, Bharati Vidyapeeth Deemed University Yashwantrao Mohite College, Pune
CERTIFICATE
This is to certify that the work incorporated in the thesis entitled “Bioprospecting of
Endophytic Fungi From Certain Medicinal Plants” submitted by Monali G. Desale for the award of the degree of Doctor of Philosophy in Microbiology under the Faculty of Science of
Bharati Vidyapeeth Deemed University, Pune was carried out under my supervision.
Date: (Dr. Mukund G. Bodhankar) Dean, Faculty of Science Department of Microbiology Bharati Vidyapeeth Deemed University Yashwantrao Mohite College, Pune
DECLARATION BY CANDIDATE
I hereby declare that the thesis entitled “Bioprospecting of Endophytic Fungi From Certain Medicinal Plants” submitted by me to the Bharati Vidyapeeth Deemed University, Pune for the degree of Doctor of Philosophy (Ph.D.) in Microbiology under the Faculty of Science is original piece of work carried out by me under the supervision of Dr. M. G. Bodhankar. I further declare that it has not been submitted to this or any other university or institution for the award of any degree or diploma.
I also confirm that all the material which I have borrowed from other sources and incorporated in this thesis is duly acknowledged. If any material is not duly acknowledged and found incorporated in thesis, it is entirely my responsibility. I am fully aware of the implications of any such act which might have been committed by me advertently or inadvertently.
Date: (Monali G. Desale) Research Student Bharati Vidyapeeth Deemed University Yashwantrao Mohite College, Pune.
ACKNOWLEDGEMENT
I would like to place on record my deep sense of gratitude to my guide Dr. Mukund G. Bodhankar, Dean, Faculty of Science, Microbiology Department, Bharati Vidyapeeth Deemed University, Yashwantrao Mohite College, Pune for his support, guidance and encouragement without which this work would not have completed.
I also take this opportunity to thank Prof. Dr. Shivajirao Kadam, Vice-Chancellor, Bharati Vidyapeeth Deemed University, Pune for creating an atmosphere conducive to research in all institutions of University which helped me a lot during the course of Ph. D. work.
I also profusely thank Dr. K. D. Jadhav, Principal, Bharati Vidyapeeth Deemed University Yashwantrao Mohite College, Pune for his support and permission to perform experimental and thesis work in the laboratory of the college.
I would like to express my sincere gratitude to Dr. Mrs. V. R. Sapre from Microbiology department of the college for her cooperation in completing the part of the work.
I would also like to express my sincere gratitude to Dr. S. K. Singh, Scientist, Agharkar Research Institute (ARI), Pune for his support and guidance in morphological identification of endophytic fungi.
I express my sincere thanks to Mr. Sachin Purohit, Managing Director, GeneOmbio Technologies, Pune and the team of Microbial Identification section specially Dr. Amol Raut, Mr. Yashawant Chavan, Mr. Asif Kawathekar for their prompt help in molecular identification.
I place on record my sincere thanks to Dr. Niraj Vyawahare, Principal, Pad. D. Y. Patil College of Pharmacy, Pune and Dr. Santosh Gandhi, Professor, Department of Analytical Chemistry, AISSMS College of Pharmacy, Pune who lent a helping hand in chemical elucidation of the bioactive metabolite.
I also thank Ms. Prajakta Pathade of Botanical survey of India, Pune for helping me in the part of the work.
I would also like to express my sincere thanks to subject experts Prof. B. P. Kapadnis and Principal Dr. G. R. Pathade for their expert and critical suggestions and positive criticism.
The work would have been incomplete without the help rendered in various ways by all staff of Department of microbiology including Mrs. Jape, Mr. Santosh Kharge, Mr. Patole and Mr. Golve.
I would also like to express special thanks to all my colleagues, friends and teaching as well as non-teaching staff who kept my spirits high during the testing period of laboratory work.
Though not connected directly with the work, my acknowledgment would be incomplete without mentioning all my family members. I express my deep gratitude for my parents in law, husband, parents and specially kids who allowed me to complete the work uninterruptedly.
Date: (Monali G. Desale)
TABLE OF CONTENTS
Page
Abstract I
Chapter 1 : Introduction 1
Chapter 2 : Objectives 6
Chapter 3 : Review of Literature
2.1 Definition 7
2.2 Distribution and biodiversity of endophytic fungi 9
2.3 Bioprospecting of microbial endophytes and their natural products for 11 various pharmaceutical activities
2.4 Antibacterial activities of endophytic fungi 14
2.5 Antifungal activities of endophytic fungi 15
2.6 Anticancer activities of endophytic fungi 15
2.7 Antiviral activities of endophytic fungi 16
2.8 Diversity and studies of endophytic fungi in India 17
2.9 Fungal endophytes from medicinal plants with reference to India 19
2.10 Therapeutic properties and endophytic fungi of Ocimum sanctum 19
2.11 Therapeutic properties and endophytic fungi of Vitex negundo 20
2.12 Therapeutic properties and endophytic fungi of Barleria prionitis 22
Chapter 4 : Materials and Methods
3.1 Selection of plant species 51
3.2 Localities/Sites for collection of plant samples 54
3.3 Collection of plant samples 54
3.4 Isolation of endophytic fungi 54
3.5 Media used for isolation of endophytic fungi 57
3.6 Calculation of colonization rate, isolation rate and density of colonization 57
3.7 Preservation of culture 58
3.8 Identification of endophytic fungi 58
3.8.1 Morphological identification 58
3.8.2 Molecular identification 58
3.9 Cultivation of fungi in different media for the production of metabolites 60
3.10 Fermentation, extraction and isolation of secondary metabolites 61
3.11 Screening of endophytic fungi for antibacterial activity 61
3.11.1 Microorganisms used for antibacterial activity 61
3.11.2 Preparation of test sample 61
3.11.3 Agar well diffusion method 61
3.12 Process optimization of fermentation conditions for production of active 62 metabolites from selected endophytic fungi
3.13 Extraction and purification of secondary metabolites of selected endophytic 62 fungi for evaluation of antibacterial activity
3.14 Determination of minimum inhibitory concentration (MIC) 63
3.15 Chemical screening of selected endophytic fungal extract 63
3.15.1 Chromatographic analysis by High performance thin layer 63 chromatography (HPTLC)
3.15.1.a Instrumentation 63
3.15.1.b Chromatographic conditions 63
3.15.1.c Mobile phase 63
3.15.1.d Calculation of Rf values 64
3.15.2 Structural elucidation 64
Chapter 5 : Results
4.1 Biodiversity and taxonomical study of the endophytic fungi isolated from 65 Ocimum sanctum, Vitex negundo and Barleria prionitis
4.1.1 Plant-wise and plant part-wise distribution of endophytic fungi 65
4.1.2 Species-wise distribution of fungi among the three medicinal plants 68
4.1.3 The species, genera and other taxonomical details of the endophytic 71 fungi isolated from the three medicinal plants
4.1.4 Colonization rate and isolation rate of plant part samples 71
4.1.4.a Colonization rate and isolation rate of endophytic fungi in case of 74 Ocimum sanctum
4.1.4.b Colonization rate and isolation rate of endophytic fungi in case of 74 Vitex negundo
4.1.4.c Colonization rate and isolation rate of endophytic fungi in case of 74 Barleria prionitis
4.1.4.d Colonization rate and isolation rate of endophytic fungi for all three 76 medicinal plants taken together
4.1.5 The density of colonization (rD%) or colonization frequency (CF%) of an 77 individual endophytic species in three medicinal plants
4.1.5.a The density of colonization (rD%) or colonization frequency (CF%) 77 of different species of endophytic fungi isolated from Ocimum sanctum
4.1.5.b The density of colonization (rD%) or colonization frequency (CF%) 78 of different species of endophytic fungi isolated from Vitex negundo
4.1.5.c The density of colonization (rD%) or colonization frequency (CF%) 79 of different species of endophytic fungi isolated from Barleriaprionitis 4.1.5.d The density of colonization (rD%) or colonization frequency (CF%) of different species of endophytic fungi isolated from all three medicinal 79 plants together 4.2. The identification of endophytic fungi 81
4.2.1 Molecular identification of Phomopsis sp. aff. P. archeri B. Sutton isolated 83 from culture no. 505 of Vitex negundo
4.2.2 Molecular identification of Phomopsis sp. aff. P. archeri B. Sutton isolated 86 from culture no. 582 of Barleria prionitis
4.2.3 Molecular identification of Alternaria raphani J.W. Groves and Skolko 89 isolated from culture no. 536 of Vitex negundo
4.3 Brief taxonomy of the other major endophytic fungi isolated from the different 92 parts of the three medicinal plants
4.4 Antibacterial screening of Fungal Endophytes 94
4.4.1 Analysis of antibacterial screening of fungal endophytes 108
4.4.2 Salient features of analysis of antibacterial screening of fungal endophytes 113
4.5 Process optimization for production of active metabolites from Phomopsis archeri B. Sutton isolated from Vitex negundo 113
4.6 Minimum inhibitory concentration (MIC) 116 4.7 Chemical elucidation of secondary metabolite extracted from Phomopsis 117 archeri B. Sutton isolated from Vitex negundo
4.7.1 High performance thin layer chromatography (HPTLC) 117
4.7.2 Calculation of Rf values 117
4.7.3 Recording details 121
4.7.4 Elemental analysis – Infrared spectrum, NMR spectrum, GC-MS spectrum 121
4.7.5 Probable structure of the compound from elemental analysis, IR and NMR 123 and GC-MS
Chapter 6 : Discussion 5.1 Collection of plant samples, isolation of endophytic fungi and preservation 124 of culture 5.2 Identification and cultivation of endophytic fungi and isolation of secondary 125 metabolites 5.3 Diversity and distribution of fungal endophytes 125 5.4 Major species isolated from the three medicinal plants – distribution and 127 antibacterial activity 5.4.1 Colletotrichum gloeosporioides 128 5.4.2 Fusarium sp. 130 5.4.3 Nigrospora state of Khuskia oryzae 130 5.4.4 Phomopsis archeri B. Sutton 131 5.5 Requirements of Intensive study 133 5.6 Requirements of extensive study 133 5.7 Antibacterial activity against gram positive vs. gram negative test bacteria 134 5.8 Taxanomic identities of endophytic fungi 134 5.9 Observations in respect of eluent 135 5.10 Chemical elucidation of compound 136 Chapter 7 : Summary and conclusions 137
Chapter 8 : Future prospects 144
References 145
List of Publications and Presentation 171
List of Tables
Table No. Title Page no.
1 Reported estimates of fungal species diversity 23
2 Examples of the endophytic activities against microbes 24
3 Natural products of endophytic microorganisms 27
Summary of certain studies related to antibacterial activities of 4 37 endophytic fungi Summary of certain studies related to antifungal activities of 5 39 endophytic fungi Representative studies on endophytic fungi from medicinal plants 6 40 in India
7 Phytochemicals present in Ocimum sanctum 41
8 Medicinal properties of Ocimum sanctum 42
Summary of certain studies in respect of antimicrobial potential of 9 44 Ocimum sanctum
10 Traditional medicinal uses of Vitex negundo 45
11 Traditional medicinal uses of Barleria prionitis 46
Summary of certain studies in respect of antimicrobial potential of 12 49 Barleria prionitis
13 Different Sterilization Protocols 56
Plant-wise and plant part-wise distribution of endophytic fungi 14 65 isolated
15 Distribution of endophytic fungi among the three medicinal plants 70
Taxonomical details of representative species sent for 16 morphological and molecular analysis at ARI and GeneOmbio 72 Technologies Pvt. Ltd. Summary of endophytic fungi and colonization rate and isolation 17 74 rate in respect of plant parts of Ocimum sanctum
Summary of endophytic fungi and colonization rate and isolation 18 74 rate in respect of plant parts of Vitex negundo Summary of endophytic fungi and colonization rate and isolation 19 75 rate in respect of plant parts of Barleria prionitis Summary of endophytic fungi and colonization rate and isolation 20 76 rate in respect of plant parts of all three plants taken together Colonization density of species of endophytic fungi isolated from 21 78 Ocimum sanctum Colonization density of species of endophytic fungi isolated from 22 78 Vitex negundo Colonization density of species of endophytic fungi isolated from 23 79 Barleria prionitis Colonization density of different species of endophytic fungi 24 80 isolated from all three medicinal plants
25 Endophytic fungi from Ocimum sanctum 82
26 Endophytic fungi from Vitex negundo 82
27 Endophytic fungi from Barleria prionitis 83
Comparison of rDNA sequence of sample ENS505 with closely 28 84 related taxa available in GenBank Database Comparison of rDNA sequence of sample ENS582 with closely 29 87 related taxa available in GenBank Database Comparison of rDNA sequence of sample EN2S536 with closely 30 90 related taxa available in GenBank Database
31 Antibacterial activity of endophytic fungi of Ocimum sanctum 95
32 Antibacterial activity of endophytic fungi of Vitex negundo 96
33 Antibacterial activity of endophytic fungi of Barleria prionitis 97
Degree of antibacterial activity in case of endophytic fungi isolated 34 109 from three medicinal plants Maximum instances of significant antibacterial activity in any base 35 109 against any test bacteria Instances of significant antibacterial activity of extracts of 36 110 endophytic fungi in three bases
37 Endophytic fungi found to be effective against respective bacteria 111
Instances of moderate to significant antibacterial activity of extracts 38 112 of endophytic fungi isolated from three plants
39 Interpretation of IR spectrum 121
40 Interpretation of NMR spectrum 122
List of Figures
Figure Legend Page no. no. Plant-wise distribution of 132 endophytic fungi isolated from three 1 66 medicinal plants Part-wise distribution of endophytic fungi isolated from Ocimum 2 66 sanctum Part-wise distribution of endophytic fungi isolated from Vitex 3 67 negundo Part-wise distribution of endophytic fungi isolated from Barleria 4 67 prionitis Part-wise distribution of endophytic fungi isolated from all three 5 68 plants taken together
The stacked bar chart for the species-wise analysis of 132 6 69 endophytic fungi isolated from all the three medicinal plants
7 Colonization rate of plant part samples in three medicinal plants 75
8 Isolation rate of plant part samples in three medicinal plants 76
9 Overall colonization rate 77
10 Overall isolation rate 77
Colonization density of different species of endophytic fungi 11 81 isolated from all three medicinal plants
Guiding phylogenetic tree for Phomopsis sp. aff. P. archeri B. Sutton 12 85 isolated from culture no. 505 of Vitex negundo
Guiding phylogenetic tree for Phomopsis sp. aff. P. archeri B. Sutton 13 88 isolated from culture no. 582 of Barleria prionitis
Guiding phylogenetic tree for Alternaria raphani J.W. Groves and 14 91 Skolko isolated from culture no. 536 of Vitex negundo
Instances of moderate to significant antibacterial activity of extracts 15 112 of endophytic fungi isolated from three plants
Effect of pH and incubation time on the growth and production of 16 114 crude metabolite at 250 C in PD broth
Effect of pH and incubation time on the growth and production of 17 115 crude metabolite at 270 C in PD broth
Effect of pH and incubation time on the growth and production of 18 115 crude metabolite at 300 C in PD broth
Effect of pH, incubation time and temperature on growth and 19 production of crude metabolite (extract) by Phomopsis sp. in PD 116 broth. HPTLC plate of ethyl acetate extract of compound isolated from 20 Phomopsis archeri B. Sutton isolated from Vitex negundo at 366 118 nm, volume applied 10 l. HPTLC plate of ethyl acetate extract of compound isolated from 21 Phomopsis archeri B. Sutton isolated from Vitex negundo at 254 119 nm, volume applied 10 l. HPTLC plate of ethyl acetate extract of compound isolated from 22 Phomopsis archeri B. Sutton isolated from Vitex negundo at visible 120 light, Volume applied 10 l. Infrared Spectrum of compound isolated from Phomopsis archeri B. 23 121 Sutton isolated from Vitex negundo
NMR Spectrum of compound isolated from Phomopsis archeri B. 24 122 Sutton isolated from Vitex negundo
Mass Spectrum of the compound isolated from Phomopsis Archeri 25 123 B. Sutton isolated from Vitex negundo
Probable structure of the compound from elemental analysis, IR and 26 123 NMR and GC-MS spectra
Abbreviations
ARI : Agharkar Research Institute BLAST : Basic Local Alignment Search Tool DNA : Deoxyribonucleic acid dNTP : Dinucleiotide triphosphate DRIFT : Diffuse Reflectance Infrared Fourier Transform EDTA : Ethylenediaminetetraacetic EMBL : European Molecular Biology Laboratory GC-MS : Gas Chromatography Mass Spectrometry HPTLC : High Performance Thin Layer Chromatography ITS : Internal Transcribed Spacer IR : Infrared NCBI : National Center for Biotechnology Information NFCCI : National Fungal Culture Colletion of India NMR : Nuclear Magnetic Resonance PCR : Polymerase Chain Reaction TE : Tris EDTA buffer TMS : Tetramethylsilane TRR : Terminated Ready Reaction
ABSTRACT
The endophytes are the microbes living within the tissues of a plant without showing any noticeable symptoms of existence in it. The nature of association of endophytes with the plant may have a wide spectrum. It may range from symbiotic to one nearing pathogenic. Endophytes may benefit host plants in several ways which include prevention of pathogenic organisms from colonizing host plants; creation of a ‘Barrier Effect’ by extensive colonization of the host plant tissue and thus outcompeting and preventing pathogens from taking hold in host plant; production of chemicals inhibiting the growth of competitors including pathogens; stimulating the plant growth; modification of biology of plant to enable it to survive in environmental extremes etc. Apart from the benefits to the host plant, the endophytes have also proved as an outstanding source of secondary metabolites and bioactive antimicrobial products. They have proved to be a significant source of antibacterial, antiviral, antidiabetic, anticancer, antioxidants and immunosuppressive compounds. Hence, since last about a decade and half, fungal endophytes have received significant attention for their potential to produce known or novel bioactive compounds.
The potential of the endophytes has been discovered at a time when, worldwide, there is an increased interest in searching novel bioactive compounds having high effectiveness, low toxicity and negligible environmental impacts. Microbes in general have been an abundant source of novel chemo-types and pharmacophores from thousands of years. In recent past, endophytes, due to their capacity to produce novel bioactive compounds, have received attention by the scientific community. Considering the increased global health concern over the failure of currently used antibiotics to many super resistant strains, indiscriminate exploitation of medicinal plants for extraction of antimicrobial agents of plant origin and limitations of plant resources due to various factors like requirement of land for cultivation, environmental competence of plants, seasonal specificity etc., the search for new and effective antimicrobial agents is becoming a necessity. Therefore, various traditionally used medicinal plants are being studied world-wide for their ability to host endophytic fungi having antimicrobial potential. However, being recent development, the endophytes in the traditional medicinal plants are relatively unstudied. The practitioners of traditional systems of medicine have been using various medicinal plants for curing various ailments and conditions due to their great therapeutic potentials and wide occurrence in India. However a scientific and rational approach to the traditional medical practices in harmony with the
I
modern system of medicine is found lacking. Identification of endophytic fungi has potential to establish a scientific basis for traditional therapeutic uses of medicinal plants.
With this background, the present work was initiated for bioprospecting the antibacterial activity of secondary metabolites extracted from endophytic fungi isolated from three medicinal plants viz. Ocimum sanctum, Vitex negundo and Barleria prionitis.
150 segments from each of the three medicinal plants i.e. 450 plant segments in total were processed. 150 segments of each plant consisted of 50 segments each of leaves, stems and roots. From these 450 segments, 132 fungal endophytes were isolated. The plant parts were collected mainly from Mulshi area near Pune. For fungal isolation, twelve different sterilization protocols were analyzed and the protocol of Petrini et al. (1986); Rubini et al. (2005) and Gao et al. (2009) were followed. Sporulating structures were considered as diagnostic features for the morphological identification of endophytic fungi. A total of 132 endophytic isolates were obtained from all the three plant species. All isolates were characterized and identified. The analysis of endophytic fungi isolated from all the three medicinal plants revealed that maximum 56 i.e. 42% were extracted from Ocimum sanctum followed by Vitex negundo which yielded 45 i.e. 34% of the total endophytic fungi isolated. More number of endophytic fungi were isolated from stem than the leaves and roots. Stem yielded 56 out of 132 i.e. 42% of endophytic fungi followed by leaves from which 48 i.e. 36% endophytic fungi were isolated. 21 species belonging to 14 genera were isolated from the three medicinal plants. The most abundantly found species were Colletotrichum gloeosporioides, Fusarium sp., Phomopsis archeri B. Sutton and Nigrospora state of Khuskia oryzae. This trend of species was also evident in individual plants except the Nigrospora sphaerica, Penicillium sp. and Aspergillus flavus which were also found in majority in Barleria prionitis.
For the production of secondary metabolites, the fungi were cultivated in appropriate media. In order to perform bioassay for the detection of active metabolites, small scale cultivation was carried out. For primary screening, fungi were cultured on Potato Dextrose Agar (PDA) in most of the cases. For evaluation of the growth rate, three different media were used. The maximum growth was observed in PDA and hence the same was used for further study and production of fungal biomass and crude extract on the basis of the comparative analysis.
II
Antibacterial activity of the isolated endophytic fungi was screened against six bacteria – three gram positive and three gram negative. Screening of antibacterial activity was carried out by agar well diffusion technique. Process optimization was carried out for different parameters like temperature, pH, incubation period with respect to fungal biomass and crude metabolite production.
Out of the 50 endophytic fungi selected for antibacterial screening, 98% endophytic fungi showed moderate to significant antibacterial activity at least against one test bacteria. 32% of the endophytic fungi showed significant antibacterial activity at least against one test bacteria. This number was highest in Ocimum sanctum. 50% of the endophytic fungi isolated from Ocimum sanctum showed significant antibacterial activity at least against one test bacteria. The endophytic fungi isolated from the three medicinal plants showed maximum effectiveness against S. typhi followed by B. cereus. The basic analysis of antibacterial activity revealed that the extracts in ethyl acetate were more effective as compared to those in hexane or methanol.
It was observed that Phomopsis archeri B. Sutton was found in all the three medicinal plants. Its isolate from Vitex negundo showed significant antibacterial activity in all three extracts with hexane, ethyl acetate and methanol against K. pneumoniae. It showed maximum antibacterial activity in terms of diameter of inhibition. The maximum instances of significant antibacterial activity in any base against any test bacteria were shown by Phomopsis archeri B. Sutton isolated from Vitex negundo (4 times) followed by Phomopsis archeri B. Sutton isolated from Barleria prionitis (3 times). Its isolate from the stem of Vitex negundo showed significant antibacterial activity against 4 bacterial strains whereas the same endophytic fungi isolated from the leaf of the same plant showed significant antibacterial activity against 2 bacterial strains. Further Phomopsis archeri B. Sutton isolated from leaf of Barleria prionitis showed significant antibacterial activity against 3 bacterial strains.
Considering these facts, the Phomopsis archeri B. Sutton from Vitex negundo was selected for further study. In order to find out the supporting conditions for the enhanced growth in the production of crude/secondary metabolites by selected endophytic Phomopsis archeri B. Sutton and its potential activity against selected test bacteria, the process optimization study was carried out. The maximum growth in fungal biomass productions as well as the crude metabolite production was recorded at 270C at pH 5.0 on 21st day of incubation.
III
Chemical elucidation of secondary metabolite extracted from Phomopsis archeri B. Sutton isolated from Vitex negundo was carried out using HPTLC, IR spectrum, NMR spectrum and GC-MS Spectrum.
The chemical compound was identified as Luteolin – 7- glucoside: 2,3-dihydro-5-hydroxy-2- (3,4-dihydroxyphenyl)-7-(tetrahydro-3,4,5-trihydroxy-6-(hydroxymethyl)-2H-pyran-2- yloxy)chromen-4-one.
The probable structure of the compound from elemental analysis, IR and NMR and GC-MS is -
OH OH O
HO OH
HO O O O
OH
OH The literature survey indicates that the flavonoids in general and Luteolin glucosides in particular are reported to be found in the extracts of Vitex negundo and show significant antibacterial activity. To this extent, the findings of present study are in agreement with the present scientific findings. However, literature survey did not reveal the luteolin glucoside being identified as having been extracted from the endophytic fungi of Vitex negundo. This supports the hypothesis that the antibacterial activity of medicinal plants may be mainly due to the endophytic fungi in them. However it needs further intensive study to confirm the same.
In summary, the present study shows broad endophytic fungal diversity in selected plant species; underlines their potential antibacterial activity and justifies the traditional use of the selected three medicinal plants against human pathogenic bacteria. Further, it also supports the possibility that the antibacterial activity can be attributed to the presence of endophytic fungi. It also justifies that the studies on isolation and identification of these bioactive compounds can be a crucial approach to the search of novel natural products.
IV
Chapter 1
Introduction
INTRODUCTION
Every ecosystem has fungi as an important component. Certain crucial processes in ecosystems such as transportation of nutrients from one environment to other, decomposition, recycling etc. are carried out by or with the help of fungi. Different estimates suggest that the earth may be hosting more than a million fungal species and only a small fraction of it (approximately 5%) have actually been identified.
After insects, they are the second largest group of tropical ecosystems of the world. Since they are heterotrophic, they usually have saprophytic or parasitic association with the hosts. However, in the course of evolution, the fungi developed various types of relationships with them. One of these associations led to formation of the group – ‘endophytes’. The fossil records show that plants are associated with endophytic (Krings et al. 2007) and mychorrhizal (Redecker 2000) fungi for more than 400 million years and most probably they were associated when plants started colonizing the land, thus they had a very long and important role in shaping the evolution on land. (Rodriguez et al. 2009).
Taken literally, the word endophyte means ‘in the plant’ (endon in Greek means within and phyton means plant). Thus in literal terms, endophyte could refer simply to the location of the organism. Thus endophyte can be taken to mean an organism which lives inside the plant as contrasted to epiphyte which lives on the outside surface of the plant. The organisms that are commonly associated with the term endophyte are fungi and bacteria. However, Wennstrom (1994) argued that such use of the term ‘endophyte’ is vague and not very useful. It has been suggested by Wennstrome that the word endophyte implies a mutualistic relationship that may not exist. The usage of this term is as broad as its literal definition (Schulz and Boyle et al. 2005) and spectrum of potential hosts and inhabitants e.g. plants (Marler et al. 1999), bacteria (Kobayashi and Palumbo 2000), fungi (Stone et al. 2000) and insects in plants (Feller 1995), algae within algae (Peters 1991) etc.
The term endophyte is equally variably used for variable life history strategies of the symbiosis. Sometimes it is used for pathogenic algae (Bouarab et al. 1999), for parasitic endophytic plants (Marler et al. 1999), for endophytic bacteria showing mutualistic association (Chanway 1996) and also for pathogenic bacteria and fungi in latent developmental phases (Sinclair and Cerkauskas 1996).
1
The term ‘endophyte’ was coined by De Barry (1866) to distinguish fungi residing within the host tissue from epiphytes. Initially, the term was used to indicate any organisms occurring within plant tissues. Petrini included in endophytes “All the organisms inhabiting plant organs that have capacity to colonize some internal plant tissue at some period in their life that does not cause harm to that plant” (Petrini 1996). Petrini included invisible pathogens in this category. Wilson (1995) broadened the definition by including both fungi as well as bacteria which, for all or part of their life cycle, enter the tissues of living plants and cause infections that are unapparent and asymptomatic and are entirely within plant tissues. More elaborate definition is given by Hirsch and Braun stating that endophytic fungi are fungi that colonize living plant tissue without causing any immediate, overt/visible negative effects (Hirsch and Braun 1992)
Stone et al. (2000) have defined endophytes as those organisms whose “infections are inconspicuous, the infected host tissues do not show symptoms at least for transient period and the microbial colonisation can be demonstrated to be internal.”
This definition attributes the term endophyte to a momentary status. It may therefore include an assemblage of micro-organisms with different life history strategies e.g. those growing saprophytically on dead tissues following an endophytic growth phase (Stone 1987) as well as latent pathogens and virulent pathogens in the early stages of infection (Sinclair and Cerkauskas 1996; Kobayashi and Palumbo 2000).
Unfortunately, if we take the literal definition, it can include all pathogens at some stage of their development. Therefore additional characteristic of “not causing apparent harm” as described by Petrini is important as it refers to an absence of macroscopically visible symptoms. In order to avoid the determinative discrepancies, the term endophyte can be used to describe those bacteria and fungi that can be detected at a particular moment within the tissue of apparently healthy plant host (Schulz and Boyle 2005).
The nature of relationship between an endophytic fungi and the host plant is complex (Owen and Hundley 2004). Fungi possess capacity to develop a relationship of symbiotic nature with their hosts which may be mutualism, latent phytopathogenesis, commensalism or saprophytism (Clay and Schardl 2002; Strobel and Daisy 2003; Kogel et al. 2006). Therefore the term endophyte has been variably used for different life history strategies of symbiosis right from facultatively saprobic to parasitic to exploitative to mutualistic. To quote a few examples, the term endophyte is used for parasitic endophytic plants (Marler et al. 1999),
2
endophytic bacteria showing mutualistic relationship (Chanway 1996) and pathogenic endophytic algae (Bouarab et al. 1999). The fact that endophytes are usually found to be inhabiting the above-ground plant tissues (leaves, stems, bark, petioles and reproductive structures) distinguishes them from better known mycorrhizal symbionts. However, the distinction is not final because endophytes may also inhabit root tissues.
The usage of the term endophytes is thus many times not consistent with each other. The broad definition by Stone et al. (2000) can be accepted as a reasonably accurate definition. However, it can unfortunately include all pathogens at some stage of their development. Thus, there are wide determinative discrepancies in the definition of the endophytes. However, they can be used to describe those bacteria and fungi that can be detected at a particular time within the tissues of otherwise healthy plant hosts (Schulz and Boyle 2005).
In recent past, there has been increasing interest as well as research in the field of endophytic fungi. Various fungal surveys of various hosts have been carried out during the past two to three decades and it has been demonstrated that endophytic colonization of land plants by fungi is ubiquitous. Carroll (1995), Petrini (1986, 1996) and Bills (1996) have carried out extensive studies on methods of detection, taxonomy, species composition, distribution, biological, ecological and physiological aspects of endophytes of woody plants in Europe and North America. Studies have also been carried out on systematics, evolutionary biology, ecology and applied research of endophytic fungi. Studies have also been carried out with regard to interactions and mutualistic symbiosis between endophytes and host plants (Saikkonen et al. 1998; Clay and Schardl 2002).
Endophytes have been found to be inhabiting plants growing in tropical, temperate and boreal forests; herbaceous plants from various habitats including extreme arctic, alpine, xeric environments; plants in mesic temperate and tropical forests. Endophytic fungi are also detected in healthy aerial tissues of conifers and grasses.
Endophytic fungi are also found in mosses and hepatics, other bryophytes, algae, ferns and fern allies, moses and ferns, broad-leaved trees, angiosperms and gymnosperms, marine algae, lichens etc.
Many efforts have been made to estimate the total number of fungi. The magnitude of fungal diversity was estimated to about 1.5 million species primarily based on a ratio of vascular
3
plants to fungal species of 1:6 which was later revised by Hawksworth (2001) to 2.27 million. However, the number of fungal species may vary because of availability of modern tools and techniques of identification. Petrini (1991) has reported that there could be more than 1 million species of endophytic fungi remaining to be discovered.
In the recent past, there has been increased global health concern over the failure of currently used antibiotics to many super resistant strains, indiscriminate exploitation of medicinal plants for extraction of antimicrobial agents of plant origin and limitations of plant resources due to various factors like requirement of land for cultivation, environmental competence of plants, seasonal specificity etc. Therefore, the search for new and effective antimicrobial agents has assumed importance. The endophytes are very important in this respect. Endophytes are found to be the promising sources of biologically active products which are of interest for specific health care applications (Strobel et al. 2001; Suthep et al. 2004). Endophytic fungal strains are also found to be potentially useful in the production of pigments, bioactive metabolites, immuno-suppressants, anticancer compounds and bio- control agents. (Wang et al. 2002; Stinson et al. 2003; Gangadevi and Muthumary 2007)
India is extremely biodiverse being one of the 17 megadiversity countries in the world and having 10 biodiversity regions. Forests, wetlands, desert, grasslands and coastal and marine are the major ecosystems in India. The important factors that make India a megadiversity country are – Forest cover of about 21% 16 major forest types with 221 subtypes More than 40 lakh hectares of wetlands Mangroves spread over an area of about 6700 km2 (7% of the world’s mangroves) Marine ecosystems - Coral reef found in Gulf of Kutch, Gulf of Mannar, Andaman, Nicobar and Lakshadweep islands Desert ecosystem covering about 2% of the total landmass Cold desert covering Ladakh, part of Jammu and Kashmir and Lahaul-Spiti part of Himachal Pradesh.
India harbours about 47,000 plant species out of about 4 lakh hitherto known in the world, representing about 11% of world’s flora. About 28% of plants occurring in India are endemic
4
to the country. Out of 34 ecologically sensitive zones in the world, India has four. No other country has so many eco-sensitive zones.
Thus India offers huge scope for fungal diversity as well. However, studies in India in this respect have many shortcomings like remarkable geographical concentration of studies of endophytic fungi, tendency among the Indian researchers to select plants primarily based on availability and vicinity of plant hosts around their work place due to convenience as well as limited funding, the studies mainly revolving round the biodiversity, ecological studies and distribution of endophytic assemblages and very few attempts to isolate and purify compounds from endophytic fungi from Indian medicinal plants.
Keeping the foregoing discussion in view, the research work was aimed at bioprospecting of endophytic fungi from certain medicinal plants to add value to the existing research work in the field of microbiology.
5
Chapter 2
Objectives
OBJECTIVES
Endophytic fungi have emerged as a novel source of bioactive compounds exhibiting antimicrobial properties. Medicinal plants are natural choice for the study of endophytic fungi due to proved medicinal properties. Traditional system of medicine in India has enlisted several medicinal plants and their therapeutic potential in curing various ailments. Thus combining the traditional wisdom in this respect with the modern strides in studies in endophytic fungi offers a novel field of research.
Hence, it was felt that bioprospecting of endophytic fungi in selected medicinal plants may -
1) help to understand the diversity of the endophytic fungi existing in selected medicinal plants,
2) help to understand the diversity of antibacterial compounds synthesized by endophytic fungi,
3) serve as a model for the discovery of new groups of secondary metabolites of pharmaceutical importance with novel and innovative applications,
4) scientifically reveal whether the medicinal properties are associated with respective medicinal plants or its endophytes.
With this view, the present study was undertaken with the objectives as –
5) Screening of indigenous fungal endophytes from selected medicinal plants.
6) Primary screening of antibacterial potential of isolated endophytes against drug resistant pathogens.
7) Laboratory scale optimization studies for antibacterial compounds production.
8) Isolation and purification of specific antibacterial compounds.
6
Chapter 3
Review of Literature
REVIEW OF LITERATURE
A fungus is any member of the group of eukaryotic organisms including unicellular microorganisms such as yeasts, molds and also multicellular fungi that produce fruiting forms known as mushrooms. All these organisms together are classified as a kingdom Fungi and it forms a separate kingdom from the other life kingdoms of plants, animals, bacteria and protists. After insects, fungi are the second largest group of tropical ecosystems.
Fungi are found in abundance worldwide. However, most fungi are inconspicuous because of the miniscule size and cryptic lifestyles in soil and on dead matter. They exhibit symbiotic as well as parasitic tendencies. Being heterotrophic, they are usually saprophytes and parasites. Their habitats range from psychrophilic to thermophilic. Brundrett (2002) has reported that the fungi might have colonized the land during the Cambrian, long before land plants. In the process of evolution fungi developed different types of relationship with plants. The group ‘endophytes’ forms one such special association with plants. The existence of endophytes has been traced in the fossil records which indicate that endophyte-host association may have developed from the time of emergence of first higher plants on earth (Strobel 2003).
2.1 Definition:
Basically the term endophyte refers to the location of an organism. Endo means “inside” or “within” and phyton means “plant”. Thus the word endophyte refers to any organism that lives within or inside the plant (Wilson 1995). Since the range of potential hosts i.e. plants and inhabitants i.e. organisms is extremely broad, the usage of this term is also extremely broad. The origin of the term endophyte can be traced back to 1860s. It was coined by De Barry (1866). It was coined to differentiate the fungi residing within the host tissues from epiphytes that live on plant surfaces. During past 25 years the term endophyte has undergone considerable changes and differentiation.
The term endophyte has been used by Carroll (1986) for referring to the mutualist organisms that colonize aerial parts of living plant tissues and do not cause symptoms of disease i.e. causing asymptomatic infections within the plant tissue excluding pathogenic and mycorrhizal fungi. Carroll’s definition was expanded by Petrini (1991) to include all the organisms inhabiting plant organs that, at some time in their life cycle can colonize internal plant tissues without causing any apparent harm to the host. This implied that latent pathogens known to live symptomlessly inside host tissues that have an epiphytic phase in
7
their life cycle are also endophytes. This definition was further expanded by Wilson (1995) to include both fungi as well as bacteria that invade living plants and cause asymptomatic infections confined within tissues but do not cause disease. It has also been used to refer to latent development phases of pathogenic bacteria (Sinclair and Cerkauskas 1996). Sturz and Nowak (2000) have used it to describe micro-organisms in commensalistic symbioses. The expansion of the term continued thereon to include all organisms living inside the plants without producing any visible symptoms (Azevedo et al. 2000). Stone et al. (2000) have defined the term endophyte as all-encompassing topographical term which includes all organisms that reside within the tissues of their hosts without any symptoms during a variable period of their life cycle.
The term endophyte has been used by some scholars to refer to bacteria (Kobayashi and Palumbo 2000), plants (Marler et al. 1999), fungi (Stone et al. 2000) and insects in plants (Feller 1995) as well as algae within algae (Peters 1991). However the organisms commonly associated with the term endophyte are bacteria and fungi (Fahey et al. 1991). Used in this simplistic way, any fungi or bacteria living inside the plant tissue would be eligible to be called endophyte. However, such usage of the term would be vague and not very useful. Accordingly, over the time, the use of the term endophyte has evolved and has been restricted in many ways such that it has now become more specific and meaningful. It has now evolved into a type of association that the fungus or bacterium has with its host.
The relationship between an endophyte and its host is complex (Owen and Hundley 2004). Fungi have capacity to develop a symbiotic relationship with their hosts that can vary from mutualism to latent phytopathogenesis, passing through commensalism and saprophytism (Clay and Schardl 2002; Strobel and Daisy 2003; Kogel et al. 2006). Therefore the term endophyte has been variably used for different life history strategies of symbiosis ranging from parasitic to facultatively saprobic and from mutualistic to exploitative. To quote few examples, Marler et al. (1999) uses the term endophyte for parasitic endophytic plants, Chanway (1996) uses the same for mutualistic endophytic bacteria whereas Bouarab et al. (1999) uses it for pathogenic endophytic algae.
Endophytes are usually found to be inhabiting the plant tissues above ground like leaves, stems, bark, petioles and reproductive structures. This distinguishes them from better known mycorrhizal symbionts. However, the distinction is not final because endophytes may also inhabit root tissues.
8
The contemporary usage of the term is many times not consistent with each other and they are not universally accepted by all scholars and investigators. Though the broad definition by Stone et al. (2000) can be accepted as a reasonably accurate definition, it can unfortunately include all pathogens at some or other stage of their development. As the definition describes a momentary status, it includes saprophytically growing micro-organisms on dead tissues following an endophytic growth phase as proposed by Stone (1987) and latent pathogens and virulent pathogens in the early stages of infection as stated by Sinclair and Cerkauskas (1996) and Kobayashi and Palumbo (2000). Thus, there are wide determinative discrepancies in the definition of the endophytes. However, as stated by Schulz and Boyle (2005), they can be used to indicate those bacteria and fungi that can be identified at a particular moment inside the tissues of otherwise healthy host plants. The endophytes have been differentiated from mycorrhizal fungi on the basis of taxonomical characteristics (Bills and Polishook 1991) and tissue specificity (Carlile and Watkinson 1989; Agrios 1997). They are differentiated from pathogenic fungi on the basis of asymptomatic growth under different conditions (Verhoeff 1974).
2.2 Distribution and biodiversity of endophytic fungi:
In the past 30 to 40 years, there has been increasing interest as well as research in the field of endophytic fungi. Various scholars and investigators have carried out fungal surveys of various hosts during the past 20-30 years and it has been demonstrated that endophytic colonization of land plants by fungi is ubiquitous. Carroll (1995), Petrini (1986, 1996) and Bills (1996) have carried out extensive studies on methods of detection, taxonomy, species composition, distribution, biological, ecological and physiological aspects of endophytes of woody plants in Europe and North America. Studies have also been carried out on systematics, evolutionary biology, ecology and applied research of endophytic fungi. Studies have also been carried out with regard to interactions and mutualistic symbiosis between endophytes and host plants (Saikkonen et al. 1998; Clay and Schardl 2002).
Endophytes have been found from plants growing in tropical, temperate and boreal forests; from herbaceous plants from various habitats including extreme arctic, alpine (Petrini 1987; Fisher et al. 1995), from xeric environments (Mushin and Booth 1987; Mushin et al. 1989) and from mesic temperate and tropical forests. Endophytic fungi are also detected in healthy aerial tissues of conifers (Petrini and Fisher 1986; Guo et al. 2004; Hormazabal and Piontelli 2009) and grasses (Bacon et al. 1977; Waller et al. 1983; Clay 1988).
9
Endophytic fungi are also found in mosses and hepatics (Pocock and Duckett 1985; Ligrone et al. 1993), other bryophytes (Davis et al. 2003), algae (Hawksworth 1988; Zuccaro et al. 2008; Suryanarayanan et al. 2010), ferns and fern allies (Fisher 1996; Schmid and Oberwinkler 1993), moses and ferns (Schulz et al. 1993; Fisher 1996), broad-leaved trees (Arrhenius and Langenheim 1986; Lodge et al. 1995), angiosperms and gymnosperms including tropical palms (Rodrigues and Samuels 1992; Fröhlich and Hyde 2000), marine algae (Cubit 1974; Hawksworth 1988), lichens (Li et al. 2007; Petrini et al. 1990; Suryanarayanan et al. 2005), the estuarine plants Salicornia perennis (Petrini and Fisher 1986), Spartina alterniflora (Gessner 1977), Suada fruticosa (Fisher and Petrini 1987) and pteridophytes (Dhargalkar and Bhat 2009).
Survey of literature indicates that endophytes are mostly confined to gymnosperms in temperate regions (Bernstein and Carroll 1977; Petrini and Fisher 1988; Boddy and Griffith 1989; Guo et al. 2004). Endophytic fungal diversity is maximum in tropical forests where woody angiosperm diversity is also higher (Lodge et al. 1996; Arnold 2001; Gamboa and Bayman 2001; Banerjee 2011). Larger woody perennials may support parasites such as mistletoes and dodders and complex assemblages of epiphytic plants and they may in turn harbor endophytic fungi (Dreyfuss and Petrini 1984; Petrini et al. 1990; Richardson and Currah 1995; Suryanarayanan et al. 2000). Since the tropical and subtropical climate harbours most of the world’s plant diversity, the diversity of endophytic fungi is also higher in this climatic zone as most of the vascular plant species investigated are found to possess endophytic fungi and bacteria (Firakova et al. 2007)
Seen in broader perspective, endophytic fungi are extremely diverse in host plants and are ubiquitous. It is observed that almost every plant examined till date is host to at least one species of endophytic fungus and many plants, particularly woody plants, contain hundreds of endophytic species (Petrini 1986; Petrini et al. 1992; Gaylord et al. 1996; Faeth and Hammon, 1997; Saikkonen et al. 1998; Arnold et al. 2000).
Several efforts have been made to estimate the total number of fungi on the basis of their association with plants (Hawksworth 1991). The magnitude of fungal diversity was estimated to about 1.5 million species, primarily based on a ratio of vascular plants to fungal species of 1:6, later revised by Hawksworth (2001) to 2.27 million. However, the number of fungal species may vary because of availability of modern tools and techniques of identification. Petrini (1991) has indicated that there could be more than 1 million species of endophytic
10
fungi remaining to be discovered. Mishra et al. (2014) have estimated the fungal species diversity as listed in Table 1.
Most of the studies on the endophytic fungi have been carried out in the Northern hemisphere of earth (Petrini 1986; Boddy and Griffith 1989; Petrini 1991). Many studies have also been carried out in sub tropical regions like Argentina (Bertoni and Cabral 1988; Cabral et al. 1993) and New Zealand (Latch et al. 1984; Philipson 1989). 3000 fungal strains belonging to 418 morphospecies from two tree species of Heisteria concinna and Ouratea lucens at Barro Colorado Island have been recovered by Arnold et al. (2000). Petrini and Dreyfuss (1981) and Dreyfuss and Petrini (1984) reported diversity of endophytic fungi belonging to family Araceae, Bromeliaceae and Orchidaceae from French Guiana, Brazil and Columbia (South America). Rodrigues and Samuels (1990) and Rodrigues (1994, 1996) studied the endophytic assemblages of tropical palm tree. Bills and Pollishook (1994), Fisher et al. (1995) and Rodrigues and Dias (1996) have studied the endophytic assemblages of some tropical tree species. There are a few investigations on endophytes from the tropics from Brazil (Rodrigues and Samuels 1999), Barro Colorado Island, Panama (Arnold et al. 2000), Bermuda (Southcott and Johnson 1997), Hong Kong (Brown et al. 1998), Guyana (Cannon and Simmons 2002), Thailand (Bussaban et al. 2001; Photita et al. 2001), England and Switzerland (Fisher and Petrini 1990), China (Huang et al. 2008), Guyana (Cannon and Simmons 2002) and Spain (Collado et al. 2001)
Despite these efforts, it has to be noted that most of the undiscovered fungi are those associated with the tropical plants and the diversity and ecological significance of endophytes in tropical plants are unexplored (Hawksworth 1993; Rodrigues and Petrini 1997).
It has been agreed that detailed investigations of the internal mycobiota of plants frequently lead to novel taxa and reveal new distributions of known species. Since the endophytic infections are inconspicuous, the species diversity of the internal mycobiota is substantially high - both within and among individual host species and since only a small proportion of potential hosts have been examined, endophytes may represent a substantial number of undiscovered fungi (Stone et al. 2000; Arnold et al. 2000).
2.3 Bioprospecting of microbial endophytes and their natural products for various pharmaceutical activities:
Worldwide, there is an increased interest in searching novel bioactive compounds having high effectiveness, low toxicity and negligible environmental impacts. This is due to the fact 11
that in last two decades there is increase in the number of drug resistant bacteria (Menichetti 2005). As reported by Mutnick et al. (2003) and Skiest (2006), many new drugs such as Daptomycin, Linezolid etc. have already acquired resistance. Considering these facts and also considering that the microbes in general have been an abundant source of novel chemo-types and pharmacophores from thousands of years, the search for new drugs/pharmaceutical products from microbial origin has gained tremendous impetus in last two decades. This search is prompted by the development of resistant infectious microorganisms like Mycobacterium, Staphylococcus, Streptococcus etc. to existing bioactive compounds and by the presence of naturally resistant organisms (Strobel and Daisy 2003). The new drugs/pharmaceutical products from microbial origin began to attract the attention of scientific community since the discovery of anticancer drug “Taxol” from Taxomyces andreanae in early 1990’s and Penicillin from Penicillium notatum by W. Flemming in 1928. Both these drugs were isolated from fungi. Natural products offer some extraordinary advantages as sources of biotherapeutics. As per Newman and Cragg (2012), in the years 1981–2010, about 50% of all small molecules had their origin in natural products.
Recently, however, natural-product research has taken backseat in many drug companies and in some cases; it has been entirely replaced by combinational chemistry involving the automated synthesis of small molecules that are structurally related (Bills et al. 2002). It appears that this loss of interest is due to the enormous expenses and efforts that are required to identify a source, isolate active natural products, decipher their structures and begin the long process of product development (Grabley and Thiericke 1999). To add to this, the extraction of natural products leads to depletion of plant population which is undesirable. Further, the production of a plant-based natural drug is always not up to the expected level as it depends on specific developmental stage, specific environmental condition, stress, nutrient availability etc. Microorganisms in general and endophytic fungi in particular come handy because they serve as readily renewable and inexhaustible source of novel compounds. Therefore, worldwide, there is an increased interest in searching novel bioactive compounds having high effectiveness, low toxicity and negligible environmental impacts.
To summarize, it may be said that considering the increased global health concern over the failure of currently used antibiotics to many super resistant strains, indiscriminate exploitation of medicinal plants for extraction of antimicrobial agents of plant origin and limitations of plant resources due to various factors like requirement of land for cultivation, environmental competence of plants, seasonal specificity etc., the search for new and
12
effective antimicrobial agents is becoming a necessity. The role of endophytes assumes importance here. Endophytes are found to be the promising sources of biologically active products which are of interest for specific health care applications (Strobel et al. 2001; Suthep et al. 2004). Endophytic fungal strains are also found to be potentially useful in the production of pigments, bioactive metabolites, immuno-suppressants, anticancer compounds and bio-control agents (Wang et al. 2002; Stinson et al. 2003; Gangadevi and Muthumary 2007).
Endophytes may benefit host plants in several ways which include prevention of pathogenic organisms from colonizing host plants, creation of a ‘Barrier Effect’ by extensive colonization of the host plant tissue and thus outcompeting and preventing pathogens from taking hold in host plant, production of chemicals inhibiting the growth of competitors including pathogens, stimulation to plant growth, modification of biology of plant to enable it to survive in environmental extremes etc. Apart from the benefits to the host plant, the endophytes have also proved as an outstanding source of secondary metabolites and bioactive antimicrobial products.
They have proved to be a significant source of antibacterial, antiviral, antidiabetic, anticancer, antioxidant, antimycotic, anti-inflammatory, antiviral, enzyme inhibitor and immunosuppressive compounds and also source of alkaloids, flavonoids, peptides, phenols, quinones, steroids, terpenoids and aliphatic compounds. Yu et al. (2010) have summarized the examples of the antimicrobial activities of various endophytes as listed in Table 2.
Thus, in last about a decade and half, fungal endophytes have received significant attention for their potential to produce known or novel bioactive compounds. World over, the traditionally used medicinal plants are natural choice for the study of endophytic fungi due to their proved medicinal properties. Various traditionally used medicinal plants are being studied world-wide for their ability to host endophytic fungi having antimicrobial potential. However, being recent development, the endophytes although relatively less studied, are potential sources for novel natural products. Numbers of review articles have been published in the recent past summarizing the importance of endophytic fungi in natural products. A review by Gusman and Vanhaelen (2000) has described secondary metabolites of 38 endophytic fungi and their biological activities. A more comprehensive review was published by Tan and Zou (2001) reporting 138 secondary metabolites of endophytes characterized before the year 2000. Schulz et al.
13
(2002) and Strobel et al. (2003) have published extensive papers dealing primarily with their own work on endophytes. After the comprehensive review by Tan and Zou (2001), 184 metabolites have been characterized from 59 strains of endophytic microorganisms of which 96 are new. Table 3 shows some examples of bioactive products from endophytic fungi as summarized by Gunatilaka (2006).
Premjanu and Jayanthy (2012) have also extensively reviewed the reporting of endophytic fungi from 45 host plants by different researchers. They have also reviewed the bioactive activities and bioactive compounds isolated from endophytic fungi of 30 host plants as reported by different researchers.
Some of the important antimicrobial properties of the endophytic fungi are discussed in the ensuing paragraphs.
2.4 Antibacterial activities of endophytic fungi:
Apart from the reviews mentioned in the foregoing paragraphs, in a more specific review, Deshmukh et al. (2014) have extensively reviewed the antibacterial compounds extracted from endophytic fungi.
Many researchers have reported isolation of various compounds from different endophytic fungi from different host plants exhibiting effective antibacterial potential. These include Phomoxanthone A (Elsaesser et al. 2005), Dicerandrol C (Erbert et al. 2012), Dicerandrol A- C (Lim et al. 2010), Cycloepoxylactone and cycloepoxytriol B (Hussain et al. 2009a), Phomosines A–C (Krohn et al. 1995), Phomosine A and G (Dai et al. 2005), Ambuic acid and derivatives of the same (Ding et al. 2009), Phomopsichalasin (Horn et al. 1995), 4- (2, 4, 7-trioxa-bicyclo [4.1.0] heptan-3-yl) phenol Colletotric acid, artemisinin (Zou et al. 2000), Dicerandrol A, B and C (Wagenaar and Clardy 2001), Phomol (Weber et al. 2004), two Fusarusides (Shu et al. 2004), Fusapyridon A (Tsuchinari et al. 2007), Javanicin (Kornsakulkarn et al. 2011), Fusaric acid (Pan et al. 2011), Rhein (Tegos et al. 2002), Epoxydine B, Epoxydon (Qin et al. 2010), Flavipucine (Loesgen et al. 2011). Zhang et al. (2009) have studied the endophytic fungi of Ilex canariensis and enlisted various compounds found to be effective against E. coli and B. megaterium. The summary of certain studies including extracted compounds, endophytic fungi from which they were isolated, host plants, geographical region if any, bacterial strains against which they showed the inhibitory action and references are enlisted in Table 4.
14
2.5 Antifungal activities of endophytic fungi:
Strobel and Daisy (2003) have highlighted various problems that today’s pharmaceutical industry is facing. These include the appearance of various drug resistant bacteria and viruses, increased instances of infections caused by fungi and patients with transplanted organs facing recurrent infections. Seen against this backdrop, the endophytic fungi are a new hope as many endophytic fungi have antifungal potential.
Research literature has abundant studies showing isolation of compounds from endophytic fungi from different host plants showing effective antifungal potential. These include pentaketide (Brady et al. 2000), Glucoside derivatives – xylarosides (Pongcharoen et al. 2008), T. brevicompactum (Xuping et al. 2014), Cytosporone B and C (Huang et al. 2008), Cryptosporiopsis quercin (Strobel and Daisy 2003), Cryptocin, a tetramic acid (Li et al. 2000). Pseudomycins (Ballio et al. 1994), L. theobromae (Orlandelli et al. 2015), Ambuic acid (Li et al. 2001) etc.
Many researchers have reported that certain endophytic fungi have shown substantial inhibitory activity against certain fungal pathogens. These include Phylotypes lecythophora sp. 1, Lecythophora sp. 2, and Fusarium oxysporum (Rosa et al. 2012), Colletotrichum ovulariopsis, Phomopsis pestalotiopsi and Alternaria (Li H. 2001), Paecilomyces sp. (Huang et al. 2001).
The summary of few such extracted compounds or the endophytic fungi, host plants, fungal strains against which they showed the inhibitory action and references are enlisted in Table 5.
2.6 Anticancer activity of endophytic fungi:
Cancer being one of dreadful disease, the search for effective and low cost anti-cancer agents has been one of the greatest challenges before mankind. Therefore, endophytes are naturally investigated for the anti-cancer properties. Role of many clinically useful compounds derived from plants in the development of anti-cancer agents like vinblastine, vincristine, camptothecin, podophyllotoxin and taxol has been crucial (Chandra 2012). Firakova et al. (2007) has suggested that bioactive compounds derived from endophytic fungi could be an alternative approach for discovery and development of novel anticancer agents.
The first major group of anticancer agents produced by endophytes is Paclitaxel and some of its derivatives. Paclitaxel is found in Yew (Taxus) species. The presence of paclitaxel in
15
Taxus species generated interest in the study of their endophytes. However, Yew trees are very rare; they grow slowly and produce meager quantity of Taxol which results into high price if it is obtained from this tree (Gangadevi and Muthumary 2008). Seen from the point of view of environmental degradation, the exclusive use of plant source has actually led to destruction of Yew trees as well as limiting the supply of Paclitaxel. Therefore investigation of alternative sources for Taxol production has assumed significance. Taxomyces andreanae – an endophyte producing Taxol has been isolated and it has opened a new vista to obtain a cheaper product via microorganism fermentation (Stierle et al. 1993). Further investigations have led to discovery of Taxol in many fungal endophytes either related to Yew trees or not associated with it, such as Wollemia nobilis (Strobel et al. 1997), Taxodium distichum (Li et al. 1996), Bartalinia robillardoides (Gangadevi and Muthumary 2008), phyllosticta spinarum (Kumaran et al. 2008), Botryodiplodia theobromae (Pandi et al. 2010), Pestalotiopsis terminaliae (Gangadevi and Muthumary 2009), Tubercularia sp. (Wang et al. 2000), Sporormia minima and Trichothecium sp. (Shrestha 2001).
An important anticancer compound – an alkaloid Campthothecin is an important antineoplastic agent isolated from the wood of Campthotheca acuminate in China (Wall et al. 1966). Ergoflavin, a compound from class ergochromes is a new anticancer agent that is isolated from an endophytic fungi isolated from Mimusops elengi (Deshmukh et al. 2009). Podophyllotoxin producing endophytic fungi Trametes hirsute has shown promising anticancer properties (Puri et al. 2006). Secalonic acid D isolated from the mangrove endophytic fungus has shown potent anticancer activities (Zhang et al. 2009).
The other endophytic fungi or compounds showing anti-cancer or anti-tumor properties include Aspergillus fumigates Fresenius isolated from Juniperus communis (Kusari et al. 2009b), Torreyanic acid isolated from endophyte P. microsporastrain derived from T. Taxifolia (Florida torreya) (Lee J. C. et al. 1995), three novel cytochalasins from endophyte Rhinocladiella (Wagennar et al. 2000), microorganisms from the genus Streptomyces (Li et al. 2008c) etc.
2.7 Antiviral activity of endophytic fungi:
Inhibition of viruses is one of the important properties of antimicrobial products from endophytic fungi. Guo et al. (2000) have reported that cytonic acids A and B are derived from endophytic fungus Cytonaema sp. and they are human cytomegalovirus protease inhibitors. An unidentified tree in Jianfeng Mountain area of China has yielded an endophytic
16
fungus Pestalotiopsis theae which has shown capability to produce anti-HIV agent Pestalotheol C (Li et al. 2008b). However, there is huge potential for the discovery of novel anti-viral compounds from endophytes and the same needs to be explored by investigators and pharmaceutical entities.
2.8 Diversity and studies of endophytic fungi in India: India has extremely rich biodiversity and many unique features in respect of biodiversity. Hence India offers huge scope for fungal diversity as well.
Chowdhary et al. (2012) have summarized the various studies carried out by Indian mycologists to study endophytic fungi. They have cited total 108 studies with respect to different medicinal plants of India.
Some salient features of studies of endophytic fungi in India are –
1) There is a remarkable geographical concentration of studies of endophytic fungi in India. The most studied part is Western Ghats. The obvious reasons for concentration of studies in this area are its rich biodiversity as well as ecological significance. This region has been declared as an “Eco-sensitive region” by various Environment and Forest related statutes. Owing to this, researchers have selected the highest numbers of medicinal plant hosts from Western Ghats. Few studies that can be listed in this respect are –
i) Endophytic fungi of five medicinal plants from Kudremukh Range - a tropical wet evergreen type of forest in Western Ghats of India (Raviraja 2005) ii) Endophytic fungi in woody perennial trees of the Western Ghats in south India (Suryanarayanan et al. 2011) iii) Endophytic fungi in tropical forest plants across a rainfall gradient (Suryanarayanan et al. 2002) iv) Endophytic fungal diversity in shrubby medicinal plants of Malnad region in Western Ghats (Naik 2008) After Western Ghats, the most studied region in respect of endophytic fungi in India is coastal zone and especially Western coast mangroves. Endophytic fungal association of mangrove plants ensures their protection from adverse conditions and helps them to successfully compete with saprobic fungi (Suryanarayanan and Kumaresan 2000). Inter alia, few studies in this respect include endophytes in mangrove community (Kumaresan and Suryanarayanan 2001), endophytes of certain halophytes from an estuarine mangrove
17
forest (Suryanarayanan and Kumaresan 2000), and endophytic fungi of some sand dune plants of western coast (Beena et al. 2000). Some other geographically specific studies include those involving endophytic fungi in some medicinal herbs of south India (Rajagopal et al. 2010), Malnad region of South India (Krishnamurthy et al. 2008), tropical seagrass (Devarajan et al. 2002)
2) There is tendency among the Indian researchers to select plants mainly based on availability and vicinity of host plants around their work place. This may be attributed to the convenience as well as limited funding. Examples of such studies are abundant e.g. study related to Tylophora indica from Delhi (Kumar and Kaushik 2010), study of local medicinal plants of Varanasi (Kharwar et al. 2008; Verma 2006), study of Ocimum sanctum from Amritsar (Bhagat et al. 2012) etc.
3) The general survey of the investigations reveal that about a decade back, the studies mainly revolved round the biodiversity, ecological studies and distribution of endophytic assemblages. This focus gradually shifted to bioactivities of endophytic fungi and now the studies of antimicrobial activity of endophytic fungi is assuming significant importance in scientific field. However study of bioactive metabolites isolated from endophytic fungi is still limited.
4) Chowdhary et al. (2012) have summarized the genus of endophytic fungi among 110 medicinal plants investigated. It has been concluded that Phomopsis is the most dominant genus isolated from Indian medicinal plants. It is followed by Colletotrichum, Alternaria, Chaetomium, Phyllosticta respectively (Chowdhary et al. 2012). These genus are reservoir of unique and novel metabolites like cytochalasins (Fu et al. 2011), antibacterial phomosines A - D (Krohn et al. 2011), phomotenone – a cyclopentenone derivative and phomochromone A, B (Ahmed et al. 2011) etc.
5) Despite the limitations mentioned in the preceding paragraphs, Indian researchers have made some strides in isolation of some bioactive metabolites from Indian medicinal plants. Some important examples in this respect are - ergoflavin - a pigment showing anticancer and anti-inflammatory activity from an endophytic fungus isolated from the leaves of Mimosops elengi (Deshmukh et al. 2009); Javanicin from Chloridium sp. (Kharwar et al. 2011); Taxol from Gliocladium sp. (Sreekanth et al. 2009); 10-deacteylbaccatin III from Gliocladium sp. (Sreekanth et al.2009); Camptothecin, 10-Hdroxycamptothecin and 9-
18
Methoxycamptothecin from Enterophospora infrequens (Puri et al. 2005). However, the efforts of isolation and purification of compounds from endophytic fungi from Indian medicinal plants are still few.
Despite these achievements, the literature survey reveals that the studies on endophytic fungi in India are very meager as compared to other tropical countries.
2.9 Fungal endophytes from medicinal plants with reference to India:
Medicinal plants are natural choice for the study of endophytic fungi due to proved medicinal properties. Accordingly, medicinal plants have been given due attention in the research related to endophytic fungi. The study varies from endophytic diversity, distribution to isolation of secondary metabolites. A number of medicinal plants have been screened in other regions of world for endophytes (Stierle et al. 1993; Strobel and Daisy 2003; Suthep et al. 2004). In respect of India, some of the studies can be summarily listed as in Table 6.
It is now pertinent to discuss the three specific medicinal plants i.e. Ocimum sanctum, Vitex negundo and Barleria prionitis.
2.10 Therapeutic properties and endophytic fungi of Ocimum sanctum:
Therapeutic use of plants dates back to about 4000–5000 B.C in India. Rig-Veda (3500– 1600 B.C.) contains the earliest references to medicinal plants. A very detail study of the characteristics and therapeutic uses of plants with medicinal properties was made by the ancient physicians and it has been recorded in Indian indigenous system of medicine – ‘Ayurveda’. Traditionally medical practitioners in India have been extensively using this medicinal plant for treatment and management of many diseases. Last few decades have seen lots of studies by scientists and researchers that point to an important role of eugenol in medicinal properties of Ocimum sanctum L.
Ocimum sanctum L. (Lamiaceae) is traditionally used as medicine to cure cough, fever, bronchitis and other diseases of lungs. Extensive studies on experimental and clinical level prove that Tulsi possesses anti-stress/adathogenic, antioxidant, immunomodulatery and antiradiation properties. It plays a major role in prevention and treatment of cancer (Singh et al. 2012). It also possesses some essential oils which have shown good antimicrobial activity against enteric bacteria and yeast (Dey et al. 1984). Tulsi exhibits rejuvenating properties like antiseptic and anti-allergic effects (Godhwani et al. 1988). ‘Eugenol’ present in Ocimum sanctum L. is mainly
19
responsible for its therapeutic properties (Ranga et al. 2005). Banerjee et al. (2009) studied three medicinal plants and reported that leaves of Ocimum sanctum were colonized by the most number of endophytic fungi. The literature review in this regard reveals that various species of Tulsi are found to possess anti-bacterial, anti-viral, anti-tussive, anti-diabetic, anti- cancer, anti-allergic and anti-septic properties. They are found to be effective against wide range of microorganisms like Klebsiella, S. typhi, E. coli, P. pyocyaneus, S. dysenteriae, P. vulgaris, V. cholerae, DNA viruses, Bovine herpes virus -1, R. solani S. sclerotiorum, F. oxysporum, B. cinerea, M. smegmatis etc. Ocimum sanctum is indicated to possess anti- hyperlipidemic, antifertility, immunomodulatory, stress relieving and analgesic properties. Kadian and Parle (2012) have summarized phytochemicals present in Ocimum sanctum as well as medicinal properties of it as given in Table 7 and Table 8. Chowdhary et al. (2012) have extensively reviewed the endophytic fungi and secondary metabolites extracted from them in respect of Indian medicinal plants. They have cited total 108 studies with respect to different medicinal plants of India. In respect of Ocimum sanctum, they have reported endophytic fungi Alternaria sp., Phoma sojicola and colletotrichum sp. showing potential for antihyperlipidemic, cardioprotective, cytotoxic and antibacterial activity along with biodiesel feedstock potential.
Essential oils from Ocimum sp. containing eugenol, carvacol, caryophyllene etc. are considered to be responsible for various antimicrobial properties. The antitussive effect is believed to be due to both opioidsystem as well as GABA-ergic system and due to Ursolic acid. Some studies in respect of antimicrobial potential of Ocimum sanctum are tabulated in Table 9.
2.11 Therapeutic properties and endophytic fungi of Vitex negundo:
Vitex negundo has been used traditionally to treat various acute and chronic diseases. It is popularly known as Nirgundi. It belongs to the family Verbenaceae. Vitex negundo is native to India and Philippines. It is also present in England as exotic species. It is also cultivated in other countries of Asia and in West Indies and Europe.
Lubna et al. (2015) have summarized the use of Vitex negundo in various traditional systems of medicine and ethanobotanical uses of Vitex negundo in different states of India as listed in Table 10. Nirgundi plant is reported to possess many wide ranging pharmacological properties such as antibacterial, antioxidant, anti-inflammatory, hepatoprotective, analgesic, anti-convulsant, memory enhancer and anti-HIV. The volatile oils obtained from various
20
parts of Vitex negundo are reported to have been possessing antibacterial activity. Ladda and Magdum (2012) have listed all important chemical constituents responsible for the antibacterial potential of Vitex negundo.
Huang (2011) studied Diversity of the endophytic fungi from Vitex negundo Var. cannabifolia and Vitex negundo and their secondary metabolites. It has been reported that a total of 1341 endophytic fungi were isolated from these two plant species. It has been reported in the same study that large number of strains induced morphological abnormality of Pyricularia oryza and many showed significant antifungal potential and antitumor activities.
Sunayana et al. (2014) studied diversity of the endophytic fungi of Vitex negundo. It has been reported that from a total of 1350 plant segments, 143 endophytic fungi were isolated with Lasiodiplodia sp. viz. L. crassispora, L. pseudotheobromae and L. theobromae being most frequently isolated and Aspergillus flavus, A. niger, Colletotrichum gloeosporioides, Fusarium oxysporum being others.
Raviraja et al. (2006) carried out the antimicrobial evaluation of endophytic fungi harbored in 8 medicinal plants in Western Ghats of India including Vitex negundo. It has been reported that endophytic fungi Papulospora sp. showed considerable activity against P. aeruginosa, S. typhi, Enterococcus sp. and S. aureus.
Kamruzzaman et al. (2013) have reported that methanol extract of Vitex negundo leaves possess potent bactericidal activity against diverse multidrug resistant enteric bacterial pathogens. Prabha Palanichamy et al. (2014) studied the endophytic fungi isolated from the leaves of Vitex negundo, Ocimum basalicum, Justicia jenderusa, Glycosmis pentophylla and Costus spictus and screened them for antimicrobial activity. It has been reported that isolate of Pestolopsis sp. exhibited very significant antibacterial activity against Salmonella typhi.
A Study by Jeyaseelan et al. (2010) established that Pseudomonas solanacearum and Xanthomonas axonopodis pv. citri are effectively inhibited by ethyl acetate extract of flower of Vitex negundo. Tenguria and Firodiya (2015) studied 10 diverse plant species samples from central region of Madhya Pradesh that included Vitex negundo. Out of total 492 isolates obtained from all plants, 42 were from Vitex negundo. A total of seven genera such as Fusarium, Aspergillus, Paecilomyces, Cladosporium, Sporobolomyces sp., Alternaria sp. and Penicillium sp. were isolated from leaves of Vitex negundo.
21
Panda et al. (2009) carried out the study of antibacterial effect of five different polarity solvent extracts of Vitex negundo. It has been reported that all the extracts showed good antibacterial activity. Rose and Catharine (2011) have concluded that the ethanolic leaf extracts of Vitex negundo possess the spectrum to inhibit the growth of Salmonella paratyphi.
2.12 Therapeutic properties and endophytic fungi of Barleria prionitis:
Barleria prionitis is well known for its medicinal value from ancient time. In traditional system of medicine in India, Barleria prionitis is used for treatment of ailments and conditions like migraine, haemoptysis, oedema, internal abscesses, urethral discharges, seminal disorders, gout and arthritis, prevention of graying of hair, rheumatic affections, dysurea, nervine disorders, chronic sinusitis, leprosy, skin diseases, some neurological disorders like sciatica, paraplegia etc. (Banerjee et al. 2012; Khare 2004).
The use of extracts of different plant parts of Barleria prionitis has also been reported to be effective in ailments and conditions like fever, stomach ulcer disorders, urinary affections, catarrhal affections, pimples, lacerated soles of feet, toothache, piles, inflammations, gastrointestinal disorders, glandular swellings, boils, urinary infection, hepatic obstruction, jaundice etc. (Khare 2007; Aneja et al. 2010; Khadse and Kakde 2011). Talukdar et al. (2015) have summarized the traditional medicinal uses of Barleria prionitis as in Table 11.
The review of literature in respect of Barleria prionitis also reveals that it possesses anti- bacterial, anti-viral and anti-fungal properties. Some studies in respect of therapeutic potential of Barleria prionitis are tabulated in Table 12. Apart from those listed in Table 12, many studies have reported various other activities of isolates from B. prionitis such as anthelmintic activity, antifertility activity, antioxidant activity, antidiabetic activity, enzyme inhibitory effects, anti-inflammatory activity, anti-arthritic activity, cytoprotective activity, hepatoprotective activity, diuretic effect, anti-nociceptive activity and anti-diarrheal activity. However, it has been revealed that while substantial studies have been carried out in respect of the antipathogenic potential of Barleria prionitis, there is hardly any investigation carried out in respect of the endophytic fungi of Barleria prionitis.
22
Table 1: Reported estimates of fungal species diversity*.
Number of fungal species Reference 27,00,000 Pascoe IG (1990) 16,20,000 Hawksworth DL (1991) 10,00,000 Hammond PM (1992) 10,00,000 Rossman AY (1994) 15,00,000 Hammond PM (1992) 99,00,000 Cannon PF (1997) 15,00,000 Frohlich J, Hyde KD (1999) 22,70,000 Hawksworth DL(2001) 5,00,000 May RM (2000) 35,00,000-51,00,000 O'Brien HE et al. (2005) 7,12,000 Schmit JP, Mueller G (2007) 6,11,000 (± SE = 2,97,000) Mora C et al. 2011 * Mishra Y. et al. (2014)
23
Table 2: Examples of the endophytic activities against microbes**.
Types of antimicrobial Host plant Endophyte/s Test microbes Reference compounds
Excoecaria agallocha Phomopsis sp. Candida albicans and Fusarium oxysporum Huang et al. (2008)
Ginkgo biloba Chaetomium globosum Mucor miehei Qin et al. (2009) Aliphatic Trichophyton rubrum, Candida albicans, compounds
Quercus variabilis Cladosporium sp. Aspergillus niger, Epidermophyton floccosum, Wang et al. (2006) Microsporum canis
Garcinia dulcis Phomopsis sp. Mycobacterium tuberculosis Rukachaisirikul et al. (2008)
Alkaloids Ginkgo biloba Chaetomium globosum Mucor miehei Qin et al. (2009) Maize Acremonium zeae Aspergillus flavus, Fusarium verticillioides Wicklow et al. (2005) Bacillus megaterium, Microbotryum violaceum,
Flavonoids Juniperus cedre Nodulisporium sp. Dai et al. (2006) Septoria tritici, Chlorella fusca
Acrostichum aureurm Penicillium sp. Staphylococcus aureus, Candida albicans Cui et al. (2008) Pinus sylvestrisand Fagus Cryptosporiopsis sp.,
Peptides Yeasts Noble et al. (1991) sylvatica Pezicula sp.
Tripterigium wiflordii Cryptosporiopsis quercina Candida albicans Strobel et al. (1999)
24
Table 2 Contd.
Types of antimicrobial Host plant Endophyte Test microbes Reference compounds Tropical tree and vine
Peptides species in several of the Muscodor albus Candida albicans Strobel et al. (1999) world’s rainforests
Cerbera manghas Penicillium sp. Staphylococcus aureus Han et al. (2008)
Saurauia scaberrinae Phoma species Staphylococcus aureus Hoffman et al. (2008) Phenols Fusarium culmorum, Gibberella zeae and Verticillium
Unidentified Pestalotiopsis adusta Li et al. (2008) aiboatrum Phythophtora capsici, Phythophtora parasitica,
Callicarpa acuminata Edenia gomezpompae Macías-Rubalcava et al. (2008) Fusarium oxysporum and Alternaria solani Fusarium culmorum, Gibberella zeae and Verticillium
Quinones Unidentified Pestalotiopsis adusta Li et al. (2008) aiboatrum Staphylococcus aureus, Staphylococcus epidermidis
Urospermum picroides Ampelomyces sp. Aly et al. (2010) and Enterococcus faecalis Steroids Phytophthora capisici, Rhizoctonia cerealis,
Artemisia annua Colletotrichum sp. Gaeumannomyces graminis var. tritici and Lu et al. (2000) Helminthosporium sativum.
25
Table 2 Contd.
Types of antimicrobial Host plant Endophyte Test microbes Reference compounds Bacillus megaterium, Microbotryum violaceum, Septoria tritici,
Steroids Juniperus cedre Nodulisporium sp. Dai et al. (2006) Chlorella fusca
Cassia spectabilis Phomopis cassiae Cladosporium sphaerospermum and Cladosporium cladosporioides Silva et al. (2006) Daphnopsis
Not identified Staphylococcus aureus and Enterococcus faecalis Brady et al. (2001) americana Terpenoids Daphnopsis
Not mentioned Staphylococcus aureus and Enterococcus faecalis Brady et al. (2000) Americana Bacillus subtilis, Staphylococcus aureus, Klebsiella pneumoniae and
Taxus cuspidate Periconia sp. Kim et al. (2004) Salmonella typhimurium **Yu et al. 2010
26
Table 3: Natural Products of Endophytic Microorganisms.#
Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Acremonium zeae (NRRL 13540) Zea maydis L. (maize) (Poaceae); kernel Whole maize kernel in Pyrrocidine A (106a) Antibacterial; antifungal (mitosporic Hypocreales) d. H2O; 25 °C; 30 days Pyrrocidine B (106b) Aspergillus clavatus strain H-037 Taxus mairei (Lemée and Lév.) PDA; 25 °C; 7 days Brefeldin A (10) Antifungal; antiviral; anticancer; weed (Trichocomaceae) and Torreya grandis Arn. (Taxaceae); bark management Aspergillus fumigatus CY018 Cynodon dactylon (L.) Pers. (Poaceae); Millet medium (solid); Asperfumoid (89)* Antifungal; mycotoxin antifungal; (Trichocomaceae) leaf 28 °C; 35 days Asperfumin (37c)* mycotoxin Monomethylsulochrin (37b) Fumigaclavine C (91) Fumitremorgin C (92) Physcion (40a) Ergosterol (68) Helvolic acid (67) 5α,8α-epidioxyergosterol (69) Cyclo (Ala-Leu) (110e) Cyclo (Ala-Ile) (110f) Aspergillus niger IFB-E003 Cynodon dactylon (L.) Pers. (Poaceae); Millet-bran medium Rubrofusarin B (47) Cytotoxic; xanthine oxidase inhibitor (Trichocomaceae) leaf (solid); 28 °C; 30 days Fonsecinone A (48) antifungal; xanthine oxidase inhibitor Aurasperone A (49) Asperpyrone B (50) Aspergillus parasiticus RDWD1-2 Sequoia sempervirens (D. Don) Endl. DIFCO mycological Sequoiatone C (84a)* Toxic to brine shrimp (Trichocomaceae) (Taxodiaceae); bark broth; 19 days; Sequoiatone D (84b)* Toxic to brine shrimp mycelial extract Sequoiatone E (84c)* Toxic to brine shrimp Sequoiatone F (84d)* Toxic to brine shrimp DIFCO mycological Sequoiamonascin A (85a)* Toxic to brine shrimp; cytotoxic broth; 21 days; Sequoiamonascin B (85b)* Toxic to brine shrimp; cytotoxic mycelial extract Sequoiamonascin C (86)* Toxic to brine shrimp Sequoiamonascin D (87)* Toxic to brine shrimp Aspergillus sp. (Strain #CY725) Cynodon dactylon (L.) Pers. (Poaceae); PDB; 28 °C; 4 days Monomethylsulochrin (37b) Antibacterial; eosinophil inhibitor (Trichocomaceae) leaf Helvolic acid (67) antibacterial Ergosterol (68) 5α,8α-epidioxyergosterol (69)
27
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Botrytis sp. (Sclerotiniaceae) Taxus brevifolia Nutt. (Taxaceae); bark DIFCO mycological Ramulosin (34a) Antibiotic broth; still culture; 21 6-hydroxyramulosin (34b) Antibiotic days 8-dihydroramulosin (34c)* Antibiotic Cephalosporium sp. IFB-E001 Trachelospermum jasminoidesLemoire Millet-bran (solid) Graphislactone A (23) Antioxidant; free radical scavenger (mitosporic Hypocreales) (Apocynaceae); vine medium; 28 °C; 30 days Cephalosporium sp. (mitosporic Dendrobium nobile Sw. (Orchidaceae); Wheat bran (liquid) Ergosterol (68) Hypocreales) root medium; 25°C; 7 days Cyclo (Gly-Val) (110a) Butanedioic acid Choline sulfate 2-[2-(hydroxyl-tetracosanoyl) amino]-1,3,4-octadecatriol Leucine d-mannitol Meso-erythritol Pyridine-3-carboxylic acid α-stearin Uracil Ceratopycnidium Baccharis cordifolia L. (Asteraceae); stem YES medium; Myro Rodicins Toxic to livestock baccharidicola(Ascomycetes, and leaf medium; rice solid Verrucarins Toxic to livestock Incerte sedis) medium; 24–27°C; 30 days Chaetomium chiversii CS-36-62 Ephedra fasciculata A. Nels PDA; 27°C; 14 days Radicicol (30b) Cytotoxic; Hsp90 inhibitor (Chaetomiaceae) (Ephedraceae); stem Chaetomium Ephedra fasciculata A. Nels PDB; 26 °C; 15 days Orsellinic acid (17a) Cytotoxic Globosum(Chaetomiaceae) (Ephedraceae); stem Globosumone A (17b)* Cytotoxic Globosumone B (17c)* Globosumone C (17d)* Trichodion (80) Orcinol Colletotrichum sp. strain EG4 Ginkgo biloba L. (Ginkgoaceae); leaf PDB; 28 °C; 6 days Flavone-like compounds (Phyllachoraceae)
28
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Cladosporium herbarum IFB-E002 Cynodon dactylon (L.) Pers. (Poaceae); Millet-bran medium; 28 Aspernigrin A (88) Cytotoxic; xanthine (Mycosphaerellaceae) leaf °C; 35 days Rubrofusarin B (47) Oxidase inhibitor Fonsecinone A (49) Plant growth inhibitor 3α,5α ,6β-trihydroxyergosta-7,22-Diene (70) 7-hydroxy-4-methoxy-5-Methylcoumarin (51a) Orlandin (52a) Kotanin (52b)
Cytospora sp. CR 200 (Valsaceae) Conocarpus erecta L. (Combretaceae); PDB Cytosporone A (26a)* Antifungal; cytotoxic stem Cytosporone B (26b)* antibacterial Cytosporone C (27a)* Cytosporone D (27b)* Cytosporone E (28)* Cytoskyrin A (41)* Cytoskyrin B (42)*
Diaporthe sp. CR 146 (Valsaceae) Forsteronia spicata G. Meyer PDB Cytosporone A (26a) Antifungal; cytotoxic (Apocynaceae); stem Cytosporone B (26b) antibacterial Cytosporone C (27a) Cytosporone D (27b) Cytosporone E (28)
Dothiorella sp. strain HTF3 Aegiceras corniculatumGaertner. PDB; 25 °C; 7 days Cytosporone B (26b) Antifungal; cytotoxic (Botryosphaeriaceae) (Myrsinaceae) (Mangrove); bark Dothiorelone A (26c)* Cytotoxic Dothiorelone B (26d)* Cytotoxic Dothiorelone C (26e)* Cytotoxic Dothiorelone D (27c)* Cytotoxic
Eupenicillium sp. Murraya paniculata (L.) Jack (Rutaceae); White-corn medium; 20 Alanditrypinone (96)* (Trichocomaceae) leaf days Alantryphenone (97)* Alantrypinene (98)* Alantryleunone (99)*
Fusarium oxysporum strain 97CG3 Catharanthus roseus (L.) G. Don Mineral medium; 25 Vincristine Anticancer (mitosporic Hypocreales) (Apocynaceae); inner bark °C; 3-4 days
29
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Fusarium sp. IFB-121 (mitosporic Quercus variabilis L. (Fagaceae); bark PDB; 28 °C; 6 days Cerebroside 4a Antibacterial; xanthine Hypocreales) Fusaruside (4b)* Oxidase inhibitor Antibacterial; xanthine Oxidase inhibitor Fusidium sp. (Mitosporic fungi) Mentha avensis L. (Lamiaceae); leaf Biomalt semi-solid Fusidilactone A (11a)* agar; or liquid biomalt; Fusidilactone B (11b)* 20 °C; 11 days Fusidilactone C (12)* Cis-4-hydroxy-6-deoxyscytalone (79) Guignardia sp. Spondias mombin L. (Anacardiaceae); leaf Malt-peptone-glucose (–)-(S)-guignardic acid (72)* (Botryosphaeriaceae) broth; 14 days Hormonema sp. ATCC 74360 Juniperus communis L. (Cupressaceae); Brown rice yeast solid Enfumafungin (66)* Antifungal (Dothioraceae) leaf medium; 25 °C; 21 days Leptosphaeria sp. strain IV403 Artemisia annua L. (Asteraceae); stem PDB; 28 °C; 10 days Leptosphaeric acid (57)* (Leptosphaeriaceae) Leptosphaerone (82)* Melanconium Betula pendula Roth; B. pubescens Ehrh. YMG medium; 22 °C; 3-hydroxypropionic acid Nematocidal betulinium(Melanconidaceae) (Betulaceae); above-ground parts until carbon source completely consumed Microsphaeropsis Pilgerodendron uviferum (D. Don) Florine Rice medium; 25 °C; 7-hydroxy-2,4-dimethyl-3(2H)- Acetylcholinesterase (AChE) olivacea(mitosporic Ascomycota) (Cupressaceae) [Gymnosperm]; phloem 30 days Benzofuranone (20a)* inhibitor Enalin (20b) Acetylcholinestase (AChE) Graphislactone A (23) inhibitor Botrallin (24) Ulocladol (25) 2,5-diacetylphenol Butyrolactone I (73) Microsphaeropsis sp. strain NRRL Buxus sempervirens L. (Buxaceae); leaf SL medium; 24 °C; 13 Lactone S 39163/F-I (83)* Antimicrobial; antiviral 15684 (mitosporic Ascomycota) days Monochaetia Several rain forest plants; leaf, stem, M1D medium Ambuic acid (75)* Antimycotic sp.(Amphisphaeriaceae) petiole supplemented with soytone; 23–24 °C; 21 days Muscodor albus (mitosporic Cinnamomum zeylanicum Schaelter. PDA Volatile antibiotics Antibiotic Xylariales) (Lauraceae); stem
30
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Mycelia sterila strain 4567 Cirsium arvense (Canadian thistle) Malt-soya and biomalt 3-acetyl-6-hydroxy-4-methyl-2,3- (Ascomycota) (Asteraceae); ns semisolid agar; 130 dihydrobenzofuran* days 3-(3′,5′-dihydroxy-2′-methylphenyl)-2- butanone (19a)* 4-acetyl-3,4-dihydro-6,8-dihydroxy-5- methylisocoumarin (31b) 4-acetyl-3,4-dihydro-6,8-dihydroxy-3- methoxy-5-methylisocoumarin (31c)* 3,4-dihydro-3,6,8-trihydroxy-3,5- dimethylisocoumarin (31d)* 6,8-diacetoxy-3,5-Dimethylisocoumarin (32d) Mycelia sterilia (Ascomycota) Atropa belladonna L. (Solanaceae); root Malt-soya and biomalt Preussomerin G (43a) Antibacterial; antifungal; FPTase semisolid agar; RT; 70 Preussomerin H (43b) inhibitor days Preussomerin I (43c) Antibacterial; antifungal Preussomerin J (43d)* Antibacterial; antifungal Preussomerin K (43e)* Antibacterial; antifungal Preussomerin L (44)* Antibacterial; antifungal Antibacterial; antifungal Nectria galligena (Nectriaceae) Malus × domestica Borkch (apple) MGP medium; 24 °C; Colletorin B (76a) Acetylcholinesterase (AChE) (Rosaceae); xylem until all glucose Colletochlorin B (76b) inhibitor; consumed Ilicicolin C (77a) β-glucuronidase inhibitor Ilicicolin E (77b) antibacterial; AChE inhibitor; Ilicicolin F (77c) β-glucuronidase inhibitor α,β-dehydrocurvularin (29b) antibacterial; AChE inhibitor; β- glucuronidase inhibitor cytotoxic; Seed germination radicle and epicotyl growth inhibitor Nodulisporium sp. MF 5954, Bontia daphnoides L. (Scrophulariaceae); Nutrient medium; 25 Nodulisporic acid A (94) Insecticidal ATCC 74245 (microsporic wood °C; 21–28 days Nodulisporic acid A1 (95a)* Insecticidal Xylariales) Nodulisporic acid A2 (95b)* Paecilomyces sp. H-036 and W- Taxus mairei (Lemée and Lév) PDA; 25 °C; 7 days Brefeldin A (10) Antifungal; antiviral; anticancer; 001 (Trichocomaceae) and Torreya grandis Arn. (Taxaceae); bark weed Management Penicillium implicatum (isolate Diphylleia sinensis H. L. Li MM medium; 28 °C; 6 Substance analogous to podophyllotoxin Anticancer SJ21) (Trichocomaceae) (Berberidaceae); root; rhizome, petiole days
31
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Penicillium Prumnopitys andina (Endl.) Laubenf. PDB: 25°C; 23 days Peniprequinolone (90) nematicidal; root growth janczewskii(Trichocomaceae) (Podocarpaceae); phloem Gliovictin (111) accelerator; weakly cytotoxic Mellein (31a) antibacterial; antiviral; phytotoxic Periconia sp. OBW-15 Taxus cuspidata Siebold and Zucc. S-7 (liquid) medium Periconicin A (65a)* Antimycotic; hypocotyl (Halosphaeriaceae) (Taxaceae); inner bark (still culture); 25 °C; 21 Periconicin B (65b)* elongation and root growth days inhibitor; root growth accelerator (at low conc.) hypocotyl elongation and root growth inhibitor; root growth accelerator (at low conc.) Pestalotiopsis Fragraea bodenii Thunb. (Gentianaceae); M1D agar medium; 23 Jesterone (74a)* Antifungal; antimycotic jesteri(Amphisphaeriaceae) inner bark °C; 21 days Hydroxyjesterone (74b)* Pestalotiopsis Terminalia morobensis L. M1D medium (still Pestacin (21)* Antimycotic; antioxidant microspora(Amphisphaeriaceae) (Combretaceae); stem culture); 23°C; 21 days Isopestacin (22)* Antifungal; antioxidant M1D medium (still culture); 23 °C; 35 days Pestalotiopsis sp. Several rain forest plants; leaf, stem, M1D medium Ambuic acid (75)* Antimycotic (Amphisphaeriaceae) petiole (supplemented with soytone); 23–24 °C; 21 days Phomopsis phaseoli (Valsaceae) Tropical tree; leaf YMG medium; 22 °C; 3-hydroxypropionic acid Nematicidal until carbon source completely consumed Phomopsis sp. (Valsaceae) Erythrina crista-galli L. (Fabaceae); twig KGA medium; RT; 39 Phomol (5)* Antibacterial; antifungal; anti- (dead) days inflammatory (mouse ear edema assay); weakly cytotoxic Phyllosticta Temperate and tropical wood trees; leaf PDA (2% Bactoagar); Melanin capitalensis(telemorph Guignardia 26 °C; 10 days mangiferae) (Botryosphaeriaceae)
Streptomyces sp. NRRL 30562 Kennedia nigricans Lindley (Fabaceae); PDB still culture; 23 Munumbacins A–D (peptides)* Antibiotic (Streptomycetaceae) stem °C; 21 days
32
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Unidentified fungus No. 1893 Kandelia candel (DC) Wight and Arn. GYT broth; 30 °C; 5–7 Lactone 1893 A (7)* (Rhizophoraceae); dropper days Lactone 1893 B (8)* Cyclo (Phe-Gly) (110b) Cyclo (Ser-Leu) (110g) 5 -(p-hydroxybenzyl)hydantoin Pseudomassaria sp. ATCC 74411 Unidentified plant (collected near WBE broth; 25 °C; 21 Demethylasterriquinone B1 (DMAQ-B1) Insulin receptor activator (Hyponectriaceae) Kinshasa, Democratic Republic of Congo); days (100c)* leaf Asterriquinone 100d Asterriquinone 100e [Oxidation product (103)] [Oxidation product (104)] [Decomposition product (105)] Rhizoctonia sp. Cy064 (mitosporic Cynodon dactylon (L.) Pers. (Poaceae); Grain-bran-yeast Rhizoctonic acid (37a)* Weakly antibacterial Hymemomycetes) leaf medium; 28 °C; 40 Monomethylsulochrin (37b) Weakly antibacterial days Ergosterol (68) Weakly antibacterial 3β,5α,6β-trihydroxergosta-7,22-diene (70) Weakly antibacterial Serratia marcescens MSU-97 Rhyncholacis penicillata Tul. PD-soytone-yeast (–)-oocydin A (9)* Antifungal (Enterobacteriaceae) (Podostemaceae); ns extract medium; 23 °C; 15 days Streptomyces griseus subsp. (strain Kandelia candel (L.) Druce Medium 1; 28 °C; 5 7-(4-aminophenyl)-2,4-dimethyl-7-oxo-hept- HKI0412) (Streptomycetaceae) (Rhizophoraceae) [Mangrove]; stem days 5-enoic acid (71a)* 9-(4-aminophenyl)-7-hydroxy-2,4,6- trimethyl-9-oxo-non-2-enoic acid (71b)* 12-(4-aminophenyl)-10-hydroxy-6-(1- hydroxyethyl)-7,9-dimethyl-12-oxo-dodeca- 2,4-dienoic acid (71c)* Streptomyces sp. NRRL 30566 Grevillea pteridifolia J. Knight DIFCO nutrient broth; Kakadumycin A (peptide)* Antibiotic (Streptomycetaceae) (Proteaceae); stem 25 °C; 3 days Streptomyces sp. MSU-2110 Monstera sp. (Araceae); stem PSNB medium, still Coronamycin (peptide)* Antibiotic (Streptomycetaceae) culture; 25 °C; 21–28 days
33
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Scytalidium sp. (mitosporic Salix sp. (Salicaceae); leaf Malt-soya and biomalt 4,6-dihydroxy-3-methyl-2-(2-Oxopropionyl)- Ascomycota) semi-solid agar; RT; benzoic acid (19b)* 111 days 2-(1 -acetyl-2-hydroxyvinyl)-4,4-Dihydroxy- 3-methylbenzoic acid (19c)* 4-acetyl-3,4-dihydro-6,8-dihydroxy-5- methylisocoumarin (31c) 4-acetyl-3,4-dihydro-6,8-dihydroxy-3- methoxy-5-methylisocoumarin (31d) Decarboxycitrinone (32e) 6,8-dihydroxy-4-hydroxymethyl-3,5- Dimethylisochromen-1-one (32f)* 4-acetoxymethyl-6,8-dihydroxy-3,5- Dimethylisochromen-1-one (32g)* 4-acetyl-6,8-dihydroxy-5-methyl-2- Benzopyran-1-one (32h) (+)-dihydronaphtho(1,2-b)furan-5,6- Dicarboxylic anhydride (45) Acetone adduct of atronenetinone (46a) Streptomyces Zingiber officinale Roscoe ISP-2 broth; 30 °C; 5 5,7-dimethoxy-4-phenylcoumarin (51b) Antifungal aureofaciensCMUAc130 (Zingiberaceae); root days 5,6-dimethoxy-4-(p-methoxyphenyl) Antifungal (Streptomycetaceae) coumarin (51c) Weakly antifungal Vanillin Weakly antifungal 3-methoxy-4-hydroxytoluene Xylaria sp. No. 2508 (Xylariaceae) Unidentified mangrove tree; seed Dextrose (1.2%), yeast Piliformic acid (1) extract (0.1%), peptone Ergosterol (68) (0.2%), NaCl (3.0%); 3β,5α,6β-trihydroxyergosta-7,22-diene (70) 30 °C; 86 h α-glycerol monopalmitate p-hydroxybenzoic acid Unidentified fungus strain SWS Picea glauca (Moench) Voss. (Pinaceae); CZ Met medium and 6,7-dihydroxy-2-propyl-2,4-octadien-4-olide Toxic to spruce budworm, cell 2611L (DAOM 229664) needles 2% malt extract (16)* line CF-1 medium; 20 °C; 42 5,6,8-trihydroxy-4-(1′-hydroxyethyl) Weakly toxic to spruce days Isocoumarin (32i)* Budworm cell line CF-1 Sescandelin (32j) Weakly toxic to spruce Sescandelin B (32k) Budworm cell line CF-1 4-hydroxy-2-methoxyacetanilide Weakly toxic to spruce Budworm cell line CF-1
34
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Unidentified fungus CR115 (90% Daphnopsis americana (Miller) J. S. PDB Guanacastepene A (58a) Antibacterial similarity to an uncharacterized oat Johnson (Thymelaeaceae); ns Guanacastepene B (59)* Antibacterial root Basidiomycete) Guanacastepene C (58b)* Guanacastepene D (60)* Guanacastepene E (61a)* Guanacastepene F (61b)* Guanacastepene G (61c)* Guanacastepene H (62)* Guanacastepene I (61d)* Guanacastepene J (61e)* Guanacastepene K (63)* Guanacastepene L (64a)* Guanacastepene M (64b)* Guanacastepene N (61f)* Guanacastepene O (61g)* Unidentified fungus No. 2524 Avicennia marina Forssk. (Acanthaceae); GPY broth (containing (3S,4R)-dihydroxy-(6S)-undecyl-α-pyranone Non-cytotoxic seed (Mangrove) 20% sea water); 28 °C; (2)* Non-cytotoxic 5–7 days Cyclo-(l-Phe-l-Leu1-l-Leu2 l-Leu3-l-Ile) (112) Unidentified fungus No. 2533 Avicennia marina Forssk.(Acanthaceae); Glucose-beef-yeast Vermopyrone (3) young leaf extract medium Avicennin A (32c) (containing 5% sea Avicennin B (31e) water); 30 °C; 5–7 days 5-dechloroavicennin A (32a) 6,7-dimethyl-8-hydroxy-3-Methylisocoumarin (32b) Unidentified fungus No. 2534 Kandelia candel (L.) Druce NS Ergosterol (68) (Rhizophoraceae); dropper 5α,8α-epidioxyergosterol (69) 3β,8α,6β-trihydroxyergosta-7,22-diene (70) Cyclo-(Phe-Phe) (110c) Cyclo-(Leu-Tyr) (110d)
Guanidine 4-hydroxy-2-methoxyacetophenone protocatechuic acid methyl ester
35
Table 3 Contd. Plant host(s) (family)b; plant part or Microbial strain Culture conditions Natural product(s)d Biological activity tissue Unidentified fungus strain Picea glauca (Moench) Voss. (Pinaceae); MEA medium; 20 °C; Vermiculin (6) SWS11I1 (DAOM 221611) needles 12 days Trans-3-methyldodec-cis-6-en-4-olide (13a)* Trans-8-hydroxy-3-methyldodec-cis-6-en-4- olide (13b)* Trans-8-acetoxy-3-methyldodec-cis-6-en-4- olide (13c)* Trans-9-hydroxy-3-methyl-8-oxo-dodec- trans-6-en-4-olide (13d)* Trans, 8,9-dihydroxy-3-methyldodec-cis-6- en-4-olide (13e)* Trans-9-hydroxy-8-oxo-3-methyldodecan-4- olide (14a)* Trans-7,9-dihydroxy-3-methyl-8-oxo- dodecan-4-olide (14b)* Trans-6-hydroxymethyl-3-methyl-7-oxo- dodecan-4-olide (15)* 7α,8β-11-trihydroxydrimane (53) 10,11-dihydroxyfarnesic acid (54) Unidentified fungus E-3 Prumnopitys andina (Endl.) Laubenf. PDA; 25 °C; 23 days Mellein (31a) Antibacterial; antiviral; (Podocarpaceae); phloem p-hydroxybenzaldehyde phytotoxic 4-(2-hydroxyethyl)phenol # Gunatilaka (2006) a b Only those reported during the period covered by this review are listed. Taxonomic data are from reference(s) listed and/or from the NCBI Entrez Taxonomy c database (www.ncbi.nlm.nih.gov/entrez/), and ref. 103; ns = not specified. For details of media used for cultivation, see reference(s) listed: CZ Met medium = glucose (20 g), NH4Cl (3 g), KH2PO4 (2 g), MgSO4 (2 g); FeSO4 7 H2O (0.2 g), yeast extract (2 g), malt extract (2 g), and peptone (2 g)/1000 mL H2O; GPY broth = glucose-peptone-yeast extract; GYT broth = glucose (5 g), peptone (1 g), yeast extract (0.5 g), beef extract (0.5 g), NaCl (3 g)/1000 mL H2O; ISP-2 broth = malt extract (10 g), yeast extract (4 g), glucose (4 g)/1000 mL H2O; KGA medium = Kim-Goepfert Agar medium; MEA medium = malt extract agar medium; MGP medium = malt extract/glucose/peptone medium; MM medium = Mineral Medium; Myro medium = 1.00% corn hull extract and MgSO4 (0.5 g/L); PDA = potato dextrose agar; PDB = potato-dextrose-broth; PSNB medium = potato-sucrose-neutral-broth; S-7 (liquid) medium = glucose (1 g), fructose (3 g), sucrose (6 g), NaOAc (1 g), soytone (1 g), thiamine (1 mg), biotin (1 mg), pyridoxal (1 mg), calcium pantothenate (1 mg), MgSO4 (3.6 mg), CaNO3 (6.5 mg), Cu(NO3)2 (1 mg), ZnSO4 (2.5 mg), MnCl2 (5 mg), FeCl3 (2 mg), phenylalanine (5 mg), sodium benzoate (100 mg), KH2PO4 (1 ml of 1M solution)/1000 mL H2O; SL medium = glucose (100 g), malt extract (0.4 g), yeast extract (0.4 g), NH4NO3(0.4 g), KH2PO4 (0.4 g), MgSO4 7H2O (0.4 g)/1000 mL H20 (demineralized); YES medium = yeast extract-sucrose medium; YMG medium = yeast-malt extract-glucose medium; ns = not specified. d New natural products are indicated with an asterisk (*); claimed “artifacts” of isolation are given in [ ], however, see text.
36
Table 4: Summary of certain studies related to antibacterial activities of endophytic fungi.
Bacterial strains against which Compound Endophytic fungi Host plant Reference inhibitory action was displayed Stem of Costus sp. from Phomoxanthone A Phomopsis sp. Bacillus megaterium Elsaesser et al. (2005) rain forest of Costa Rica Phomopsis Red seaweed Bostrychia S. aureus and Staphylococcus Dicerandrol C Erbert et al. (2012) longicolla radicans saprophyticus A plant from Hadong-gun, Dicerandrol A – C, Xanthomonas oryzae, S. Phomopsis South Korea and from Deacetylphomoxanthone B, aureus, B. subtilis, Clavibacter Lim et al. (2010) longicolla Korean Agricultural Fusaristatin A michiganesis, Erwinia amylovora Culture Collection, Korea Cycloepoxylactone, Phomopsis sp. Laurus azorica B. megaterium Hussain et al. (2009a) Cycloepoxytriol B Phomosines A–C Phomopsis sp. Teucrium scorodonia B. megaterium and E. coli Krohn et al. (1995) Phomosine A and Phomosine Adenocarpus Phomopsis sp. B. megaterium Dai et al. (2005) G foliolosus form Gomera Ambuic acid Pestalotiopsis sp. Lichen Clavaroid sp. S. aureus Ding et al. (2009) Bacillus subtilis, Salmonella Phomopsichalasin Phomopsis sp. ---- enterica serovar gallinarum, Horn et al. (1995) Staphylococcus aureus Bacillus subtilis, K. 4-(2, 4, 7-trioxa-bicyclo Pestalotiopsis Mangifera indica pneumoniae, E. coli, Micrococcus Subban et al. (2013) [4.1.0] heptan-3-yl) phenol mangiferae luteus, P. aeruginosa. Colletotrichum Artemisia mongolica from B. subtilis, S. aureus, and Sarcina Colletotric acid Zou et al. (2000) gloeosporioides Nanjing, China lutea
Ilex canariensis from Various compounds Colletotrichum sp. Various strains Zhang et al. (2009) Gomera
37
Table 4 Contd. Bacterial strains against which Compound Endophytic fungi Host plant Reference inhibitory action was displayed Wagenaar and Clardy Dicerandrol A, B and C Phomopsis longicolla Dicerandra frutescens B. subtilis and S. aureus (2001) Arthrobacter citreus Phomol Phomopsis sp. Erythrina crista-galli Weber et al. (2004) and Corynebacterium insidiosum. Two Fusarusides Fusarium sp. Quercus variabilis B. subtilis, E. coli and P. fluorescens Shu et al. (2004) Maackia chinensis from Fusapyridon A Fusarium sp. P. aeruginosa and S. aureus Tsuchinari et al. (2007) Gottingen (Germany) Mycobacterium bovis BCG strain and Fusaric acid Fusarium sp. Mangrove plant Pan et al. (2011) M. tuberculosis H37Rv strain S. aureus, S. aureus, B. Rheum palmatum from Rhein Fusarium solani megaterium, Sinorhizobium meliloti, Tegos et al. (2002) Ruoergai County, China Pseudomonas syringae Epoxydine Phoma sp. Salsola oppostifolia E. coli and B. megaterium Qin et al. (2010) Flavipucine Phoma sp. Salsola oppositifolia B. subtilis, S. aureus, E. coli Loesgen et al. (2011)
38
Table 5: Summary of certain studies related to antifungal activities of endophytic fungi.
Fungal strains against which inhibitory action Compound Host plant Reference was displayed Selaginella pallescens from Pentaketide isolated from Costa Rica (Guanacaste Candida albicans Brady and Clardy (2000) Fusarium Conservation Area) Glucoside derivatives – xylarosides isolated from Sordaricin Candida albicans Pongcharoen et al.(2008) Xylaria Trichoderma Garlic Rhizoctonia solani Xuping et al. (2014) brevicompactum Cytosporone B and C Mangroves from South C. Albicans and F. oxysporum Huang et.al. (2008) isolated from Phomopsis sp. China sea Tripterigeum wilfordii from Cryptosporiopsis quercin Candida albicans and Trichophyton sp. Strobel and Daisy (2003) Eurasia Cryptocin produced by C. --- Pyricularia oryzae Li et al. (2000) quercina Colletotrichum sp., A. alternaria, M. Lasiodiplodia theobromae P. hispidum Orlandelli et al. (2015) perniciosa, P. citricarpa Fusarium oxysporum, Smallanthus uvedalius and Colletotrichum fragariae, Colletotrichum phylotypes Lecythophora sp. Rosa et al. (2012) Smallanthus sonchifolius acutatum, and Colletotrichum gloeosporioides 1, Lecythophora sp. 2 12 Chinese traditional Colletotrichum gloeosporioides, Aspergillus Colletotrichum, Ovulariopsis, plants from Dawei niger, Fusarium sp., Scopulariopsis sp., Phomopsis,Ppestalotiopsi Li et al. (2005) Mountain region and Phytophthora nicotianae, Trichoderma viride, and Alternaria Yuanmou county, China Verticillium sp. Taxus Mairei, Torreya Neurospora sp., Fusarium sp. and Trichoderma Paecilomyces sp. grandis, Cephalataxus from Huang et al. (2001) sp. Fujian province, China
39
Table 6: Representative studies on endophytic fungi from medicinal plants in India.
Medicinal plant/s Reference Rajagopal and Suryanarayanan (2000); Azadirachta indica A. Juss. (ver. Neem) Singh et al. (2006)
Terminalia arjuna Tejesvi et al. (2005)
Plants of riparian vegetation of Mysore, Nanjungud and Srirangatna of Tejesvi et al. (2006) Southern India
Catharanthus roseus Kharwar et al. (2008)
Aegle marmelos (L.) Correa (Rutaceae) collected from Varanasi, India Gond et al. (2007)
Five medicinal plant species from Kudremukh Range, Western Ghats of India Raviraja (2005)
Three medicinal plants of Lamiaceae (Ocimum sanctum Linn, O. bacilicum L. Banerjee et al. (2006, 2009) and Leucas aspera (Wild) Link and Vitex negundo L. (Verbenaceae), Nine medicinal herbs for fungal communities from Bhandra River Project, Krishnamurthy et al. (2008) Malnad region, Southern India
15 shrubby medicinal plants growing in Malnad region, Southern India Naik (2008)
40
Table 7: Phytochemicals Present in Ocimum sanctum@
S/No Extracts Phyto Chemicals Plant Parts
1 Fixed oil Linoleic acid, Linolenic acid, Oleic acid, Palmitric acid, Stearic acid. Seeds
Aromadendrene oxide, Benzaldehyde, Borneol, Bornyl acetate, Camphor, Caryophyllene oxide, cis-Terpineol, Cubenol, Cardinene, D-Limonene, Eicosane, Eucalyptol, Eugenol, Farnesene, 2 Essential oil Farnesol, Furaldehyde, Germacrene, Heptanol, Humulene, Limonene, n-butylbenzoate, Ocimene, Leaves Oleic acid, Sabinene, Selinene, Phytol, Veridifloro, Camphene, Myrcene, Pinene, Pinene, Thujene, Guaiene, Gurjunene, methyl chavicol and linalool.
3 Mineral Contents Vitamin C, Vitamin A, Calcium, Phosphours, Chromium, Copper, Zink, Iron Whole Plant
Aesculectin, Aesculin, Apgenin, Caffiec acid, Chlorgenic Acid, Circineol, Gallic Acid, Leaves/Areal 4 Alcoholic Extract Galuteolin, Isorientin, Isovitexin, Luteolin, Molludistin, Orientin, Procatechuic acid, Stigmsterol, Parts Urosolic acid, Vallinin, Viceni, Vitexin, Vllinin acid.
@ Kadian and Parle (2012)
41
Table 8: Medicinal Properties of Ocimum sanctum@
S/No Pharmacological Activity Plant Parts Extracts 1 Analgesic Activity Leaves/seeds Aqueous Suspension / Fixed oil 2 Antiulcer Activity Seeds Fixed oil 3 Antiarthritic Activity Seeds Fixed oil 4 Antiasthmatic Activity Leaves Hydroalcholic Extract Aqueous / Chloroform/ Alcohol 5 Antibacterial Activity Leaves extract/ Fixed oil 6 Anticancer Activity Leaves Alcoholic extract 7 Anticataleptic Activity Leaves Alcoholic Extract 8 Anticataract Activity Leaves Aqueous Extract 9 Anticoagulant Activity Stem/Leaves Fixed oil 10 Anticonvulsant Activity Stem/ Leaves Alcholic/ Chloroform extract 11 Antidiabetic Activity Whole Plant Aqueous decoction 12 Antiemetic Acti vity Leaves Leaf Extract 13 Antifertility activity Leaves Benzene extract 14 Antifungal Activity Leaves Essential oil 15 Antihelminthic Activity Leaves Essential oil 16 Antihyperlipidemic Activity Seeds/Leaves Fixed oil, Essential oil 17 Antihypertensive Activity Seeds Fixed oil 18 Antiinflammatory Activity Whole Plant Alcholic extract/ fixed oil 19 Antioxidant Activity Whole plant Alcoholic extract 20 Antiplasmodial Activity Leaves Alcholic extracts
42
Table 8 Contd. S/No Pharmacological Activity Plant Parts Extracts 21 Antipyretic Activity Seeds Fixed oil 22 Antispasmodic Activity Leaves Leaf infusion 23 Antistress Activity Whole Plant Alcholic extract 24 Antithyroidic Activity Leaves Leaf extract 25 Antitussive Activity Areal Parts Aqueous / Alcholic extract 26 Antianxiety Activity Leaves Alcholic extract 27 Antidepressant Activity Leaves Alcholic extract 28 Cardioprotective Activity Whole Plant Fixed oil 29 Chemopreventive Activity Seeds Fixed oil 30 Demulcent/Stimulant/expectorant Leaves Leaf juice 31 Eye Disease Leaves Leaf juice 32 Genoprotective Activity Leaves Hydroalcholic extract 33 Hepatoprotective Activity Leaves Hydroalcholic extract 34 Immunomodulatory Activity Seeds/ Whole Plant Seed oil /Aquous extract 35 Memory Enhancer Activity Whole Plant/ Leaves Aquous / Alcoholic Extract 36 Larvicidal Activity Seeds Fixed oil 37 Neuroprotective Activity Leaves Alcholic extract 38 Piles Seeds Fixed Oil 39 Radio-protective Activity Leaves Alcholic extract @ Kadian and Parle (2012)
43
Table 9: Summary of certain studies in respect of antimicrobial potential of Ocimum sanctum.
S. No. Brief description Reference Antibacterial activity against S. typhi, E. coli, Pseudomonas pyocyaneus, S. 1 Parag et al. (2010) dysenteriae, P. vulgaris and V. cholerae 2 Strong antiviral properties against DNA viruses Chiang L.C. et al. (2005) 3 Antiviral activity against Bovine herpes virus -1 Shynu et al. (2006) Expectorant, demulcent to treat cough, f o r mild upper respiratory tract infection, 4 Pratibha et al. (2005) worm infestations, 5 Hypoglycaemic effect Kochhar et al. (2009) 6 Stimulatory effects on physiological pathways of insulin secretion Mandal S. et al.(1993) Reduction in tumor cell size and increased lifespan of experimental mice affected by 7 Nakamura et al. (2004) Sarcoma-180 solid tumor 8 Inhibitory activity against S. sclerotiorum, B. cinerea, F. oxysporum and R. solani Chowdhary K. et al. (2015) Isolation of endophytic fungi and their potential against Mycobacterium Smegmatis; 9 potential for Antihyperlipidemic, cardioprotective, cytotoxic and antibacterial Chowdhary K. et al. (2012) activity along with Biodiesel feedstock potential.
44
Table 10: Traditional medicinal uses of Vitex negundo$
System of medicine Uses Analgesic, anthelmintic, demulcent in diarrhoea and piles, rheumatism, female reproductive Ayurvedic system of medicine disorders, tranquilizer, sinusitis, neck swellings and ulcer
Unani system of medicine Contraceptive, dropsy, aphrodisiac, malarial fever and spermatorrhoea
Antacid, stomach-ache, arthritis, bronchitis, asthma, cold, eye disorders, indigestion, diarrhea, Chinese system of medicine gallstone and hernia
Siddha system of medicine Joint inflammation swelling
$Lubna et al. (2015)
45
Table 11: Traditional medicinal uses of Barleria prionitis##
Plants part Disorder/Disorders Application mode
Skin diseases Crushed leaf applied to skin
Scabies Paste form of fresh leaf
Cough and cold Not specified
Pus in ears Applied as extract
Catarrhal affections of children Juice directly applied
Irritation and stiffness of limbs Not specified
Glandular swellings and boils Given as juice directly
Leaf Fever Decoction with honey
Whooping cough Juice form or decoction is given
Leucoderma Leaf ash with butter
Wound Crushed form directly applied
Enlarged scrotum and sciatica Not specified
Dropsy Directly as juice
Gastric problems Juice obtained from macerated
Cataract Not specified
46
Table 11 Contd.
Plants part Disorder/Disorders Application mode Paste or juice form is applied on the Toothache Leaf affected area Mouth ulcers Chewed and sap is swallowed
Cyst Prepared oil is used externally
Whooping cough Dried plant is used
Gout Paste is applied externally as an ointment
Dysuria Used by formulation
Respiratory problem Not specified Whole plant Toothache Plant decoction
Pyorrhoea Plant decoction
Bronchial asthma Mixed with honey
Tonsillitis Applied by formulation
Greying of hair Oil extract is given
Dropsy and liver congestion Powder with cow milk Stem Dropsy Juice of bark directly
47
Table 11 Contd.
Plants part Disorder/Disorders Application mode
Fever Powder form
Boils and glandular swellings Paste form is directly applied
Rheumatic fever Paste with goat milk
Root Jaundice Not specified
Snakebite Decoction is taken orally
Expel out spine Extract is applied locally on skin
Whooping cough Used as formulation
Flower Viral fever Not specified
Seed Edema Paste is taken daily once
Asthma Used by formulation Shoot Whooping cough Prepared tablets with honey
##Talukdar et al. (2015)
48
Table 12: Summary of certain studies in respect of antimicrobial potential of Barleria prionitis.
S. No. Brief description Reference 26 endophytic fungi were isolated from the leaf and stem of Barleria prionitis 1 that included Aspergillus niger, Aspergillus flavus, Curvularia lunata, Kumari P. et al. (2015) Trichoderma sp., Alternaria alternata and Rhizopus oryzae. Ether extract of Barleria prionitis leaves exhibited significant antibacterial 2 Shukla et al. (2011) activity against many gram positive bacterial isolates. Extracts of Barleria prionitis showed significant activity against Streptococcus 3 Aneja et al. (2010) mutans, Staphylococcus aureus, Pseudomonas sp. and Bacillus sp. Antibacterial phytochemicals isolated from Ethanolic extract of Barleria prionitis 4 showed strong antibacterial activity inhibiting Pseudomonas aeruginosa and Kosmulalage et al. (2007) Bacillus cereus. Seeds extract of Barleria prionitis showed significant inhibition against B.cereus 5 and E. coli. comparable to standard antibacterial agent Ampicillin, Tetracycline Kumar et al. (2013) and streptomycin. Solvent extracts of different parts of Barleria prionitis exhibited substantial 6 antibacterial activity against S. aureus, B. cereus, S. mutans and P. Aneja et al. (2010) aeruginosa which are oral pathogens causing dental caries. Methanol extract of Barleria prionitis showed significant antibacterial activity 7 against the selected human pathogens such as E. coli, S. typhi, S.aureus and B. Nidhi et al. (2013) cereus. Antimicrobial activity of extracts different parts of Barleria prionitis showed inhibitory effect against S. typhi, Pseudomonas aeruginosa, C. vaginitis, C. 8 Panchal and Singh (2015) pneumoniae (bacterial cell), C. neoformans, A. fumigates, C. albicans and B. dermatidis. Various extracts of Barleria prionitis exhibited substantial antibacterial activity 9 against S. aureus, K. pneumoniae, B. subtilis, P. vulgaris, P. aeruginosa and E. Chavan C. B. et al. (2011) coli. A new compound balarenone (1) and other three known compounds isolated in 10 the study exhibited antibacterial activity against B. cereus, GST, AChE and P. Kalhari et al. (2007) aeruginosa
49
Table 12 Contd. S. No. Brief description Reference Various extracts of Barleria prionitis bark exhibited antifungal activity against 11 two strains of Candida albicans and oral pathogenic fungus Saccharomyces Aneja et al. (2010) cerevisiae. Various extract of stem and root of Barleria prionitis showed fungistatic and 12 Amoo et al. (2011) fungicidal activities against Candida albicans. Isolation of two iridoid glycosides from Barleria prionitis which have been found 13 Chen et al. (1998) to exhibit substantial antiviral activity against Respiratory syncytial virus.
50
Chapter 4
Materials and Methods
MATERIALS AND METHODS
The present work was carried out for bioprospecting the antibacterial activity of secondary metabolites extracted from endophytic fungi isolated from three medicinal plants viz. Ocimum sanctum, Vitex negundo and Barleria prionitis. This chapter of the thesis describes and elaborates the materials used and methods followed for the present study.
3.1 Selection of plant species:
Three plant species viz. Ocimum sanctum, Vitex negundo and Barleria prionitis were selected on the basis of literature survey on medicinal properties of the plants, their use in household cure and availability in the area around Pune.
It is now pertinent to discuss the properties of each one of them.
1. Ocimum sanctum Linn.:
Synonym - O. tenuiflorum Linn. Family - Labiatae; Lamiaceae. Habitat – Spread throughout India; grown in gardens, houses, temple complexes etc. English - Sacred Basil, Holy Basil. Ayurvedic - Tulsi, Surasa, Suravalli, Bhuutaghni, Manjarikaa, Deva dundubhi, Bahumanjari, Graamya, Shuulaghni, Sulabhaa. Unani - Tulsi. Siddha/Tamil - Tulsi, Nalla-Tulsi. Ocimum sanctum Linn. (Lamiaceae) is an Herb plant traditionally used as medicine to cure cough, fever, bronchitis and other diseases of lungs.
51
Extensive studies on experimental and clinical level prove that Tulsi possesses anti-stress / adathogenic, antioxidant, immunomodulatery and antiradiation properties. It plays a major role in prevention and treatment of cancer (Singh et al. 2012). It also possesses some essential oils which have shown good antimicrobial activity against enteric bacteria and yeast (Dey et al. 1984). Tulsi exhibits rejuvenating properties viz. antiseptic and anti-allergic effects (Godhwani et al. 1988). ‘Eugenol’- an active constituent present in Ocimum sanctum Linn. is largely responsible for the therapeutic potential of Tulsi in the treatment of various chronic diseases including cancer (Ranga et al. 2005).
2. Vitex negundo Linn.:
Family- Verbenaceae. Habitat- Spread throughout India in warmer geographical areas; found till the ascent of 900 m in the North-western parts of Himalaya. English- Five-leaved chaste tree. Ayurvedic - Nirgundi, Shephaalikaa, Sindhuka, Sindhuvaara,Suvahaa, Sugandhikaa. Nila Nilanirgundi, Sinduvaara (White-flowered variety), Shephaali (Blue flowered variety) Unani - Sambhaalu, Fanjankisht. Siddha/Tamil- Nochi, Nalla Nochi, Vellai Nochchi, Nirkundi. Administration of Vitex negundo extract potentiated the effect of commonly used anti-inflammatory drugs such as ibuprofen and phenyl butazone (Tandon et al. 2006).
52
Leaf extracts of Vitex negundo were found to possess hepato-protective activity against liver damage induced by d-galactosamine (Yang et al. 1987), commonly used in tubercular drugs (Tandon et al. 2008). Water extract of Vitex negundo leaves, when administered in rats, exhibited anti- inflammatory, analgesic, antihistaminic and membrane stabilizing activity (Khare 2004) The extract of Vitex negundo possesses inhibitory detergent or lethal activity on biological agents that cause disease and damage other organisms viz. antibacterial activity against E. coli, K. pneumoniae, P. vulgaris and P. aurogenosa (Samy et al. 1998) It also showed antifungal activity against Trichopyton mentagophytes and candida albicans (Guleria et al. 2006; Aswar et al. 2009).
3. Barleria prionitis L.:
Family - Acanthaceae. Habitat - Spread throughout the relatively hotter parts of country. Usually grown as a hedge plant. English - Common Yellow Nail Dye Plant. Ayurvedic - Sahachara, Kurantaka, Baana, Koranda, Kuranta, Shairiya, Korandaka, Vajradanti, Pita-saireyaka (yellow-flowered variety). Unani - Piyaabaansaa. Siddha/Tamil - Chemmulli. Folk - Jhinti, Piyaabaasaa, Katsaraiyaa Barleria prionitis Linn. (Acanthaceae) is well known plant in Auyrveda. It is distributed throughout India, Sri Lanka and South Asia (Burkill 1985).
53
The extract of plant is also useful in respiratory infection (Chen et al.1998). The juice of plant leaves is useful in fungal infection (Panwar et al. 1979), wound healing, bleeding, toothache and joint pain (Parotta et al. 2001). The plant is rich in potassium and important as diuretic. Flavonoides, glycosides and fatty acids have also been reported from the plant (Barnabas and Nagarajan 1988).
3.2 Localities/Sites for collection of plant samples:
Three relatively pollution free localities/sites in and around Pune were randomly selected for collection of each of the three plant samples. These three locations were - 1) Relatively pollution free part of Mulshi Dam backwater area. 2) Relatively pollution free area near Lonawala. 3) Empress Garden, Pune.
3.3 Collection of plant samples: Apparently healthy, symptomless, disease free and mature plants were selected from the three predecided sites during monsoon and post monsoon season between July – September 2012. The samples were collected from three parts of the selected plants viz. leaves, stem and roots. Separate pre-sterilized zip lock plastic bags were used for collection of plant parts. The plant samples were brought and processed in laboratory within 24 hours after sampling.
3.4 Isolation of endophytic fungi:
Sterilization Protocol - In order to remove surface adherents, all the plant samples were first cleaned thoroughly under running tap water. Each of them was then cut into small pieces. Leaves were cut into 5 to 6 mm diameter and 1 cm in length while stem and roots were cut into 1 to 2 cm in length. All the work was carried out in laminar air flow to avoid contamination and to maintain aseptic conditions. All the segments were then separately subjected to surface sterilization. Twelve different sterilization protocols as listed by Premjanu and Jayanthy (2012) were analyzed and three of them each by Petrini (1986), Rubini et al. (2005) and Gao et al. (2009) were used. Summary of all the methods used by different researchers is listed in Table 13. The leaves were first rinsed under running tap water, immersed in 75% ethanol (1 min.) followed by NaOCl (1 to 13% depending upon type of tissue for 3 to 5 min.) and then with 75% ethanol (30 sec.).
54
PLATE I
Plant segments collection sites
Relatively pollution free area of Mulshi Dam Backwaters
Relatively pollution free area of Lonawala
Relatively pollution free area of Empress Garden, Pune
55
Table 13: Different Sterilization Protocols.
Rinsed with Rinsed with Rinsed in sterile distilled Incubation (days, Reference Washing ethanol Surface disinfection ethanol water temperature) solution solution Petrini (1986) Running tap water 75%, 1 min. 1-13%, 3-10 min. 75%, 0.5 min. Thrice Several days, 27-29oC (RTW) (NaOCl) Rubini et al. (2005) RTW 70% 3%, 3 min. (NaOCl) 70% Twice 3-15, 28oC Gao et al. (2006) Water and detergent 70%, 1 min. 15%, 1 min. H2O2 70%, 1 min. Not informed, Material was Not informed material was dried with dried with sterile filter paper sterile filter paper Chomcheon et al. RTW, air-dried 70%, 1 min. 5%, 5 min. (NaOCl) Not informed Twice, 1 min. 30oC, cultivated on banana (2005) leaf agar the fungi developed conidia, which permitted their identification Raviraja et al. (2006) RTW 75%, 1 min. 6%, 3 or 5 min. (NaOCl) 75%, 0.5 min. Three times 30, 25oC Agusta et al. (2005) RTW 70%, 1 min. 5.3%, 5 min. (NaOCl) 75%, 0.5 min. Not informed Several days, 27oC Chomcheon et al. RTW, air-dried 70%, 1 min. 6%, 5 min. (NaOCl) Not informed Twice, 1 min. 30oC (2006) Amna et al. (2006) Not informed 95% Not informed Not informed Not informed 28oC Mirlohi et al. (2006) Not informed, Not 2,5% 20-30 min. Not informed Once 7-14, 28oC Technique used for Informed (NaOCl) seeds Seena and Sridhar RTW 95%, 1 min. 6%, 5 min. (NaOCl) 95%, 0.5 min. Three times 4-5, 25oC (2004) Medina et al. (2006) Not informed, Not 2%, 1 min. Not informed Twice, 1 min. 2-15, 25oC Technique used for informed seeds Souza et al. (2004) Water and detergent 70%, 1 min. 3%, 4 min. (NaOCl) 70%, 0.5 min. Once 3-8, 18oC Bayman et al. RTW, Technique used 75%, 1 min. 34%, 10 min. 75%, 0.5 min. Not informed 22oC (1998) for seeds Bayman et al. Water and detergent Not used, 0.5%, 20 min. Not used, leaf Once 22oC (1998) leaf contain contain latex latex
56
All the segments were then washed three times with sterile distilled water and allowed to surface-dry on sterilized filter paper. The efficiency of surface sterilization procedure was ascertained by the imprint method of Schulz et al. (1993).
3.5 Media used for isolation of endophytic fungi: All the sterilized segments of each plant part were placed on water agar supplemented with chloramphenicol (50 µg/mL) to inhibit bacterial growth. Plates were sealed with parafilm to prevent desiccation of the medium and incubated in dark at 270C for 1 to 2 weeks. The fungal growth was continuously monitored. As soon as growth was observed, the hyphal tips were transferred to fresh PDA to enhance normal sporulation for better identification. For preliminary isolation, only water agar supplemented with antibiotics was used. For obtaining pure culture, hyphal tips from water agar were transferred to PDA.
To induce in-vitro sporulation in non-sporulating forms of endophytes, the grass leaf technique proposed by Srinivasan et al. (1971) was used. Leaves from medicinal plants were cut into small pieces and all of them were transferred onto 2% water agar plates after sterilization. The hyphal tips from non-sporulating endophytic fungi were inoculated on the margin of the leaves. The plates were then incubated at 270C for 1 to 2 weeks. All the endophytic fungi were then submitted for identification to ARI, Pune.
3.6 Calculation of colonization rate, isolation rate and density of colonization:
Colonization rate was calculated by the method of Petrini et al. (1982). The formula is –
Colonization rate = Total number of plant-tissue segments infected by one or more fungi X 100 Total number of inoculated segments
Isolation rate was determined by the method of Wang and Guo (2007). The formula is –
Isolation rate = The number of isolates obtained from plant-tissue segments X 100 Total number of segments inoculated
The density of colonization (rD%) or colonization frequency (CF%) of a single endophyte species was calculated by the method of Fisher and Petrini (1987). The formula is –
rD % = (Ncol/Nt) × 100
Ncol = Number of segments colonized by each fungus Nt = Total number of segments inoculated
57
3.7 Preservation of culture: Pure cultures were preserved on PDA slant maintained at 80C with proper labeling e.g. code no., name of medicinal host plant, batch no. and date of storage etc. Several replicates were made for each sample. All the samples were then deposited in National Fungal Culture Collection of India (NFCCI), Agharkar Research Institute, Pune for identification.
3.8 Identification of endophytic fungi: 3.8.1 Morphological identification: The morphological identification of fungi was carried out at Agharkar Research Institute (ARI), Pune. Sporulating structures of fungi were considered as diagnostic features for identification of endophytes. Standard taxonomic keys and monographs were used to identify all the endophytic isolates and were placed in appropriate genera and species. Authoritative monographs and other taxonomic papers relating to particular genera and species of endophytes were referred for identification of endophytes. ‘Methuen Handbook of Colour’ (Kornerup and Wanscher 1978) was used for colour differentiation of cultures.
3.8.2 Molecular identification: Molecular identification of selected endophytes showing substantial antibacterial activity was carried out at GeneOmbio Technologies Pvt. Ltd. Pune. The materials and methods in respect of the molecular identification is -
a. Fungal genomic DNA isolation:
Isolation of fungal genomic DNA was carried out using geneO-spin Microbial DNA isolation kit. The ITS1, ITS2 and inverting 5.8S coding rDNA were amplified using Universal ITS rDNA typing primers ITS1 and ITS4 in a standard PCR reaction. Purification was carried out after amplification by using a geneO-spin PCR product Purification kit. Direct sequencing was then carried out by using an ABI PRISM BigDye Terminator V3.1 kit (Applied Biosystems, USA). Analysis of the sequences was carried out by using Sequencing Analysis 5.2 software. BlastN site at NCBI server (http://www.ncbi.nlm.nih.gov/BLAST) was used to perform BLAST analysis.
b. Agarose gel electrophoresis of PCR products for confirmation of PCR amplification:
After completion of PCR, the PCR products were checked on 2% Agarose by Agarose Gel Electrophoresis and amplicon size was compared using reference Ladder. 2%
58
agarose gel spiked with Ethidium bromide at a final concentration of 0.5 g/ml was prepared using Agarose (LE, Analytical Grade, Promega Corp., Madison, WI 53711 USA) in 0.5X TBE buffer. 5.0 l of PCR product was mixed with 1 l of 6X Gel tracking dye. 5l of gScale 100bp size standard (GeneOmbio Technologies, Pune, India) was loaded in one lane for confirmation of size of the amplicon using reference ladder. The DNA molecules were resolved at 5V/cm until the tracking dye was 2/3 distance away from the lane within the gel. Bands were detected under a UV Trans illuminator. Gel images were recorded using BIO-RAD GelDocXR gel documentation system. The PCR product of size 600 bp was generated through this reaction. c. Purification of PCR products: Sequencing uses one primer, while PCR utilizes two. If we try to sequence with two primers present, we get the two sequences back, superimposed on each other and completely unreadable. Hence it is necessary to purify a PCR product prior to sequencing. Purification of PCR products was carried out by using geneO-Spin PCR purification Kit. The PCR products were eluted in final volume of 20.0l. d. Agarose gel electrophoresis of purified PCR products: The protocol mentioned in (2) was used for checking of purified PCR products on 2% agarose gel and determination of approximate concentration of DNA. e. DNA sequencing: Using the gene specific sequencing primers and ABI BigDye Terminator V3.1 Cycle Sequencing reaction kit (Applied Biosystems, USA), the purified PCR amplicons was sequenced.
I. Sequencing strategy: Primers: PCR is intrinsically an exponential process and is usually carried well beyond completion. Hence even relatively poor primers tend to produce amplification in a PCR reaction. However, sequencing is strictly linear, and it is much more unforgiving towards poor primers. Proper primer design is the most important factor in successful automated DNA sequencing. In most of the cases the PCR primers are used for sequencing of the PCR amplicons. It is desirable for the primer to have certain characteristics like:
59
Melting temperature between 500C to 650C Absence of hairpin formation of more than 3 bp Absence of dimerization capability Low to moderate specific binding at the 3' end (avoid high GC content to prevent mispriming) Primer length from 18 to 30 bases and having %GC of 40 to 60. Lack of secondary priming sites
Amplicon sequencing was done using specified gene specific primers (forward and reverse) via custom DNA sequencing services from GeneOmbio Technologies, Pune, India. From each lot of PCR amplicons random 5 samples were subjected to automated DNA sequencing using both the primers as indicated. Primer that generated maximum QV (Quality Value) bars in an electropherogram was selected for sequencing of rest of the samples in the same lot.
II. Concentration of DNA template:
As PCR fragments are smaller than plasmids giving more DNA per sample, it makes PCR products more effective sequencing templates than the usual plasmids. Therefore it is needed to have lower concentrations for PCR products. If the samples have too high a concentration, they do not sequence properly and also cause DNA sequencing to fail. Hence it is prerequisite to estimate PCR product concentration by loading them with standards on an agarose gel. Highly concentrated PCR products were diluted and then used as template for DNA sequencing.
For each lot of samples, estimation of concentration on agarose gel was done and appropriate amount of template DNA was used for sequencing.
3.9 Media optimization for the production of metabolites:
For the production of secondary metabolites, the fungi were cultivated in appropriate media. In order to perform bioassay for the detection of active metabolites, small scale cultivation was carried out. For primary screening, fungi were cultured on PDA in most of the cases. For evaluation of the growth rate, Sabouraud’s agar (SA), Czapek’s yeast extract agar (CYA), Malt extract agar (MEA) were also used. After observing the growth of fungi in different media, a suitable media was used for the cultivation of fungi.
60
3.10 Fermentation, extraction and isolation of secondary metabolites: This process was carried out by the method described by Choudhary et al. (2004). Organic solvents like hexane and ethyl acetate were used to extract the filter. The culture media and the mycelia were separated from each other by filtration. Mycelia were soaked in methanol. The methanolic extract was collected after 7 to 10 days of soaking. The filtrate was extracted three times with equal volume of Hexane and Ethyl acetate. Each solvent was subjected to liquid - liquid extraction for 3 to 4 times. Solid residues obtained by evaporating organic extracts under reduced pressure were used for antibacterial assay.
3.11 Screening of endophytic fungi for antibacterial activity: The antibacterial activity of isolated endophytic fungi was screened against pathogenic and non pathogenic bacteria using agar well diffusion method.
3.11.1 Microorganisms used for antibacterial activity: Six bacteria used in the present study were procured from National Collection of Industrial Microorganisms, NCL, Pune. They were –
Gram Positive -
. Bacillus subtilis (NCIM No. 2063) . Staphylococcus aureus (NCIM No. 2079) . Bacillus cereus (NCIM No. 2155)
Gram Negative -
. Escherichia coli (NCIM No. 2345) . Klebsiella pneumoniae (NCIM No. 2706) . Salmonella typhimurium (NCIM No. 2501)
3.11.2 Preparation of test sample:
The extract was dissolved in Dimethyl Sulphoxide (DMSO) for preparation of stock solutions (3mg/100mL)
3.11.3 Agar well diffusion method:
For screening of antibacterial activity, modified agar well diffusion method was employed against six human pathogenic bacteria. A loopful of bacterial culture was inoculated in 5 ml of Muller Hilton broth. It was incubated at 370c for 24 hours. After incubation, standard
61
inoculum was prepared by inoculating 100 μl (107 CFU/ml) of fresh bacterial culture into soft agar and mixed properly. Plates were prepared with 15 ml of Muller Hilton Agar medium and inoculated with standardized inoculum. Wells of about 6 mm diameter were prepared and filled with 100 μl of endophytic fungal extract. Standard antibiotic Cloramphenicol and equal quantity of DMSO was used as a positive and negative control respectively. All the experiments were carried out in triplicates. Results were recorded as zone of inhibition in mm (of diameter). The mean values of inhibition zones were calculated (Perez et al. 1990; Rojas et al. 2006) after 24 hrs of incubation. The zone of inhibition was rated as significant (+++) if the diameter of inhibition zone was > 20 mm, moderate (++) if the zone of inhibition was between 10–20 mm and poor (+) if it was < 7 mm.
3.12 Process optimization of fermentation conditions for production of active metabolites from selected endophytic fungi:
Based on the analysis of antibacterial activity of different extracts, an isolate was shortlisted for further study. For the selected species, further study of fungal biomass and crude metabolite production was carried out by optimizing various parameters like temperature, pH and incubation period in shake culture condition. The fungus was cultivated on Potato Dextrose Broth by placing agar blocks (3 mm in diameter) of actively growing culture in 250 ml Erlenmeyer flask containing 100 ml of the medium at three different pH (3.0, 5.0, 7.0). The flasks were then incubated in BOD incubator for 15 and 21 days at 25ºC, 27ºC, 30ºC. The experiment was carried out in triplicate. The culture filtrates were extracted using ethyl acetate after 15 and 21 days of incubation. The mycelial mats were filtered and dried at 50ºC until constant weight was obtained. The final fungal biomass was recorded in mg/100mL. Effects of temperature, pH and incubation period on the production of crude metabolite were studied and proper optimization parameters were selected for further extraction of crude metabolites.
3.13 Extraction and purification of secondary metabolites of selected endophytic fungi for evaluation of antibacterial activity:
Extraction of selected endophytic fungus was carried out by the procedure same as described in foregoing section. Only ethyl acetate solvent was used to extract the filter. The culture media and the mycelia were separated from each other by filtration. The filtrate was extracted three times with equal volume of ethyl acetate. Each flask was subjected to liquid - liquid
62
extraction for 3 to 4 times. Solid residues obtained by evaporating organic extracts under reduced pressure were used for evaluation of antibacterial activity.
3.14 Determination of minimum inhibitory concentration (MIC):
The minimum inhibitory concentration (MIC) was calculated for a single selected fungal extract of Phomopsis archeri B. Sutton from Vitex negundo. The test was performed at six different concentrations i.e. 25, 50, 100, 200, 400, 800 μg/disc employing the agar disc diffusion method (Dilika et al. 2000; Leite et al. 2006).
3.15 Chemical screening of selected endophytic fungal extract:
Chemical screening of the selected fungal endophytes was carried out by HPTLC and IR, NMR and GC-MS.
3.15.1 Chromatographic analysis by High Performance Thin Layer Chromatography (HPTLC):
3.15.1.a Instrumentation:
HPTLC system of CAMAG, Muttenz, Switzerland, Anchrom Enterprises (I) Pvt. Ltd, Mumbai, consisting of sample applicator (Linomat 5), Twin trough chamber with lid (10×10 cm, CAMAG, Muttenz, Switzerland), UV cabinet (Aetron, Mumbai) with dual wavelength (254/366 nm) and the HPTLC photodocumentation (Aetron, Mumbai) was used for study.
3.15.1.b Chromatographic Conditions:
The sample (ethyl acetate extract) was applied in the form of band of width 6 mm with a 100 µL sample syringe (Hamilton, Bonaduz, Switzerland) on precoated silica gel aluminium plate 60 F254 (5 × 10) with 250 µm thickness (E. MERCK, Darmstadt, Germany) using a CAMAG Linomat 5 sample applicator (Switzerland). The plate was prewashed with methanol and activated at 1100C for 5 minutes prior to chromatography. The optimized chamber saturation time for mobile phase was kept at 15 min. The length of chromatogram run was 9 cm. HPTLC plate was dried in a current of air with the help of a hair dryer. The slit dimensions of 5 × 0.45 mm and scanning speed of 20 mm/sec were employed in analysis.
3.15.1.c Mobile phase:
The composition of mobile phase was n-Hexane: Ethyl Acetate (7: 3)
63
3.15.1.d Calculation of Rf Values:
Plate was observed in the daylight, under UV light (254 and 366 nm). After each observation the central points of spots that appeared on chromatogram were marked with needle. Retention factor (Rf) was calculated by the formula of Chatwal and Anand (2004); Sethi and Charegaonkar (1999).
Rf = A/B
A = distance between point of application and central point of spot of material being examined.
B = distance between the point of application and the mobile phase front.
A particular band at relevant Rf Value was scratched and subjected to structural elucidation.
3.15.2 Structural elucidation: Probable structure of the compound was derived from elemental analysis, IR and NMR and GC-MS spetra. IR spectra were recorded using KBr on “JASCO FT-IR 460 plus” instrument by DRIFT method. 1H-NMR spectra were recorded in CDCl3 solution on “FTNMR VARIAN MERCURY YH-300” using tetramethyl silane (TMS) as internal standard. Mass Spectra were recorded on “Shimadzu GC-MS QP-5050” instrument by direct injection method.
64
Chapter 5
Results
RESULTS
4.1. Biodiversity and taxonomical study of the endophytic fungi isolated from Ocimum sanctum, Vitex negundo and Barleria prionitis: The plant samples were collected from 3 locations –
1) Relatively pollution free part of Mulshi dam backwater area. 2) Relatively pollution free area near Lonawala. 3) Empress Garden, Pune.
150 segments each of the three medicinal plants i.e. 450 plant segments in total were processed. 150 segments of each plant consisted of 50 segments each of leaves, stems and roots. From these 450 segments, 132 fungal endophytes were isolated.
4.1.1 Plant-wise and plant part-wise distribution of Endophytic fungi:
The analysis of 132 endophytic fungi isolated from all the three medicinal plants is given in Table 14. From data in the table, it can be inferred that -
1) Out of 132 isolates, maximum 56 i.e. 42% were extracted from Ocimum sanctum followed by Vitex negundo which yielded 45 i.e. 34% of the total endophytic fungi.
2) The maximum numbers of endophytic fungi were isolated from stem. Stem yielded 56 out of 132 i.e. 42% of endophytic fungi followed by leaves from which 48 i.e. 36% endophytic fungi were isolated. This trend of isolation of maximum endophytic fungi from stem was seen individually in Ocimum sanctum as well as Vitex negundo. However, Barleria prionitis was exception since higher numbers of endophytic fungi (15) were isolated from the leaves of Barleria prionitis as compared to its stem (10) and roots (6).
Table 14: Plant-wise and plant part-wise distribution of endophytic fungi isolated.
Plant Total endophytic Number of endophytic fungi isolated from fungi isolated Leaves Stem Roots Ocimum sanctum 56 18 26 12 Vitex negundo 45 15 20 10 Barleria prionitis 31 15 10 6 Total 132 48 56 28
65
Barleria prionitis 31 (24%) Ocimum sanctum 56 (42%)
Ocimum sanctum Vitex negundo Vitex negundo 45 Barleria prionitis (34%)
Fig. 1. Plant-wise distribution of 132 endophytic fungi isolated from three medicinal plants.
Roots 12 (21%) Leaves 18 (32%)
Leaves
Stem Stem 26 (47%) Roots
Fig. 2. Part-wise distribution of endophytic fungi isolated from Ocimum sanctum.
66
Roots 10 (22%) Leaves 15 (33%)
Leaves Stem Roots
Stem 20 (45%)
Fig. 3. Part-wise distribution of endophytic fungi isolated from Vitex negundo.
Roots 6 (19%)
Leaves
Stem Stem 10 (32%) Leaves 15 (49%) Roots
Fig. 4. Part-wise distribution of endophytic fungi isolated from Barleria prionitis.
67
Leaves 48 (37%) Roots 28 (21%)
Leaves
Stem Stem 56 (42%) Root
Fig. 5. Part-wise distribution of endophytic fungi isolated from all three plants taken together.
4.1.2 Species-wise distribution of fungi among the three medicinal plants:
The species-wise analysis of 132 endophytic fungi isolated from all the three medicinal plants is given in Table 15. From data in the table, it can be inferred that –
1) The endophytic fungi isolated represented 14 genera and 21 species.
2) Out of 132 isolates, maximum 24 i.e. 18% were Colletotrichum gloeosporioides Penz. followed by Fusarium sp. (12%) and Phomopsis archeri B. Sutton (11%). The other species showing substantial presence were Nigrospora state of khuskia oryzae H. J. Hudson, Penicillum sp., Aspergillus flavus gr., Nigrospora sphaerica (Sacc.) Mason, Alternaria raphani J. W. Groves and Skolko and Curvularia borreriae (Viegas) M.B. Ellis.
68
25 Barleria prionitis Vitex negundo 1
Ocimum sanctum
20
9
15 4 8
5 1 Number of of fungi endophytic Number 10 2 3 3
2 0 13 3 6 3 4 5 3 1 8 2 7 7 2 0 2 0 0 0 2 4 0 1 0 0 1 1 0 0 3 3 0 1 1 3 2 1 2 0 0 0 1 1 1 2 1 1 0 0 0 0 0 0 0 0 1 0 0
Endophytic fungi
Fig. 6. The stacked bar chart for the species-wise analysis of 132 endophytic fungi isolated from all the three medicinal plants. 69
Table 15: Distribution of endophytic fungi among the three medicinal plants.
Ocimum Vitex Barleria S.N. Species Total % sanctum negundo prionitis 1 Colletotrichum gloeosporioides Penz. 13 9 1 23 17 2 Fusarium sp. (GeneOmbio 520) 7 3 8 18 14 3 Phomopsis archeri B. Sutton 8 5 4 17 13 4 Nigrospora state of khuskia oryzae 7 3 1 11 8 H.J.Hudson. 5 Aspergillus flavus gr. 3 3 2 8 6 6 Penicillum sp. 3 2 3 8 6 7 Alternaria raphani J.W. Groves and 4 3 0 7 5 Skolko 8 Nigrospora sphaerica (Sacc.) Mason 1 2 4 7 5 9 Curvularia borreriae (Viegas) M.B. Ellis 2 2 1 5 4 10 Colletotrichum lindemuthianum (sacc. 2 0 0 2 2 andmagn) 11 Cladosporium sphaerospermum Penz. 1 1 0 2 2 12 Fusarium semitectum Berk. and Rav. 0 0 2 2 2 13 Phoma glomerata (cda) Wollenw and 1 1 0 2 2 Hochapf 14 Mucor hiemalis Wehmer 0 2 0 2 2 15 Monodictys paradoxa (Corda) Hughes 0 1 0 1 1 16 Drechslera australiensis Bugnic.ex M.B. 0 0 1 1 1 Ellis 17 Trichoderma harzianum Rifai 0 0 1 1 1 18 Fusarium brachygibbosum (GeneOmbio 0 0 1 1 1 567) 19 Pleosporales sp. A10 (GeneOmbio - 1 0 0 1 1 509) 20 Eutypa sp. (GeneOmbio - 531) 0 1 0 1 1 21 Talaromycespurpurogenus (GeneOmbio 0 1 0 1 1 560) Non Sporulating 3 6 2 11 8 Total 56 45 31 132 100
70
4.1.3 The species, genera and other taxonomical details of the endophytic fungi isolated from the three medicinal plants:
The taxonomical details were obtained from GBIF – Global Biodiversity Information Facility (http://www.gbif.org/) and Mycobank (http://www.mycobank.org/). The isolated endophytic fungi represented 14 genera and 21 species as given in Table 16.
1) Most of the endophytic fungi belonged to phylum Ascomycota. 2) There were total 15 non-sporulating species among the 132 fungi. The efforts to induce sporulation by grass leaf technique also failed. Out of these, 4 species (Culture nos. 509, 531, 560, 582) showing significant antibacterial activity were sent for molecular identification at GeneOmbio Technologies Pvt. Ltd. These four fungi were identified as Unclassified Pleosporales, Eutypa and Talaromyces and Phomopsis archeri B. Sutton respectively. One Sample no. 592 which was also non-sporulating did not respond to the PCR and hence no report could be generated. Thus these 4 species which have been identified are not included in non-sporulating category in the final analysis but are included as identified species among the 121 endophytes and remaining 11 are included in non-sporulating species.
4.1.4 Colonization rate and isolation rate of plant part samples: Colonization rate was calculated by the method of Petrini et al. (1982). The formula is –
Colonization rate = Total number of plant-tissue segments infected by one or more fungi X 100 Total number of inoculated segments
Isolation rate was determined by the method of Wang and Guo (2007). The formula is –
Isolation rate = The number of isolates obtained from plant-tissue segments X 100 Total number of segments inoculated
71
Table 16: Taxonomical details of representative species sent for morphological and molecular analysis at ARI and GeneOmbio Technologies. Pvt. Ltd.:
S.N. Species Phylum Class Order Family Genus 1 Colletotrichum Ascomycota Caval. Sordariomycetes O.E. -- Glomerellaceae Glomerella Spaulding and gloeosporioides Penz. Sm.Ascomycota Erikss. and Winka Locq. H. Schrenk, 1903 2 Colletotrichum Ascomycota Caval. Sordariomycetes O.E. -- Glomerellaceae Colletotrichum Corda lindemuthianum Sm.Ascomycota Erikss. and Winka Locq. (sacc.andmagn) 3 Nigrospora state of khuskia Ascomycota Caval. Sordariomycetes O.E. Trichosphaeriales -- Khuskia H.J. Huds. oryzae H.J.Hudson. Sm.Ascomycota Erikss. and Winka M.E. Barr 4 Nigrospora sphaerica Ascomycota Caval. Sordariomycetes O.E. Trichosphaeriales -- Khuskia H.J. Huds. (Sacc.) Mason Sm.Ascomycota Erikss. and Winka M.E. Barr 5 Fusarium semitectum Berk. Ascomycota Caval. Sordariomycetes O.E. Hypocreales Lindau Nectriaceae Tul. Fusarium Link, 1809 and Rav. Sm.Ascomycota Erikss. and Winka and C. Tul. 6 Phomopsis archeri B. Ascomycota Caval. Sordariomycetes O.E. Diaporthales Nannf. Diaporthaceae Phomopsis (Saccardo) Sutton Sm.Ascomycota Erikss. and Winka Höhn. ex Wehm. Bubák, 1905 7 Penicillum sp. Ascomycota Caval. Eurotiomycetes O.E. Eurotiales G.W. Trichocomaceae E. -- Sm.Ascomycota Erikss. and Winka Martin ex Benny Fisch. and Kimbr. 8 Aspergillus flavus gr. Ascomycota Caval. Eurotiomycetes O.E. Eurotiales G.W. Trichocomaceae E. Aspergillus E.M. Fries, Sm.Ascomycota Erikss. and Winka Martin ex Benny Fisch. 1832 and Kimbr. 9 Alternaria raphani J.W. Ascomycota Caval. Dothideomycetes O.E. Pleosporales Luttr. Pleosporaceae Alternaria Nees Groves and Skolko Sm.Ascomycota Erikss. and Winka ex M.E. Barr Nitschke 10 Cladosporium Ascomycota Caval. Dothideomycetes O.E. Capnodiales Davidiellaceae Cladosporium Link sphaerospermum Penz. Sm.Ascomycota Erikss. and Winka Woron. C.L. Schoch, Spatafora, Crous and Shoemaker 11 Curvularia borreriae Ascomycota Caval. Dothideomycetes O.E. Pleosporales Luttr. Pleosporaceae Curvularia Boedijn, 1933 (Viegas) M.B. Ellis Sm.Ascomycota Erikss. and Winka ex M.E. Barr Nitschke 12 Phoma glomerata (cda) Ascomycota Caval. Dothideomycetes O.E. Pleosporales Luttr. -- Phoma Saccardo, 1880 Wollenw and Hochapf Sm.Ascomycota Erikss. and Winka ex M.E. Barr 13 Monodictys paradoxa Ascomycota Caval. Dothideomycetes O.E. Dothideales Lindau -- Monodictys S. Hughes (Corda) Hughes Sm.Ascomycota Erikss. and Winka 14 Mucor hiemalis Wehmer Zygomycota Moreau --- Mucorales Fr. Mucoraceae Mucor Fresenius, 1850 Zygomycota Dumort.
72
Table 16 Contd.
S.N. Species Phylum Class Order Family Genus 15 Drechslera australiensis Ascomycota Dothideomycetes O.E. Pleosporales Luttr. Pleosporaceae Cochliobolus Drechsler Bugnic.ex M.B. Ellis Erikss. and Winka ex M.E. Barr Nitschke 16 Trichoderma harzianum Ascomycota Caval. Sordariomycetes O.E. Hypocreales Lindau Hypocreaceae De Trichoderma Persoon, Rifai Sm.Ascomycota Erikss. and Winka Not. 1794
17 Fusarium sp. (GeneOmbio Ascomycota Caval. Sordariomycetes O.E. Hypocreales Lindau Nectriaceae Tul. and Fusarium (GeneOmbio 520) Sm.Ascomycota Erikss. and Winka C. Tul. (mitosporic 520) Nectriaceae (GeneOmbio 520) 18 Fusarium brachygibbosum Ascomycota Sordariomycetes Hypocreales mitosporic Fusarium (GeneOmbio 567) Nectriaceae 19 Pleosporales sp. A10 Ascomycota Dothideomycetes Pleosporomycetidae Pleosporales Unclassified (GeneOmbio - 509) Pleosporales 20 Eutypa sp. (GeneOmbio - Ascomycota Sordariomycetes Xylariales Diatrypaceae Eutypa 531) 21 Talaromyces purpurogenus Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Talaromyces (GeneOmbio 560)
73
4.1.4.a Colonization rate and isolation rate of endophytic fungi in case of Ocimum sanctum: In case of Ocimum sanctum, the colonization rate was highest in stem at 34% followed by Leaf at 30% and was the least in roots at 20% (Table 17). The isolation rate also followed the same pattern with the highest in stem at 0.52 followed by leaf at 0.36 and was the least in roots at 0.24.
Table 17: Summary of endophytic fungi and colonization rate and isolation rate in respect of plant parts of Ocimum sanctum.
Ocimum sanctum Leaf Stem Root Total no of plant segments used 50 50 50 Total no of plant segments yielding 15 17 10 endophytes Total no of endophytic isolates obtained 18 26 12 Colonization Rate (%) 30% 34% 20% Isolation rate 0.36 0.52 0.24
4.1.4.b Colonization rate and isolation rate of endophytic fungi in case of Vitex negundo: In case of Vitex negundo, the colonization rate was highest in stem at 36% followed by leaf at 30% and was the least in roots at 18% (Table 18) .These observations almost match with that of Ocimum sanctum. The isolation rate also followed the same pattern with the highest in stem at 0.4 followed by leaf at 0.3 and was the least in roots at 0.2.
Table 18: Summary of endophytic fungi and colonization rate and isolation rate in respect of plant parts of Vitex negundo.
Vitex negundo Leaf Stem Root Total no of plant segments used 50 50 50 Total no of plant segments yielding 15 18 9 endophytes Total no of endophytic isolates obtained 15 20 10 Colonization Rate (%) 30% 36% 18% Isolation rate 0.3 0.4 0.2
4.1.4.c Colonization rate and isolation rate of endophytic fungi in case of Barleria prionitis: In case of Barleria prionitis, the colonization rate was highest in leaves at 26% followed by stem at 18% and was the least in roots at 10% (Table 19). The isolation rate also followed the same pattern with the highest in leaves at 0.3 followed by leaf at 0.2 and was the least in roots at 0.12.These observations were different from both Ocimum sanctum as well as Vitex
74
negundo where the stem showed maximum colonization rate as well as isolation rate followed by leaves.
Table 19: Summary of endophytic fungi and colonization rate and isolation rate in respect of plant parts of Barleria prionitis.
Barleria prionitis Leaf Stem Root Total no of plant segments used 50 50 50 Total no of plant segments yielding 13 9 5 endophytes Total no of endophytic isolates obtained 15 10 6 Colonization Rate (%) 26% 18% 10% Isolation rate 0.3 0.2 0.12
Ocimum sanctum
40 Vitex negundo 36% 34% Barleria prionitis 35 30% 30% 30 26%
25 20% 20 18% 18%
15
Colonization Colonization rate 10% 10
5
0 Leaf Stem Root
Plant part
Fig. 7. Colonization Rate of plant part samples in three medicinal plants.
75
Ocimum sanctum 0.6 0.52 Vitex negundo 0.5 Barleria prionitis 0.4
0.4 0.36
0.3 0.3 0.3 0.24 0.2 0.2
Isolation rate Isolation 0.2 0.12
0.1
0 Leaf Stem Root Plant part
Fig. 8. Isolation rate of plant part samples in three medicinal plants. 4.1.4.d Colonization rate and isolation rate of endophytic fungi for all three medicinal plants taken together: The colonization rate was highest in stem at 29.33% only marginally higher than that in leaves at 28.67% and was the least in roots at 16% (Table 20). The isolation rate also followed the same pattern with the highest in stem at 0.37 again only marginally higher than that in leaves at 0.32 and was the least in roots at 0.19.
Table 20: Summary of endophytic fungi and colonization rate and isolation rate in respect of plant parts of all three plants taken together.
All three medicinal plants taken together Leaf Stem Root Total no of plant segments used 150 150 150 Total no of plant segments yielding 43 44 24 endophytes Total no of endophytic isolates obtained 48 56 28 Colonization Rate (%) 28.67 29.33 16.00 Isolation rate 0.32 0.37 0.19
76
Overall Colonization Rate (%) Overal Isolation rate 28.67 29.33 0.37 30.00 0.40 0.32 0.35 25.00 0.30 20.00 16.00 0.25 0.19 15.00 0.20 0.15 10.00 Isolatedrate
Colonization Colonization rate 0.10 5.00 0.05 0.00 0.00 Leaf Stem Root Leaf Stem Root
Fig. 9. Overall colonization Rate. Fig. 10. Overall Isolation Rate.
4.1.5 The density of colonization (rD%) or colonization frequency (CF%) of an individual endophytic species in three medicinal plants:
The density of colonization is important from the point of view of selecting the appropriate species for future commercial production of the useful compound as it indicates the percentage of segments colonized by each fungus with respect to the total number of segments inoculated. The density of colonization (rD%) or colonization frequency (CF%) of a single endophyte species was calculated by the method of Fisher and Petrini (1987). The formula is –
rD % = (Ncol/Nt) × 100
Ncol = Number of segments colonized by each fungus Nt = Total number of segments inoculated
4.1.5.a The density of colonization (rD%) or colonization frequency (CF%) of different species of endophytic fungi isolated from Ocimum sanctum:
The highest density of colonization (rD%) was recorded for Colletotrichum gloeosporioides Penz. at 8.67% (Table 21). It was followed by Phomopsis archeri B. Sutton (5.33%). Nigrospora state of khuskia oryzae H.J.Hudson and Fusarium sp. had the same density of colonization at 4.67%. The other species showing density of colonization between 1% to 3% were Alternaria raphani J.W. Groves and Skolko, Penicillum sp., Aspergillus flavus and Colletotrichum lindemuthianum (sacc.andmagn).
77
Table 21: Colonization density of species of endophytic fungi isolated from Ocimum sanctum
Species rD% of Ocimum sanctum Colletotrichum gloeosporioides Penz. 8.67 Phomopsis archeri B. Sutton 5.33 Nigrospora state of khuskia oryzae H.J.Hudson. 4.67 Fusarium sp. (GeneOmbio 520) 4.67 Alternaria raphani J.W. Groves and Skolko 2.67 Penicillum sp. 2.00 Aspergillus flavus gr. 2.00 Colletotrichum lindemuthianum(sacc.andmagn) 1.33 Curvularia borreriae (Viegas) M.B. Ellis 1.33 Nigrospora sphaerica (Sacc.) Mason 0.67 Cladosporium sphaerospermum Penz. 0.67 Phoma glomerata (cda) Wollenw and Hochapf 0.67 Pleosporales sp. A10 (GeneOmbio - 509) 0.67
4.1.5.b The density of colonization (rD%) or colonization frequency (CF%) of different species of endophytic fungi isolated from Vitex negundo:
As in the case of Ocimum sanctum, the highest density of colonization (rD%) in case of Vitex negundo was also recorded for Colletotrichum gloeosporioides Penz. (6%) followed similarly by Phomopsis archeri B. Sutton (3.33%). It was followed by Nigrospora state of khuskia oryzae H. J. Hudson, Aspergillus flavus, Alternaria raphani J.W. Groves and Skolko and Fusarium sp. all at 2% (Table 22).
Table 22: Colonization density of species of endophytic fungi isolated from Vitex negundo.
Species rD% of Vitex negundo Colletotrichum gloeosporioides Penz. 6.00 Phomopsis archeri B. Sutton 3.33 Nigrospora state of khuskia oryzae H.J.Hudson. 2.00 Aspergillus flavus gr. 2.00 Alternaria raphani J.W. Groves and Skolko 2.00 Fusarium sp. (GeneOmbio 520) 2.00 Nigrospora sphaerica (Sacc.) Mason 1.33 Penicillum sp. 1.33 Curvularia borreriae (Viegas) MB Ellis 1.33 Mucor hiemalis Wehmer 1.33 Cladosporium sphaerospermum Penz. 0.67 Phoma glomerata (cda) Wollenw and Hochapf 0.67 Monodictys paradoxa (Corda) Hughes 0.67 Eutypa sp. (GeneOmbio - 531) 0.67 Talaromyces purpurogenus (GeneOmbio 560) 0.67
78
4.1.5.c The density of colonization (rD%) or colonization frequency (CF%) of different species of endophytic fungi isolated from Barleria prionitis:
The highest density of colonization (rD%) was recorded for Fusarium sp.(5.33). It was followed by Nigrospora sphaerica (Sacc.) Mason and Phomopsis archeri B. Sutton both at 2.67%. The other species showing density of colonization between 1% to 2% were Penicillum sp., Fusarium semitectum Berk and Rav. and Aspergillus flavus (Table 23).
Table 23: Colonization density of species of endophytic fungi isolated from Barleria prionitis
Species rD% of Barleria prionitis Fusarium sp. (GeneOmbio 520) 5.33 Nigrospora sphaerica (Sacc.)Mason 2.67 Phomopsis archeri B. Sutton 2.67 Penicillum sp. 2.00 Fusarium semitectum Berk. and Rav. 1.33 Aspergillus flavus gr. 1.33 Colletotrichum gloeosporioides Penz. 0.67 Nigrospora state of khuskia oryzae H.J.Hudson. 0.67 Curvularia borreriae (Viegas)M.B. Ellis 0.67 Drechslera australiensis Bugnic.ex M.B. Ellis 0.67 Trichoderma harzianum Rifai 0.67 Fusarium brachygibbosum (GeneOmbio 567) 0.67
4.1.5.d The density of colonization (rD%) or colonization frequency (CF%) of different species of endophytic fungi isolated from all three medicinal plants together:
The highest density of colonization (rD%) was recorded for Colletotrichum gloeosporioides Penz. at 5.11%. It was followed by Fusarium sp. (4%) and Phomopsis archeri B. Sutton (3.78%). Nigrospora state of khuskia oryzae H. J. Hudson came next with the density of colonization at 2.44%. The other species showing density of colonization between 1% to 2% were Penicillum sp., Aspergillus flavus, Nigrospora sphaerica (Sacc.) Mason and Curvularia borreriae (Viegas) MB Ellis (Table 24).
79
Table 24: Colonization density of different species of endophytic fungi isolated from all three medicinal plants.
Overall rD% for all three medicinal Species plants Colletotrichum gloeosporioides Penz. 5.11 Fusarium sp. (GeneOmbio 520) 4.00 Phomopsis archeri B. Sutton 3.78 Nigrospora state of khuskia oryzae H.J.Hudson. 2.44 Penicillum sp. 1.78 Aspergillus flavus gr. 1.78 Nigrospora sphaerica (Sacc.) Mason 1.56 Alternaria raphani J.W. Groves and Skolko 1.56 Curvularia borreriae (Viegas) M.B. Ellis 1.11 Colletotrichum lindemuthianum (sacc. and magn) 0.44 Fusarium semitectum Berk. and Rav. 0.44 Cladosporium sphaerospermum Penz. 0.44 Phoma glomerata (cda)Wollenw and Hochapf 0.44 Mucor hiemalis Wehmer 0.44 Monodictys paradoxa (Corda) Hughes 0.22 Drechslera australiensis Bugnic. ex M.B. Ellis 0.22 Trichoderma harzianum Rifai 0.22 Fusarium brachygibbosum (GeneOmbio 567) 0.22 Pleosporales sp. A10 (GeneOmbio - 509) 0.22 Eutypa sp. (GeneOmbio - 531) 0.22 Talaromyces purpurogenus (GeneOmbio 560) 0.22
80
Trichoderma harzianum Drechslera australiensis Mucor hiemalis Wehmer Monodictys paradoxa Rifai Bugnic.ex M.B. Ellis Fusarium brachygibbosum (Corda) Hughes Phoma glomerata Pleosporales sp. A10 (cda)Wollenw & Hochapf (GeneOmbio - 509)
Cladosporium Eutypa sp. (GeneOmbio - sphaerospermum Penz. 531)
Fusarium semitectum Berk.& Talaromyces purpurogenus Rav. Colletotrichum Colletotrichum lindemuthianum gloeosporioides Penz. (sacc.&magn) Curvularia borreriae (Viegas)MB Ellis Fusarium sp. (GeneOmbio 520) Alternaria raphani JW Groves and Skolko
Nigrospora sphaerica (Sacc.) Mason
Aspergillus flavus gr.
Phomopsis archeri B. sutton
Penicillum sp. Nigrospora state of khuskia oryzae H.J.Hudson.
Fig. 11. Colonization density of different species of endophytic fungi isolated from all three medicinal plants. 4.2. The identification of endophytic fungi:
Identification of endophytic fungi was carried out in two stages:
1. First stage: All endophytic fungi were initially identified by morphological method. Sporulating structures of fungi were considered as diagnostic features for identification of endophytes. Standard taxonomic keys and monographs were used to identify all the endophytic isolates and were placed in appropriate genera and species (Table 25,26 and 27). Authoritative monographs and other taxonomic papers relating to particular genera and species of endophytes were referred for identification of endophytes. ‘Methuen Handbook of Colour’ (Kornerup and Wanscher 1978) was used for colour differentiation of cultures. There were total 15 non-sporulating species among the 132 fungi. The efforts to induce sporulation by grass leaf technique also failed. Out of these, 4 species (Culture nos. 509,531,560,582) showing significant antibacterial activity were subjected to molecular identification at GeneOmbio Technologies Pvt. Ltd. All these four endophytic fungi were identified by molecular analysis. One culture no. 592 which was also non-sporulating did not respond to the
81
PCR and hence no report could be generated. Thus these 4 species which have been identified are not included in non-sporulating category in the final analysis but are included as identified species among the 121 endophytes and remaining 11 are included in non-sporulating species.
Table 25: Endophytic fungi from Ocimum sanctum.
Sr. NFCCI Culture No. Source Identification Remark No Accession 1 501 Stem 3005 Cladosporium sphaerospermum Penz. 2 502 Leaf 3006 Colletotrichum gloeosporioides Penz. 3 503 Root 3007 Aspergillus flavus gr. 4 508 Stem 3012 Colletotrichum gloeosporioides Penz. 6 510 Leaf 3013 Nigrospora state of khuskia oryzae H.J.Hudson. 7 511 Leaf 3058 Colletotrichum lindemuthianum (sacc.andmagn) 8 512 Stem 3059 Penicillum sp. 9 514 Leaf 3060 Colletotrichum gloeosporioides Penz. 11 516 Stem 3061 Colletotrichum gloeosporioides Penz. 12 517 Root 3062 Curvularia borreriae (Viegas) M.B. Ellis 13 518 Leaf 3063 Phoma glomerata (cda) Wollenw and Hochapf 14 519 Leaf 3064 Phomopsis archeri B. Sutton 15 520 Stem 3065 Fusarium sp. 16 521 Stem 3066 Penicillum sp.
Table 26: Endophytic fungi from Vitex negundo.
Sr. NFCCI Culture No. Source Identification Remark No Accession 1 504 Stem 3008 Colletotrichum gloeosporioides Penz. 2 505 Stem 3009 Phomopsis sp. aff. P. archeri B. Sutton 3 506 Leaf 3010 Colletotrichum gloeosporioides Penz. 4 507 Root 3011 Nigrospora state of Khuskia oryzae H.J. Hudson 5 532 Leaf 3087 Colletotrichum gloeosporioides Penz. 6 535 Leaf 3070 Phomopsis archeri B. Sutton 7 536 Stem 3088 Alternaria raphani J.W. Groves and Skolko 8 538 Leaf 3076 Aspergillus flavus gr. 9 539 Leaf 3083 Nigrospora sphaerica (Sacc.) Mason 10 543 Root 3079 Monodictys paradoxa (Corda) Hughes 11 552 Stem 3077 Penicillum sp. 12 554 Stem 3089 Mucor hiemalis Wehmer 13 561 Root 3090 Mucor hiemalis Wehmer
82
Table 27: Endophytic fungi from Barleria prionitis.
Sr. NFCCI Culture No. Source Identification Remark No Accession 1 565 Leaf 3082 Colletotrichum gloeosporioides Penz. 2 567 Leaf 3009 Fusarium sp. 3 569 Leaf 3010 Curvularia borreriae (Viegas) M.B. Ellis 4 570 Stem 3011 Fusarium sp. 5 575 Leaf 3087 Aspergillus 6 578 Leaf 3070 Nigrospora sphaerica (Sacc.) Mason 7 579 Leaf 3088 Drechslera australiensis Bugnic.ex M.B. Ellis 8 580 Leaf 3076 Fusarium sp. Phomopsis archeri B. Sutton (Molecular 9 582 Leaf 3083 Identification) 10 590 Root 3079 Trichoderma harzianum Rifai 11 594 Stem 3077 Penicillum sp. 12 595 Stem 3089 Fusarium semitectum Berk. and Rav.
2. Second Stage: The selected endophytic fungi showing substantial antibacterial activity were then subjected to molecular identification. The molecular identification was carried out at GeneOmbio Technologies Pvt. Ltd. Pune. The results in respect of the some selected fungi are discussed in detail in ensuing paragraphs.
4.2.1 Molecular identification of Phomopsis sp. aff. P. archeri B. Sutton isolated from culture no. 505 of Vitex negundo:
1. Sequence – Partial sequencing of the ITS region for sample ENS505 resulted in 526 bp long sequence. CCTGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTACTGTTGCCTCGGC GCAGGCCGTCCTTACGGGACCCTTGGTAACAAGGAGCAGCCGGCCGGTGGC CAGGTTAACTCTTGTATTAATTTGTCTCTCTGAGCATAAACATAAATGAATCAA AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAA ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAAC GCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTC AACCCTCAAGCCTGGCTTGGTGTTGGGGCACTGCCTGTAAAAGGGCAGGCC CTGAAATATAGTGGCGAGCTCGCCAGGACTCCGAGCGTAGTAGTTAAACCCT CGCTTTGGAAGGCCTGGCGGTGCCCTGCCGTTAAACCCCAACTTTTGAAAAT TTGACCTCGGATCAGGTAGGAATACCCGGTGAACTTAAGCATATCA
83
2. Blast analysis -
The nr nucleotide database of NCBI having a composite data of GenBank, European Molecular Biology Laboratory (EMBL), DNA Data Bank of Japan (DDBJ) and Protein Data Bank (PDB) sequences were used for BLAST Search. The sample showed sequence similarity between 98-99% with known strain of Phomopsis sp. (Table 28 )
Table 28: Comparison of rDNA sequence of sample ENS505 with closely related taxa available in GenBank Database.
Gene bank entry JN153068 JN637950 JN153063 EU977295 JN153060 Sequence 99% 98% 98% 98% 98% Similarity Domain Fungi Fungi Fungi Fungi Fungi Phylum Ascomycota Ascomycota Ascomycota -- Ascomycota Class Sordariomycetes Sordariomycetes Sordariomycetes -- Sordariomycetes Order Diaporthales Diaporthales Diaporthales -- Diaporthales Family Valsaceae Diapothales Valsaceae -- Valsaceae Genus Phomopsis Diaporthales Phomopsis -- Phomopsis Species sp. CML 1936 sp. E9919c sp. CML 1507 -- sp. CML 1502
3. Brief description of closest genetic neighbor as it appears in NCBI GeneBank
Database - JN153068: PHOMOPSIS SP. CML 1936 18S RIBOSOMAL RNA GENE, PARTIAL SEQUENCE; INTERNAL TRANSCRIBED SPACER 1, 5.8S RIBOSOMAL RNA GENE, AND INTERNAL TRANSCRIBED SPACER 2, COMPLETE SEQUENCE; AND 28S RIBOSOMAL RNA GENE, PARTIAL SEQUENCE
84
4. Guiding phylogenetic tree :
Guiding phylogenetic tree was drawn using topological algorithm with first five hits in NCBI nucleotide sequence database. Tree generated using bootstrap method on GeneBee online TreeTop-Phylogenetic Tree Prediction program appeared as in Fig. 12.
Fig. 12. Guiding phylogenetic tree for Phomopsis sp. aff. P. archeri B. Sutton isolated from culture no. 505 of Vitex negundo.
85
Distance Matrix –
1 2 3 4 5 6 1 EU977295 0.000 0.003 0.000 0.000 0.029 0.034 2 JN153060 0.003 0.000 0.003 0.003 0.031 0.037 3 JN153063 0.000 0.003 0.000 0.000 0.029 0.034 4 JN637950 0.000 0.003 0.000 0.000 0.029 0.034 5 FI02 0.029 0.031 0.029 0.029 0.000 0.010 6 JN153068 0.034 0.037 0.034 0.034 0.010 0.000
5. Brief taxonomy of Phomopsis sp. (Plate II, Fig. 1)
Colonies fast growing, reaching up to 3.5 cm diameter in 7 days on PDA, dry, growing in concentric rings, margin regular, white to satin white, reverse greyish brown to dark brown Conidiomata pycnidial. Pycnidia globose to ubglobose, eustromatic, dark brownish to black, scattered or aggregated and confluent, thick-walled, ostiolate. Conidiophores branched, 1–2 septate at the base, hyaline, filiform, formed from the inner cells of the locule. Conidiogenous cells enteroblastic, phialidic, determinate, integrated, hyaline and cylindrical. Conidia of two basic types - alpha (α) conidia, oval to cylindrical to fusiform, 1-celled with obtuse ends, hyaline; beta (β) conidia hyaline, linear, sharply curved at one end. (Sutton 1980)
4.2.2 Molecular identification of Phomopsis sp. aff. P. archeri B. Sutton isolated from culture no. 582 of Barleria prionitis:
1. Sequence – Partial sequencing of the ITS region for sample MSL582 resulted in 528 bp long sequence.
GCTTCGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTACTGTTGCCTCGG CGCAGGCCGGCCTCCCTGGAGGCCCCTCCGAGAGGAGGAGCAGCCCGCCGG CGGCCAACTAAACTCTTGTTTCTTAGTGAATCTCTGAGTAAAAAAACATAATG AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCG TCATTTCAACCCTCAAGCATTGCTTGGTGTTGGGGCACCGCCTGTAAAAGGG CGGGCCCTGAAATCTAGTGGCGAGCTCGCCAGGACCCCGAGCGTAGTAGTTA CATCTCGCTCTGGAAGGCCCTGGCGGTGCCCTGCCGTTAAACCCCCAACTTC TGAAATTTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA ATAAG
86
2. Blast Analysis -
The nr nucleotide database of NCBI having a composite data of GenBank, European Molecular Biology Laboratory (EMBL), DNA Data Bank of Japan (DDBJ) and Protein Data Bank (PDB) sequences were used for BLAST Search. The sample showed sequence similarity between 98-100% with known strain of Phomopsis sp. (Table 29)
Table 29: Comparison of rDNA sequence of sample ENS582 with closely related taxa available in GenBank Database.
Gene bank entry EU256482 GQ461581 KC007266 KC007265 FJ827629 Sequence 100% 99% 98% 98% 98% Similarity Domain Fungi Fungi Fungi Fungi Fungi Phylum Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Class Sordariomycetes Sordariomycetes Sordariomycetes Eurotiomycetes Sordariomycetes Order Diaporthales Diaporthales Diaporthales Diaporthales Diaporthales Family Valsaceae Valsaceae Valsaceae Valsaceae Valsaceae Genus Phomopsis Phomopsis Phomopsis Phomopsis Phomopsis Species sp. YM311483 sp. G10-20 sp. C_1_BESC_294j sp. C_1_BESC_294i sp. CPK3471
3. Brief description of closest genetic neighbor as it appears in NCBI GeneBank Database - EU256482: PHOMOPSIS SP. YM311483 INTERNAL TRANSCRIBED SPACER 1, PARTIAL SEQUENCE; 5.8S RIBOSOMAL RNA GENE AND INTERNAL TRANSCRIBED SPACER 2, COMPLETE SEQUENCE; AND 28S RIBOSOMAL RNA GENE, PARTIAL SEQUENCE
87
4. Guiding phylogenetic tree Guiding phylogenetic tree was drawn using topological algorithm with first five hits in NCBI nucleotide sequence database. Tree generated using bootstrap method on GeneBee online TreeTop-Phylogenetic Tree Prediction program appeared as in Fig. 13.
Fig. 13. Guiding phylogenetic tree for Phomopsis sp. aff. P. archeri B. Sutton isolated from culture no. 582 of Barleria prionitis.
88
Distance Matrix –
1 2 3 4 5 6 1 KC007265 0.000 0.000 0.000 0.034 0.034 0.048 2 FJ827629 0.000 0.000 0.000 0.034 0.034 0.048 3 KC007266 0.000 0.000 0.000 0.034 0.034 0.048 4 FI10 0.034 0.034 0.034 0.000 0.000 0.017 5 EU256482 0.034 0.034 0.034 0.000 0.000 0.017 6 GQ461581 0.048 0.048 0.048 0.017 0.017 0.000
5. Brief taxonomy of Phomopsis sp. (Plate II, Fig. 1)
Colonies fast growing, reaching up to 3.5 cm diameter in 7 days on PDA, dry, growing in concentric rings, margin regular, white to satin white, reverse greyish brown to dark brown Conidiomata pycnidial. Pycnidia globose to ubglobose, eustromatic, dark brownish to black, scattered or aggregated and confluent, thick-walled, ostiolate. Conidiophores branched, 1–2 septate at the base, hyaline, filiform, formed from the inner cells of the locule. Conidiogenous cells enteroblastic, phialidic, determinate, integrated, hyaline and cylindrical. Conidia of two basic types - alpha (α) conidia, oval to cylindrical to fusiform, 1-celled with obtuse ends, hyaline; beta (β) conidia hyaline, linear, sharply curved at one end. (Sutton 1980)
4.2.3 Molecular identification of Alternaria raphani JW Groves and Skolko isolated from culture no. 536 of Vitex negundo:
1. Sequence – Partial sequencing of the ITS region for sample MN2S536 resulted in 515 bp long sequence. ACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAATCTCTCGGG GTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCT TGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATC AGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTC TGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAA TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAA GGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGG CGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGG CCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCT AGCATCCATTAAGCCTTTTTCAACTTTTGACCTCGGATCAGG
89
2. Blast analysis –
The nr nucleotide database of NCBI having a composite data of GenBank, European Molecular Biology Laboratory (EMBL), DNA Data Bank of Japan (DDBJ) and Protein Data Bank (PDB) sequences were used for BLAST Search. The sample showed sequence similarity of 99% with known strain of Alternaria sp. (Table 30)
Table 30: Comparison of rDNA sequence of sample EN2S536 with closely related taxa available in GenBank Database.
Gene bank entry EU256482 GQ461581 KC007266 KC007265 FJ827629 Sequence 99% 99% 99% 99% 99% Similarity Domain Fungi Fungi Fungi Fungi Fungi Phylum Ascomycota Ascomycota Ascomycota Ascomycota Ascomycota Class Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Order Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Family Pleosporaceae Pleosporaceae Pleosporaceae Pleosporaceae Pleosporaceae Genus Alternaria Alternaria Alternaria Alternaria Alternaria Species sp. C19 brassicae sp. ZJ-2008017 sp. MBP13A brassicae
3. Brief description of closest genetic neighbor as it appears in NCBI GeneBank Database - KC010550: ALTERNARIA SP. C19 18S RIBOSOMAL RNA GENE, PARTIAL SEQUENCE; INTERNAL TRANSCRIBED SPACER 1, 5.8S RIBOSOMAL RNA GENE, AND INTERNAL TRANSCRIBED SPACER 2, COMPLETE SEQUENCE; AND 28S RIBOSOMAL RNA GENE, PARTIAL SEQUENCE
90
4. Guiding phylogenetic tree : Guiding phylogenetic tree was drawn using topological algorithm with first five hits in NCBI nucleotide sequence database. Tree generated using bootstrap method on GeneBee online TreeTop-Phylogenetic Tree Prediction program appeared as in Fig. 14.
Fig. 14. Guiding phylogenetic tree for Alternaria raphani J.W. Groves and Skolko isolated from culture no. 536 of Vitex negundo.
91
Distance Matrix –
1 2 3 4 5 6 1 FI04 0.000 0.003 0.003 0.003 0.003 0.003 2 KC010550 0.003 0.000 0.000 0.000 0.000 0.000 3 JX857165 0.003 0.000 0.000 0.000 0.000 0.000 4 JQ936168 0.003 0.000 0.000 0.000 0.000 0.000 5 JF694935 0.003 0.000 0.000 0.000 0.000 0.000 6 JN108900 0.003 0.000 0.000 0.000 0.000 0.000
5. Brief taxonomy of Alternaria sp. (Plate III, Fig. 3)
Colonies fast growing, reaching upto 6.5 cm in diameter in 7 days on PDA, dry, cottony, blackish brown, margin brownish black, reverse brownish black, margin brown, margin irregular, mycelium is septate, branched, whitish to greenish, gray, aging to dark olive. Conidiophores are simple, cylindrical erect or somewhat curved septate (3-7), greyish olive. Conidia produced singly or in short chain of 2-3 are irregular, oval, light greyish olive to greyish olive and smooth with 3-10, constricted at septa. (Thomma 2000).
4.3 Brief taxonomy of the other major endophytic fungi isolated from the different parts of the three medicinal plants is discussed in ensuing paragraphs:
1. Colletotrichum gloeosporioides (Plate II, Fig. 2) Colonies reaching up to 7.8 cm diameter in 7 days on PDA, fluffy, cottony, irregular, greenish grey, reverse brownish grey, Conidiomata acervular, setose. Setae brown, smooth, septate, tapered towards apex. Conidiophores hyaline to brown, septate, branched only at the base, smooth, formed from the upper cells of the conidiomata. Conidiogenous cells enteroblastic, phialidic, hyaline, smooth, determinate, cylindrical. Conidia hyaline, 1-celled, straight, obtuse at the apex, cylindrical. Appressoria abundant, clavate to irregular, thick-walled, olivaceous brown (Sutton 1980).
2. Nigrospora sphaerica (Plate III, Fig. 4) Colonies fast growing, reaching up to 8.1 cm diameter in 7 days on PDA, dry, fluffy, initially white, becoming greyish brown, darker in age when sporulation is abundant. Conidiophores macronematous, semimicronematous, branched, flexuous, sub-hyaline to pale brown, smooth. Conidiogenous cells, monoblastic, discrete, determinate, solitary,
92
ampulliform, hyaline. Conidiaspherical to broadly ellipsoid, solitary, simple, black, shiny, smooth, 0–septate.
3. Cladosporium sp. (Plate IV, Fig. 5) Colonies slow growing, reaching up to 2 cm diameter in 7 days on PDA, effused, appressed to the medium, olive green to olivaceous brown, Conidiophores macronematous, micronematous, pale to mid olivaceous brown, smooth to minutely verruculose. Ramo–conidia, 1 septate, smooth to occasionally, minutely verruculose, formed in long branched chains, 1-celled, ellipsoid to limoniform, olivaceous brown, smooth to minutely verruculose. (Ellis 1971; David 1997)
4. Curvularia sp. (Plate IV, Fig. 6) Colonies reaching up to 6.5 cm diameter in 7 days on PDA, greyish brown to black, reverse blackish brown, hairy, cottony. Conidiophores macronematous, mononematous, straight to slightly flexuous, brown, smooth. Conidiogenous cells polytretic, integrated, terminal, sometimes becoming intercalary, sympodial, cylindrical or occasionall swollen. Conidia solitary, acropleurogenous, simple, often curved, clavate, ellipsoid, broadly fusiform, obovoid or pyriform, 1–3 transverse septate, pale or dark brown, the end cells are paler, smooth with distinct hilum (Ellis 1971).
5. Fusarium sp. (Plate V, Fig. 7) Colonies reaching up to 3.1 cm diameter in 7 days on PDA, mycelium felted, pink to purple. Sporodochia abundant. Conidiophores simple to verticillately branched, hyaline, smooth, phialidic. Macroconidia slightly curved, apical cell slightly curved, basal cell foot-shaped, 1–3 septate. Microconidia abundant, thin-walled, ovoid to fusiform, 1- celled, hyaline. Chlamydospores abundant, intercalary, globose, thin-walled. (Leslie and Summerell 2006)
6. Aspergillus flavus (Plate V, Fig. 8) –
Colonies fast growing reaching upto 2 cm diameter in 7 days on PDA, light greenish yellow, reverse yellowish, Conidiophores arrows from submerged hypae, Conidial heads are typically radiate splitting to form loose columns, biseriate phialides born on vesicle , conidiospore stipe are hyline and coarsely roughened, conidia were pyriform, globose to subglobose, pale green echinulate, colourless, size of conidia varied from 3 to 4 µm
93
4.4. Antibacterial screening of fungal endophytes:
Antibacterial activity of the isolated endophytic fungi was screened against six bacteria – three gram positive and three gram negative pathogens. Screening of antibacterial activity was carried out by agar well diffusion technique. Respective wells were poured with 30µL/mL (1mg/100mL concentration) of the sample. In other wells, supplements of DMSO and reference antibacterial drug (Cloramphenicol) were used as negative and positive controls respectively. Experiment was carried out in triplicate. The plates were incubated at 370C for overnight and results were recorded as zone of inhibition in mm (Table 31, 32 and 33).
94
Table 31: Antibacterial activity of endophytic fungi of Ocimum sanctum.
[‘D’ – Diameter of inhibition zone); ‘-’ : No activity; ‘+’ : Poor (D<7mm); ‘++’ : Moderate (D=10mm to 20mm); ‘+++’ : Significant (D>20mm); H : Hexane; E.A. : Ethyl Acetate; M : Methane]
Sr.No. Endophytes S. typhi S. aureus B. subtilis B. cereus E. coli K. pneumoniae H E.A. M H E.A. M H E.A. M H E.A. M H E.A. M H E.A. M
1 501 - - - - - ++ - ++ - - - +++ - - - - ++ ++ 2 502 ++ - ++ - - +++ - + - - - +++ ++ ++ ++ - - - 3 503 - ++ - + ++ ++ ++ - - ++ ++ ++ - ++ - - ++ - 4 508 - ++ - - - ++ + ++ ++ - - - ++ ++ ++ - - - 5 509 +++ ++ + +++ ++ + - +++ ++ + - - ++ - - - - - 6 510 +++ ++ ++ - - - ++ - - - ++ - + ++ - - - - 7 511 ------+ ++ ++ - - - + ++ - - - - 8 512 ++ +++ - + - ++ - ++ ++ - - - ++ ++ +++ - - - 9 514 ++ - - + - - ++ ++ - ++ ++ - ++ ++ - - ++ - 10 515 + + - - - - ++ - - - ++ ------++ 11 516 ------+ - ++ - - - + - 12 517 - - - ++ ++ - ++ ++ - ++ ++ - ++ ++ - ++ ++ - 13 518 ------+ ++ - ++ ++ ------14 519 - - - - ++ ++ ++ ++ ++ ++ - +++ - - - + - - 15 520 ++ ++ + ++ ++ - ++ +++ - + ++ ++ ------16 521 ++ ++ - ++ - - +++ ++ - +++ +++ - +++ - - ++ ++ - 17 523 ++ ------++ - - ++ ++ - ++ - - 18 526 - ++ +++ ------++ - - - - -
95
Table 32: Antibacterial activity of endophytic fungi of Vitex negundo.
[‘D’ – Diameter of inhibition zone); ‘-’ : No activity; ‘+’ : Poor (D<7mm); ‘++’ : Moderate (D=10mm to 20mm); ‘+++’ : Significant (D>20mm); H : Hexane; E.A. : Ethyl Acetate; M : Methane]
Sr.No. Endophytes S. typhi S. aureus B. subtilis B. cereus E. coli K. pneumoniae H E.A. M H E.A. M H E.A. M H E.A. M H E.A. M H EA. M
1 504 ++ - - - - ++ ++ ++ - - - - ++ ++ ++ - ++ - 2 505 ++ +++ ++ ++ ++ ++ ++ ++ ++ - ++ ++ - - - +++ +++ +++ 3 506 ++ ++ - - - ++ - ++ ++ - - - ++ ++ ++ - - ++ 4 507 +++ +++ ++ - - - ++ - - - ++ - ++ ++ - - - ++ 5 531 ++ ++ - ++ ++ - ++ ++ - ++ ++ - - - - + - + 6 532 - ++ - + ++ - - ++ ++ ++ ++ ++ - - - - ++ - 7 535 - +++ - - ++ - ++ + - ++ - - - +++ - ++ + - 8 536 ++ +++ - ++ ++ - ++ +++ ++ ++ + ++ - ++ - - - ++ 9 538 - - - - ++ - - ++ - - ++ - - - - - + - 10 539 - - - ++ ++ - ++ ++ - ++ ++ ------11 540 ------++ ------++ - 12 543 ++ ------++ - - ++ ++ - ++ - - 13 550 ++ ------++ - ++ ++ ------14 552 - ++ ++ - - - ++ ++ - - - ++ ++ - - - -
15 554 ------++ - - - ++ ++ - ++ ++ - 16 560 ++ ++ - ++ ++ - ++ ++ - - - - ++ ++ - - - - 17 561 ------+++ - - ++ - - - - -
96
Table 33: Antibacterial activity of endophytic fungi of Barleria prionitis.
[‘D’ – Diameter of inhibition zone); ‘-’ : No activity; ‘+’ : Poor (D<7mm); ‘++’ : Moderate (D=10mm to 20mm); ‘+++’ : Significant (D>20mm); H : Hexane; E.A. : Ethyl Acetate; M : Methane]
Sr.No. Endophytes S. typhi S. aureus B. subtilis B. cereus E. coli K. pneumoniae H E.A. M H E.A. M H E.A. M H E.A. M H E.A. M H E.A. M
1 565 ------++ ++ ++ + ++ - - - - - ++ - 2 567 ------3 569 + ++ ------++ ++ - ++ ++ - - - - 4 570 ------+ ++ +++ - - ++ - - ++ - 5 572 - - - ++ ++ ------++ ++ - - - - 6 575 ------++ ------7 578 - - - + ++ - ++ ++ - ++ ++ ------8 579 ------+ ++ - - - - 9 580 ++ ++ - ++ ++ - + + ------10 582 ++ +++ - + ++ - ++ +++ ++ +++ ++ ++ - + - - - ++ 11 587 - - - ++ ++ ------12 590 - - - ++ - - - - ++ ------
13 592 ++ ++ - ++ ++ - - - ++ - - - ++ ++ - ++ ++ - 14 594 ++ ++ ------++ ++ - 15 595 ++ ++ - ++ ++ - ++ ++ ------
97
Plate II
A B
C D Fig. 1. Phomopsis Archeri B. Sutton A. Colony Morphology B. Conidiomata C. Alpha Conidia D. Beta Conidia
A B C Fig. 2. Colletotrichum gloeosporioides A. Colony Morphology B and C. Conidia
98
Plate III
A B C
Fig. 3. Alternaria raphani A. Colony Morphology B and C. Conidia
A B C
Fig. 4. Nigrospora spaerica A. Colony Morphology B and C. Conidia
99
Plate IV
A B
Fig. 5. Cladosporium sphaerospermum A. Colony Morphology B. Conidia
A B
Fig. 6. Curvularia sp. A. Colony Morphology B. Conidia
100
Plate V
A B
Fig. 7. Fusarium sp. A. Colony Morphology B. Conidia
A B
Fig. 8. Aspergillus flavus A. Colony Morphology B. Conidia
101
Plate VI
Fig. 9. Antibacterial activity of Phomopsis Fig. 10. Antibacterial activity of Phomopsis archeri B. Sutton showing inhibition against S. archeri B. Sutton showing inhibition against B. typhi culture no. 505 subtilis culture no. 519
Fig. 11. Antibacterial activity of Phomopsis Fig. 12. Antibacterial activity of Phomopsis archeri B. Sutton showing inhibition against B. archeri B. Sutton showing inhibition against B. subtilis culture no. 582 cereus culture no. 582
102
Plate VII
Fig. 13 Antibacterial activity of Aspergillus Fig. 14. Antibacterial activity of Penicillium flavus showing inhibition against S. aureus sp. showing inhibition against B. cereus culture no. 503 culture no. 521
Fig. 15. Antibacterial activity of Alternaria Fig. 16. Antibacterial activity of Pleosporales sp. showing inhibition against B. subtilis sp. showing inhibition against S. typhis culture culture no. 536 no. 509
103
Plate VIII
Fig. 17. Non sporulating species Fig. 18. Non sporulating species corresponding to culture no. 509 identified as corresponding to culture no. 531 identified as Unclassified Pleosporales sp. Eutypa sp.
Fig. 19. Non sporulating species Fig. 20. Non sporulating species corresponding to culture no. 560 identified as corresponding to culture no. 582 identified as Talaromyces sp. Phomopsis archeri B. Sutton
104
Plate IX
A B
Fig. 21. Colonies of endophytic fungi on A. Water agar B. PDA
Fig. 22. Actively growing culture in Erlenmeyer flask containing medium.
Fig. 23. Liquid - Liquid Extraction by organic solvents
105
B
Plate X
Fig. 24. Microscopic observation by slide culture technique
Fig. 25. Microscopic observation by staining
106
Plate XI
Fig. 26. Plates showing colony morphology of various endophytic fungi
107
4.4.1 Analysis of antibacterial screening of fungal endophytes:
1. Out of the 50 enlisted endophytic fungi, 98% endophytic fungi showed moderate to significant antibacterial activity at least against one test bacteria. 32% of the endophytic fungi showed significant antibacterial activity at least against one test bacteria. This number was highest in Ocimum sanctum. 50% of the endophytic fungi isolated from Ocimum sanctum showed significant antibacterial activity at least against one test bacteria (Table 34).
2. Total 5 endophytic fungi showed moderate to significant antibacterial activity against every one of all six test bacteria. These 5 endophytic fungi were Aspergillus flavus from the root of Ocimum sanctum, Penicillum sp. from stem of Ocimum sanctum, Phomopsis archeri B. Sutton from leaf of Vitex negundo, Alternaria raphani J.W. Groves and Skolko from stem of Vitex negundo and Phomopsis archeri B. Sutton from leaf of Barleria prionitis.
3. Penicillum sp. isolated from Ocimum sanctum showed significant antibacterial activity against 4 bacterial strains.
4. Pleosporales sp. A10 isolated from Ocimum sanctum showed significant antibacterial activity against 3 bacterial strains.
5. Phomopsis sp. aff. P. archeri B. Sutton isolated from stem of Vitex negundo showed significant antibacterial activity against 4 bacterial strains whereas the same endophytic fungi isolated from the leaf of the same plant showed significant antibacterial activity against 2 bacterial strains.
6. Phomopsis archeri B. Sutton isolated from leaf of Barleria prionitis showed significant antibacterial activity against 3 bacterial strains.
108
Table 34: Degree of antibacterial activity in case of endophytic fungi isolated from three medicinal plants.
% % % % S. Description of degree of Ocimum out Vitex out Barleria out out Total No. antibacterial activity sanctum of negundo of prionitis of of 18 17 15 50 1 Moderate to Significant antibacterial activity at least 18 10 17 100 14 93 49 98 against one test bacteria 2 Significant antibacterial activity at least against one 9 50 5 29 2 13 16 32 test bacteria 3 Some antibacterial activity against every one of all six 3 17 2 12 1 7 6 12 test bacteria 4 Moderate to Significant antibacterial activity against every one of all six 2 11 2 12 1 7 5 10 test bacteria in any base (out of item no. 3)
Maximum instances of significant antibacterial activity in any base against any test bacteria were shown by the endophytic fungi listed in Table 35.
Table 35: Maximum instances of significant antibacterial activity in any base against any test bacteria.
Ocimum Barleria Vitex negundo sanctum prionitis No. of instances of significant antibacterial 2 times 4 times 3 times activity in any base against any test bacteria Phomopsis Phomopsis Pleosporales Endophytic Fungi archeri B. archeri B. A10 Sutton Sutton Sample Culture No.509 Culture No. 505 Culture No. 582
7. The endophytic fungi isolated from the three medicinal plants showed maximum effectiveness against S. typhi with 10 instances of significant antibacterial activity noticed against it. The second best effectiveness of the endophytic fungi isolated from the three medicinal plants was observed against B. cereus with 8 instances of significant antibacterial activity noticed against it. B. subtilis was also found to be vulnerable to the endophytic fungi isolated from these medicinal plants as 5 instances were noted where significant antibacterial activity was noticed against it.
109
Table 36: Instances of significant antibacterial activity of extracts of endophytic fungi in three bases.
K. S. typhi S. aureus B. subtilis B. cereus E. coli pneumoniae H EA M H EA M H EA M H EA M H EA M H EA M
Ocimum 2 1 1 1 0 1 1 2 0 1 1 3 1 0 1 0 0 0 sanctum Vitex 1 4 0 0 0 0 0 1 0 1 0 0 0 1 0 1 1 1 negundo Barleria 0 1 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 prionitis 3 6 1 1 0 1 1 4 0 3 2 3 1 1 1 1 1 1 Total 10 2 5 8 3 3 H-Hexane; EA-Ethyl Acetate; M-Methanol
8. The endophytic fungi found to be effective against test bacteria are given in Table 37.
9. The basic analysis of antibacterial activity revealed that the extracts in ethyl acetate were more effective as compared to those in Hexane or methanol (Table 38) Significant antibacterial activity against any test bacteria was observed 15 times with ethyl acetate whereas with hexane and methanol, it was observed for 11 and 8 times respectively. Moderate to significant antibacterial activity taken together against any test bacteria was observed 119 times with ethyl acetate whereas with hexane and methanol, it was observed for 99 and 47 times respectively. In individual plant analysis, the same pattern was observed in Barleria prionitis and Vitex negundo with a minor exception in case of Ocimum sanctum. In case of Ocimum sanctum, significant antibacterial activity against any test bacteria was observed in 4 cases with ethyl acetate which was lower than 7 such instances in case of hexane and methanol. However if the moderate and significant antibacterial activity is clubbed together, even Ocimum sanctum is no exception to the fact that endophytic fungi extracted in ethyl acetate showed indisputably superior performance as compared to hexane and methanol.
110
Table 37: Endophytic fungi found to be effective against respective bacteria.
S. typhi S. aureus B. subtilis Culture Endophytic fungi Culture No. Endophytic fungi Culture No. Endophytic fungi No. 509 Pleosporales A 10 509 Pleosporales A 10 509 Pleosporales A 10 Ocimum 510 Nigrospora state of khuskia oryzae 502 Colletotrichum gloeosporioides 520 Fusarium sp. sanctum 512 Penicillum sp. - - 521 Penicillum sp. 526 Alternaria raphani - - - - 505 Phomopsis P. archeri B. Sutton - - 536 Alternaria raphani Vitex 507 Nigrospora state of Khuskia oryzae - - - - negundo 535 Phomopsis archeri B. Sutton - - - - 536 Alternaria raphani - - - - Barleria Phomopsis archeri B. Sutton Phomopsis archeri B. Sutton 582 582 prionitis - - B. cereus E. coli K. pneumoniae Culture Endophytic fungi Culture No. Endophytic fungi Culture No. Endophytic fungi No. 501 Cladosporium sphaerospermum 512 Penicillum sp. - - Ocimum 502 Colletotrichum gloeosporioides 521 Penicillum sp. - - sanctum 519 Phomopsis archeri B. Sutton - - - - 521 Penicillum sp. - - - - Vitex Mucor hiemalis Wehmer 535 Phomopsis archeri B. Sutton 505 Phomopsis P. archeri B. 561 negundo Sutton Barleria 570 Fusarium sp. - - - - prionitis 582 Phomopsis archeri B. Sutton - - - -
111
Table 38: Instances of moderate to significant antibacterial activity of extracts of endophytic fungi isolated from three plants.
Moderate to significant Moderate antibacterial Significant antibacterial antibacterial activity activity against any test activity against any test taken together against bacteria bacteria any test bacteria
OS* VN * BP * Total OS* VN @ BP# Total OS* VN* BP* Total
Hexane 29 36 23 88 7 3 1 11 36 39 24 99 Ethyl 40 38 26 104 4 8 3 15 44 46 29 119 Acetate
Methanol 12 22 5 39 7 1 0 8 19 23 5 47 *OS-Ocimum sanctum; @VN - Vitex negundo ; #BP - Barleria prionitis
120
29 100 24 80
46 Barleria prionitis 60
39 Vitex negundo activity 5 Ocimum sanctum 40 23 44 20 36 19
No. of instances of instances No. moderate of to significant antibacterial 0 Hexane Ethyl Acetate Methanol Eluent
Fig. 15. Instances of moderate to significant antibacterial activity of extracts of endophytic fungi isolated from three plants.
112
4.4.2 Salient features of analysis of antibacterial screening of fungal endophytes: From the results discussed in the preceding paragraphs, it was observed that –
1) Phomopsis archeri B. Sutton was found in all the three medicinal plants – in leaf of Ocimum sanctum and Barleria prionitis and stem and leaf of Vitex negundo.
2) Phomopsis archeri B. Sutton isolated from Vitex negundo showed significant antibacterial activity in all three extracts against K. pneumoniae.
3) Phomopsis archeri B. Sutton isolated form Vitex negundo showed maximum antibacterial activity in terms of diameter of inhibition.
4) Maximum instances of significant antibacterial activity in any base against any test bacteria were shown by Phomopsis archeri B. Sutton isolated from Vitex negundo (4 times) followed by Phomopsis archeri B. Sutton isolated from Barleria prionitis (3 times).
5) Phomopsis sp. aff. P. archeri B. Sutton isolated from stem of Vitex negundo showed significant antibacterial activity against 4 bacterial strains whereas the same endophytic fungi isolated from the leaf of the same plant showed significant antibacterial activity against 2 bacterial strains.
6) Phomopsis archeri B. Sutton isolated from leaf of Barleria prionitis showed significant antibacterial activity against 3 bacterial strains.
Considering these facts, the Phomopsis archeri B. Sutton from Vitex negundo was selected for further study.
4.5 Process optimization for production of active metabolites from Phomopsis archeri B. Sutton isolated from Vitex negundo: In order to find out the supporting conditions for the enhanced growth in the production of crude/secondary metabolites by selected endophytic Phomopsis archeri B. Sutton and its potential activities against selected test bacteria, the process optimization study was carried out.
For primary screening, Potato Dextrose Agar (PDA), Sabouraud’s agar (SA), Czapek’s yeast extract agar (CYA), Malt extract agar (MEA) were used for evaluation of the growth rate. The maximum growth was observed in PDA medium (Fig. 16).
113
Considering these facts, the PDA medium was used for production. Different parameters like temperature, pH and incubation period were optimized with respect to fungal biomass and crude metabolite production in shake culture condition. The mycelial mats were filtered and dried at 500C until constant weight was obtained. The final fungal biomass was recorded in mg/100mL. Effects of temperature (250C, 270C, 300C), pH (3.0, 5.0, 7.0) and incubation period (15th and 21st day) were studied by inoculating the fungus in Potato Dextrose Broth and the effect on crude metabolite production was observed.
Fungal biomass and metabolite production increased from 15th to 21st day of incubation at all three temperatures i.e. 250C, 270C and 300C and at all different pH values of 3.0, 5.0 and 7.0. A similar trend was observed in the production of crude extract. The crude extract production increased from 15th to 21st day of incubation at all different pH values of 3.0, 5.0 and 7.0 and at all three temperatures i.e. 250C, 270C and 300C. At all the three temperatures i.e. 250C, 270C and 300C, the maximum growth was recorded at pH 5.0 after 21st day of incubation. The values of maximum fungal biomass production and maximum production of crude extract at these variables were 425 mg and 0.94 mg at 250C, 450 mg and 1.04 mg 270C and 403 mg and 0.61 mg at 300C respectively.
450 425 415 1.00
400 0.90 ) 350 0.94 0.80 310
304 (mg 300 0.70 215 245 0.64 0.66 250 0.60 200 0.54 0.50 0.52 0.55
150 0.40 metabolite
Biomass (mg) Biomass 100 0.30
50 0.20 Crude 0 0.10 3 5 7 3 5 7 15 21
Biomass at Incubation time (in days) and pH 25⁰C
Fig. 16. Effect of pH and incubation time on the growth and production of crude metabolite at 250 C in PD broth.
114
Biomass at 27⁰C Crude at 27⁰C 450 450 1.20 405 400
1.04 1.00
350 320 ) 300 280
300 0.80 (mg 0.67 250 217 0.58 0.68 0.60 200 0.54 0.62
150 0.40
metabolie metabolie
Biomass (mg) Biomass 100 0.20
50 Crude 0 0.00 3 5 7 3 5 7 15 21
Incubation time (in days) and pH
Fig. 17. Effect of pH and incubation time on the growth and production of crude metabolite at 270 C in PD broth.
Biomass at 30⁰C Crude at 30⁰C
450 0.70 403 380 400 0.60 0.57
350 0.52 0.61 ) 270 0.50
300 260 250 0.40 180 204 200 0.30 0.25 150 0.22 0.21 0.20 Biomass (mg) Biomass 100 50 0.10
0 0.00 (mg metabolite Crude 3 5 7 3 5 7 15 21
Incubation time (in days) and pH
Fig. 18. Effect of pH and incubation time on the growth and production of crude metabolite at 300 C in PD broth.
115
Combining all the variables together, it was observed that the maximum growth in fungal biomass production as well as the crude metabolite production was recorded at 270C at pH 5.0 on 21st day of incubation (Fig. 19).
450 450 1.20 425 Biomass 415 403 405 at 25⁰C Biomass 400 380 at 27⁰C 1.00 Biomass 350 at 30⁰C 320 310 Crude at 300 304 25⁰C 300 280 0.80 Crude at 270 260 27⁰C 245 250 Crude at 30⁰C 215 217 0.60
204 )
200 180
(mg
150 0.40
Biomass (mg) Biomass metabolite
100 0.20
50 Crude
0 0.00 3 5 7 3 5 7 15 21 Incubation time in days and pH
Fig. 19. Effect of pH, Incubation Time and Temperature on growth and production of crude metabolite (extract) by Phomopsis sp. in PD broth.
4.6 Minimum inhibitory concentration (MIC): The minimum inhibitory concentration (MIC) was calculated for a single selected fungal extract of Phomopsis isolated from Vitex negundo. The test was performed at six different concentrations i.e. 25, 50, 100, 200, 400, 800 μg/disc by agar disc diffusion method. The MIC value was found to be 100 μg/disc.
116
4.7 Chemical elucidation of secondary metabolite extracted from Phomopsis archeri B. Sutton isolated from Vitex negundo:
4.7.1 High Performance Thin Layer Chromatography (HPTLC): 1. Instrumentation: Instruments used were HPTLC system of CAMAG, Muttenz, Switzerland, Anchrom Enterprises (I) Pvt. Ltd, Mumbai, consisting of sample applicator (Linomat 5), Twin trough chamber with lid (10×10 cm, CAMAG, Muttenz, Switzerland), UV cabinet (Aetron, Mumbai) with dual wavelength (254/366 nm) and the HPTLC photodocumentation (Aetron, Mumbai) was used for study.
2. Chromatographic conditions: The sample (ethyl acetate extract) was applied in the form of band of width 6 mm with a 100 µL sample syringe (Hamilton, Bonaduz, Switzerland) on precoated silica gel aluminium plate 60 F254 (5×10) with 250 µm thickness (E. MERCK, Darmstadt, Germany) using a CAMAG Linomat 5 sample applicator (Switzerland). The plate was prewashed with methanol and activated at 110 0C for 5 minute, prior to chromatography. The optimized chamber saturation time for mobile phase was kept at 15 min. The length of chromatogram run was 9 cm. HPTLC plate was dried in a current of air with the help of a hair dryer. The slit dimensions of 5 × 0.45 mm and scanning speed of 20 mm/sec were employed in analysis.
3. Mobile phase: The composition of mobile phase was n-Hexane : Ethyl Acetate (7: 3)
4.7.2 Calculation of Rf values: Plate was observed in the daylight, under UV light (254 and 366 nm). After each observation the central points of spots appearing on chromatogram were marked with needle. Retention factor (Rf) was calculated by the formula of Chatwal and Anand (2004); Sethi and Charegaonkar, (1999). Rf = A/B A = distance between point of application and central point of spot of material being examined. B = distance between the point of application and the mobile phase front.
The Band 6 at Rf Value 0.476 was scratched and subjected to structure elucidation. The data was found to be matching to Luteolin - 7- glucoside (Fig. 20, 21 and 22).
117
Band 08
Band 06
Band 05
Band 04
Band 03
Band 02
Band 01
Fig. 20. HPTLC plate of Ethyl Acetate extract of compound isolated from Phomopsis archeri B. Sutton isolated from Vitex negundo at 366 nm, volume applied 10 l.
118
Band 08
Band 07
Band 06
Band 05
Band 04
Band 03 Band 02 Band 01
Fig. 21. HPTLC plate of Ethyl Acetate extract of compound isolated from Phomopsis archeri B. Sutton isolated from Vitex negundo at 254 nm, volume applied 10 l.
119
Band 06
Band 04
Band 01
Fig.22. HPTLC plate of Ethyl Acetate extract of compound isolated from Phomopsis archeri B. Sutton isolated from Vitex negundo at visible light, volume applied 10 l.
120
4.7.3 Recording details: IR spectra were recorded using KBr on “JASCO FT-IR 460 plus” instrument by DRIFT method. H-NMR spectra were recorded in CDCl3 solution on “FTNMR VARIAN MERCURY YH-300” using tetramethyl silane (TMS) as internal standard. Mass Spectra were recorded on “Shimadzu GC-MS QP-5050” instrument by direct injection method.
4.7.4 Elemental analysis: C- 56.10 H- 4.90 N- Nil
1. Interpretation of Infrared spectrum:
Fig. 23. Infrared Spectrum of compound derived from Phomopsis archeri B. Sutton isolated from Vitex negundo.
2. Interpretation of IR spectrum:
Table 39: Interpretation of IR spectrum
Frequency Sr. No. Part of molecule Vibration cm-1 a) C-H str 2991 1 Aliphatic CH 2 b) C-H bend 1446 1715 2 -C(O)-CH - a) C=O str 2 1030,1261 -C=C- ring a) C=C str 1624 3 (Furan ring) b) C-O str 1370 a) C-H str 3150 Ar ring 4 b) C=C str 1523
c) C-H bend 722 5 -OH groups a) O-H str 3389
121
3. Interpretation of NMR spectrum:
Fig. 24. NMR Spectrum of compound derived from Phomopsis archeri B. Sutton isolated from Vitex negundo. Table 40: Interpretation of NMR spectrum.
Sr. Protons Type no. 1 2.218 3 (s) OH Protons 2 3.234-3.385 1 +1 (d) CH2 Protons on ring of fused Benzopyran ring 3 3.412-3.764 6 (m) Protons on the pyran ring 4 5.422 1 (m) CH Proton on ring of fused Benzopyran ring 5 5.628 1 (d) CH Proton near oxygen linkage of the pyran ring 6 5.934-6.032 1 +1 (d) Aromatic Protons on ring of fused Benzopyran ring 7 6.325-6.616 3 (m) Protons on Benzene ring attached to Benzopyran ring 8 10.014 4 (s) OH Protons on pyran ring
122
4. Interpretation of GC-MS spectrum:
Fig. 25. Mass Spectrum of the compound derived from Phomopsis archeri B. Sutton isolated from Vitex negundo. 4.7.5 Probable structure of the compound from elemental analysis, IR and NMR and GC-MS:
Probable structure of the compound was determined from the elemental analysis, IR and NMR and GC-MS. It is Luteolin – 7- glucoside. The International Union of Pure and Applied Chemistry (IUPAC) name of the compound is 2,3-dihydro-5-hydroxy-2-(3,4- dihydroxyphenyl)-7-(tetrahydro-3,4,5-trihydroxy-6-(hydroxymethyl)-2H-pyran-2- yloxy)chromen-4-one
OH OH O
HO OH
HO O O O
OH
OH Fig. 26. Probable structure of the compound from elemental analysis, IR and NMR and GC- MS spectra
123
Chapter 6
Discussion
DISCUSSION
Human beings, during their evolution have always been searching for new remedies for reducing incidence of pathogens and eliminating the diseases caused by them in humans, animals as well as plants. The new solutions that have been discovered at a particular point of time, though have proved effective for a considerable period of time; have also given rise to newer problems in long run. Presently, the medical sciences worldwide have expressed increased global health concern over the issues like –
1) The failure of currently used antibiotics to many multi resistant and super resistant strains, 2) Indiscriminate exploitation of medicinal plants for extraction of antimicrobial agents of plant origin and 3) Limitations of plant resources due to various factors like requirement of land for cultivation, environmental competence of plants, seasonal specificity etc.
This has led various streams of sciences to have an increased interest in searching novel bioactive compounds having high effectiveness, low toxicity and negligible environmental impacts. Traditionally, humans have been predominantly dependent on remedial measures derived from medicinal plants. Further, the microbes in general have been an abundant source of novel chemo-types and pharmacophores from thousands of years. In recent past, endophytes, due to their capacity to produce novel bioactive compounds, have received attention of the scientific community. However, it was observed that the endophytes in the traditional medicinal plants are relatively unstudied. The traditional practitioners of medicine have been using various medicinal plants for curing various ailments and conditions due to their great potential for therapeutic use and extensive occurrence in India. However a scientific and rational approach to the traditional systems of medicine in harmony with the modern medical practices was found wanting. Bioprospecting of endophytic fungi has potential to establish a scientific basis for traditional therapeutic uses of medicinal plants.
5.1 Collection of plant samples, isolation of endophytic fungi and preservation of culture:
Healthy and mature plants of Ocimum sanctum, Vitex negundo and Barleria prionitis were selected from three locations. The segments were collected from leaves, stem, and roots. All the segments were subjected to surface sterilization. All the sterilized segments of each plant
124
part were placed on PDA medium supplemented with chloramphenicol (50 µg/mL) to inhibit bacterial growth. Plates were sealed with parafilm and incubated in dark at 270C for 1 week. The fungal growth was continuously monitored. Hyphal tips were transferred to fresh PDA. For preliminary isolation, only water agar supplemented with antibiotics was used. For obtaining pure culture, hyphal tips from water agar were transferred to PDA supplemented with chloramphenicol. Pure cultures were preserved on PDA slant maintained at 80C. The selected samples were then deposited in National Fungal Culture Collection of India (NFCCI), Agharkar Research Institute, Pune for identification.
5.2 Identification and cultivation of endophytic fungi and isolation of secondary metabolites:
The morphological identification of all fungi was carried out. In case of few selected samples, molecular identification was carried out.
For evaluation of the growth rate, three different media were used. The maximum growth was observed in PDA and hence the same was used for production of fungal biomass and crude extract.
In order to find out the supporting conditions for the enhanced growth in the production of crude/secondary metabolites by selected endophytic Phomopsis archeri B. Sutton, the process optimization study was carried out. It was observed that the maximum growth in fungal biomass productions as well as the crude metabolite production was recorded at 270C at pH 5.0 on 21st day of incubation.
5.3 Diversity and distribution of fungal endophytes:
Total 132 fungal endophytes were isolated from 450 segments. Maximum 56 i.e. 42% endophytic fungi were extracted from Ocimum sanctum followed by Vitex negundo which yielded 45 i.e. 34% of the total endophytic fungi isolated. From Ocimum sanctum, 15 different species were identified whereas Vitex negundo produced 16 species. Barleria prionitis harboured 13 species of endophytic fungi. Thus the data does not reveal any marked preference by endophytic fungi for any particular plant.
Colletotrichum gloeosporioides Penz., Nigrospora state of khuskia oryzae H.J.Hudson, Nigrospora sphaerica (Sacc.) Mason, Phomopsis archeri B. Sutton, Penicillum sp., Aspergillus flavus, Curvularia borreriae (Viegas) MB Ellis, Fusarium sp. and
125
Nonsporulating dematiaceous form were found in all the three plants thereby indicating that these endophytic fungi have no plant specific preferences. However, some endophytic fungi were found exclusively in one of the three plants. They were –
1) Ocimum sanctum - Colletotrichum lindemuthianum (sacc.andmagn) and Pleosporales sp. A10 2) Vitex negundo - Mucor hiemalis Wehmer, Monodictys paradoxa (Corda) Hughes, Eutypa sp., Talaromyces purpurogenus. 3) Barleria prionitis - Fusarium semitectum Berk. and Rav., Drechslera australiensis Bugnic.ex M.B. Ellis, Trichoderma harzianum Rifai, Fusarium brachygibbosum
More number of endophytic fungi were isolated from stem than the leaves and roots. Stem yielded 56 out of 132 i.e. 42% of endophytic fungi followed by leaves from which 48 i.e. 36% endophytic fungi were isolated. This trend of isolation of maximum endophytic fungi from stem was seen individually in Ocimum sanctum as well as Vitex negundo. However, Barleria prionitis was exception since higher number of endophytic fungi (15) were isolated from the leaves of Barleria prionitis as compared to its stem (10).
There are mixed results from different studies regarding plant, tissue and organ specificity of the endophytic fungi. The differences in colonization frequencies and tissue and organ specificity of endophytes in plant organs of different host species have been widely reported. Dreyfuss and Petrini (1984) have reported that some fungi are confined almost exclusively to the roots, whereas others to aerial plant organs. Sun et al. (2012) have reported significantly higher overall infection rates of endophytic fungi in twigs than in leaves in the three host plants whereas Fisher et al. (1995) has reported in one of the studies that roots harboured more endophytic fungi than stems or leaves. Many studies have reported more endophytic fungi infection rate in leaves than the other organs of host plants. The variations in colonization and isolation rates with respect to plants and their organs have been noted and are attributed to the distinct substrate utilization patterns developed by them. These studies indicate that the distribution of endophytic fungi depends on adaptation of chemistry of particular tissue of host plant organs. As against this, Zakaria et al. (2010) have reported that the occurrence of endophytic fungi in different parts of the plant was not tissue specific.
126
The specificity of endophytes for particular host tissues or organs can be assessed through careful dissection and separate culturing and analysis of samples from those tissues or organs (Carroll 1995). The focus point of present study was not the biodiversity of the endophytic fungi and hence the sample size was kept smaller i.e. 450 in all from three medicinal plants. A smaller sample size is not sufficient to make a conclusive remark on the plant, organ or tissue specificity of the endophytic fungi. Further the presence of some rapidly growing fungi that masks the presence of other slow growing fungi can also distort the results. However, the present results definitely indicate the possibility of plant and organ specificity of the endophytic fungi and hence needs further dedicated study with bigger sample size and thorough assessment through careful dissection and separate culturing and analysis of samples from those organs.
5.4 Major species isolated from three medicinal plants – distribution and antibacterial activity:
21 species belonging to 14 genera were isolated from the three medicinal plants. The most abundantly found species were Colletotrichum gloeosporioides, fusarium sp., Phomopsis archeri B. Sutton and Nigrospora state of Khuskia oryzae. This species trend was also evident in individual plants except for Nigrospora sphaerica, penicillium sp. and aspergillus flavus which were also found in majority in Barleria prionitis. Considering these facts, these can be said to form the core group of species isolated from the medicinal plants under investigation. In addition to this core group of species, some incidental species were also isolated. Bills and Polishook (1992) have defined incidental species as the one which is usually found once or twice in several hundred samples.
Monodictys paradoxa (Corda) Hughes isolated from Vitex negundo, Drechslera australiensis Bugnic.ex M.B. Ellis isolated from Barleria prionitis, Trichoderma harzianum Rifai isolated from Barleria prionitis, Fusarium brachygibbosum isolated form Barleria prionitis, Pleosporales sp. A10 isolated from Ocimum sanctum, Eutypa sp. isolated from Vitex negundo and Talaromyces Purpurogenus isolated from Vitex negundo are such incidental species identified from the present study. However, the findings need to be confirmed by studying a larger number of samples.
Pleosporales sp. A10 isolated from Ocimum sanctum has shown significant antibacterial activity against S. typhi, S. aureus and B. subtilis and moderate activity against E. coli. Hence
127
this endophytic fungus requires further study for possibility of extracting new bioactive metabolite having antimicrobial potential.
Monodictys paradoxa has shown moderate antibacterial activity against three test bacteria, Drechslera australiensis against one, Trichoderma harzianum Rifai against two, Fusarium brachygibbosum against none, Eutypa sp. against three and Talaromyces Purpurogenus has shown moderate antibacterial activity against four test bacteria. Thus the incidental species need to be investigated further selectively instead of discarding them as incidental occurrences.
5.4.1 Colletotrichum gloeosporioides: The most abundantly found species was Colletotrichum gloeosporioides. Not only that Colletotrichum gloeosporioides was found in most number of samples, it was found in all three medicinal plants. The overall colonization density for all three plants taken together was also highest in Colletotrichum gloeosporioides. In case of individual plants, the colonization density of Colletotrichum gloeosporioides was highest in Ocimum sanctum and Barleria prionitis.
The literature survey does not widely record the isolation of Colletotrichum gloeosporioides from Ocimum sanctum as well as Barleria prionitis. However, Dey et al. (2013) have reported the isolation of Colletotrichum sp. DM-06 from Ocimum sanctum. To this extent the isolation of Colletotrichum gloeosporioides from Ocimum sanctum is a new finding.
However, the isolation of Colletotrichum gloeosporioides has been reported from Vitex negundo. Arivudainambi et al. (2011) have reported that Colletotrichum gloeosporioides was isolated from the medicinal plant Vitex negundo L. and it exhibited substantial antimicrobial activity against bacterial and fungal strains.
The isolation of Colletotrichum gloeosporioides has also been widely reported to have been isolated from some other medicinal plants. It has been reported that Colletotrichum is a ubiquitous endophyte and has been reported from several plant hosts (Brown et al. 1998). Siqueira et al. (2011) concluded that Colletotrichum gloeosporioides had the maximum colonization frequency among the endophytes isolated from lippia sidoides - medicinal plant used as antiseptic in northeast of Brazil. Wang et al. (2000) have reported that Colletotrichum gloeosporioides is an endophyte of Taxus mairei which showed high colonization in leaf. Endophytic fungi Colletotrichum gloeosporioides isolated from the plant Vitex negundo has
128
been reported as a potential source for production of metabolites against multi drug resistant S. aureus by Arivudainambi et al. (2011). Brown et al. (1998) in their study have concluded that the only endophytic taxa to be recorded at all sites except one were Colletotrichum gloeosporioides or its teleomorph Glomerella cingulata. They have further reported that Colletotrichum gloeosporioides was the most frequent endophyte isolated in Hong Kong (22 % of discs) and Glomerella cingulata (12 %) was the most frequently isolated endophtye in southeast Queensland.
Colletotrichum gloeosporioides isolated from Ocimum sanctum and Vitex negundo showed consistent antibacterial activity against E. coli in all three extracts in hexane, ethyl acetate and methanol. Colletotrichum gloeosporioides extracted in methanol isolated from Ocimum sanctum has shown significant antibacterial activity against B. cereus. It also showed consistent antibacterial activity against B. subtilis and S. typhi. These findings are in agreement with other reported observations about Colletotrichum gloeosporioides. Colletotrichum gloeosporioides isolated from different medicinal plants are reported to have shown significant antibacterial activity against different test bacteria and to produce novel antimicrobial metabolites.
A study by Gangadevi and Muthumary (2008) states that the production of taxol by fungal endophyte Colletotrichum gloeosporioides was first reported from a medicinal plant Justicia gendarussa Burm. f. (Acanthaceae). It has been further reported in the same study that the discovery of certain endophytic fungi being able to produce taxol has brought to the front the possibility of cheaper and more widely available products being produced via industrial fermentation. The major problem in using fungi fermentation for production of taxol is the very low yield of the process and unstable production. The amount of taxol produced by most endophytic fungi of Taxus trees is small as compared to that of the other trees. However, the short generation time and high growth rate of fungi makes it worthwhile to continue investigation of these species. Zou et al. (2000) have reported that a new antimicrobial metabolite named colletotric acid was isolated from a liquid culture of Colletotrichum gloeosporioides, an endophytic fungus colonized inside the stem of Artemisia mongolica. It inhibited the growth of Bacillus subtilis, Staphylococcus aureus and Sarcina lutea and the crop pathogenic fungus Helminthosporium sativum.
Arivudainambi et al. (2011) in their study have reported that the fungal extracts of Colletotrichum gloeosporioides showed an effective antibacterial and antifungal especially
129
the antibacterial activity against S. aureus. These results clearly point to the fact that the metabolite of endophytic fungus C. gloeosporioides is a potential source of new antibiotics.
The synergy of the findings of present study with the existing scientific studies with a new finding that Colletotrichum gloeosporioides is found in Ocimum sanctum and Barleria prionitis too reveals the possibility of discovery of new endophytic fungi from the selected medicinal plants that are relatively under-explored from the point of view of endophytic fungal diversity. The consistent and substantial antibacterial potential of these endophytic fungal species as revealed in the present study make them potentially suitable candidates for the production of biologically active metabolites.
5.4.2 Fusarium sp.:
Different fusarium species such as Fusarium semitectum Berk. and Rav., Fusarium sp. E109 were isolated mainly from Ocimum sanctum and Barleria prionitis. Though they were found abundantly, they failed to show any substantial antibacterial activity against the test bacteria. Fusarium sp. isolated from the leaf of Barleria prionitis did not show any antibacterial activity against any test bacteria. Similarly Fusarium semitectum Berk.and Rav. isolated from the root of Barleria prionitis did not show any antibacterial activity against any test bacteria except moderate activity against S. aureus. Only two isolates - Fusarium sp. from the stem of Ocimum sanctum and Fusarium sp. from the stem of Barleria prionitis showed significant antibacterial activity against only one test bacteria each.
5.4.3 Nigrospora state of Khuskia oryzae:
Another species abundantly found in the three medicinal plants under investigation was Nigrospora state of Khuskia oryzae. It was mainly isolated only from Ocimum sanctum and Vitex negundo and not Barleria prionitis. Maximum occurrence of Nigrospora state of Khuskia oryzae was in the leaves of Ocimum sanctum. The overall colonization density of Nigrospora state of Khuskia oryzae was 2.44% while it was substantially high (4.67%) in Ocimum sanctum.
The Nigrospora state of Khuskia oryzae is reported to have been isolated from different plant species. However, the general literature survey did not point to many studies showing that it has been isolated from Ocimum sanctum or Vitex negundo. Thus the present study indicates a new possible line of scientific investigation of presence of Nigrospora state of Khuskia
130
oryzae in traditional medicinal plants of India and Asia in particular and tropical and subtropical regions in general.
Nigrospora state of Khuskia oryzae isolated from stem of Ocimum sanctum showed significant antibacterial activity against S. typhi in hexane extract and that isolated from root of Vitex negundo also showed significant antibacterial activity against S. typhi in hexane as well as ethyl acetate extract. Apart from this, the fungus did not exhibit noticeable antibacterial activity.
5.4.4 Phomopsis archeri B. Sutton:
The second most abundantly found species was Phomopsis archeri B. Sutton. Not only that Phomopsis archeri B. Sutton was abundantly found in many number of samples, it was found in all three medicinal plants. The overall colonization density of Phomopsis archeri B. Sutton for all three plants taken together was substantially high (3.78%). The Phomopsis archeri B. Sutton is reported to have been isolated from different plant species. Isabella et al. (2012) have reported that Phomopsis archeri was one of most representative species recorded from the plants of Avicennia schaueriana, Laguncularia racemosa. Paula et al. (2011) have observed that the most frequently isolated species from leaves and stems of cotton was Phomopsis archeri. However, the general literature survey did not point to many studies showing that it has been isolated from Ocimum sanctum, Vitex negundo and Barleria prionitis and especially from Vitex negundo which has been subject matter of present study.
Huang et al. (2011) have carried out extensive study of endophytic fungi in Vitex negundo. They have reported 12 species which includes a species from genus phomopsis - phomopsis phoenicicola but not Phomopsis archeri B. Sutton. Sunayana et al. (2014) in their study of endophytic fungi isolated from Vitex negundo have reported 23 species which does not include Phomopsis archeri B. Sutton. Some other studies such as Maehara et al. (2010), Raviraja (2005), Ananda and Sridhar (2002) have reported species of genus phomopsis other than Phomopsis archeri B. Sutton from plants different than the three medicinal plants of the present study. Thus the present study indicates a new possible line of scientific investigation of presence of Phomopsis archeri B. Sutton in traditional medicinal plants of India and Asia in particular and tropical and subtropical regions in general. Some studies indicate that Phomopsis is not host restricted. It has been reported by Murali et al. (2006) that this fungus
131
is not host specific and that it can continue to survive as a saprotroph in teak leaf, by exploiting senescent leaves as well as the litter.
This observation coupled with the findings of the present study reinforces the need to study presence of Phomopsis archeri B. Sutton in different medicinal plants.
Some distinguishing observations that made Phomopsis archeri B. Sutton stand out for special attention were –
1) Phomopsis archeri B. Sutton was found in all the three medicinal plants – in leaf of Ocimum sanctum, stem and leaf of Vitex negundo and leaf of Barleria prionitis.
2) Phomopsis archeri B. Sutton isolated from Vitex negundo showed significant antibacterial activity in all three extracts with hexane, ethyl acetate and methanol against K. pneumoniae.
3) Phomopsis archeri B. Sutton isolated form Vitex negundo showed maximum antibacterial activity in terms of diameter of inhibition
4) Maximum instances of significant antibacterial activity in any base against any test bacteria were shown by Phomopsis archeri B. Sutton isolated from Vitex negundo (4 times) followed by Phomopsis archeri B. Sutton isolated from Barleria prionitis (3 times).
5) Phomopsis sp. aff. P. archeri B. Sutton isolated from stem of Vitex negundo showed significant antibacterial activity against 4 bacterial strains whereas the same endophytic fungi isolated from the leaf of the same plant showed significant antibacterial activity against 2 bacterial strains.
6) Phomopsis archeri B. Sutton isolated from leaf of Barleria prionitis showed significant antibacterial activity against 3 bacterial strains.
7) Phomopsis archeri B. Sutton isolated from leaf of Ocimum sanctum showed significant antibacterial activity against B. cereus in methanol extract.
8) Phomopsis archeri B. Sutton isolated from stem of Vitex negundo showed significant antibacterial activity against S. typhi in ethyl acetate extract. The same sample showed significant antibacterial activity against K. pneumoniae in all the three extracts i.e.
132
hexane, ethyl acetate and methanol. Phomopsis archeri B. Sutton was also isolated from leaf of Vitex negundo and it showed significant antibacterial activity against S. typhi and E. coli.
9) Phomopsis archeri B. Sutton isolated from leaf of Vitex negundo showed significant antibacterial activity against S. typhi, B. subtilis and B. cereus. It is curious to note that the endophytic fungi was seen as non-sporulating and was subjected to molecular identification which revealed that it is Phomopsis archeri B. Sutton.
Thus in one way or other, Phomopsis archeri B. Sutton has shown significant antibacterial activity against 5 test bacteria viz. S. typhi, K. pneumoniae, E. coli, B. subtilis, B. cereus. In case of S. aureus, Phomopsis archeri B. Sutton isolated from all three plants have shown moderate antibacterial activity. Thus it has been seen to be active against all six test bacteria.
The review of available literature also points to widely reported potential of Phomopsis archeri B. Sutton for its antibacterial activity.
All the foregoing discussion clearly points to the fact that Phomopsis archeri B. Sutton needs further intensive as well as extensive study.
5.5 Requirements of intensive study:
1) Investigating the antibacterial activity of Phomopsis archeri B. Sutton against K. pneumoniae as it has shown significant activity against this bacteria in all three bases.
2) Investigating the antibacterial activity of Phomopsis archeri B. Sutton against more test bacteria as it can prove to be having antibacterial activity against many other test bacteria.
3) Investigating the different antimicrobial activities of Phomopsis archeri B. Sutton such as antifungal, antiprotozoal, anticancer, antiviral, antibacterial, antioxidant activities etc.
5.6 Requirement of extensive study:
1. Investigating the presence of Phomopsis archeri B. Sutton as endophytic fungi in the three medicinal plants of the present study i.e. Ocimum sanctum, Vitex negundo,
133
Barleria prionitis with larger sample size covering more number of plant samples, more specific tissues and more number of locations of collecting the samples which will give clearer picture of biodiversity of this fungi and open more opportunities for discovery of new bioactive compounds with antibacterial potential.
2. Investigating the presence of Phomopsis archeri B. Sutton as endophytic fungi in different traditional medicinal plants - There is possibility that Phomopsis archeri B. Sutton may be isolated from different medicinal plants and may lead to discovery of variety of new bioactive compounds with antimicrobial potential against variety of pathogens.
5.7 Antibacterial activity against gram positive vs. gram negative test bacteria:
The analysis of antibacterial activity against the six test bacteria showed that significant antibacterial activity was observed against B. subtilis, S. aureus and B. cereus as compared to that against E. coli, K. pneumoniae and S. typhimurium. This shows a clear trend that the endophytes exhibited comparatively more frequency of antibacterial activity specifically against gram positive bacteria as against the gram negative bacteria. It was also observed that endophytic strain from the same host or from different hosts exhibited variations in their antibacterial activity. It indicates that different strains of the same species could have potential to produce different metabolites and hence should be studied more rigorously.
5.8 Taxanomic identities of endophytic fungi:
A significant number of non-sporulating forms of endophytic fungi were isolated from the three medicinal plants. This trend finds support in the existing studies also. For example, Frohlich et al. (2000) and Arnold (2001) have reported that significant numbers of non- sporulating forms of fungi are frequently isolated as endophytic fungi from a vast range of hosts. In the present study, efforts to induce sporulation by grass leaf technique also failed. The four non-sporulating species exhibiting significant antibacterial activity were subjected to molecular identification. Out of these four, three were identified as Phomopsis archeri B. Sutton, Pleosporales A 10, Eutypa and Talaromyces. The Phomopsis archeri B. Sutton among these exhibited significant antibacterial activity. The fact that these non-sporulating forms also contribute to fungal diversity and more importantly they have potential to exhibit antibacterial activity, non-sporulating forms should not be discarded and rather efforts should
134
be made to identify them either by in-vitro induction of sporulation or by using molecular techniques. This will bring forth the unexplored and hidden fungi to our knowledge and may possibly lead to discovery of newer bioactive metabolites.
5.9 Observations in respect of eluent:
The fractions obtained by using ethyl acetate as eluent were found to be more effective in inhibiting the bacterial growth as compared to the ethyl acetate and methanol. This trend was consistently observed in all three medicinal plants. The endophytic fungi showing significant activity with hexane were -
Pleosporales sp. A10, Nigrospora state of Khuskia oryzae, Penicillium sp. and a non-sporulating form.
The endophytic fungi showing significant activity with ethyl acetate were
Pleosporales sp., Penicillium sp. and fusarium sp.
The endophytic fungi showing significant activity with methanol were
Cladosporium sphaerospermum Penz., Colletotrichum gloeosporioides Penz., Penicillium sp., Phomopsis archeri B. Sutton, Alternaria raphani J.W. Groves and Skolko and a non sporulating form.
This data makes it clear that though the ethyl acetate as eluent is seen to be most effective as eluent based on general frequency, it cannot be endorsed as the best eluent in general. This is because different species are seen to be effective in two or three media eluents.
135
5.10 Chemical elucidation of compound:
Chemical Elucidation of secondary metabolite extracted from Phomopsis archeri B. Sutton isolated from Vitex negundo revealed that the chemical compound is Luteolin – 7- glucoside :2,3-dihydro-5-hydroxy-2-(3,4-dihydroxyphenyl)-7-(tetrahydro-3,4,5-trihydroxy-6- (hydroxymethyl)-2H-pyran-2-yloxy)chromen-4-one.
The probable structure of the compound from elemental analysis, IR and NMR and GC-MS is -
OH OH O
HO OH
HO O O O
OH
OH
The literature survey indicates that the flavonoids in general and Luteolin glucosides in particular are reported to be found in extracts of Vitex negundo and show significant antibacterial activity. To this extent, the findings of present study are in agreement with the present scientific findings. However, literature survey did not reveal the luteolin glucoside being identified as having been extracted from the endophytic fungi of Vitex negundo. This supports one of the hypotheses that the antibacterial activity of medicinal plants may be mainly due to the endophytic fungi in them. However it needs further intensive study to confirm the same.
136
Chapter 7
Summary and conclusions
SUMMARY AND CONCLUSIONS
Worldwide global health concern over the issues like the failure of currently used antibiotics to many multi resistant and super resistant strains, indiscriminate exploitation of medicinal plants for extraction of antimicrobial agents of plant origin and limitations of plant resources due to various factors like requirement of land for cultivation, environmental competence of plants, seasonal specificity etc. has led various streams of sciences to have an increased interest in searching novel bioactive compounds having high effectiveness, low toxicity and negligible environmental impacts.
Considering that traditionally, human in general and Indians in particular have been predominantly dependent on remedial measures derived from medicinal plants and that the microbes in general have been an abundant source of novel chemo-types and pharmacophores from thousands of years, three medicinal plants viz. Ocimum sanctum, Vitex negundo and Barleria prionitis were selected for the present study.
Healthy and mature plants were selected from relatively pollution free areas in and around Pune. The segments were collected from three parts of the selected plants viz. leaves, stem, and roots. Twelve different sterilization protocols were analyzed and three of them each by Petrini (1986), Rubini et al. (2005) and Gao et al. (2009) were used.
For the production of secondary metabolites, the fungi were cultivated in appropriate media. For primary screening, fungi were cultured on PDA in most of the cases. The maximum growth among three alternate media was observed in PDA and hence the same was used for further study and production of fungal biomass and crude extract on the basis of the comparative analysis.
150 segments (50 each of leaves, stems and roots) of each of the three medicinal plants i.e. 450 plant segments in total were processed. From these 450 segments, 132 fungal endophytes were isolated. The maximum 56 endophytic fungi i.e. 42% were extracted from Ocimum sanctum followed by Vitex negundo which yielded 45 i.e. 34% of the total endophytic fungi isolated.
The species indentified from Ocimum sanctum, Vitex negundo and Barleria prionitis were 15, 16 and 13 respectively revealing no marked preference by endophytic fungi for any particular plant among the three selected plants. 137
Colletotrichum gloeosporioides Penz., Nigrospora state of khuskia oryzae H. J. Hudson, Nigrospora sphaerica (Sacc.) Mason, Phomopsis archeri B. Sutton, Penicillum sp., Aspergillus flavus, Curvularia borreriae (Viegas) M.B. Ellis, Fusarium sp. and Nonsporulating dematiaceous form were found in all the three plants thereby indicating that these endophytic fungi have no plant specific preferences. However, some endophytic fungi were found exclusively in one of the three plants viz. - Colletotrichum lindemuthianum (sacc.andmagn) and Pleosporales sp. A10 were found only in Ocimum sanctum; Mucor hiemalis Wehmer, Monodictys paradoxa (Corda) Hughes, Eutypa sp., Talaromyces Purpurogenus were found only in Vitex negundo and Fusarium semitectum Berk and Rav., Drechslera australiensis Bugnic.ex M.B. Ellis, Trichoderma harzianum Rifai, Fusarium brachygibbosum were found only in Barleria prionitis.
Stem yielded maximum i.e. 56 out of 132 (42%) of endophytic fungi followed by leaves from which 48 i.e. 36% endophytic fungi were isolated. This trend was seen individually in Ocimum sanctum as well as Vitex negundo. However, in Barleria prionitis, higher numbers of endophytic fungi (15) were isolated from the leaves as compared to its stem (10). Since the focus point of present study was not the biodiversity of the endophytic fungi, the sample size was kept smaller i.e. 450 in all from three medicinal plants and hence no conclusive remarks are made on the plant, organ or tissue specificity of the endophytic fungi. However, the present results definitely indicate the possibility of plant and organ specificity of the endophytic fungi and hence needs further dedicated study with bigger sample size and thorough assessment through careful dissection and separate culturing and analysis of samples from those organs.
In all, 21 species belonging to 14 genera were isolated from the three medicinal plants, the most abundant being Colletotrichum gloeosporioides, fusarium sp., Phomopsis archeri B. Sutton and Nigrospora state of Khuskia oryzae. This species abundance trend was also evident in individual plants except that Nigrospora sphaerica, penicillium sp. and aspergillus flavus were also found in majority in Barleria prionitis. Thus, these species can be said to form the core group of species isolated from the medicinal plants under investigation. In addition to this core group of species, some incidental species were also isolated. Among the incidental species, Pleosporales sp. A10 and Monodictys paradoxa showed moderate to significant antibacterial activity against some test bacteria and hence these species need further investigation selectively instead of discarding them as incidental occurrences.
138
The literature survey does not widely record the isolation of Colletotrichum gloeosporioides from Ocimum sanctum as well as Barleria prionitis. However, Dey et al. (2013) have reported the isolation of Colletotrichum sp. DM-06 from Ocimum sanctum. To this extent the isolation of Colletotrichum gloeosporioides from Ocimum sanctum is a new finding. However, the isolation of Colletotrichum gloeosporioides has been widely reported to have been isolated from some other medicinal plants.
Most of the endophytic fungi belonged to phylum Ascomycota. There were total 15 non- sporulating species among the 132 fungi. The efforts to induce sporulation by grass leaf technique also failed. Out of these, 4 species showing significant antibacterial activity were subjected to molecular identification and were identified as Unclassified Pleosporales, Eutypa, Talaromyces and Phomopsis archeri B. Sutton.
Colonization rate was calculated by the method of Petrini et al. (1982). For all three plants taken together, it was highest in stem at 29.33 %, only marginally higher than that in leaves at 28.67% and was the least in roots at 16%. The isolation rate also followed the same pattern with the highest in stem at 0.37 again only marginally higher than that in leaves at 0.32 and was the least in roots at 0.19.
The density of colonization (rD%) or colonization frequency (CF%) of a single endophyte species was calculated by the method of Fisher and Petrini (1987). The highest density of colonization (rD%) was recorded for Colletotrichum gloeosporioides Penz. at 5.11% followed by Fusarium sp. (4%) and Phomopsis archeri B. Sutton (3.78%).
Identification of endophytic fungi was carried out in two stages. All endophytic fungi were initially identified by morphological method whereas the selected endophytic fungi showing substantial antibacterial activity were subjected to molecular identification. Antibacterial activity of the isolated endophytic fungi was screened against three gram positive and three gram negative. Screening of antibacterial activity was carried out by agar well diffusion technique.
Out of the 50 endophytic fungi screened in detail for antibacterial activity, 98% showed moderate to significant antibacterial activity at least against one test bacteria. 32% of the endophytic fungi showed significant antibacterial activity at least against one test bacteria. This number was highest in Ocimum sanctum. 50% of the endophytic fungi isolated from
139
Ocimum sanctum showed significant antibacterial activity at least against one test bacteria. Total 5 endophytic fungi (Aspergillus flavus from the root of Ocimum sanctum, Penicillum sp. from stem of Ocimum sanctum, Phomopsis archeri B. Sutton from leaf of Vitex negundo, Alternaria raphani from stem of Vitex negundo and Phomopsis archeri B. Sutton from leaf of Barleria prionitis) showed moderate to significant antibacterial activity against every one of all six test bacteria in either of the three bases. Penicillum sp. isolated from Ocimum sanctum showed significant antibacterial activity against 4 bacterial strains. The endophytic fungi isolated from the three medicinal plants showed maximum effectiveness against S. typhi followed by B. cereus. The basic analysis of antibacterial activity revealed that the extracts in ethyl acetate were more effective as compared to those in hexane or methanol.
The analysis of antibacterial activity against the six test bacteria showed significant antibacterial activity against B. subtilis, S. aureus and B. cereus as compared to that against E. coli, K. pneumoniae and S. typhimurium. This revealed a clear trend that the endophytes exhibited comparatively more frequency of antibacterial activity specifically against gram positive bacteria as against the gram negative bacteria. It was also observed that endophytic strain from the same host or from different hosts exhibited variations in their antibacterial activity. It indicates that different strains of the same species could have potential to produce different metabolites and hence need to be studied more rigorously.
As regards the eluent, it was observed that the fractions obtained by using ethyl acetate as eluent were found to be more effective in inhibiting the bacterial growth as compared to the ethyl acetate and methanol. This trend was consistently observed in all three medicinal plants. However, different species are seen to be effective in two or three media eluents. Thus, though ethyl acetate as eluent is seen to be most effective as eluent based on general frequency, it cannot be endorsed as the best eluent in general.
Colletotrichum gloeosporioides isolated from Ocimum sanctum and Vitex negundo showed consistent antibacterial activity against E. coli in all three extracts in hexane, ethyl acetate and methanol. Colletotrichum gloeosporioides extracted in methanol isolated from Ocimum sanctum has shown significant antibacterial activity against B. cereus. It also showed consistent antibacterial activity against B. subtilis and S. typhi. These findings are in agreement with other reported observations about Colletotrichum gloeosporioides. Colletotrichum gloeosporioides isolated from different medicinal plants is reported to have shown significant antibacterial activity against different test bacteria and to produce novel
140
antimicrobial metabolites. The synergy of the findings of present study with the existing scientific studies with additional new finding that Colletotrichum gloeosporioides is found in Ocimum sanctum and Barleria prionitis too reveals the possibility of discovery of new endophytic fungi from the selected medicinal plants that are relatively under-explored from the point of view of endophytic fungal diversity. The consistent and substantial antibacterial potential of these endophytic fungal species as revealed in the present study make them potentially suitable candidates for the production of biologically active metabolites.
It was observed that Phomopsis archeri B. Sutton in general and that isolated from Vitex negundo in particular showed unique results. It was observed that Phomopsis archeri B. Sutton was found in all the three medicinal plants. Its isolate from Vitex negundo showed significant antibacterial activity in all three extracts with hexane, ethyl acetate and methanol against K. pneumoniae and showed maximum antibacterial activity in terms of diameter of inhibition. Maximum instances of significant antibacterial activity in any base against any test bacteria were shown by its isolate from Vitex negundo (4 times) followed by Phomopsis archeri B. Sutton isolated from Barleria prionitis (3 times). Its isolate from stem of Vitex negundo showed significant antibacterial activity against 4 bacterial strains whereas the same endophytic fungi isolated from the leaf of the same plant showed significant antibacterial activity against 2 bacterial strains. Further Phomopsis archeri B. Sutton isolated from leaf of Barleria prionitis showed significant antibacterial activity against 3 bacterial strains.
Considering these unique observations, the Phomopsis archeri B. Sutton from Vitex negundo was selected for further study. In order to find out the supporting conditions for the enhanced growth in the production of crude/secondary metabolites by selected endophytic Phomopsis archeri B. Sutton and its potential activities against selected bacteria, the process optimization study was carried out. The maximum growth in fungal biomass productions as well as the crude metabolite production was recorded at 270C at pH 5.0 on 21st day of incubation.
Chemical Elucidation of secondary metabolite extracted from Phomopsis archeri B. Sutton isolated from Vitex negundo was carried out using HPTLC, IR spectrum, NMR spectrum and GC-MS Spectrum.
The chemical compound was identified as Luteolin – 7- glucoside: 2, 3-dihydro-5-hydroxy-2- (3,4-dihydroxyphenyl)-7-(tetrahydro-3,4,5-trihydroxy-6-(hydroxymethyl)-2H-pyran-2- yloxy)chromen-4-one. 141
The probable structure of the compound from elemental analysis, IR and NMR and GC-MS is -
OH OH O
HO OH
HO O O O
OH
OH
The literature survey indicates that the flavonoids in general and Luteolin glucosides in particular are reported to be found in extracts of Vitex negundo and show significant antibacterial activity. To this extent, the findings of present study are in agreement with the present scientific findings. However, literature survey did not reveal the luteolin glucoside being identified as having been extracted from the endophytic fungi of Vitex negundo. This supports one of the hypotheses that the antibacterial activity of medicinal plants may be mainly due to the endophytic fungi in them. However it needs further intensive study to confirm the same.
Considering the observations, findings and analysis in the foregoing paragraphs, and with a view to confirm the findings of the present study, further intensive study is required in certain direction like - investigating the antibacterial activity of Phomopsis archeri B. Sutton against K. pneumoniae as it has shown significant activity against this bacteria; investigating the antibacterial activity of Phomopsis archeri B. Sutton against more test bacteria as it can prove to be having antibacterial potential against many other test bacteria; investigating the different antimicrobial activities of Phomopsis archeri B. Sutton such as antifungal, antiprotozoal, anticancer, antiviral, antibacterial, antioxidant activities.
In addition to the intensive study as mentioned in foregoing paragraph, an extensive study is also required in certain directions like investigating the presence of Phomopsis archeri B. Sutton as endophytic fungi in the three medicinal plants of the present study i.e. Ocimum sanctum, Vitex negundo, Barleria prionitis with larger sample size covering more number of plant samples, more specific tissues and more number of locations of collecting the samples
142
which will give clearer picture of biodiversity of this fungi and open more opportunities for discovery of new bioactive compounds with antibacterial potential. It is also required to investigate the presence of Phomopsis archeri B. Sutton as endophytic fungi in different traditional medicinal plants. There is possibility that Phomopsis archeri B. Sutton may be isolated from different medicinal plants and may lead to discovery of variety of new bioactive compounds with antimicrobial potential against variety of pathogens.
Conclusions:
In summary, the present study shows broad endophytic fungal diversity in selected plant species, some of them relatively under-explored as endophytic fungal hosts.
The substantial antibacterial potential shown by many of them underlines their potential use in antibacterial remedies opening the vista for alternate sources free from the drawbacks of present antibiotics.
The substantial antibacterial potential of endophytic fungi in the present study also underlines their potential for possibility of other antimicrobial activities.
The results also justify the traditional use of the selected three medicinal plants against human pathogenic bacteria though the crude use in traditional way needs refinement.
The results also lend strong support to the possibility that the antimicrobial activity of the medicinal plant extract may be attributed to the presence of endophytic fungi and bioactive metabolites synthesized by them.
It also justifies that the studies on isolation and identification of these bioactive compounds can be a crucial approach to the search of novel natural products.
143
Chapter 8
Future prospects
FUTURE PROSPECTS
The present study of ‘Bioprospecting of Endophytic Fungi from Certain Medicinal Plants’ has potential to be further explored. Many aspects of the subject could not be investigated as they were out of scope of this study. However they present the future prospects of being explored as –
1. Intensive investigation of the antibacterial activity of Phomopsis archeri B. Sutton isolated from different medicinal plants (as against limited plants in the present study) against K. pneumoniae may lead to discovery of new/novel compounds as it has shown significant activity against this bacteria in all three bases.
2. Intensive investigation of the antibacterial activity of Phomopsis archeri B. Sutton against more test bacteria may lead to discovery of new/novel compounds against many other test bacteria.
3. Investigation of Phomopsis archeri B. Sutton for the different antimicrobial activities such as antifungal, antiprotozoal, anticancer, antiviral, antibacterial, antioxidant activities can lead to isolation of more secondary metabolites effective as antifungal, antiprotozoal, anticancer, antiviral, antibacterial, antioxidant agents.
4. Investigation of the presence of Phomopsis archeri B. Sutton as endophytic fungi in the three medicinal plants of the present study i.e. Ocimum sanctum, Vitex negundo, Barleria prionitis with larger sample size covering more number of plant samples, more specific tissues and more number of locations of collecting the samples will give clearer picture of biodiversity of this fungi and open more opportunities for discovery of new bioactive compounds with antibacterial potential.
144
REFERENCES
Agrios, G. 1997. Plant Pathology. 4th edition. Academic Press, San Diego, California. Agusta, A., Maehara, S., Ohashi, K., Simanjuntak, P. and Shibuya, H. 2005. Stereoselective oxidation at C-4 of flavans by endophytic fungus Diaporthe sp. isolated from a tea plant. Chem. Pharm. Bull. 53:1565-1569. Ahmed, I., Hussain, H., Schulz, B., Draeger, S., Padula, D., Pescitelli, G., Ree, T. V. and Krohn, K. 2011. Three new antimicrobial metabolites from the endophytic fungus Phomopsis sp. Eur. J. Org. Chem. 15:2867-2873. Aly, A.H., Debbab, A., Kjer, J. and Proksch, P. 2010. Fungal endophytes from higher plants: a prolific source of phytochemicals and other bioactive natural products. Fungal Divers. 41:1-16. Amna, T., Puri, S. C., Verma, V., Sharma, J. P., Khajuria, R. K., Musarrat, J., Spiteller, M. and Qazi, G. N. 2006. Bioreactor studies on the endophytic fungus Entrophospora infrequens for the production of an anticancer alkaloid camptothecin. Can. J. Microbiol. 52:189-196. Amoo, S.O., Ndhlala, A.R., Finnie, J.F. and Staden and J. V. 2011. Antifungal acetylcholinesterase inhibition, antioxidant and phytochemical properties of three Barleria species. S. Afr. J. Bot. 77:435-445. Ananda, K. and Sridhar K. R. 2002. Diversity of endophytic fungi in the roots of mangrove species on the west coast of India. Can. J. Micobiol. 48:871-878. Aneja, K.R., Joshi, R., Sharma, C. 2010. Potency of Barleria prionitis L. bark extracts against oral diseases causing strains of bacteria and fungi of clinical origin. N. Y. Sc.i J. 3(11):5-12. Arivudainambi, U.S., Thangarajan, D. A. S. V., Karunakaran, C., Rajendran, A. 2011. Novel bioactivemetabolites producing endophytic fungus Colletotrichum gloeosporioides against multidrug-resistant Staphylococcus aureus. FEMS Immunol. Med. Microbiol. 61:340-345. Arnold, A. E., Maynard, Z., Gilbert, G. S., Coley, P. D. and Kursar, T. A. 2000. Are tropical fungal endophytes hyperdiverse? Ecol. Lett. 3:267-274.
145
Arnold, A. E. 2001. Fungal endophytes in neotropical trees: abundance, diversity and ecological interactions. In Tropical ecosystems: structure, diversity, and human welfare. Edited by K. N. Ganeshiah, R. Uma Shaankar, K. S., Bawa, New Delhi, India: Oxford and IBH publishing Co. Pvt. Ltd., pp. 739-743. Arrhenius, S.P., Langenheim, J.H. 1986. The association of Pestalotia species with members of the leguminous tree genera Hymenaea and Copaifera in the neotropics. Mycologia 78: 673-676. Aswar, P.B., Khadabadi, S.S., Kuchekar, B.S., Rajurkar, R.M., Saboo, S.S. and Javarkar, R.D. 2009. In vitro evaluation of anti-bacterial and anti-fungal activity of Vitex negundo (Verbenaceae). Ethnobotanical Leaflets. 13: 962-967. Azevedo, J. L., Maccheroni, W., Jr., Pereira, J. O. and de Araujo, W. L. 2000. Endophytic microorganisms: A review on insect control and recent advances on tropical plants. Electron. J. Biotechnol. http://www.ejb.org/content/vol3/issue1/full/4. Bacon, C. W., Porter, J. K., Robbins, J. D. and Luttrell, E. S. 1977. Epichloë typhina from toxic tall fescue grasses. Appl. Environ. Microbiol. 34:576-581. Ballio, A. F., Bossa, P., Digiogio, P., Ferranti, P., Paci, M., Pucci, P., Sealoni, A., Segre, A. and Strobel, G. A. 1994. Structure of the Pseudomycins. New lipodepsipeptides produced by Pseudomonas syringae MSU 1 b11. FEBS Lett. 255: 96-100. Barnabas, C. G. G., Nagarajan, S. 1988. Antimicrobial activity of flavonoids of some medicinal plants. Fitoterapia, 59(6):508-510. Banerjee, D. 2011. Endophytic fungal diversity in tropical and subtropical plants. Res. J. Microbiol. 6:54-62. Banerjee, D., Mahapatra, S., Manna, S., Mujherjee, R. and Pati, B. R. 2006. Occurrence of endophytic fungi in Vitex negundo L. (Verbenaceae). J. Bot. Soc. Bengal. 60:28-31. Banerjee, D., Maji, A., Banerji, P. 2012. Barleria prionitis Linn: A review of its traditional uses, phytochemistry, pharmacology and toxicity. Res. J. Phytochem. 6(2):31-41. Banerjee, D., Manna, S., Mahapatra, S. and Pati, B. R. 2009. Fungal endophytes in three medicinal plants of Lamiaceae. Acta. Microbiol. Immunol. Hung. 56:243-50.
146
Bayman, P., Angulo-Sandoval, P., Báez-Ortiz, Z. and Lodge, J. 1998. Distribution and dispersal of Xylaria endophytes in two tree species in Puerto Rico. Mycol. Res. 102:944-948. Beena, K.R., Ananda, K., Sridhar, K.R. 2000. Fungal endophytes of three sand dune plant species of west coast of India. Sydowia. 52:1-9. Bernstein, M. E. and Carroll, G. 1977. Internal fungi in old-growth Douglas fir foliage. Can. J. Bot. 55:644-653. Bertoni, M. D. and Cabral, D. 1988. Phyllosphere of Eucalyptus viminalis. 11. Distribution of endophytes. Nova Hedwigia 46: 491-502. Bhagat, J., Kaur, A., Sharma, M., Saxena, A. K., Chadha, B. S., 2012. Molecular and functional characterization of endophytic fungi from traditional medicinal plants. World J. Microbiol. Biotechnol. 28:963-971 Bills, G. F. 1996. Isolation and analysis of endophytic fungal communities from woody plants. In Endophytic Fungi in Grasses and Woody Plants. Edited by S.S. Redlin and L.M. Carris, APS Press, Saint Paul, pp.121-132. Bills, G., A. Dombrowski, F. P., Polishook, J. and An, Z. 2002. Recent and Future Discoveries of Pharmacologically Active Metabolites from Tropical Fungi. In Tropical Mycology, Watling, R., Frankland, J.C., Ainsworth, A.M., Issac, S. and Robinson, C.H. (Eds.). Vol. 2. CABI Publishing, New York, pp: 165-194. Bills, G. F. and Polishook, J. D. 1991. Microfungi from Carpinus caroliniana. Can. J. Bot. 69:1477-1482. Bills, G.F., Polishook, J.D. 1992. Recovery of endophytic fungi from Chamaecyparis thyoides. Sydowia. 44:1-12. Bills, G. F. and Polishook, J. D. 1994. Microfungi from decaying leaves of Heliconia mariae (Heliconiaceae). Brenesia 41-42:27-43. Boddy, L. and Griffith, G. S. 1989. Role of endophytes and latent invasion in the development of decay communities in sapwood of angiospermous trees. Sydowia 41:41- 73. Bouarab, K., Potin, P., Correa, J., Kloareg, B. 1999. Sulfated oligosaccharides mediate the interaction between a marine red alga and its green algal pathogenic endophyte. Plant Cell 11:1635-1650
147
Brady, S. F., Bondi, S. M. and Clardy, J. 2001. The guanacastepenes: A highly diverse family of secondary metabolites produced by an endophytic fungus. J. Am. Chem. Soc.123:9900-9901. Brady, S. F. and Clardy, J. 2000. CR377, a New Pentaketide Antifungal Agent Isolated from an Endophytic Fungus. J. Nat. Prod. 63(10):14447-8. Brady, S. F., Singh, M. P., Janso, J. E. and Clardy, J. 2000. Guanacastepene, a fungal- derived diterpene antibiotic with a new carbon skeleton. J. Am. Chem. Soc.122:2116- 2117. Brown, K. B., Hyde, K. D. and Guest, D. I. 1998. Preliminary studies on endophytic fungal communities of Musa acuminata species complex in Hong Kong and Australia. Fungal Divers. 1:27-51. Brundrett, M.C. 2002. Coevolution of roots and mycorrhizas of land plants. New Phytol 154: 275-304. Burkill, H.M. 1985. The Useful Plants of West Tropical Africa. 2nd edition. Royal Botanic Garden, Kew, UK. 1:960. Bussaban, B., Lumyong, S., Lumyong, P., Hyde, K. D. and Mckenzie, E. H. C. 2001. Two new species of endophytes (ascomycetes) from Zingiberaceae. Nova Hedwigia 73:487-493. Cabral, D., Stone, K. and Carroll, G.C. 1993. The internal mycobiota of Juncus sp.: Microscopic and cultural observations of infection patterns. Mycol. Res. 97:367-376. Cannon, P. F. and Simmons, C. M. 2002. Diversity and host preference of leaf endophytic fungi in the Iwokrama Forest Reserve, Guyana. Mycologia 94:210-220. Carlile, M. and Watkinson, S. C. 1989. The fungi. Academic Press, 6:983-987. Carroll, G. C. 1986. The biology of endophytism in plants with particular reference to woody perennials. In Microbiology of the Phyllosphere. Edited by N.J. Fokkema, J. vanden Huevel, Cambridge University Press, Cambridge, pp. 205-222. Carroll, G. C. 1995. Forest endophytes: Pattern and process. Can. J. Bot, 73: S1316- S1324. Chandra, S. 2012. Endophytic fungi: novel sources of anticancer lead molecules. Appl Microbiol Biotechnol. 95:47-59. Chanway, C.P. 1996. Endophytes: they’re not just fungi! Can J Bot. 74:321–322 Chatwal G.R., Anand S.K. 2008. Instrumental Methods of Chemical Analysis. 1st edition, Himalaya Publishing House, Mumbai
148
Chavan, C. B, Mulik, S., Chavan, M., Adnaik, R., Patil, P. 2011. Screening of Antioxidant activity and phenolic content of whole plant of Barleria prionitis Linn. Int. J. Res. Ayurveda. Pharm. 2(4):1313-1319. Chen, J. L., Blanc, P., Stoddart, C. A., Bogan, M., Rozhon, E. J., Parkinson, N., Ye, Z., Cooper, R., Balick, M. and Nanakorn, W. 1998. New iridoids from the medicinal plant Barleria prionitis with potent activity against respiratory syncytial virus. J. Nat. Prod. 61:1295-1297. Chiang, L. C., Ng, L. T., Cheng, P. W., Chiang, W. and Lin, C. C. 2005. Antiviral activities of extracts and selected pure constituents of Ocimum basilicum. Clin. Exp. Pharmacol. Physiol. 32(10):811-816. Chomcheon P, Sriubolmas N, Wiyakrutta S, Ngamrojanavanich N, Chaichit N, Mahidol C. 2006. Cyclopentenones, scaffolds for organic syntheses produced by the endophytic fungus mitosporic dothideomycete sp. LRUB20. J. Nat. Prod. 69:1351- 1353. Chomcheon, P., Wiyakrutta, S., Sriubolmas, N., Ngamrojanavanich, N., Isarangkul, D. and Kittakoop, P., 2005. 3-Nitropropionic acid (3-NPA), a potent antimycobacterial agent from endophytic fungi: is 3-NPA in some plants produced by endophytes?. J. Nat. Prod. 68:1103-1105. Chowdhary, K., Kaushik, N., Coloma, A.G., Raimundo, C.M. 2012. Endophytic fungi and their metabolites isolated from Indian medicinal plant. Phytochem. Rev 11: 467- 485. Chowdhary, K., Kaushik, N. 2015. Fungal Endophyte Diversity and Bioactivity in the Indian Medicinal Plant Ocimum sanctum Linn. PLoS ONE 10(11):1-25. Choudhary, M. I., Musharraf, T., Shaheen, F., Ali, S., Atta-ur-rehman and Naturforsch, Z. C. 2004. Isolation of bioactive compounds from Aspergillus terreus. J. Biosci. 59:324-327. Clay, K. 1988. Fungal endophytes of grasses: A defensive mutualism between plants and fungi. Ecology 69:10-16. Clay, K. and Schardl, C. L. 2002 Evolutionary origins and ecological consequences of endophyte symbiosis with grasses. Amer. Nat. 160:S99-S127. Collado, J., Platas, G. and Peláez, F. 2001. Identification of an Endophytic Nodulisporium sp. from Quercus ilex in Central Spain as the Anamorph of Biscogniauxia mediterranea by rDNA Sequence Analysis and Effect of Different Ecological Factors on Distribution of the Fungus. Mycologia 93:875-886 149
Cubit, J. D. 1974. Interactions of seasonally changing physical factors and grazing affecting high intertidal communities on a rocky shore. PhD thesis, University of Oregon, Eugene. Dai, J., Krohn, K., Floerke, U., Gehle, D., Aust, H. J., Draeger S. et al. 2005. Novel highly substituted biraryl ethers, phomosines D-G, isolated from the endophytic fungus Phomopsis sp. from Adenocarpus foliolosus. Eur. J. Org. Chem. 23:5100- 5105. Dai, J., Krohn, K., Flörke, U., Draeger, S., Schulz, B., Kiss-Szikszai, A.et al. 2006. Metabolites from the endophytic fungus Nodulisporium sp. from Juniperus cedre. Eur. J. Org. Chem. 15:3498–3506
David, J. C. 1997. A contribution to the systematics of Cladosporium: Revision of the fungi previously referred to Heterosporium. CAB International, New York, USA, pp. 157.
Davis, E. C., Franklin, J. B., Shaw, A. J. and Vilgalys, R. 2003. Endophytic Xylaria (Xylariaceae) among liverworts and angiosperms: Phylogenetics, distribution, and symbiosis. Am. J. Bot. 90:1661-1667. De Barry, A. 1866. Morphologie und Physiologie der Pilze, Flechten, und Myxomyceten, (Vol. II), Hofmeister’s Handbook of Physiological Botany, Leipzig, Germany. Deshmukh, S.K., Mishra, P.D., Kulkarni, A., Almeida, et al. 2009. Antiinflammatory and anticancer activity of ergoflavin isolated from an endophytic fungus. Chem. Biodiv. 6:784-789. Deshmukh, S. K., Verekar, S. A. and Bhave, S. V. 2014. Endophytic fungi: a reservoir of antibacterials. Front Microbiol. 5:715. Devarajan, P.T., Suryanrayanan, T.S., Geetha, V., 2002. Endophytic fungi associated with the tropical seagrass Halophila ovalis (Hydrocharitaceae). Ind. J. Mar. Sci. 31:73-74. Dey, B.B., Choudhury, M.A. 1984. Essential oil of Ocimum sanctum L. and its antimicrobial activity. Indian Perfumer. 28:82-87. Dey, P., Kamdarm, M. R., Mandal, S. M., Maiti, K. M. 2013. Identification of an Extracellular Antifungal Protein from the Endophytic Fungus Colletotrichum sp. DM06. Protein Pept. Lett. 20(2):173-179.
150
Dhargalkar, S. and Bhat, D. J. 2009. Echinosphaeria pteridis sp. nov. and its Vermiculariopsiella anamorph. Mycotaxon 108:115-122. Dilika, F., Bremner, P.D. and Meyer, J. J. M. 2000. Antibacterial activity of linoleic and oleic acids isolated from Helichrysum pedunculatum: a plant used during circumcision rites. Fitoterapia. 71:450-452. Ding, G., Li, Y., Fu, S., Liu, S., Wei, J., Che, Y. 2009. Ambuic acid and torreyanic acid derivatives from the endolichenic fungus Pestalotiopsis sp. J. Nat. Prod. 72:182- 186. Dreyfuss, M. and Petrini, O. 1984. Further investigations on the occurrence and distribution of endophytic fungi in tropical plants. Bot. Helv. 94:33-40. Ellis, M. B. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, pp. 595. Elsaesser, B., Krohn, K., Floerke, U., Root, N., Aust, H.J., Draeger, S., Schulz, B., Antus, S., Kurtan, T., 2005. X-ray structure determination, absolute configuration and biological activity of phomoxanthone. A. Eur. J. Org. Chem. 21:4563-4570. Erbert, C., Lopes, A. A., Yokoya, N. S., Furtado, N. A. J. C., Conti, R., Pupo, M. T., et al. 2012. Antibacterial compound from the endophytic fungus Phomopsislongicolla isolated from the tropical red seaweed Bostrychia radicans. Bot. Mar. 55:435-440 Faeth, S. H., and Hammon, K. E. 1997. Fungal endophytes in oak trees. I. Long-term patterns of abundance and associations with leafminers. Ecology, 78:810-819. Fahey, J.W., Dimock, M.B., Tomasino, S.F., Taylor, J.M., Carlson, P.S., 1991. Genetically engineered endophytes as biocontrol agents: a case study in industry. In: Microbial Ecology of Leaves. Springer-Verlag, New York, pp. 402-411. Feller, I. C. 1995. Effects of nutrients enrichment on growth and herbivory of dwarf red mangrove (Rhizophora mangle). Ecol. Monogr. 65:477-505. Firakova, S., Sturdikova, M. and Muckova, M. 2007. Bioactive secondary metabolites produced by microorganisms associated with plants. Biologia, 62:251-257. Fisher, P. J. 1996. Survival and spread of the endophytic stagonospora pteridiicola in Pteridium aquilinum, other ferns and some flowering plants. New phytopathologist 132:199-122. Fisher, P. J. and Petrini, O. 1987. Location of fungal endophytes in tissues of Suaeda fruticosa: A preliminary study. Trans. Brit. mycol. Soc. 89:246-249.
151
Fisher, P. J. and Petrini, O. 1990. A comparative study of fungal endophytes in xylem and bark of Alnus species in England and Switzerland. Mycol. Res. 94:313-319. Fisher, P. J., Petrini, L. E., Sutton, B. C. and Petrini, O. 1995. A study of fungal endophytes in leaves, stems and root of Gynoxis oleifolia Muchler (Compositae) from Ecuador. Nova Hedwigia 60:589-594. Fröhlich, J., Hyde, K. D. and Petrini, O. 2000. Endophytic fungi associated with palms. Mycol. Res. 104:1202-1212. Fu, J., Zhou, Y., Li, H. F., Guo, J. H. 2011. Antifungal metabolites from Phomopsis sp. By254, an endophytic fungus in Gossypium hirsutum. Afr. J. Microbiol. Res. 5(10):1231-1236. Gamboa, M. A. and Bayman, P. 2001. Communities of endophytic fungi in leaves of a tropical timber tree (Guarea guidonia: Meliaceae). Biotropica 33:352-360. Gangadevi, V. and Muthumary, J., 2007. Preliminary studies on cytotoxic effect of fungal taxol on cancer cell lines. Afr. J. Biotechnol. 6: 1382- 1386. Gangadevi, V. and Muthumary, J. 2008. Isolation of Colletotrichum gloeosporioides, a novel endophytic taxol-producing fungus from the leaves of a medicinal plant, Justicia gendaruss. Mycologia Balcanica 5:1-4. Gangadevi, V. and Muthumary, J., 2008. Taxol, an anticancer drug produced by an endophytic fungus Bartalinia robillardoides Tassi, isolated froma medicinal plant, Aegle marmelos Correa ex Roxb. World J. Microbiol. Biotechnol. 24: 717-724. Gangadevi, V. and Muthumary, J. 2009. Taxol production by Pestalotiopsis terminaliae, an endophytic fungus of Terminalia arjuna (arjun tree). Biotechnol. Appl. Biochem. 52:9- 15. Gao Li Wen, Wan Yi Li, Yi Lu Zhao , Jian Wen Wang. 2009. The cultivation, bioactive components and pharmacological effects of Armillaria mellea. Afr. J. Biotechnol. 8(25):7383-7390. Gaylord, E. S., R. W. Preszler, and W. J. Boecklen. 1996. Interactions between host plants, endophytic fungi, and a phytophagous insect in an oak (Quercus grisea ×Quercus gambelii) hydrid zone. Oecologia 105:336-342. Gessner, R. V. 1977. Seasonal occurrence and distribution of fungi associated with Spartina alterniflora from a Rhode Island estuary. Mycologia, 68:477-491.
152
Godhwani, S., Godhwani, J.L., Vyas, D.S. 1988. Ocimum sanctum-A preliminary study evaluating its immunoregulatory profile in albino rats. J. Ethnopharmacol. 24:193-198. Gond, S. K., Verma, V. C., Kumar, A. and Kharwar, R. N. 2007. Study of endophytic fungal community from different parts of Aegle marmelos Correae (Rutaceae) from Varanasi (India). World J. Microb. Biotechnol. 23:1371-1375. Grabley, S., Thiericke, R. (eds.). 1999. Drug Discovery from Nature. Springer- Verlag, Heidelberg. Guleria, S. and Kumar, A. 2006. Antifungal activity of some Himalayan medicinal plants using direct bioautography. J. Cell. Mol. Bio. 5:95-98. Gunatilaka, L.A. A., 2006. Natural Products from Plant-Associated Microorganisms: Distribution, Structural Diversity, Bioactivity, and Implications of Their Occurrence. Nat. Prod. 69:509-526 Guo, B., Dai, J. R., Ng, S., Huang, Y., Leong, C., Ong, W., et al. 2000. Cytonic acids A and B: novel tridepside inhibitors of hCMV protease from the endophytic fungus Cytonaema sp. J. Nat. Prod. 63:602-604 Guo, J. H., Qi, H.Y., Guo, Y.H., Ge, H. L., Gong, L.Y., Zhang, L. X. and Sun, P. H. 2004. Biocontrol of tomato wilt by plant growth-promoting rhizobacteria. Biological Control 29:66-72. Gusman J, Vanhaelen M. 2000. Endophytic fungi: An underexploited source of biologically active secondary metabolitesRecent Res. Devel. Phytochem. 4:187-206. Hawksworth, D. L. 1988. The variety of fungal-algal symbioses, their evolutionary significance and the nature of lichens. Bot. J. Linn. Soc. 96:3-20. Hawksworth, D. L. 1991. The fungal dimension of biodiversity: magnitude, significance, and conservation. Mycol. Res. 95:641-655. Hawksworth, D. L. 1993. The tropical fungal biota: census, pertinence, prophylaxis, and prognosis. In Aspects of Tropical Mycology. Edited by S. Isaac, J. C. Frankland, R. Watling and A. J. S. Whalley, Cambridge University Press, Cambridge, pp. 265- 293. Hawksworth, D. L. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol. Res. 105:1422-1432.
153
Hirsch, G.U., Braun, U. 1992. Communities of parasitic microfungi. In: Winterhoff W, editor. Handbook of vegetation science: fungi in vegetation science. Dordrecht: Kluwer Academic.225–250. Hormazabal, E. and Piontelli, E. 2009. Endophytic fungi from Chilean native gymnosperms:antimicrobial activity against human and phytopathogenic fungi. World J. Microbiol. Biotechnol. 25:813-819. Horn, W. S., Simmonds, M. S. J., Schwarts, R. E. and Blaney, W. M. 1995. Phomopsichalasin, a novel antimicrobial agent from an endophytic Phomopsis sp. Tetrahedron. 14:3969-3978. Huang, F., Han, T., Qin, L. 2011. Isolation and identification of endophytic fungi from Vitex negundo var. cannabifolia. Zhongguo Zhong Yao Za Zhi. 36(14):1945-50. Huang, W. Y., Cai, Y. Z., Hyde, K. D., Corke, H. and Sun, M. 2008. Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Divers. 33:61-75. Huang, Y. Wang, J. Li, G., Zheng, Z. and Su, W. 2001. Antitumor and antifungal activities in endophytic fungi isolated from pharmaceutical plants Taxus mairei, Cephalataxus fortunei and Torreya grandis. FEMS Immunol. Med. Microbiol. 31:163- 167. Hussain, H., Akhtar, N., Draeger, S., Schulz, B., Pescitelli, G., Salvadori, P., et al. 2009a. Biologically active secondary metabolites from fungi, 40. New bioactive 2,3- epoxycyclohexenes and isocoumarins from the endophytic fungus Phomopsis sp. from Laurus azorica. Eur. J. Org. Chem. 83:749-756 Isabella, P. M., Wanderley, C., Leonor C. , Maria A. C. 2012. Diversity of leaf endophytic fungi in mangrove plants of northeast brazil. Braz. J. Microbiol. 43(3):1165-1173. Jeyaseelan, E.C., Pathmanathan, M.K., Jeyadevan, J.P., 2010. Inhibitory effect of different solvent extracts of Vitex negundo L. and Allium sativum L. on phytopathogenic bacteria. Arch. Appl. Sci. Res. 2(6):325-331. Kadian R. and Parle M. 2012. Therapeutic potential and phytopharmacology of tulsi. International journal of pharmacy and life sciences. 3(7): 1858-1867. Kalhari, S. K., Shamsulhaq, Z., Chibuike, C. U., Sarfraz, A., Athar, A., and Radhika, S, 2007. Glutathione S-Transferase,Acetylcholinesterase Inhibitory and Antibacterial Activities of Chemical Constituents of Barleria prionitis. Z. Naturforsch. 62b:580- 586. 154
Kamruzzaman, M., Nayeemul, B. S. M., Faruque, S. M. 2013. In vitro and in vivo bactericidal activity of Vitex negundo leaf extract against diverse multidrug resistant enteric bacterial pathogens. Asian Pac J Trop Med. 6(5):352-359. Khadse, C.D. and R.B. Kakde, 2011. Anti-inflammatory activity of aqueous extract fractions of Barleria prionitis L. roots. Asian J. Plant Sci. Res. 1(2):63-68. Khare, C. P. 2004. Encyclopedia of India Medicinal plants. Spinger Verlange, Berline, Heidelberge, New York. 474-476. Khare, C.P., 2004. Indian Herbal Remedies: Rational Western Therapy, Ayurvedic and Other Traditional Usage, Botany. 1st Edn., Springer, New York, pp: 93-94. Khare, C.P., 2007. Indian Medicinal Plants: An Illustrated Dictionary. 1st Edn., Springer Science, New York, pp: 82-83. Kharwar, R. N., Verma, Satish K., Mishra, A., Gond, S. K., Sharma V. K., Afreen, T., Anuj Kumar. 2011. Assessment of diversity, distribution and antibacterial activity of endophytic fungi isolated from a medicinal plant Adenocalymma alliaceum Miers. Symbiosis. 55:39-46. Kharwar, R. N., Verma, V. C., Strobel, G. and Ezra, D. 2008. The endophytic fungal complex of Catharanthus roseus (L.) G. Don. Curr. Sci. 95:228-233. Kobayashi, D.Y. and Palumbo, J. D. 2000. Bacterial endophytes and their effects on plants and uses in agriculture. In microbial endophytes. Edited by C. W. Bacon and J. F. White, Marcel Dekker, New York, pp. 199-236. Kochhar, A., Sharma, N. and Sachdeva, R. 2009. Effect of Supplementation of Tulsi (Ocimum sanctum) and Neem (Azadirachta indica) Leaf Powder on Diabetic Symptoms, Anthropometric Parameters and Blood Pressure of Non Insulin Dependent Male Diabetics. Ethno-Med 3(1): 5-9. Kogel, K.H., Franken, P., Hückelhoven, R. 2006. Endophyte or parasite - what decides? Curr. Opin. Plant Biol. 9:358-363 Kornerup, A. and Wanscher, H. 1978. Methuen Handbook of Colour. Methuen and Co. Ltd., London, 243. Kornsakulkarn, J., Dolsophon, K., Boonyuen, N., Boonruangprapa, T., Rachtawee, P., Prabpai, S., et al. 2011. Dihydronaphthalenones from endophytic fungus Fusarium sp. BCC14842. Tetrahedron 67: 7540-7547
155
Kosmulalage, K.S., Zahid S., Udenigwe, C. C., Akhtar, A. A. S. and Samarasekera, R. 2007. Glutathione S-transferase, acetylcholinesterase inhibitory and antibacterial activities of chemical constituents of Barleria prionitis. Z. Naturforsch. 62b:580-586. Krishnamurthy, Y. L., Naik, S. B. and Jayaram, S. 2008. Fungal communities in herbaceous medicinal plants from the malnad region, Southern India. Microbes Environ. 23(1):24-28 Krohn, K., Farooq, U., Hussain, H., Ahmed, I., Rheinheimer, J., Draeger, S., et al.. 2011. Phomosines H-J, novel highly substituted biaryl ethers, isolated from the endophytic fungus Phomopsis sp. from Ligustrum vulgare. Nat. Prod. Commun. 6:1907-1912. Krohn, K., Michel, A., Roemer, E., Floerke, U., Aust, H. J., Draeger, S., et al. 1995. Biologically active metabolites from fungi. 6. Phomosines A-C Three new biaryl ethers from Phomopsis sp. Nat. Prod. Lett. 6:309-314 Kumar, U., Ahmed, F., Khanojia, P., Kukreja, K., Kumari, S. and Bhat, R. A. 2013. Exploration of antioxidant and antibacterial activity of Barleria prionitis linn. Int. J. Curr. Microbiol. App. Sci. 2(12):585-591. Kumar, S. Kaushik, N., Ruangelie, Edrada-Ebel, Rainer, E., Proksch, P. 2011. Isolation, characterization and bioactivity of endophytic fungi of Tylophora indica. World J Microbiol Biotechnol 27:571-577. Kumaran, R. S., Muthumary, J. B., Hur, K., 2008. Production of Taxol from Phyllosticta spinarum, an Endophytic Fungus of Cupressus sp. Eng. Life Sci. 4:438- 446 Kumaresan, V., Suryanarayanan, T.S., 2001. Occurrence and distribution of endophytic fungi in a mangrove community. Mycol. Res. 105:1388-1391. Kumari, P., Tripathi, S., Kumar, S. 2015. Isolation of endophytic microorganism from Kigelia pinnata (jacq.) Dc and Barleria prionitis linn. Ind. J. Fun. and Appl. Life. Sci. 5(4):6-10. Kusari, S., Zuhlke, S., Spiteller, M. 2009b. An endophytic fungus from Camptotheca acuminata that produces camptothecin and analogues. J. Nat. Prod. 72:2-7 Ladda, P. L., Magdum, C. S. 2012. Vitex negundo Linn.: Ethnobotany, Phytochemistry and Pharmacology-A Review. Int. J. Pharm. Biol. Sci. 1(1):111-120. Latch, G. C. M, Christensen, M. J. and Samuels, G. J. 1984. Five endophytes of Lolium and Festuca in New Zealand. Mycotaxon 20:535-550.
156
Lee, J.C,, Yang, X., Schwartz, M., Strobel, G., Clardy, J., 1995. The relationship between an endangered North American tree and an endophytic fungus. Chem. Biol. 2:721-727 Leite, S. P., Vieira, J. R. C., de Madeiros, P. L., Leite, R. M. P., Lima, V. L., Xavier, H. S. and Lima, E. 2006. Antimicrobial activity of Indigofera suffruticosa. Evid. Based Complement. Alternat Med. 2:261-265. Leslie, J. F. and Summerell, B. A. 2006. Taxonomy and identification of Fusarium. Blackwell Publishing Asia, Australia, pp. 278. Li, E., Tian, R., Liu, S., Chen, X., Guo, L., Che, Y. 2008b. Pestalotheols A-D, bioactive metabolites from the plant endophytic fungus Pestalotiopsis theae. J. Nat. Prod. 71:664-668 Li, H., Qing, C., Zhang, Y., Zao, Z. 2005. Screening for endophytic fungi with antitumor and antifungal activities from Chinese medicinal plants. World J Microb Biot. 21:1515-1519. Li, J. Y., Harpe, J. K., Grant, D. M., Tombe, B. O., Bashyal, W. M., Hess and Strobel, G. A., 2001. Ambuic acid, a highly functionalized cyclohexane with antifungal activity from Pestalotiopsis sp. and Monochaetia sp. Phytochem. 56:463-468. Li, J. Y., Strobel, G., A., Harper, J. K., Lobkovsky, E., Clardy, J. 2000. Cryptocin, a potent tetramic acid antimycotic from the endophytic fungus Cryptosporiopsis cf. quercina. Org. Lett. 2:767-770. Li, J.Y., Strobel, G., Sidhu, R., Hess, W.M., Ford, E.J.,1996. Endophytic taxol- producing fungi from bald cypress, Taxodium distichum. Microbiology. 142:2223- 2226. Li, N., Yang, P., Wang, Y., Luo, H., Meng, K., Wu, N., Fan, Y., Yao, B. 2008c. Cloning, expression, and characterization of protease-resistant xylanase from Streptomyces fradiae var. k11. J. Microbiol. Biotechnol. 18:410-416 Li, W. C., Zhou, J. and Guo, L. D. 2007. Endophytic fungi associated with lichens in Baihua mountain of Beijing, China. Fungal Divers. 25:69-80. Ligrone, R., Pocock, K. and Duckett, J. G. 1993. A comparative ultrastructural study of endophytic basidiomycetes in the parasitic achlorophyllous hepatic Cryptothallus mirabilis and the closely allied photosynthetic species Aneura pinguis (Metzgeriales). Can. J. Bot. 71:666-679.
157
Lim, C., Kim, J., Choi, J. N., Ponnusamy, K., Jeon, Y., Kim, S. U., et al. . 2010. Identification, fermentation, and bioactivity against Xanthomonas oryzae of antimicrobial metabolites isolated fromPhomopsis longicolla S1B4. J. Microbiol. Biotechnol. 20:494-500. Lodge, D. J. and Cantrell, S. 1995. Diversity of litter agarics at Cuyabeno, Ecuador: calibrating sampling efforts in tropical rainforest. Mycologist 9:149-151. Lodge, D. J., Fisher, P. J. and Sutton, B. C. 1996. Endophytic fungi of Manilkara bidentata leaves in Puerto Rico. Mycologia 88:733-738. Loesgen, S., Bruhn, T., Meindl, K., Dix, I., Schulz, B., Zeeck, A., et al. 2011. (+)- Flavipucine, the missing member of the pyridione epoxide family of fungal antibiotics. Eur. J. Org. Chem. 2011:5156-5162 Lubna, A., Aftab, A., Shokat, R. M., Mohd, M., Shah, A. K. 2015. Ethnobotany, phytochemistry and pharmacological potential of Vitex negundo L. (five-leaved chaste tree): An updated review. J. coast. Life. Med. 3(10): 826-833. Maehara, S., Simanjuntak, P., Ohashi, K., Shibuya, H. 2010. Composition of endophytic fungi living in Cinchona ledgeriana (Rubiaceae). J. Nat. Med. 64(2):227- 230. Mandal, S., Das, D. N., De, K., Ray, K., Roy, G., and Chaudhuri, S. B. 1993. Ocimum sanctum Linn: A study on gastric ulceration and gastric secretion in rats. Ind. J. Physiol. Pharmacol. 37(1):91-2. Marler, M., Pedersen, D., Mitchell, O. T., Callaway, R. M., 1999. A polymerase chain reaction method for detecting dwarf mistletoe infection in Douglas fir and western larch. Can. J. For Res. 29:1317-1321 Medina, A., Valle-Algarra, F. M., Mateo, R., Gimeno-Adelantado, J. V., Mateo, F. and Jiménez, M. 2006. Survey of the mycobiota of Spanish malting barley and evaluation of the mycotoxin producing potential of species of Alternaria, Aspergillus and Fusarium. Int. J. Food Microbiol. 108:196-203. Menichetti, F. 2005. Current and emerging serious Gram-positive infections. Clin. Microbiol. Infect. 11:22-28. Mirlohi, A., Sabzalian, M. R., Sharifnabi, B. and Nekoui, M. K. 2006. Widespread occurrence of Neotyphodium-like endophyte in populations of Bromus tomentellus Boiss. in Iran. FEMS Microbiol. Lett. 256:126-131.
158
Mishra, Y., Singh, A., Batra, A., Sharma, M. M., 2014. Understanding the Biodiversity and Biological Applications of Endophytic Fungi: A Review. J. Microb. Biochem. Technol. S8:004. doi:10.4172/1948-5948.S8-004 Murali, T. S., Suryanarayanan, T.S. and Geeta, R. 2006. Endophytic phomopsis species: host range and implications fordiversity estimates. Can. J. Microbiol. 52:673- 680. Mushin, T. M., Booth, T., Zwain, K. H., 1989. A fungal endophyte associated with a desert parasitic plant. Kavaka 17:1-5. Mushin, T. M., Booth. T., 1987. Fungi associated with halophytes of inland salt marsh, Manitoba, Canada. Can. J. Bot. 65:1137-1151. Mutnick, A. H., Enne, V., and Jones, R. N. 2003. Linezolid resistance since 2001: SENTRY Antimicrobial Surveillance Program. Ann. Pharmacother. 37(6):769-774. Naik, B. S., Shashikala, J.and Krishnamurthy, Y. L. 2008. Diversity of fungal endophytes in shrubby medicinal plants of Malnad region, Western Ghats, Southern India. Fungal Ecol. 1(2-3):89-93. Nakamura, C. V., Ishida, K., Faccin, L. C., Filho, B. P. D. and Cortez, D. A. G. 2004. In vitro activity of essential oil from Ocimum gratissimum L. against four Candida species. Res. Microbiol. 155:579-586. Newman, D.J., Cragg, G.M. 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod. 75:311-335. Nidhi., Uttam Kumar , Sumit kumar., 2013. Identification and screening of bioactive compounds in Barleria prionitis linn rhizome exhibiting antibacterial activity. International Journal of Research in Biotechnology and Biochemistry. 3(1):1-6. Orlandelli, Casarotti, R. et al., 2015. Antifungal and proteolytic activities of endophytic fungi isolated from Piper hispidum Sw. Braz. J. Microbiol., 46:359-366. Owen, N.L. and N. Hundley. 2004. Endophytes-the chemical synthesizers inside plants. Sci. Progress, 87:79-99. Palanichamy, P., Thangavel A., Maruthamuthu M. 2014. Ethyl acetate Extraction of Antibacterial Compounds of Endophytic Fungi Isolated from Medicinal Plants. Chem. Sci. Rev. Lett. 3(10):178-182. Pan, J. H., Chen, Y., Huang, Y. H., Tao, Y. W., Wang, J., Li, Y., et al. . 2011. Antimycobacterial activity of fusaric acid from a mangrove endophyte and its metal complexes. Arch. Pharm. Res. 34, 1177-1181.
159
Panchal P., Singh, K. 2015. Antimicrobial activity of Barleria prionitis on pathogenic strains. Int. J. Curr. Pharm. Res. 7(4):73-75. Panda, S. K., Dutta, S. K. 2009. Antibacterial activity and phytochemical screening of leaf and bark extracts of Vitex negundo L. from similipal biosphere reserve, Orissa. J. Med. Plants. Res. 3(4):294-300. Pandi, M., Manikandan, R., Muthumary, J., 2010. Anticancer activity of fungal taxol derived from Botryodiplodia theobromae Pat; an endophytic fungus, against 7,12 dimethyl benz (a) anthracene (DMBA)- induced mammary gland carcinogenesis in sprague dawley rats. Biomed Pharmacother 64: 48-53. Panwar, H. S., Nauriyal, M. M. and Joshi, H. C. 1979. In vitro screening of certain indigenous plants for their antimycotic activity. Veterinary Research Bulletin. 2(2):164-167. Parag, S., Vijyayshree, N., Rami, B., Patil, B. 2010. Antibacterial activity of Ocimum sanctum Linn. and its application in water purification. Res J Chem Environ. 14:46- 50. Paula, D. S.V., Cristina, M. de S. M., Débora, L., Jorge, B. T. , Maria, C. Q., João L. A., and Neiva, T. de O. 2011. Endophytic fungi associated with transgenic and non- transgenic cotton. Mycology. 2(2):91-97. Perez, C., Paul, M. and Bazerque, P. 1990. Antibiotic assay by agar-well diffusion method. Acta. Biol. Med. Exp. 15:113-115. Peters, A. F. 1991. Field and culture studies of Streblonema-Macrocystis new species Ectocarpales Phaeophyceae from Chile, a sexual endophyte of giant kelp. Phycologia 30:365-377. Petrini, O. 1986. Taxonomy of endophytic fungi of aerial plant tissues. In Microbiology of the Phyllosphere Edited by N. J. Fokkema, J. Van Den Heuvel, Cambridge University Press, Cambridge. pp. 175-187. Petrini, O. 1987. Endophytic fungi of alpine Ericaceae. The endophytes of Loiseleuria procumbens (eds. Laursen, G.A., Amairati, J.F., and Redhead, S.A.), Arctic and Alpine Mycology II. Environmental Science Research vol. 34. pp 71-77, Plenum Press, New York and London. Petrini, O. 1991. Fungal endophytes of tree leaves. In Microbial Ecology of leaves. Edited by J. H. Andrews, and S. S. Monano, Springer-Verlag, NewYork, pp. 179-197.
160
Petrini, O. 1996. Ecological and physiological aspects of host specificity in endophytic fungi. In Endophytic Fungi in Grasses and Woody Plants. Edited by S. C. Redlin and L. M. Carris, APS Press, St Paul, pp. 87-100. Petrini, O. and Dreyfuss, M. M. 1981. Endophytische Pilze in epiphytischen Araceae, Bromeliaceae and Orchidaceae. Sydowia 34:135-148. Petrini, O. and Fisher, P. J. 1986. Fungal endophytes in Salicornia perennis. Trans. Brit. mycol. Soc. 87:647-651. Petrini, O. and Fisher, P. J. 1988. A comparative study of fungal endophytes in xylem and whole stem of Pinus sylvestris and Fagus sylvatica. Trans. Br. mycol. Soc. 91: 233-238. Petrini, O., Hake, U. and Dreyfuss, M.M. 1990. An analysis of fungal communities isolated from fruticose lichens. Mycologia 82:444-451. Petrini, O., Sieber, T. N., Toti, L. and Viret, O. 1992. Ecology, metabolite production, and substrate utilization in endophytic fungi. Nat Toxins 1:185-196. Petrini, O., Stone, J. and Carroll, F. E. 1982. Endophytic fungi in evergreen shrubs in western Oregon: a preliminary study. Can. J. Bot. 60:789-796. Philipson, M. N. 1989. A symptomless endophyte of ryegrass (Lolium perenne) that spores on its host -a light microscope study. New Zeal. J. Bot. 27:513-519. Photita, W., Lumyong, S., Lumyong, P. and Hyde, K. D. 2001. Endophytic fungi of wild banana (Musa acuminata) at Doi Suthep Pui National Park, Thailand. Mycol. Res. 105:1508-1513. Pocock, K., Duckett, J. G. 1985. On the occurrence of branched and swollen rhizoids in British hepatics: Their relationships with the substratum and associations with fungi. New Phytologist 99:281- 304. Pongcharoen, W., Rukachaisirikul, V., Phongpaichit, S., Taylor, W. C., 2008. Metabolites from the endophytic fungus Xylaria sp. PSU-D14. Phytochemistry 69:1900-1902. Pratibha, D., Nadig, L. S. 2005. Study of anti-tussive activity of Ocimum sanctum Linn. in guinea pigs. Indian. J. Physiol. Pharmacol. 49(2):243-245. Premjanu N., Jayanthy C. 2012. Endophytic fungi a repository of bioactive compounds- a review. International Journal of Institutional Pharmacy and Life Sciences. 2(1):135-162.
161
Puri, S. C. Verma, V., Amna, T., Qazi, G. N. and Spiteller, M. 2005. An endophytic fungus from Nothapodytes foetida that produces Camptothecin. J. Nat. Prod. 68:1717- 1719. Puri, S. C., Nazir, A., Chawla, R., Arora, R., Riyaz-ul-Hasanb, S., Amna, T., Ahmed, B., Verma, V., Singh, S., Sagar, R., Sharma, A., Raj Kumar, Sharma, R. K. and Qazi, G. N. 2006. The endophytic fungus Trametes hirsuta as a novel alternative source of podophyllotoxin and related aryl tetralin lignans. J. Biotechnol. 122:494-510. Qin, J. C., Zhang, Y. M., Gao, J. M., Bai, M. S., Yang, S. X., Laatsch, H. and Zhang, A.L. 2009. Bioactive metabolites produced by Chaetomium globosum, an endophytic fungus isolated from Ginkgo biloba. Bioorg. Med. Chem. Lett. 19:1572-1574. Qin, S., Hussain, H., Schulz, B., Draeger, S., Krohn, K. 2010. Two new metabolites, epoxydine A and B, from Phoma sp. Helv. Chim. Acta 93, 169-174 Rajagopal, K. and Suryanarayanan, T. S. 2000. Isolation of endophytic fungi from leaves of neem Azadirachta indica A. Juss. Curr. Sci. 78:1375-1378. Rajagopal, K., Kalavathy, S., Kokila, S. et al. 2010. Diversity of fungal endophytes in few medicinal herbs of southern India. Asian j. exp. biol. sci. 1: 415-418 Ranga, R. S., Sowmyalakshmi, S., Burikhanov, R., Akbarsha, M. A., Chendil, D. A. 2005. Herbal medicine for the treatment of lung cancer. Mol. Cell. Biochem. 280:125- 133. Raviraja, N. S. 2005. Fungal endophytes in five medicinal plant species from Kudremukh Range, Western ghats of India. J. Basic. Microbiol. 45:230-235. Raviraja, N. S. 2005. Fungal endophytes in five medicinal plant species from Kudremukh Range, western ghats of India. J. Basic Microbiol. 45:230-235. Raviraja, N. S., Maria, G. L., Sridhar, K. R. 2006. Antimicrobial evaluation of endophytic fungi Inhabiting Medicinal Plants of the Western Ghats of India. Eng. Life. Sci. 6(5): 515-520. Redecker, D. 2000. Specific PCR primers to identify arbuscular mycorrhizal fungi within colonized roots. Mycorrhiza. 10:73-80 Richardson, K. A. and Currah, R. S. 1995. The fungal community associated with the roots of some rainforest epiphytes of Costa Rica. Selbyana 16:49-73. Rodrigues, K. F. 1994. The foliar fungal endophytes of the Amazonian palm Euterpe oleracea. Mycologia 86:376-385.
162
Rodrigues, K. F. 1996. Fungal endophytes of palms. In Endophytic fungi in grasses and woody plants. Edited by S. C. Reddin and L. M. Carris, APS Press, St. Paul, pp. 121-132. Rodrigues, K. F. and Dias Filho, M. B. 1996. Fungal endophytes in the tropical grasses Brachiaria brizantha cv. Marandu and B. humidicola. Pesquisa Agropecuária Brasileira 31:905-909. Rodrigues, K. F. and Petrini, O. 1997. Biodiversity of endophytic fungi in tropical regions. In Biodiversity of tropical microfungi. Edited by K. D. Hyde, Hong Kong University Press, Hong Kong, pp. 57-69. Rodrigues, K. F. and Samueles, G. J. 1999. Fungal endophytes of Spondias mombin leaves in Brazil. J. Basic Microbiol. 39:131-135. Rodrigues, K. F. and Samuels, G. 1990. Preliminary study of endophytic fungi in a tropical palm. Mycol. Res. 94:827-830. Rodrigues, K. F. and Samuels, G. J. 1992. Idriella species endophytic in palms. Mycotaxon 43:271-276. Rodriguez, R. J., White J. F. Jr., Arnold A. E., Redman R. S. 2009. Fungal endophytes: diversity and roles. New Phytol.182:314-330. Rojas, J. J., Veronica, J. O., Saul, A. O., and John, F. M., 2006. Screening for antimicrobial activity of ten medicinal plants used in Colombian folkloric medicine: A possible alternative in the treatment of non-nosocomial infections. BMC Complement. Altern. Med. 6(2):1-6. Rosa, L. H., Tabanca, Techen, N. N., Pan, Z., Wedge, D. E., and Moraes, R. M. 2012. Antifungal activity of extracts from endophytic fungi associated with Smallanthus maintained in vitro as autotrophic cultures and as pot plants in the greenhouse. Symbiosis 60:133-142 Rose, C. M., Catharine, L. 2011. Preliminary phytochemical screening and antibacterial activity on Vitex negundo. Int. J. Curr. Pharm. Res. 3(2):99-101. Rubini, M. R., Silva-Ribeiro, R. T., Pomella, A. W. V., Maki, C. S., Araújo, W. L., Santos, D. R. and Azevedo, J. L. 2005. Diversity of endophytic fungal community of cacao (Teobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of witches´ broom disease. Int. J. Biol. Sci, 1:24-33.
163
Saikkonen, K., Faeth, S. H., Helander, M. and Sullivan, T. J. 1998. Fungal endophytes: a continuum of interactions with host plants. Annu. Rev. Ecol. Syst. 29:319-343. Samy, R.P., Ignacimuthu, S. and Sen, A. 1998. Screening of 34 Indian medicinal plants for antibacterial properties. J. Ethnopharmacol. 62:173-182. Schmid, E. and Oberwinkler, F. 1993. Mycorrhiza-like interaction between the achlorophyllous gametophyte of Lycopodium clavatum L. and its fungal endophyte studied by light and electron microscopy. New Phytol. 124:69-81. Schulz, B. and Boyle, C. 2005. The endophytic continuum. Mycol. Res. 109:661-686. Schulz, B., Boyle, C., Draeger, S., Rommert, A. K. and Krohn, K. 2002. Endophytic fungi: a source of novel biologically active secondary metabolites. Mycol. Res. 9:996- 1004. Schulz, B., Wanke, U. and Draeger, S. 1993. Endophytes from herbaceous and shrubs: Effectiveness of surface sterilization methods. Mycol. Res. 97:1447-1450. Seena, S. and Sridhar, K. R. 2004. Endophytic fungal diversity of 2 sand dune wild legumes from southwest coast of India. Can. J. Microbiol. 50:1015-1021. Sethi, P. D., Charegaonkar, D. 1999. Identification of drugs in pharmaceutical formulations by Thin Layer Chromatography. 2nd edition. CBS publishers and distributors, 4596/1-A, 11 darya ganj, New delhi-110002. 1-30,32-52. Shrestha, K., Strobel, G. A., Prakash, S. and Gewali, M. 2001. Evidence for paclitaxel from three new endophytic fungi of Himalayan yew of Nepal. Planta Med. 67:374- 376. Shu, R. G., Wang, F. W., Yang, Y. M., Liu, Y. X., Tan, R. X. 2004. Antibacterial and xanthine oxidase inhibitory cerebrosides from Fusarium sp. IFB-121, an endophytic fungus in Quercus variabilis. Lipids 39:667-673. Shukla, P., Singh A., Gawri S., Alexande A., Sonwane S., 2011. In vitro propagation of Barleria prionitis Linn and its antibacterial activity. Int. J. Pharma Prof. Res. 2:198-200. Shynu, M., Saini, M., Sharma, B., Gupta, L. K., Gupta, P. K. 2006. Ocimum tenuiflorum possesses antiviral activity against bovine herpes virus-1.Indian J. Virol. 17(1): 28-34.
164
Sinclair, J.B., Cerkauskas, R.F. 1996. Latent infection vs. endophytic colonisation by fungi. In: Redlin SC, Carris LM (eds) Endophytic fungi in grasses and woody plants. APS, St Paul, Minnesota, pp 3-30 Singh, N., Verma, P., Pandey, B. R., Bhalla, M. 2012. Therapeutic Potential of Ocimum sanctum in Prevention and Treatment of Cancer and Exposure to Radiation: An Overview. Int. J. Pharm. Sci. Drug Res. 4(2):97-104. Singh, P. and Dash, S.S. 2014. Plant Discoveries 2013 - New Genera, Species and New Records. Botanical Survey of India, Kolkata. Singh, S. K., Gaikwad, V. P. and Waingankar, V. M. 2006. Diversity of endophytic fungi from aerial parts of Azadirachta indica A. Juss. Indian J. Bot. Res. 3:11-16. Siqueira, V.M., Conti, R., Araújo, J. M. and Souza-Motta, C. M. 2011. Endophytic fungi from the medicinal plant Lippia sidoides Cham. and their antimicrobial activity. Symbiosis. 53:89-95. Sirkar, N. N. 1989. Pharmacological basis of Ayurvedic therapeutics In: Atal, C. K. and Kapoor, B. M. (Eds.), Cultivation and utilization of medicinal plants. Published by PID CSIR. Skiest, D.J. 2006. Treatment failure resulting from resistance of Staphylococcus aureus to daptomycin. J. Clin. Microbiol. 44:655-6. Southcott, K. A. and Johnson, J. A. 1997. Isolation of endophytes from two species of palm from Bermuda. Can. J. Microbiol. 43:789-792. Souza, A. Q. L., Souza, A. D. L., Astolfi Filho, S., Pinheiro, M. L. B., Sarquis, M. I. M. and Pereira, J. O., 2004. Antimicrobial activity of endophytic fungi isolated from amazonian toxic plants: Palicourea longiflora (aubl.) rich and Strychnos cogens bentham. Acta Amaz. 34:185-195. Sreekanth, D., Syed, A., Sarkar, S., Sarkar,D., Santhakumari, B., Ahmad, A., and Khan, M. I. 2009. Production, Purification, and Characterization of Taxol and 10- DABIII from a new Endophytic Fungus Gliocladium sp. Isolated from the Indian Yew Tree, Taxus baccata. J. Microbiol. Biotechnol. 19(11):1342-1347. Srinivasan, M. C., Chidambaram, P., Mathur, S. B. and Neergaard, P. 1971. A simple method for inducing sporulation in seed-borne fungi. Trans. Br. mycol. Soc. 56:31-35.
165
Stierle, A., Strobel, G. A. and Stierle, D. 1993. Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew. Science 260:214-216. Stinson, M., Ezra, D., Hess, W. M., Sears, J. and Strobel, G. A. 2003. An endophytic Gliocladium sp. of Eucryphia cordifolia producing selective volatile antimicrobial compounds. Plant Sci. 165:913-922. Stone, J. K., Bacon, C. W. and White, J. F. 2000. An overview of endophytic microbes: endophytism defined. In Microbial endophytes. Edited by C. W. Bacon and J. F. White, Marcel Dekker, New York, pp. 199-236. Stone, J.K. 1987. Initiation and development of latent infections by Rhabdocline parkeri on Douglas-fir. Can. J. Bot. 65:2614-2621 Strobel, G. A., 2002. Microbial gifts from rain forests. Can. J. Plant Pathology 24:14-20. Strobel, G. A., Dirksie, E., Sears, J. and Markworth, C. 2001. Volatile antimicrobials from Muscodor albus, a novel endophytic fungus. Microbiology 147:2943-2950. Strobel, G. A., Hess, W. M., Li, J. Y., Ford, E. J., Sidhu, R. S. and Summerell, B. 1997. Pestalotiopsis guepini, a taxol producing Wollemi pine endophyte of Wollemia nobilis. Aust. J. Bot. 45:1073-1082. Strobel, G., and Daisy, B. 2003. Bioprospecting for Microbial Endophytes and Their Natural Products. Microbiol Mol Biol Rev 67(4):491-502. Strobel, G.A., 2003,Endophytes as sources of bioactive products. Microb Infect 5:535-44. Strobel, G.A., 2002. Rainforest endophytes and bioactive products. Crit. Rev. Biotech. 22:315-333. Sturz, A. V., and Nowak, J. 2000. Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Appl. Soil Ecol. 15:183-190. Subban, K., Subramani, R., Johnpaul, M. 2013. A novel antibacterial and antifungal phenolic ompound from the endophytic fungus Pestalotiopsis mangiferae. Nat. Prod. Res. 27:1445-1449. Sun, X., DING, Q., HYDE, K. D., GUO, L. D. 2012. Community structure and preference of endophytic fungi of three woody plants in a mixed forest. Fungal. Ecol. 5(5):624-632.
166
Sunayana, N., Nalini, M. S., Sampath Kumara, K. K. and Prakash, H. S. 2014. Diversity studies on the endophytic fungi of Vitex negundo L. Mycosphere 5(4):578- 590. Suryanarayanan T. S. and Kumaresan, V. 2000. Endophytic fungi of some halophytes from an estuarine mangrove forest. Mycol. Res. 104:1465-1467. Suryanarayanan, T. S., Murali, T. S. and Venkatesan, G. 2002. Ouccurance and distribution of fungal endophytes in tropical forests across a rain fall gradient. Can. J. Bot. 80:818- 826. Suryanarayanan, T. S., Senthilarasu, G. and Muruganandam, V. 2000. Endophytic fungi from Cuscuta reflexa and its host plants. Fungal Divers. 4:117-123. Suryanarayanan, T.S., Murali, T.S., Thirunavukkarasu, N., Rajulu, M.B.G., Venkatesan, G., Sukumar, R. 2011. Endophytic fungal communities in woody perennials of three tropical forest types of the Western Ghats, southern India. Biodivers. Conserv. 20:913-928. Suryanarayanan, T.S., Thirunavukkarasu, N., Hariharan, G.N. and Balaji, P. 2005. Occurrence of non-obligate inside lichen thalli. Sydowia 57:120-130. Suryanarayanan, T.S., Venkatachalam, A., Thirunavukkarasu, N., Ravishankar, J.P., Doble, M., Geetha, V. 2010. Internal mycobiota of marine macroalgae from the Tamilnadu coast: distribution, diversity and biotechnological potential. Bot Mar 53:457-468. Suthep, W., Nongluksna, S., Wattana, P., Nuntawan, T., Kannawat, D., Nijsiri, R. and Vithaya, M. 2004. Endophytic fungi with antimicrobial, anti-cancer and anti-malarial activities isolated from Thai medicinal plants. World J. Microb. Biotechnol. 20:265- 272. Sutton, B. C. 1980. The Coelomycetes, Fungi Imperfecti with pycnidia Acervuli and Stromata. Robert Mac Lechose and Co. Ltd. University of Glasgow. England, pp. 696. Talukdar, S. N., Rahman, Md. B., Paul, S. 2015. A Review on Barleria prionitis: Its Pharmacognosy, Phytochemicals and Traditional Use. Journal of Advances in Medical and Pharmaceutical Sciences 4(4):1-13. Tan, R. X. and Zou, W. X. 2001. Endophytes: a rich source of functional metabolites. Nat. Prod. Rep. 18:448-459.
167
Tandon, V. R. and Gupta, R. K. 2006. Anti-inflammatory activity and mechanism of action of vitex negundo linn. Int. J. Pharmacol. 2:303-308. Tandon, V. R., Khajuria, V., Kapoor, B., Kaur, D. And Gupta, S. 2008. Hepatoprotective activity of Vitex negundo leaf extract against antitubercular drugs induced hepatotoxicity. Fitoterapia. 29(7-8): 533-538 Tegos, G., Stermitz, F. R., Lomovskaya, O., Lewis, K. 2002. Multidrug pump inhibitors uncover remarkable activity of plant antimicrobials. Antimicrob. Agents Chemother. 46:3133-3141. Tejesvi, M. V., Mahesh, B., Nalini, M. S., Prakash, H. S., Kini, K. R., Subbiah, V.and Shetty, H. S., 2006. Fungal endophyte assemblages from ethnopharmaceutically important medicinal trees. Can. J. Microbiol. 52:427-435. Tejesvi, M. V., Mahesh, B., Nalini, M. S., Prakash, H. S., Kini, K. R., Subbiah, V. and Shetty, S. 2005. Endophytic fungal assemblages from inner bark and twig of Terminalia arjuna W. and A. (Combretaceae). World J. Microbiol. Biotechnol. 21:1535-1540. Tenguria, R. K. and Firodiya, A. 2015. Occurrence of endophytic fungi in leaves of medicinal plants from central region of Madhya pradesh, India. World Journal of Pharmacy and Pharmaceutical Sciences. 4(11):1921-1934. Thomma, B.P.H.J., Eggermont, K., Broekaert, W.F., Cammue, B.P.A. 2000. Disease development of several fungi on Arabidopsis can be reduced by treatment with methyl jasmonate. Plant Physiol. Biochem. 38:421–427. Tsuchinari, M., Shimanuki, K., Hiramatsu, F., Muratama, T., Koseki, T., Shiono, Y. 2007. Fusapyridons A and B, novel pyridone alkaloids from an endophytic fungus, Fusarium sp. YG-45. Z. Naturforsc. B Chem. Sci. 62:1203-1207. Verhoeff, K. 1974. Latent infection by fungi. Annu. Rev. Phytopathology 12:99-110. Verma, V. C., Gond, S. K., Kumar, A., Kharwar, R. N. and Strobel, G. A. 2006. The endophytic mycoflora of bark, leaf and stem tissues of Azadirachta indica A. Juss. (Neem) from Varanasi (India). Microbial Ecol. DOI 10.1007/s00248-006-9179-9. Wagenaar, M. M., Clardy, J. 2001. Dicerandrols, new antibiotic and cytotoxic dimers produced by the fungus Phomopsis longicolla isolated from an endangered mint. J. Nat. Prod. 64:1006-1009
168
Wagenaar, M. M., Corwin, J., Strobel, G., Clardy, J. 2000. Three newcytochalasins produced by an endophytic fungus in the genus Rhinocladiella. J. Nat. Prod. 63(12):1692-1695. Wall, M.E., Wani, M.C., Cook, C.E., Palmer, K.H., McPhail, A.T. and Sim, G.A. 1966. Plant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from Camptotheca acuminata. J. Am. Chem. Soc. 88:3888-3890. Waller, G. R., Mac Vean, C. D. and Suzuki, T. 1983. High production of caffeine and related enzyme activities in callus cultures of Coffea arabica L. Plant Cell. Rep. 2:109- 112. Wang, J., Li, G., Lu, H., Zheng, Z., Huang, Y., Su, W. 2000. Taxol from Tubercularia sp. strain TF5, an endophytic fungus of Taxus mairei. FEMS Microbiology Letters 193:249-253. Wang, J., Huang, Y., Fang, M., Zhang, Y., Zheng, Z., Zhao, Y., Su, W. and Brefeldin, A. 2002. A cytotoxin produced by Paecilomyces sp. and Aspergillus clavatus isolated from Taxus mairei and Torreya grandis. FEMS Immunol. Medical Microbiol. 34:51-57. Wang, Y. and Guo, L.D. 2007. A comparative study of endophytic fungi in needles, bark, and xylem of Pinus tabulaeformis. Can. J. Bot. 85:911-917. Weber, D., Sterner, O., Anke, T., Gorzalczancy, S., Martino, V., Acevedo, C. 2004. Phomol, a new antiinflammatory metabolite from an endophyte of the medicinal plant Erythrina crista-galli. J. Antibiot. 57:559-563 Wennström, A. 1994. Endophyte: the misuse of an old term. Oikos 71: 535-536. Wilson, D. 1995. Endophyte-the evolution of a term and clarification of its use and definition. Oikos 73:274-276. Xuping, S., Zhan, X., Ma, Z., Yu, X. and Zhang, C., 2014. Antifungal activity of metabolites of the endophytic fungus Trichoderma brevicompactum from garlic. Braz. J Microbiol. 45:248-254. Yang, L., Yen, K., Kiso, Y. and Hikino, H. 1987. Antihepatotoxic actions of formosan plant drugs. J. Ethnopharmacol. 19:103-110. Yu, H.S., Zhang, L., Li, L., Zheng, C., Guo, L., Li, W., Sun, P., Qin, L., 2010. Recent developments and future prospects of antimicrobial metabolites produced by endophytes. Microbiol. Res. 165:437-449.
169
Zakaria, L., Yaakop, A. S., Salleh, B. and Zakaria, M. 2010. Endophytic Fungi from Paddy. Trop. Life. Sci. Res. 21(1):101-107. Zhang, W., Draeger, S., Schulz, B., Krohn, K. 2009. Ring B aromatic steroids from an endophytic fungus, Colletotrichum sp. Nat. Prod. Commun. 4:1449-1454. Zhang, Y., Zhang, H, Yu, P., Liu, Q., Liu, K., Duan, H., Luan, G., Yagasaki, K., Zhang, G. 2009. Effects of matrine against the growth of human lung cancer and hepatoma cells as well as lung cancer cell migration. Cytotechnology. 59:191-200. Zou, W. X., Meng, J. C., Lu, H., Chen, G. X., Sh,i G. X., Zhang, T. Y., et al. . 2000. Metabolites of Colletotrichum gloeosporioides, an endophytic fungus in Artemisia mongolica. J. Nat. Prod. 63:1529-1530. Zuccaro, A., Schoch, C.L., Spatafora, J.W., Kohlmeyer, J., Draeger, S., Mitchell, J. 2008. Detection and identification of fungi associated with the brown seaweed Fucus serratus. Appl. Environ. Microbiol. 74:931-941.
170
List of Publications and Presentation
1. Desale, M. G. and Bodhankar M. G. 2013. Antimicrobial Activity of Endophytic Fungi Isolated From Vitex negundo Linn. Int.J.Curr.Microbiol.App.Sci. 2(12):389-395
2. Desale, M. G. and Bodhankar M. G. 2014. Antimicrobial activity of endophytic fungi isolated from Ocimum sanctum. Am. int. j. contemp. sci. res. 1:3. http://www. http://journal.yloop.com/index.php/AIJ/article/view/32/31
3. Paper on ‘Endophytic fungi isolated from Ocimum sanctum’ presented at International conference BTBT (Biotechnology for Better Tomorrow) - 2013 held at Mauritius, 11- 12 November 2013.
171