Myxovirus Resistance Protein 1 (MX1), a Novel HO-1 Interactor, Tilts the Balance of Endoplasmic Reticulum Stress Towards Pro-Death Events in Prostate Cancer

biomolecules

Article Myxovirus Resistance Protein 1 (MX1), a Novel HO-1 Interactor, Tilts the Balance of Endoplasmic Reticulum Stress towards Pro-Death Events in Prostate Cancer

1,2, 1,2, 1,2 1,2 Emiliano Ortiz †, Pablo Sanchis †, Juan Bizzotto , Soﬁa Lage-Vickers , Estefania Labanca 3 , Nora Navone 3, Javier Cotignola 1,2 , Elba Vazquez 1,2 and Geraldine Gueron 1,2,*

1 Laboratorio de Inflamación y Cáncer, Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires C1428EGA, Argentina; [email protected] (E.O.); [email protected] (P.S.); [email protected] (J.B.); sofi[email protected] (S.L.-V.); [email protected] (J.C.); [email protected] (E.V.) 2 CONICET-Universidad de Buenos Aires, Instituto de Química Biológica de la Facultad de Ciencias Exactas y Naturales (IQUIBICEN), Buenos Aires C1428EGA, Argentina 3 Department of Genitourinary Medical Oncology and the David H. Koch Center for Applied Research of Genitourinary Cancers, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] (E.L.); [email protected] (N.N.) * Correspondence: [email protected]; Tel.: +54-9114-408-7796; Fax: +54-9114-788-5755 These authors contributed equally to this work and are co-first authors. † Received: 5 June 2020; Accepted: 25 June 2020; Published: 6 July 2020

Abstract: The inflammatory tumor microenvironment is a fertile niche accelerating prostate cancer (PCa). We have reported that heme-oxygenase (HO-1) had a strong anti-tumoral effect in PCa. We previously undertook an in-depth proteomics study to build the HO-1 interactome in PCa. In this work, we used a bioinformatics approach to address the biological significance of HO-1 interactors. Open-access PCa datasets were mined to address the clinical significance of the HO-1 interactome in human samples. HO-1 interactors were clustered into groups according to their expression profile in PCa patients. We focused on the myxovirus resistance gene (MX1) as: (1) it was significantly upregulated under HO-1 induction; (2) it was the most consistently downregulated gene in PCa vs. normal prostate; (3) its loss was associated with decreased relapse-free survival in PCa; and (4) there was a significant positive correlation between MX1 and HMOX1 in PCa patients. Further, MX1 was upregulated in response to endoplasmic reticulum stress (ERS), and this stress triggered apoptosis and autophagy in PCa cells. Strikingly, MX1 silencing reversed ERS. Altogether, we showcase MX1 as a novel HO-1 interactor and downstream target, associated with ERS in PCa and having a high impact in the clinical setting.

Keywords: heme-oxygenase 1 (HO-1); myxovirus resistance protein (MX1); endoplasmic reticulum stress; unfolded protein response; prostate cancer

1. Introduction The principal goal currently within prostate cancer (PCa) research is to unveil markers for the early detection of aggressive tumors that are predestined to invade and metastasize and to find druggable targets. Proteomics represents an important tool for the identification of new molecular targets for PCa-tailored therapy. Towards this end, we previously undertook an in-depth mass spectrometry-based study to build the heme-oxygenase 1 (HO-1) interactome in PCa. Heme-oxygenase 1, a critical mediator of cellular homeostasis [1], appears as an interesting target in oncology [2]. Although different roles

Biomolecules 2020, 10, 1005; doi:10.3390/biom10071005 www.mdpi.com/journal/biomolecules Biomolecules 2020, 10, 1005 2 of 23 have been attributed to HO-1 and tumor pathology [3], we have shown its anti-tumoral effects in PCa. This factor was capable of inhibiting cell proliferation, migration, and invasion [4]; it impaired tumor growth and angiogenesis in vivo and downregulated target genes associated with inflammation [4,5]. Interestingly, we have also found a tight association between HO-1 and the cytoskeletal compartment, altering adherens junctions and cell-cell zippering in PCa [6–8]. We have established a four molecular pathway foundation (ANXA2/HMGA1/POU3F1; NFRSF13/GSN; TMOD3/RAI14/VWF; PLAT/PLAU) behind HO-1 regulation of the tumor cytoskeletal compartments [8]. We propose that HO-1 and its interactors reprogram PCa cells and, in turn, modify the tumor microenvironment, favoring a less aggressive phenotype. Thus, we were interested in addressing the clinical significance of HO-1 interactors in PCa. In particular, as HO-1 is a stress response protein [9], we sought interactors associated with cellular stress. The constant division of tumor cells represents a challenge given by the restriction in nutrients and oxygen supplies, supporting the selection of cell variants. This characteristic represents one of the reasons why proteins display altered expression patterns in cancer. The functional complexity of the endoplasmic reticulum (ER) can be affected by a number of factors, both from the cell interior itself and/or from the environment that surrounds it, causing ER stress (ERS) [10]. Such factors include hypoxia, glucose availability, hypernatremia, redox status, and calcium levels, which directly impact the correct folding of proteins within the endoplasmic lumen, thus generating an accumulation of unfolded or misfolded proteins within ER [10]. This event triggers a specific cellular process in order to reestablish cellular proteostasis, which is known as the response to misfolded proteins (unfolded protein response (UPR)) [11]. Activation of this mechanism is the criterion that defines ERS [10]. The suboptimal conditions of the tumor microenvironment are the main triggers that make UPR activation a vital mechanism for the survival of tumor cells. Several observations have shown that an aggravated increase in acute stress, as well as the extension in time of the stressful stimulus represent decisive factors when determining cell destiny regarding death or survival [12,13]. To explore the contribution of HO-1 interactors associated with ER stress in PCa, we first performed a thorough bioinformatics analysis to address the role of HO-1 interacting proteins in this disease. Proteins were clustered into three groups according to their expression profile. In parallel, we carried out an RNA-seq analysis to compare gene expression profiles between PCa cells over-expressing HO-1 and their respective controls, to evaluate the ability of HO-1 in regulating the expression at the transcriptional level of the proteins included in these clusters. Taking into account all of our results, we focused on the human myxovirus resistance gene (MX1). This factor is well described as playing a vital role in preventing the replication of various types of RNA viruses [14–16]. Interestingly, some reports demonstrated that cells infected with the Influenza virus increased apoptosis mediated by ERS [14]. Hence, we sought to assess whether there was an association between MX1 and ERS in PCa and, in turn, whether this association was linked to pro-apoptotic or pro-autophagic events. Further, we analyzed HMOX1, MX1, and ERS as risk predictors of clinical outcome in PCa.

2. Materials and Methods

2.1. Cell Culture, Treatments, Reagents, and Antibodies PC3 cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured with RPMI 1640 culture medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% v/v fetal bovine serum (FBS) (Internegocios, Buenos Aires, Argentina), penicillin 100 U/mL, streptomycin 100 µg/mL, and amphotericin 0.5 µg/mL. Hemin was obtained from SIGMA-Aldrich (St. Louis, MO, USA). For treatments, cells were incubated 24 h in RPMI media containing 10% FBS and antibiotics and then were exposed to hemin (80 µM, 24 h). Thapsigargin was obtained from Sigma-Aldrich and dissolved in dimethyl sulfoxide (DMSO) and phosphate-buﬀered saline (PBS). For treatments, cells Biomolecules 2020, 10, 1005 3 of 23 were incubated in complete RPMI media and treated with thapsigargin 0.1 µM or 0.25 µM for 24 h. Interferon gamma (INFγ) protein was obtained from ImmunoTools (Friesoythe, Germany). PC3 cells were treated with INFγ, 500 U/mL, for 18 or 24 h. Mouse anti-human HO-1 monoclonal antibody and rabbit anti-MX1 antibody were obtained from Abcam (Cambridge, UK). Mouse anti-human β-actin antibody, rabbit anti-LC3, and rabbit anti-GADPH antibodies were obtained from Cell Signaling (Danvers, MA, USA). Horseradish peroxidase (HRP) conjugated anti-mouse secondary antibody was obtained from Cell Signaling. Secondary antibodies conjugated to Alexa 555 and Alexa 647 ﬂuorophores were obtained from Molecular Probes, Invitrogen.

2.2. Plasmids and Transient Transfections PC3 cells were transiently transfected for 48 h with HO-1 expression plasmids (p3xFLAGHO-1 or pcDNA3HO-1) or empty vectors as controls (p3xFLAG or pcDNA3), as previously described [8]. Cells cultured in 10 cm plates were transfected using 10 µg of plasmid and 20 µL of polyethylene glycol (PEI) in a ﬁnal volume of 200 µL of RPMI 1640 culture medium. Transfections were performed on plates with 3 mL of RPMI 1640 without FBS or antibiotics. Five hours post-transfection, the culture medium was replaced by RPMI 1640 complete with 10% v/v FBS and antibiotics in the previously mentioned concentrations.

2.3. RNA Isolation, c-DNA Synthesis, and Quantitative Real-Time Polymerase Chain Reaction Total RNA was isolated with Quick-Zol (Kalium technologies, Buenos Aires, Argentina) according to the manufacturer’s protocol. cDNAs were synthesized with the RevertAid Premium First Strand cDNA Synthesis Kit (Fermentas, Waltham, MA, USA) and used for real-time PCR ampliﬁcation with Taq DNA Polymerase (Invitrogen, Waltham, MA, USA) in a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientiﬁc, Waltham, MA, USA). PPIA was used as an internal reference gene. The data obtained were analyzed using the method of 2-∆∆CT [17]. Primers used for each gene were as follows (50-30): MX1 Fw: AGGACCATCGGAATCTTGAC, Rv: TCAGGTGGAACACGAGGTTC; HSPA5 Fw: ACCGCTGAGGCTTATTTGGGA, Rv: CGTCTTTGGTTGCTTGGCGT; XBP1 Fw: TGGATGCCCTGGTTGCTGAA, Rv: GCACCTGCTGCGGACTCA; DDIT3 Fw: GCAGCGACAGAGCCAAAATC, Rv: GCTTTCAGGTGGTGATGTATG; PPIA Fw: GGTATAAAAGGGGCGGGAGG, Rv: CTGCAAACAGCTCAAAGGAGAC.

2.4. RNA Sequencing RNA-seq was performed as previously described [8].

2.5. Immunofluorescence Assay Cells were seeded in 12 well plates at a density of 1 105 cells per well on coverslips overnight. × After cells were transiently transfected with pcDNA3HO-1 or empty vector, cells were fixed in ice-cold methanol for 20 min at 4 ◦C and permeabilized with 0.1% Triton X (v/v) in PBS for 5 min at room temperature. After washing twice with PBS, cells were blocked with 3% (m/v) bovine serum albumin (BSA)/PBS for 1 h at room temperature. Cells were incubated overnight at 4 ◦C with anti-MX1 and HO-1 antibodies diluted 1:200 in 3% (m/v) BSA/PBS. Negative controls were carried out using PBS instead of primary antibodies. Cells were washed with PBS and incubated with fluorescent secondary antibodies for 1 h at room temperature, then stained with DAPI, and imaged by confocal laser scanning microscopy, performed with an Olympus Fluo View FV 1000 microscope, using an Olympus 60X/1.20 NA UPLAN APO water immersion objective.

2.6. Protein Extraction, Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis and Western Blot Total cell lysates and immunoblot analysis were carried out as previously described [18]. Brieﬂy, cells were lysed with RIPA buﬀer (Tris HCl 50 mM pH 7.4; NaCl 150 mM; ethylenediaminetetraacetic Biomolecules 2020, 10, 1005 4 of 23

acid (EDTA) 20 mM pH 8; sodium deoxycholate 1%; SDS 0.1%; Triton X-100 1%, 1 mM Na3VO4, 20 mM NaF, and 1 mM Na4 P2O7, pH 7.9) and homogenized. After 20 min of incubation at 4 ◦C, lysates were centrifuged at 12,000 g for 20 min at 4 C and the supernatant kept at 80 C. Lysates containing equal × ◦ − ◦ amounts of proteins (60 µg) were resolved on 7.5–12.5% Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS–PAGE) depending on the molecular weight of the proteins under study. Page Ruler Plus Prestained Protein Ladder (Fermentas) was used for the estimation of molecular weight. Proteins were blotted to a Hybond-ECL nitrocellulose membrane (GE Healthcare, Little Chalfont, UK). Membranes were blocked with 5% dry non-fat milk in TBS containing 0.1% Tween 20 (TBST) for 1 h at room temperature and incubated with primary monoclonal antibodies diluted in TBST (overnight; at 4 ◦C). Membranes were then washed with TBST (10 min; three times) and incubated with horseradish peroxidase-labelled secondary antibody (1 h at room temperature).

2.7. Apoptosis Analysis by Flow Cytometry The FITC Annexin V Apoptosis Detection Kit II (BD Pharmingen, San Jose, CA, USA) was used to assay thapsigargin-induced apoptosis in PC3 cells, according to the manufacturer’s instructions. Briefly, after treatment, cells were washed twice with cold 1 PBS and resuspended in binding buffer × 1 at a concentration of 1 106 cells/mL. From this suspension, one-hundred microliters were labeled × × with FITC Annexin V and propidium iodide (IP) and incubated for 15 min at room temperature in the dark. Finally, four-hundred microliters of binding buffer 1 were added and analyzed by flow × cytometry (Attune ™ NxT Flow Cytometer, Thermo Fisher Scientific) in the corresponding channels (Ex/Em: 495 nm/519 nm and 543 nm/614 nm), and the results were analyzed with FlowJo 8.7 software. For the non-specific label control, between 5 and 15 µg of the purified recombinant Annexin V protein were added to the cell suspension and incubated at room temperature for 15 min before proceeding with the labeling step (FITC + IP).

2.8. siRNA Transfection PC3 cells were transfected with ON-TARGETplus SMARTpool siRNA (Dharmacon; Pittsburgh, PA, USA, cat# L-011735-00-0005) to knock down MX1 expression or with a non-speciﬁc sequence siRNA (siRNA scrambled) as a negative control (ON-TARGETplus siRNA, Dharmacon, cat# D-001810-01-05). An amount of 3 105 PC3 cells was plated in six well multiwell plates until 50% of conﬂuence. × The culture medium in each plate was then replaced with 1.8 mL of complete RPMI 1640 medium and transfected with the corresponding siRNA in a concentration of 25 nM using Lipofectamine LTX (Invitrogen). Forty-eight hours later, thapsigargin 0.25 µM was added for 24 h until RNA extraction.

2.9. Statistical Analysis The t-test or ANOVA with the Tukey post-test was used to ascertain statistical signiﬁcance with a threshold of p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).

2.10. Bioinformatics Analysis

2.10.1. Oncomine Meta-Analysis in Prostate Cancer Patients We searched the public cancer microarray database Oncomine (http://www.oncomine.org) to identify expression microarrays that compared expressions in prostatic adenocarcinoma vs. prostate gland. To be included in our study, a dataset was required to (1) be generated from human prostate tumors and (2) compare prostate adenocarcinoma vs. normal prostate gland. Differential genes were considered when: (1) they presented a p-value < 0.05 and (2) had an increase or decrease in expression 1.5 times. Although the p-value criterion was strict for the dataset selection, some genes ≥ were considered even if the fold change or the gene rank was <1.5 or >10%, respectively, when the gene showed a significant over- or under-expression. Genes were ranked by their p-value for every Biomolecules 2020, 10, 1005 5 of 23 analysis scoring a gene rank. The median rank was the median p-value rank across datasets, for each gene assessed. Search/study selection: We performed a search for each HO-1 interactor protein. The resulting studies were analyzed on the basis of healthy prostate gland vs. prostate adenocarcinoma. The cited literature was reviewed to confirm that the analysis was as documented in the Oncomine database. All the selected papers are included in Table1 of the Results Section.

Table 1. Meta-analysis of multiple microarray datasets for HO-1-interacting proteins. Expression microarray studies selected from the Oncomine platform (http://www.oncomine.org) comparing prostate adenocarcinoma vs. normal prostate. N/A = not available.

Measured N GEO N Dataset Platform ◦ ◦ Genes Samples Accession 1 Arreduani Prostate HG U133 Plus 2.0 Array 19,574 21 GSE55945 2 Grasso Prostate Agilent Human Genome 44K 19,189 122 GSE35988 3 Holzbeierlein Prostate HG U95A-Av2 Array 8603 54 N/A 4 Lapointe Prostate Undefined Platform 10,166 112 GSE3933 5 LaTulippe Prostate HG U95A-Av2 Array 8603 35 GSE68882 6 Liu Prostate HG U133A Array 12,624 57 N/A Hu35k (A-D) and HG 7 Luo Prostate 15,302 30 GSE68545 U95A-Av2 array 8 Magee Prostate HumanGeneFL Array 5338 15 N/A 9 Singh Prostate HG U95A-Av2 Array 8603 102 GSE68907 10 Taylor Prostate Undefined Platform 22,238 185 GSE21032 11 Tomlins Prostate Undefined Platform 10,656 101 GSE6099 12 Vanaja Prostate HG U133(A-B) Array 17,779 40 N/A 13 Varambally Prostate HG U133 Plus 2.0 Array 19,574 19 GSE3325 14 Wallace Prostate HG U133 2.0 Array 12,603 89 GSE6956 15 Welsh Prostate HG U95A-Av2 Array 8603 34 N/A 16 Yu Prostate HG U95A-Av2 Array 8603 112 GSE68555

2.10.2. RNA-Seq Gene Expression and Correlation Analysis in Prostate Cancer Patients For gene expression and correlation analysis, we used the dataset from the Prostate Adenocarcinoma Project of The Cancer Genome Atlas (TCGA-PRAD; http://cancergenome.nih.gov). This study includes RNA-seq data from 497 prostate tumor samples and normal adjacent to tumor tissue, measured by massively parallel sequencing (Illumina HiSeq). For transcriptomics data derived from normal tissues, we browsed the Genotype-Tissue Expression (GTEx) project (2013) (https://gtexportal.org/), a collection of 54 non-diseased tissues sites across 1000 healthy donors. For our study, we used RNA-seq gene expression data of prostate samples (n = 100).

2.10.3. Gene Expression Microarray and Relapse-Free Survival in Prostate Cancer Patients To study the impact of expression levels on relapse-free survival (RFS) for PCa patients, one dataset was selected according to the following criteria: (1) the study included gene expression and clinical data for each patient with 5 years of follow-up; (2) the study consisted of 60 samples; and (3) ≥ ≥ the study was published and available in public repositories. We used the dataset from Ross-Adams 2015 (GSE70770) [19] GPL10558 series available in gene expression omnibus (GEO). It includes information of a prostate cancer patient cohort with 206 samples from men who had undergone radical prostatectomy and clinical follow-up of eight years, including relapse information (biochemical relapse). Biochemical relapse was deﬁned according to the European Guidelines as a prostate speciﬁc antigen (PSA) persistent rise above 0.2 ng/mL). Tumor sample expression of 31,000 transcripts was measured by 47,000 probes using the Illumina HumanHT-12 V4.0 platform. Biomolecules 2020, 10, 1005 6 of 23

2.10.4. cBioPortal Exome Analysis in Prostate Cancer Patients We used cBioPortal (https://www.cbioportal.org/), an open source cancer genomics data platform, created by the Memorial Sloan-Kettering Cancer Center (MSKCC), to analyze the most common mutations, copy-number alterations, and gene expression of MX1 and HMOX1 in PCa patients (11 datasets, n = 3211 samples; last accessed April 2020). The criteria used in order to include datasets in our analysis were as follows: (1) type of cancer: Prostate adenocarcinoma or metastasis; (2) the study must be published; and (3) the study consists of a sample number > 60.

2.10.5. Statistical Analysis Stata software (StataCorp LLC, College Station, TX, USA) was used to explore patients’ RFS, and survminer R package [20] was used to generate Kaplan–Meier (KM) curves. To find the cutoff value to stratify patients into two groups based on the gene expression levels, we used the minimal p-value approach from the Cutoff Finder tool [21]. For univariable analyses of prognostic factors, the log-rank test and Cox proportional hazard model regression were employed. The hazards ratio (HR) indicates the probability of relapse of a patient with high gene expression with respect to one with low gene expression, considering HR=1 for the latter case. Correlation analysis between HMOX1 and MX1 was performed using Graph Pad Software. The Pearson correlation coefficient was determined for all analyses. Statistical significance was set at p < 0.05. For copy-number alterations and gene expression analysis, ANOVA followed by Tukey post tests were performed to assess statistical significance with a threshold of p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).

3. Results

3.1. Clinical Relevance of the HO-1 Interactome in Prostate Cancer The molecular mechanisms underlying the pathogenesis of cancer-associated inflammation are intricate and represent a complex dialogue between the tumor and the microenvironment. As mentioned previously, HO-1 induction represents a critical event in cellular responses to pro-oxidative and pro-inflammatory insults [22]. HO-1 has been proposed to act as a biosensor regulating cell fate [23]. The current literature evidences that HO-1 has a role beyond its catalytic activity, participating in a wide variety of cellular processes that inhibit prostate tumor progression [1]. For this reason, we set out to identify HO-1-associated proteins and assess their clinical significance in PCa. We previously described the HO-1 interactome in PCa through a proteomics approach, identifying HO-1 molecular partners [8]. To address the clinical relevance of the HO-1 interactome in PCa, we searched the public cancer microarray database Oncomine (http://www.oncomine.org). This tool enabled us through pre-computed analyses to identify whether these genes had a high statistical significance for over- or under-expression in prostate adenocarcinoma vs. normal prostate gland. At the time of analysis, it harbored a total of 715 datasets and 86,763 human patient samples. We considered 16 datasets that met our eligibility criteria. Table1 outlines the datasets selected, the total number of patients assessed (n = 1045), and the number of genes analyzed in each microarray. We elaborated a transcriptomic profile for each of the HO-1 interactors and classified them into three different clusters (A, B, or C) according to the following expression profiles (Figure1A): Cluster A, genes that were over- or under-expressed in approximately 60% of datasets; Cluster B, genes that were over- or under-expressed in approximately 50% of datasets; Cluster C, genes that were over- or under-expressed in similar percentages of datasets (Figure1A). Cluster A rendered the following genes: NOA1, CBX3, RCC1, EEF2, ASPH, SQSTM1, TMOD3, GSN, HSPB1, and ANXA2 (Figure1B). The pie charts represent the percentage of datasets where the gene under study was over-expressed in PCa vs. normal prostate (red) or under-expressed in the same comparison (blue) (Figure1B). Cluster B included: TOP1, PDCD5, THRAP1, SLC12A7, PURA, RPA1, SFRS3 and MX1 (Figure1B). Cluster C included: ZC3HAV1, AHCTF1, TIMM44, KHSRP, MATR3, SIPA1L1, FTSJ3, NAP1L1, PRDX2, CACYBP, and ARNTL2 (Figure1B). The meta-analysis combining data from the independent datasets assessed showed that for prostate adenocarcinoma vs. Biomolecules 2020, 10, 1005 7 of 23

Biomolecules 2020, 10, x FOR PEER REVIEW 7 of 23 normal prostate gland, Cluster A and B genes lied within 35% of the most consistently high or low B genesexpressed lied within genes 35% across of the this most comparison consistently (Figure high1 C).or low We expressed also assessed genes all across clusters’ this expressioncomparison proﬁles (Figureacross 1C). The We Human also assessed Protein Atlasall clusters’ platform expr (https:ession//www.proteinatlas.org profiles across The Human/). Although Protein a fewAtlas samples platformwere available (https://www.proteinatlas for prostate adenocarcinoma,.org/). Although we coulda few observe samples a positivewere available correlation for forprostate NOA, RCC1, adenocarcinoma,TMOD3, HSPB1, we ASPH, could observe SQSTM1, a andpositive ANXA2 correlation from Cluster for NOA, A and RCC1, TOP1, TMOD3, PDCD5, HSPB1, THRAP3, ASPH, and MX1 SQSTM1,from Cluster and ANXA2 B (Supplementary from Cluster Figure A and S1A). TOP1, PDCD5, THRAP3, and MX1 from Cluster B (Supplementary Figure S1A).

Figure 1. HO-1 interactome analysis. (A) HO-1 interactor proteins clustered according to their genetic Biomolecules 2020, 10, 1005 8 of 23

expression profile in PCa patients in the Oncomine platform (n = 1045): Cluster A (aquamarine), Cluster B (red), Cluster C (yellow), and unclustered proteins (grey). Cluster A: genes that presented over- or under-expression in approximately 60% of the analyzed studies. Cluster B: genes that presented over- or under-expression in approximately 50% of the studies analyzed. Cluster C: genes expressed in similar proportions of over- or under-expression in the analyzed studies. (B) HO-1 interactor proteins were grouped according to their genetic expression profile. The graph shows the percentage of studies reporting gene under-expression (blue), over-expression (red), or without changes (gray) in each study analyzed in Oncomine (n = 1045). (C) Summary table showing the median rank and p-value for genes in Clusters A and B. (D) Gene expression analysis for genes in Clusters A and B comparing tumor vs. normal adjacent to tumor tissue, using the TCGA-Prostate Adenocarcinoma Project (PRAD) expression dataset (n = 497). The color code indicates no change in gene expression (white), over-expression (red), or under-expression (blue) for each gene. The intensity of the color is directly proportional to the gene’s expression fold change. The p-value for each gene is indicated in the third column. (E) The table summarizes the global analysis of the HO-1 interactome genes corresponding to Clusters A and B in Oncomine (16 datasets, n = 1045) and TCGA-PRAD (n = 497). The arrows indicate over- (red) or under-expression (blue) when comparing PCa vs. normal or normal adjacent to tumor tissue. Meta-analyses determined a median rank (position) for each gene assessed across all datasets. N/A = not available. In parallel, we examined gene expression for Clusters A and B using the data from the Prostate Adenocarcinoma Project of The Cancer Genome Atlas (TCGA-PRAD, n = 497) [24]. This dataset allowed us to evaluate gene expression profiles for PCa vs. normal adjacent to tumor tissue (Figure1D). Values greater than one represent gene induction (red), while values lower than one represent gene downregulation (blue). Results showed a significant dysregulation of selected genes in tumor compared with normal adjacent to tumor tissues: ANXA2 (fold change = 0.496; p = 4.48E-19), GSN (fold change = 0.533; p = 3.40 10 21), MX1 (fold change = 0.578; p = 1.04 10 7), HSPB1 (fold × − × − change = 0.584; p = 9.95 10 24), and ASPH (fold change = 0.613; p = 1.87 10 13); EEF2 (fold × − × − change = 2.43; p = 1.31 10 73), NOA1 (fold change = 1.762; p = 9.53 10 40), and RCC1 (fold × − × − change = 1.740; p = 6.48 10 31). Although the comparisons made in TCGA-PRAD and Oncomine × − were not exactly performed on the same tissues, some synchronicity could be observed between the expression profiles in both analyses for the genes studied (Figure1E). Genes CBX3, RCC1, TMOD3, and NOA1 (Cluster A) and TOP1, PDCD5, and THRAP3 (Cluster B) were upregulated for both datasets in PCa tissue vs. normal gland or normal adjacent to tumor tissue. Genes ASPH, HSPB1, SQSTM1, ANXA2, and GSN (Cluster A) and PURA and MX1 (Cluster B) were downregulated for both datasets in PCa tissue vs. normal gland or normal adjacent to tumor tissue (Figure1F).

3.2. Transcriptomic Analysis of HO-1 Interactors and Risk of Relapse in Prostate Cancer Patients To evaluate the relapse-free survival (RFS) time in PCa patients, associated with changes in the expression of Cluster A and B genes, we carried out an analysis using the Ross–Adams dataset (GSE70770) [19](n = 206), which gathers expression and clinical data from PCa patients who had undergone radical prostatectomy. Kaplan–Meier (KM) curves were performed taking the low expression group as the control. Results showed that RFS was signiﬁcantly lower in patients who had low expression of TMOD3, EEF2, ASPH, HSPB1, SQSTM1, ANXA2, GSN, TOP1, THRAP3, SLC12A7, PURA, and MX1 or high expression of RCC1, PDCD5, RPA1, and SFRS3 (Table2 and Supplementary Figure S1B). When compiling all the expression and RFS data, we could sub-classify genes with high expression in PCa vs. normal gland or normal adjacent to tumor tissue and signiﬁcantly decreased RFS (RCC1 and PCDC5) or with low expression in PCa and decreased RFS (ASPH, GSN, HSPB1, SQSTM1, ANXA2, MX1, and PURA) (Table2, white dots). In summary, the results evidenced how transcript dysregulation of these HO-1 interactors was associated with a change in RFS, highlighting their clinical importance for PCa. Biomolecules 2020, 10, 1005 9 of 23

Table 2. General comparative summary of gene expression and the eﬀects on relapse-free survival (RFS). The table summarizes the global analysis of the HO-1 interactome genes corresponding to Clusters A and B using Oncomine (16 datasets, n = 1045) and TCGA-PRAD (n = 497). The arrows indicate over- (red) or under-expression (blue) when comparing PCa vs. normal or normal adjacent to tumor tissue. Biomolecules 2020, 10, x FOR PEER REVIEW 10 of 24 Meta-analyses determined a median rank (position) for each gene assessed across all datasets. RFS

Biomoleculesreference 2020 , group.10, x FOR HR: PEER hazards REVIEWassociated ratio. N/A:Biomolecules with not avathe 2020ilable. gene, 10, x FORGenes expression PEER selected REVIEW profilesfor further of analysis Clusters are10 A of and24 B are shown for the Ross–Adams10 of 24 dataset highlighted with a white dot next to their gene symbol. Biomolecules 2020, 10, x FOR PEER REVIEW(GSE70770) Biomolecules (n = 2020206)., 10,All x FOR comparisons PEER REVIEW considered low10 expression of 24 patients as the reference10 of group.24 HR: reference group. HR: hazards ratio. N/A: referencenot available. group. Genes HR: selectedhazards forratio. further N/A: analysisnot ava ilable.are Genes selected for further analysis are Biomolecules 2020, 10, x FOR PEER REVIEWhazards Biomolecules ratio.EXPRESSION N 2020/A:, 10 not , x FOR available. PEER REVIEW Genes selectedSURVIVAL for10 further of 24 analysis are highlighted10 with of 24 * next to highlighted with a white dot nextOncomine to their genehighlighted symbol. with a whiteTCGA dot next to their geneRoss symbol. Adams Biomoleculesreference 2020 , group.10, x FOR HR: PEER hazards REVIEW ratio. N/A:Biomolecules referencenot ava 2020ilable. , group.10, x FORGenes HR: PEER selectedhazards REVIEW forratio. further N/A: analysisnot ava ilable.are10 of 24Genes selected for further analysis are10 of 24 reference group. HR:Over- hazards or their ratio. gene N/A: symbol. referencenot available. group.Over- Genes or HR: selectedhazards forratio. further N/A: analysisnot ava ilable.are Genes selected for further analysis are Biomolecules highlighted 2020, 10 with, x FOR a white PEER REVIEWdot next to theirBiomolecules gene EXPRESSIONhighlighted symbol. 2020, 10 with , x FOR a white PEERFold REVIEWdot next to their geneEXPRESSIONSURVIVAL symbol.Hazards10 of 24 SURVIVAL10 of 24 Expressiohighlighted with a whiteUnder- dot nextMedian to their genehighlighted symbol. Under- with a white dot next to their Coxgene p -symbol. referenceGene group. HR: hazardsOncomine ratio. N/A: p reference-Valuenot ava ilable. group. Genes HR:TCGA Changselectedhazards Oncomine pforratio.-Value further N/A: analysisnotRoss ava Adams ilable.areRatio GenesTCGA selected for further analysisRoss Adams are Biomoleculesn Cluster 2020, 10, x FORExpressio PEER REVIEWRank Biomolecules EXPRESSION 2020,Expressio 10 , x FOR PEER REVIEW ValueEXPRESSIONEXPRESSIONSURVIVAL 10 of 24 SURVIVAL10 of SURVIVAL 24 Biomoleculesreference 2020 , group.10, x FOR HR:Over- PEER hazards or REVIEW ratio. N/A:Biomolecules referencenot ava 2020ilable. , group.Over-10, x FORGenes or HR: Over- PEER selectedhazards or eREVIEW forratio. further N/A: analysisnot ava ilable.(IC95)are10Over- of 24Genes or selected for further analysis are10 of 24 highlighted with a whiten dot nextOncomine to their gene EXPRESSION highlighted symbol. with n a whiteTCGAFold dot nextOncomine to their geneEXPRESSIONRossSURVIVAL symbol. AdamsHazards TCGAFold RossSURVIVAL AdamsHazards Expressiohighlighted with a whiteUnder- dot nextMedian to their Expressio genehighlighted symbol. Under- with a whiteUnder-Oncomine dot nextMedian to their Coxgene p -symbol. Under- TCGACox p- Ross Adams referenceGene group. HR:Over- hazards or Oncomine 825ratio. (top N/A: p reference4.21-Valuenot ×ava Geneilable. group. Over- Genes or HR: Over-TCGA Changselectedhazards or Oncomine pforratio.8.67-Value further × N/A: p analysis-ValuenotRoss ava Adams 0.65 ilable.areRatioOver- (0.4– Genes or TCGA Changselected pfor-Value further analysisRoss Adams areRatio Biomoleculesn Cluster 2020CBX3, 10, x FORExpressio PEER REVIEWRank Biomoleculesn Cluster EXPRESSION 2020,Expressio 10 , x FORExpressio PEER1.312 REVIEW Rank Value0.085EXPRESSIONSURVIVAL Expressio10 of 24 ValueSURVIVAL 10 of 24 reference group. HR:Over- hazards or ratio. N/A: referencenot− 04available. group.Over- Genes or HR: Over- selectedhazardsFold or forratio. −further12 N/A: analysisnot ava Hazardsilable.areOver- Genes or selectedFold for further analysis Hazardsare BiomoleculesExpressio 2020, 10, x FOR Under-PEER REVIEW Median20%) Biomolecules Expressio EXPRESSION10 2020,Over- 10Under- , x FOR or Under-PEER eREVIEW Median 10 CoxEXPRESSION pSURVIVAL- (IC95)1.06)Over-10Under- of 24 or e Cox pSURVIVAL- (IC95)10 of 24 highlightedGene with a whiten Expressiondot nextOncomine to their genep highlighted-Value symbol. Gene with n a whiteTCGAnChang FoldMedian dot nextOncominep-Value to their genep-ValueRoss symbol. Adams HazardsRatio n TCGAChangFoldFold p-Value Ross AdamsCoxHazardsRatiop - Hazards Ratio Expression Clusterhighlighted with aExpressio whiteUnder- dot next487MedianRank to (top their Expression Gene Clustergenehighlighted symbol. ExpressioUnder- Under- with aExpressio whiteUnder- dot nextMedian6.48Rank to their× p -Value CoxgeneValue p -symbol. 4.85Expressio Under- (1.20–Under- p-ValueCoxValue p- referenceRCC1*Gene group. HR:Over- hazards orCluster Oncomine 825ratio. (top N/A: p reference4.21-Valuenot0.012 ×ava Geneilable. group. Over- Genes or HR: Over-TCGA Changselectedhazards1.74 orRank Oncomine p825forratio.8.67-Value (topfurther × N/A: 0.034 p analysis4.21-ValuenotRoss ×ava Adams 0.65 ilable.areRatioOver- (0.4– Genes or TCGA ChangselectedChange pfor8.67-Value further × analysisRoss Adams0.65Value areRatio (0.4– (IC95) n Cluster CBX3 Expressio Rank15%) Biomoleculesn Cluster EXPRESSION 2020CBX3Expression,Expressio 10 , x FORExpressio PEER 1.312 eREVIEW Rank10 −31 Value0.085EXPRESSIONSURVIVAL Expression(IC95)2.09)Expressio 1.312e Value0.085SURVIVAL (IC95)10 of 24 reference group. HR:Over-n hazards or ratio.20%) N/A: referencenot10− 04ava ilable. group.Over-n Genes or HR: Over- n selectedhazards Fold ore forratio.20%)10 −further12 N/A: analysisnot10− 04ava Hazardsilable.(IC95)are1.06)Over- n Genes or selectedFolde for10 −further12 analysis Hazards(IC95)are1.06) Expressio highlighted with a whiteUnder-n dot nextMedian to their Expressio gene EXPRESSIONhighlighted symbol. Under- with n a whiteUnder-n Fold dot nextMedian to their CoxgeneEXPRESSION pSURVIVAL -symbol. Hazards Under- n Fold Cox pSURVIVAL- Hazards Expressio Gene Under- Oncomine2,035Median825 (top (top Expressio p 4.21-Value × Gene Under- Under-TCGAChang OncomineMedianp8259.238.67-Value (top × Coxp4.21-Value pRoss- × Adams 0.420.65Ratio (0.26– Under-(0.4– TCGAChang p8.67-Value × Cox pRoss- Adams0.65Ratio (0.4– n Cluster highlighted TMOD3CBX3 with aExpressio white dot nextOncomine487Rank to (top their n Clustergene highlighted0.016 symbol. CBX3Expressio with aExpressio whiteTCGA 1.1521.312 dot825 nextOncomine4876.48Rank to (top their× geneValue0.0010.085Ross 04 symbol. Adams4.85Expressio (1.20– TCGA1.312 6.48 × Value0.08512Ross Adams4.85 (1.20– RCC1*Gene Over- or 82522%) (top CBX3preference4.21-Value0.012−04 × RCC1*Gene group.Over- or HR: Over- Changhazards1.74 or p825ratio.8.67-Value10 (top−−0512 ×4.21 N/A: 0.03410p 4.21-Valuenot0.012− − 04×ava 0.65ilable.Ratio0.69)Over- (0.4– Genes or Changselected1.741.312 pfor8.67-Value 8.67−further12 × 100.034 −analysis 0.65 0.085areRatio (0.4– 0.65 (0.4–1.06) n Cluster CBX3 Expressio Rank15%)20%) n Cluster EXPRESSION10 CBX3Expressio Expressio 1.312(tope 20%)Rank15%)20%)10−31 Value0.085EXPRESSION10SURVIVAL (IC95)2.09)1.06)Expressio 1.312e 10−31 Value0.085SURVIVAL (IC95)2.09)1.06) Over-n or 20%) 10−04 Over-n or Over-n Fold ore 20%)10−12 × 10−04 Hazards(IC95)1.06)Over- n or Folde 10−12 × Hazards(IC95)1.06) Expressio Under-n 203487Median (top Expressio EXPRESSIONhighlighted3.76 × Under- with n a whiteUnder-n Fold dot next487Median9.536.48 to (top ×their CoxgeneEXPRESSION pSURVIVAL -symbol. 4.85Hazards (1.20–Under- n Fold 6.48 × Cox pSURVIVAL- 4.85Hazards (1.20– Expressio RCC1*NOA1Gene Under- Oncomine2,035Median825 (top (top Expressio p 4.21-Value0.012 × RCC1*Gene Under- Under-TCGAChang 1.7621.74 Oncomine2,035Medianp8259.238.67-Value (top (top × Cox0.034…p4.21-Value0.012 pRoss- × Adams 0.420.65Ratio …(0.26– Under-(0.4– TCGAChang1.74 p9.238.67-Value × Cox0.034 pRoss- Adams0.420.65Ratio (0.26– (0.4– n Cluster TMOD3CBX3 Expressio Oncomine487Rank15%)3%) (top n Cluster 0.01610−06 TMOD3CBX3Expressio ExpressioTCGA 1.1521.312487 Oncomine4876.48Rank15%)10 (top−−4031 × Value0.0010.0850.016Ross Adams4.852.09)Expressio (1.20– TCGA1.1521.312 6.4810−31 × Value0.0010.08531Ross Adams4.852.09) (1.20– RCC1*Gene Over- or 82522%) (top RCC1p4.21-Value0.012 *−04 × RCC1*GeneOver- or Over-Chang 1.74 or p8258.67-Value22%)10 (top−−0512 × 0.0120.034p4.21-Value0.012 −04 × 0.65Ratio0.69)Over- (0.4– or Chang1.741.74 p8.67-Value106.48−−0512 × 100.034− 0.650.034Ratio0.69) (0.4– 4.85 (1.20–2.09) n Cluster CBX3 Expressio Rank15%)20%) n Cluster 10 CBX3Expressio Expressio 1.312(tope 15%)Rank15%)20%)10−31 Value0.085EXPRESSION10 (IC95)2.09)1.06)Expressio 1.312e 10−31 Value0.085SURVIVAL (IC95)2.09)1.06) Over-n or 2,03529920%) (top (top 1.0610−04 × Over-n or Over-n Fold ore 2,0351.319.2320%)10− 12(top × 10−04 0.300.42Hazards(IC95)1.06) Over-(0.15–(0.26– n or Folde 9.2310−12 × × 0.42Hazards(IC95)1.06) (0.26– Expressio TMOD3EEF2 Under-n 203487Median (top Expressio3.760.016 × TMOD3Under-n Under-n 1.152Fold2.43 203487Median9.536.48 (top × Cox0.00020.0013.760.016 p- × 4.85Hazards (1.20–Under-n 1.152Fold 9.536.48 × Cox0.001 p- 4.85Hazards (1.20– Expressio RCC1*NOA1Gene Under- 2,035Median82524%)22%) (top (top Expressio p 4.21-Value0.01210−05 × RCC1*NOA1Gene Under- Under- Chang1.7621.74 Oncomine2,035Medianp8259.238.67-Value22%)10 −(top− 73(top05 × Cox0.034…p4.21-Value0.012 p- × 0.420.65Ratio0.59)0.69) …(0.26– Under-(0.4– TCGAChang1.7621.74 p9.238.67-Value10−05 × Cox0.034… pRoss- Adams0.420.65Ratio0.69) …(0.26– (0.4– n ClusterA TMOD3CBX3 Expressio 487Rank3%) (top n Cluster0.01610−06 TMOD3CBX3Expressio Expressio 1.1521.3122035 4876.48Rank103%) (top−−4031 × Value0.0010.0850.01610 − 06 4.85Expressio (1.20– 1.1521.312 6.4810−−4031 × Value0.0010.08505 4.85 (1.20– RCC1*Gene 82522%)15%) (top TMOD3p4.21-Value0.012−04 × RCC1*Gene Chang 1.74 p8258.67-Value22%)15%)10 (top−−0512 × 0.0160.034p4.21-Value0.012 −04 × 0.65Ratio0.69)2.09) (0.4– Chang1.741.152 p8.67-Value109.23−−0512 × 100.034 0.650.001Ratio0.69)2.09) (0.4– 0.42 (0.26–0.69) n Cluster CBX3 Expressio 798203Rank20%) (top n Cluster3.7610 × CBX3Expressio ExpressioOver- 1.312 ore 2031.879.53Rank20%)10 −(top31 × Value0.0853.7610 × 0.34(IC95)1.06)Expressio Over-(0.18– or 1.312e 9.5310−31 × Value0.085− (IC95)1.06) ASPH* n 29915%) (top 1.060.003−04 × n n0.613 (top 22%)2991.3115%)10 (top−12 × 0.0011.06 −04 × 0.302.09) (0.15– n Fold 1.3110−12 × × 0.30Hazards2.09) (0.15– NOA1 2,03520%) (top Biomolecules 10 2020NOA1, 10, x FOR PEER 1.762 eREVIEW 2,0359.2320%) 10− 13(top × …10 0.42(IC95)1.06) …(0.26– 1.762e 9.2310 × … 0.42(IC95)1.06)10 …(0.26– of 24 TMOD3EEF2 n 2034879%)3%) (top Expressio3.760.01610−06 × TMOD3EEF2 n Under-n 1.1522.43 203487Median9.536.48103%) (top−40 × 0.00020.0013.760.01610 − 06 × 4.850.66) (1.20–Under- n 1.1522.43 9.536.4810−40 × Cox0.00020.001 p- 4.85 (1.20– RCC1*NOA1 2,03582524%)22%) (top (top 4.210.01210−05 × RCC1*NOA1Gene 1.7621.74 2,0358259.238.6724%)22%)10 −(top− 73(top05 × 0.034…p4.21-Value0.01210 −05 × 0.420.650.59)0.69) …(0.26– (0.4– Chang1.7621.74 p9.238.67-Value10−−7305 × 0.034… 0.420.65Ratio0.59)0.69) …(0.26– (0.4– A TMOD3CBX3 4873%) (top n ClusterA 0.01610−06 TMOD3CBX3 Expressio 1.1521.312203 4876.48Rank103%) (top−−4031 × 0.0010.0850.0161006 −06 4.85Expressio (1.20– 1.1521.312 6.4810−−4031 × Value0.0010.08540 4.85 (1.20– RCC1* 182.582529922%)15%) (top (top NOA11.064.210.012−04 × RCC1* 1.74 8252998.679.951.3122%)15%)10 (top−−0512 ×3.76 0.034104.211.060.012 −04 × 0.360.300.650.69)2.09) (0.20– (0.15–(0.4– 1.741.762 8.671.31109.53−−0512 × 100.034 0.300.650.69)...... 2.09) (0.15–(0.4– HSPB1*CBX3EEF2 79820315%)20%) (top 3.7610 × CBX3EEF2 1.3120.584(top2.43 3%)7982031.879.5315%)20%)10 (top−31 × 0.00020.0850.0013.7610− × 0.342.09)1.06) (0.18– 1.3122.43e 1.879.5310−31 × 0.00020.085− 0.34(IC95)2.09)1.06) (0.18– ASPH* 299 (top 1.060.003−−0405 × ASPH* n 0.613 2991.31 (top−−122473 × ×0.0011.060.003 −−0405 × 0.30 (0.15–n 0.613 1.31−−1273 × × 0.001 0.30 (0.15– Biomolecules 2020NOA1, 10, x FOR PEER REVIEW2,03511%)20%) 24%) (top Biomolecules reference10 2020NOA1 , group.10, x FOR HR: PEER hazards1.762 REVIEW 2,035ratio.9.2320%) 24%)10− 13(top × N/A: …not10 ava 0.42ilable.0.66)1.06)0.59)10 …(0.26– of 24Genes selected1.762 for9.2310 −further13 × …analysis 0.42 are1.06)0.59)10 …(0.26– of 24 TMOD3EEF2 2034879%)3%) (top 3.760.01610−06 × TMOD3EEF2 1.1522.43 2034879.536.48109%)3%) (top−40 × 0.00020.0013.760.01610 − 06 × 4.850.66) (1.20– 1.1522.43 9.536.4810−40 × 0.00020.001 4.850.66) (1.20– A RCC1*NOA1 2,03524%) (top A 0.01210−05 RCC1*NOA1 1.7621.74 2,0358259.2324%)10 −(top− 73(top05 × 0.034…4.210.01210 −05 × 0.420.59) …(0.26– 1.7621.74 9.238.6710−−7305 × 0.034… 0.420.650.59) …(0.26– (0.4– TMOD3SQSTM 1,58148779822%) (top (top highlighted0.016−06 TMOD3 with a white 1.152 dot299 next4877986.481.879.39×22%)10 to (top−−4031 their× gene0.0010.016 symbol.−06 4.850.340.400.69) (1.20–(0.18–(0.2– 1.152 6.481.8710−−4031 × 0.001 4.850.340.69) (1.20–(0.18– A 182.515%)3%) (top A 1.060.00310 × CBX3 0.961 182.59.9515%)103%)− 05(top × 0.0091.061005 × 0.362.09) (0.20– 1.312 9.9510−05 × 0.08573 0.362.09) (0.20– ASPH*RCC1* 29922%) (top EEF21.060.0120.003 × ASPH*RCC1* 0.6131.74 2991.3122%)10 −(top01 1.06× 0.0340.001101.060.0120.003− −04 × 0.300.69) (0.15– 0.6131.742.43 1.31101.31−12 × 100.0340.001− 0.300.00020.69) (0.15– 0.30 (0.15–0.59) HSPB1*EEF21* 79820315%)35%)9%) (top 3.76 × HSPB1*EEF2 0.584(top2.43 24%)7982031.879.5315%)20%)109%) (top−−3113 × 0.00020.0013.7610 × 0.342.09)0.79)0.66) (0.18– 0.5842.43 1.879.5310−−3113 × 0.00020.001 0.342.09)0.66)1.06) (0.18– referenceASPH*NOA1 group. HR: hazards 2,035299ratio.11%) (top (top N/A: referencenot1.060.00310−− 0405 ×ava ASPH*NOA1ilable. group. Genes HR: selectedhazards0.6131.762 2,035299forratio.1.319.2311%)10 (top−− further2473(top × N/A: ×0.001 …analysisnot1.060.00310 −− 0405 ×ava 0.300.42 ilable.are0.66) …(0.15–(0.26– Genes selected0.6131.762 for1.319.2310 −−further2473 × × 0.001 …analysis 0.300.42 are0.66) …(0.15–(0.26– Biomolecules 2020EEF2, 10, x FOR PEER REVIEW203 24%) (top 3.7610−06 × EEF2 2.43 2039.5324%)10 (top−−1340 × 0.00023.7610− 06 × 0.59)10 of 24 2.43 9.5310−−1340 × 0.0002 0.59) TMOD3 A 1339%)3%) (top 0.01610−05 TMOD3 1.152 4874.48109%)3%) −(top73 × 0.001EXPRESSION0.01610 −05 0.400.66) (0.23– 1.152 6.4810−73 × 0.001SURVIVAL 4.850.66) (1.20– A NOA1 2,035182.524%) (top A 1.0610 × RCC1*NOA1 1.762 2,035182.59.239.9524%)10− (top05 × …1.060.01210 × 0.420.360.59) …(0.26–(0.20– 1.7621.74 9.239.9510−05 × 0.034… 0.420.360.59) …(0.26–(0.20– highlightedANXA2*TMOD3SQSTMHSPB1* with a white dot next1,58179822%) 3%)to (top (toptheir genehighlighted0.0030.01610 symbol.−06 TMOD3SQSTMHSPB1* with a white 0.4961.1520.584 dot798 next1,5817981.879.39×22%)10 3%)to −(top 40 (top their× gene0.0010.01610 symbol.−06 0.340.400.69) (0.18–(0.2– 1.1520.584 1.879.39×10−−4031 × 0.001 0.340.400.69) (0.18–(0.2– A 182.5 (top A 1.060.003−04 × 0.961 Oncomine182.59.9515%)−− 0519(top24 × 0.0091.060.003 −04 × 0.36 (0.20– TCGA0.961 9.9510−−0524 × 0.00913Ross Adams0.362.09) (0.20– ASPH* 29916%)22%)11%) (top ASPH1.060.00310 * × ASPH* 0.613 2991.3122%)11%)10 −(top01 × 0.0030.0011.060.00310 × 0.300.69)0.70)0.66) (0.15– 0.6130.613 1.31101.87−01 × 100.001− 0.300.0010.69)0.66) (0.15– 0.34 (0.18–0.66) Biomolecules 2020HSPB1*EEF21*, 10 , x FOR PEER REVIEW79820335%) 9%) (top Biomolecules3.76 × 2020HSPB1*EEF21*, 10 , x FOR PEER 0.584(top2.43 REVIEW 9%)7982031.879.5335%)10 9%) (top−13 × 0.00020.0013.76 × 0.340.79)0.66) 10(0.18– of 24 0.5842.43 1.879.5310−13 × 0.00020.001 0.340.79)0.66) 10(0.18– of 24 referenceASPH*NOA1 group. HR: hazards 299ratio.11%) (top N/A: not1.060.00310−− 0405 ×ava ASPH*NOA1ilable. GenesOver- selected0.6131.762 or 2,035299for1.3111%)10 (top−− further2473(top × 0.001 …analysis1.060.00310 −−0405 × 0.30 are0.66) Over-…(0.15– or 0.6131.762 1.319.2310−−2473 × × 0.001… 0.300.420.66) …(0.15–(0.26– Biomolecules 2020SQSTMEEF2, 10, x FOR PEER REVIEW586.51,581203 24%) (top (top EXPRESSION3.7610−06 × SQSTMEEF2 2.43 1,5812039.539.39×3.424%)10 (top−− 1340(top× × 0.0002EXPRESSION3.7610SURVIVAL− 06 × 0.270.400.59) 10(0.12– (0.2– of 24 2.43 9.539.39×10−−1340 × 0.0002SURVIVAL 0.400.59) (0.2– A GSN* 1339%)3%) (top A 0.00510−05 TMOD3 0.533 1334.48109%)3%) (top−73 × 0.0010.01610 −05 0.400.66) (0.23– 1.152Fold 4.4810−73 × 0.001 0.40Hazards0.66) (0.23– NOA1 182.524%) (top 1.060.00310 × NOA1 1.7620.961 182.59.9524%)10− 21(top × 0.009…1.060.00310 × 0.360.59)… (0.20– 1.7620.961 9.9510−05 × 0.009… 0.360.59)… (0.20– highlightedANXA2*SQSTMHSPB1* with a white dot next1,58179810%) 3%)to (top (toptheir Expressio gene0.00310 symbol.−06 ANXA2*SQSTMHSPB1* Under- 0.4960.584182.5 1,581Median7981.879.39×22%)103%) −(top− 40(top01 × 0.0010.00310 −06 0.340.400.60) (0.18–Under-(0.2– 0.4960.584 1.879.39×10−−4001 × Cox0.001 p- 0.340.400.69) (0.18–(0.2– A 1* Oncomine182.535%) (top A 1.060.003−04 × Gene1* TCGA 0.961 Oncomine182.59.9535%)10−− 19(top24 × 0.009p1.06-Value0.003Ross04 −04 × Adams 0.360.79) (0.20– TCGAChang0.961 p9.95-Value10−−1924 × 0.00924Ross Adams0.36Ratio0.79) (0.20– referenceASPH* group. HR: hazards 299ratio.16%)11%) (top N/A: HSPB1* referencenot1.060.00310 ×ava ASPH*ilable. group. Genes HR: selectedhazards0.613 299forratio.1.3116%)11%)10 −(topfurther01 1.06× N/A: 0.001 10 analysisnot1.060.00310− ×ava 0.30 ilable.are0.70)0.66) (0.15– Genes selected0.6130.584 for1.3110 9.95−further01 × 100.001 −analysis 0.30 0.001are0.70)0.66) (0.15– 0.36 (0.20–0.66) Biomolecules 2020HSPB1*EEF21*, 10 , x FOR PEER REVIEW79835%) (top Biomoleculesn Cluster 2020HSPB1*EEF21*, 10 , x FORExpressio PEER 0.584(top2.43 REVIEW 11%)7982031.87Rank35%)10 (top−13 × 0.00020.0013.76 × 0.340.79)Expressio 10(0.18– of 24 0.5842.43 1.879.5310−13 × Value0.00020.001 0.340.79) 10(0.18– of 24 ASPH* 1,0822991339%) (top (top 1.060.003−−0405 × ASPH* 0.613 2991331.315.584.48109%) (top−−2473 × ×0.0011.060.003 −−0405 × 0.480.300.400.66) (0.29–(0.15–(0.23– 0.613 1.314.4810−−2473 × × 0.001 0.300.400.66) (0.15–(0.23– Biomoleculesreference 2020TOP1 , group.10, x FOR HR:Over- PEER hazards or REVIEW 586.5 ratio.11%) 24%) (top N/A:Biomolecules not0.00310 ava 2020NOA1ilable., Over-10, x FORGenes or Over- PEER selected1.468 or REVIEW 586.5for11%)3.4 24%)10 − further13(top× 0.005 analysis10 0.27 are0.66)0.59) 10Over-(0.12– of 24 or 1.762e 3.410− 13× … 0.27(IC95)0.66)0.59) 10…(0.12– of 24 highlightedANXA2*SQSTMEEF2 with a white dot next1,5819%) to (toptheir geneEXPRESSIONhighlighted0.003 symbol. ANXA2*SQSTMEEF2 with a whiten 0.496Fold2.43 dot next1,5819.39×109%) to− 14 (toptheir 0.0002gene0.0010.003SURVIVAL symbol.− 06 0.40Hazards0.66) (0.2– n 0.496Fold2.43 9.39×10−40 0.00020.001 0.40Hazards0.66) (0.2– A GSN* 182.513324%)25%)16%) (top (top A 1.060.0050.00310−05 × GSN* 0.5330.961 182.51334.489.9524%)16%)103%) (top−− 7319(top × 0.0010.0091.060.0050.00310 −05 × 0.400.360.80)0.59)0.70) (0.23–(0.20– 0.5330.961 4.489.9510−−7319 × 0.0010.009 0.400.360.59)0.70) (0.23–(0.20– ExpressiohighlightedANXA2*SQSTMHSPB1* with a whiteUnder- dot next1,581Median79810%) to (top (toptheir Expressio gene0.003 symbol. ANXA2*SQSTMHSPB1* Under- Under- 0.4960.584 1581 1,581Median7981.879.39×10%)10 −(top− 21(top01 × Cox0.0010.003 p- 0.340.400.60) (0.18–Under-(0.2– 0.4960.584 1.879.39×10−−2101 × Cox0.001 p- 0.340.400.60) (0.18–(0.2– A Gene1* Oncomine182.535%) (top Ap 1.06-Value0.003−04 × Gene1* TCGAChang 0.961 182.5p9.95-Value35%)10−− 19(top24 × 0.009p1.06-Value0.003Ross −04 × Adams 0.36Ratio0.79) (0.20– Chang0.961 p9.95-Value10−−1924 × 0.00901 0.36Ratio0.79) (0.20– referenceASPH* group. HR: hazards836.5 ratio.16%)11%) (top SQSTM1N/A: referencenot0.00310 * ava ASPH*ilable. group. Genes HR: selectedhazards0.613 825299forratio.2.4116%)11%)10 (top−further01 × N/A: 0.0030.001 analysis4.21not1.060.00310 ×ava 5.80 ilable.are0.70)0.66) (2.72– Genes selected0.6130.961 for8.671.3110 9.39−further01 × 100.001 −analysis 0.300.65 0.009are0.70)0.66) (0.15–(0.4– 0.40 (0.2–0.79) Biomoleculesn Cluster 2020HSPB1*1*, 10 , x FORExpressio PEER REVIEW586.5798Rank35%) 9%) (top (top Biomoleculesn Cluster EXPRESSION 2020HSPB1*CBX3EEF21*,Expressio 10 , x FORExpressio PEER 0.584(top REVIEW 35%)586.57981.87Rank35%)103.4 9%) (top− 13(top ×× Value0.001EXPRESSIONSURVIVAL 0.340.270.79)0.66)Expressio 10(0.18–(0.12– of 24 1.3120.5842.43 1.87103.4− 13 ×× Value0.00020.0850.001SURVIVAL 0.340.270.79)0.66) 10(0.18–(0.12– of 24 referencePDCD5*ASPH*GSN* group. HR:Over- hazards or 1,082 133ratio.11%) (top (top N/A: referencenot0.0110.0030.00510− 04ava ASPH*GSN*ilable. group.Over- Genes or HR: selectedhazards1.1640.6130.533e 1,082 for133ratio.5.584.4811%)10 −(top further24(top × N/A: 0.00010.001 analysisnot0.0030.00510 −− 0405ava 0.480.40 ilable.(IC95)are0.66) (0.29–(0.23– Genes selected0.6130.533e for5.584.4810 −−further122473 × × 0.001 analysis 0.480.40 (IC95)are0.66) (0.29–(0.23– ANXA2*SQSTMTOP1 586.51,58122%)9%) (top EXPRESSION0.003 ANXA2*SQSTMTOP1 1.4680.496 586.51,58120%)9.39×3.424%)109%)−− 1305(top21× 0.0050.0010.00310SURVIVAL 0.270.4012.32)0.66) (0.12– (0.2– 1.4680.496 9.39×3.410−− 1321× 0.0050.001 0.270.400.66)1.06)0.59) (0.12– (0.2– highlightedGSN* with a whiten dot next13310%) to (top their geneAhighlighted 0.005 symbol. GSN* with n a whiten 0.533Fold dot next1334.4810%)10 to (top−−1419 ×their gene0.0010.005 symbol. 0.40Hazards0.60) (0.23– n 0.533 4.4810−−1419 × 0.001 0.400.60) (0.23– Oncomine182.525%)16%) (top 1.060.003 × TCGA 0.961 Oncomine182.59.9525%)16%)10− 21(top × 0.0091.060.003Ross × Adams0.360.80)0.70) (0.20– TCGA0.961 9.9510−21 × 0.009Ross Adams0.360.80)0.70) (0.20– ExpressiohighlightedANXA2*SQSTMHSPB1* with a whiteUnder- dot next1,581Median10%) to (toptheir genehighlighted0.003 symbol. ANXA2*SQSTMHSPB1* Under- with a white 0.4960.584 dot133 next1,5814877989.39×10%)10 to (top− (top01their Coxgene0.0010.003 p - symbol. 0.400.60) (0.2– 0.4960.584 6.481.879.39×10−01 × 0.00119 4.850.340.400.60) (1.20– (0.18–(0.2– THRAPGene1* Oncomine1,898182.51,08282535%) (top (top p1.064.21-Value0.003−04 × 1* TCGAChang 0.961 182.51,082p8258.679.955.84-Value5.5835%)10 (top−− 19(top24 × 0.0091.064.210.003Ross −04 × Adams0.360.480.650.49Ratio0.79) (0.20– (0.29–(0.4–(0.3– 0.961 8.679.955.5810−−1924 × 0.009 0.360.480.650.79) (0.20– (0.29–(0.4– reference group. HR:Over- hazards or 836.5 ratio.16%)11%) (top N/A:ANXA2 referencenot0.00210 * ava ASPH*RCC1*ilable. group.Over- Genes or HR: Over- selected1.073hazards or 836.5 forratio.2.4116%)11%)10 − further01(top × N/A: 0.0030.004 analysisnot0.0120.00310 ava 5.80 ilable.are0.70)0.66) Over-(2.72– Genes or selected0.6131.740.496 for2.4110 4.48−further01 × 100.0340.001 −analysis 5.80 0.001are0.70)0.66) (2.72– 0.40 (0.23–0.70) Biomoleculesn Cluster 2020HSPB1*CBX3TOP11*, 10 , x FORExpressio PEER REVIEW586.5Rank35%) (top EXPRESSION0.003 HSPB1*CBX3TOP11*Expressio 1.3120.584(top1.468 16%)586.515%)35%)103.4− 05(top× Value0.0850.0010.005EXPRESSION0.003SURVIVAL 0.270.79) 10(0.12– of 24 1.3120.5841.468 103.4−− 3113× 0.0850.0010.005SURVIVAL 0.272.09)0.79) (0.12– PDCD5*GSN*3 Over- or 1,08213324%)11%)25%) (top (top 0.0110.00510−04 PDCD5*GSN*Over- or 1.1640.533Folde 1,0821335.584.4811%)25%)109%) −(top− 1224(top14 × 0.00010.0010.0110.00510 − 04 0.480.40Hazards(IC95)0.66)0.80)0.8) (0.29–(0.23– 1.1640.533Fold 5.584.4810−−122414 × × 0.00010.001 0.480.40Hazards0.66)0.80) (0.29–(0.23– Expressio ANXA2*SQSTMTOP1 Under- 586.51,581Median22%)20%) (top Expressio EXPRESSION0.00310 ANXA2*SQSTMTOP1 Under- Under- 1.4680.496 586.51,581Median22%)20%)9.39×3.410−− 05(top21× Cox0.0050.001EXPRESSION0.00310 pSURVIVAL - 0.270.4012.32)1.06) (0.12– Under-(0.2– 1.4680.496 9.39×3.410−− 0521× Cox0.0050.001 pSURVIVAL - 0.270.4012.32)1.06) (0.12– (0.2– highlightedGSN* with a whiten dot next13310%) to (top their genehighlighted0.005 symbol. GSN* with n a white 0.533Fold dot next1334.4810%)10 to (top−−1419 ×their gene0.0010.005 symbol. 0.40Hazards0.60) (0.23– 0.533 4.4810−−1419 × 0.001 0.400.60) (0.23– SLC12AGene Oncomine1,91425%)16%) (top p -Value0.0035.5 × Gene TCGA Chang0.961 Oncomine2,035182.5p3.86-Value25%)16%)10− 21(top × 0.009p1.06-Value0.003Ross × Adams 0.39(0.19–Ratio0.80)0.70) TCGAChang0.961 p9.239.95-Value10−21 × 0.009Ross Adams0.420.36Ratio0.80)0.70) (0.26–(0.20– Expression Cluster ANXA2*SQSTM ExpressioUnder- 1,581836.5487MedianRank10%) (top (top n Cluster0.003 ANXA2*TMOD3SQSTMHSPB1*ExpressioUnder- Expressio 0.496586.5 1,581836.54876.482.419.39×Rank10%)10 (top− (top01 × CoxValue0.0010.0030.016 p- 4.855.800.400.60)Expressio (1.20– (2.72–(0.2– 0.4961.1520.584 6.482.419.39×10−01 × Value0.00121 4.855.800.400.60) (1.20– (2.72–(0.2– PDCD5*THRAPGene1* Oncomine1,8981,08282516%)35%) (top (top p 4.21-Value0.0030.011 × PDCD5*THRAP1* TCGAChang 0.8490.9611.164 Oncomine1,8981,082p8.675.84-Value5.5816%)35%)10− 19(top × 0.00010.0090.0010.0030.011Ross − 04 Adams0.480.650.49Ratio0.70)0.79) (0.29–(0.4–(0.3– TCGA0.9611.164 5.845.5810−−051924 × 0.00010.009Ross Adams0.480.490.70)0.79) (0.29–(0.3– referenceRCC1* group. HR:Over- hazards or 836.5 ratio. (top N/A: GSN not0.0020.012 * −04 ava RCC1*ilable.Over- Genes or Over- selected1.0731.74 ore 836.5for2.4122%)11%) −− further01(top05 × 0.0050.0040.034 analysis0.0020.01210 5.80 (IC95)are Over-(2.72– or 1.0731.740.533e 2.4110−−3.40105 × 100.0040.034− 5.800.001(IC95)0.69)0.66) (2.72– 0.27 (0.12–0.60) n Cluster CBX3TOP11*7 Expressio 586.5Rank25%)15%)35%)22%) (top EXPRESSION0.00310 TOP11*Expressio 1.312(top1.468 10%)586.515%)35%)22%)103.4− 0531(top× Value0.0850.005EXPRESSION0.003SURVIVAL 0.2712.32)2.09)0.79)0.65) (0.12– 1.468 103.4− 0531× 0.005SURVIVAL 0.2712.32)2.09)0.79) (0.12– B PDCD5*GSN*3 Over-n or 1,08213324%) (top (top 0.0110.005−04 PDCD5*GSN*3Over- n or Over-n 1.164 0.533Fold or 1,0821335.584.4824%)10 −(top− 12(top14 × 0.00010.0010.0110.005 0.480.40Hazards0.8) Over-(0.29–(0.23– n or 1.1640.533Fold 5.584.4810−14 × × 0.00010.001 0.480.40Hazards0.8) (0.29–(0.23– TOP1 586.520%)25%) (top 0.00310 TOP1 1.468e 586.53.425%)10−− 05(top21× 0.0050.003 0.27(IC95)1.06)0.80) (0.12– 1.468 3.410−− 0521× 0.005 0.270.80) (0.12– ExpressiohighlightedANXA2* with a whiteUnder-n dot next1,280Median22%)10%) to (top their Expressio gene0.003 symbol. ANXA2*SQSTMUnder-n Under- 0.496Fold 1,581203Median1.8722%)10%)10 (top− 14(top × Cox0.0013.760.003 p- × 0.41Hazards12.32)0.60) (0.25–Under- 0.496Fold 9.539.39×10−14 × Cox0.001 p- 0.40Hazards12.32)0.60) (0.2– THRAPGSN*Gene Oncomine2,0351,89813382525%) (top (top p 4.21-Value0.005 × THRAPNOA1GSN*Gene TCGAChang 0.533 Oncomine2,0351,898133p8254.489.238.675.84-Value25%)10 (top− (top19 × 0.001p4.21-Value0.0050.003Ross × Adams 0.420.400.650.49Ratio0.80) (0.26–(0.23– (0.4–(0.3– TCGAChang1.7620.5330.961 p4.489.238.675.84-Value10−19 × 0.0010.009… Ross Adams0.420.400.650.49Ratio0.80) …(0.26–(0.23– (0.4–(0.3– Expressio ANXA2*SLC12APURA* Under- 1,914836.5487Median10%)16%) (top (top Expressio 0.0030.0310.0025.5 × ANXA2*SLC12AUnder- Under- 0.4960.9511.073 1082 1,914836.5Median3.866.482.4110%)16%)10− 21(top × Cox0.0010.0040.0030.0025.5 p- − 06× 4.855.800.39(0.19–0.60)0.70) (1.20–(2.72–Under- 0.4961.073 3.862.4110−−402101 × Cox0.0010.004 p- 5.800.39(0.19–0.60)0.70) (2.72– n Cluster TMOD3THRAPCBX3 Expressio 1,898Rank (top n Cluster0.016 TMOD3THRAPCBX31*Expressio Expressio 0.8491.1521.312 1,8985.84Rank35%)3%)−− 1901(top05 × Value0.0010.0850.01610 0.49Expressio (0.3– 0.8491.1521.312 5.8410−−1905 × Value0.0010.08514 0.490.79) (0.3– PDCD5*RCC1*Gene3 1,08282516%)22%)24%) (top (top TOP1p4.21-Value0.0120.011−−0404 × PDCD5*Gene3 Chang 1.1641.74 1,082p8.67-Value5.5816%)22%)24%)10−− 010512(top × 0.0030.00010.034p-Value0.011 −− 0404 0.480.65Ratio0.69)0.70)0.8) (0.29–(0.4– Chang1.1641.468 p-Value5.58105.58−−010512 × 100.0001 0.480.005Ratio0.69)0.70)0.8) (0.29– 0.48 (0.29–0.80) n Cluster TOP17 ExpressioOver- or 836.5586.5Rank25%)20%) (top Biomoleculesn Cluster0.0020.00310 2020TOP1,Expressio7 Over-10 , x FOR orExpressio Over- PEER 1.0731.468 or eREVIEW 836.5586.52.41Rank25%)20%)103.4 −− 31(top05 ×× Value0.0040.0050.0020.00310 5.800.27(IC95)0.65)1.06)Expressio Over-(2.72–(0.12– or 1.0731.468e 2.41103.4− 05 ×× Value0.0040.005− 5.800.27(IC95)0.65)1.06) 10(2.72–(0.12– of 24 PDCD5*CBX3 n 1,08215%)22%) (top EXPRESSION0.011 PDCD5* n n 1.3121.164 (topFold 25%)1,0825.5822%)10−− 05(top14 × 0.00010.0850.011SURVIVAL 0.48Hazards12.32)2.09) (0.29– n 1.164Fold 5.5810−−0514 × × 0.0001 0.48Hazards12.32) (0.29– B GSN*3 2,09324%)20%)25%) (top B 7.71×0.00510−04 GSN*3 0.533e 2991335.3924%)25%)10 (top−0512 × 0.0011.060.005 × 2(IC95) 1.06)0.80)(1.16–0.8) 0.533e 1.314.4810−05 × 0.001 0.300.40(IC95)0.80)0.8) (0.15–(0.23– Expressio SLC12ATOP1 Under- 586.51,914203487Median22%) (top (top Expressio 3.760.0035.5 ×× ANXA2*SLC12ATOP1EEF2Under- Under- 1.468 586.51,914203487Median9.533.866.4822%)3.410 (top− (top21× × Cox0.0053.760.0035.5 p - ×× 0.274.850.39(0.19–12.32) (0.12–(1.20–Under- 1.4680.4962.43 9.533.866.483.410− 21× × Cox0.00020.0050.001 p - 0.274.850.39(0.19–12.32) (0.12–(1.20– THRAPGSN*RPA1 n Oncomine2,0351,2801,89825%)10%) (top 0.005 THRAPGSN* n TCGAn 1.2460.5330.849 1,2801,8989.231.875.8425%)10%)10− 14(top × 0.0010.0130.005Ross −05 Adams0.420.410.490.80)0.60) (0.26–(0.25– (0.3– n 0.5330.849 1.875.8410−−731419 × 0.001 0.410.490.80)0.60) (0.25– (0.3– SLC12APURA*RCC1*NOA1Gene 1,914825 (top (top p4.21-Value0.0310.0125.5−− 0404× × SLC12APURA*RCC1*NOA1Gene Chang1.7620.9511.74 1,914p8253.868.67-Value24%)16%) −(top− 2106(top01 × 0.0010.034…p4.21-Value0.0310.0125.510 − 04× × 0.39(0.19–0.65Ratio… (0.4– Chang1.7620.9511.74 p3.868.67-Value10−−2101 × 0.0010.034… 0.39(0.19–0.65Ratio0.59)0.70)… (0.4– TMOD37 836.548710%)23%)25%)3%) (top (top 0.0160.00210−06 7 1.1521.073836.5 836.56.482.4110%)25%)103%)−− 014031(top × 0.0010.0040.00210 −06 4.855.800.60)3.47)0.65) (1.20–(2.72– 1.073 2.4110−−014031 × 0.004 5.800.60)0.65) (2.72– 5.80 n Cluster PDCD5*THRAPCBX3 Expressio 1,8981,082825Rank16%)15%) (top (top n ClusterA 4.210.011 × PDCD5*THRAPCBX3Expressio Expressio 0.8491.3121.164 1,8981,0828258.675.845.58Rank16%)15%)10 (top−− 05(top05 × 0.0001Value0.0010.0854.210.011 × 0.480.650.490.69)2.09)Expressio (0.29–(0.4–(0.3– 0.8491.3121.164 8.675.845.5810−05 × 0.0001Value0.0010.08505 0.480.650.490.69)2.09) (0.29–(0.4–(0.3– B RCC1*3 Over- or 836.522%)24%)20%) (top PDCD5 Breference 0.0020.01210− *−0404 3group.Over- or HR: 1.073hazards1.74e 836.5 ratio.2.4124%)20%)10−− 01(top0512 × N/A: 0.0110.0040.034 not0.00210 −−04 04ava 5.80ilable.(IC95)0.69)1.06)0.8) (2.72– Genes selected1.0731.164e for2.4110 2.41−−further010512 × 100.004 −analysis 5.800.0001 (IC95)are1.06)0.8) (2.72– CBX3TOP17 79325%)15%)22%) (top 0.00310 CBX3TOP17 1.312(top1.468 22%)586.579825%)22%)10 (top− 0531(top 0.0850.0050.00310 1.7712.32)2.09)0.65) (1.08– 1.3121.468 1.87103.4− 05 ×× 0.0850.005 0.340.2712.32)0.65) (0.18–(0.12– (2.72–12.32) B PDCD5*3 n 1,0822,0351,28029924%)25%) (top (top B 1.060.011−04 × PDCD5*ASPH*GSN*3 n n 1.164 Fold 1,0822,0351,2802991.315.589.231.8724%)25%)10 (top−− 12(top14 × 0.00011.060.0110.0030.005− 04 × 0.480.300.420.41Hazards0.80)0.8) (0.29–(0.15–(0.26–(0.25– n 1.1640.6130.533 1.315.589.231.8710−−1214 × × 0.00010.001 0.480.300.420.410.80)0.8) (0.29–(0.15–(0.26–(0.25– Expressio SLC12APURA*SFSR3TOP1EEF2 Under- 2,0931,914203Median22%)20%) (top (top 3.767.71×0.0030.031105.50.01 ×× SLC12APURA*TOP1EEF2Under-N/A 1.4680.9512.43… 2,0931,9149.535.393.8622%)20%)10…− 05(top × Cox0.00020.0050.0240.0017.71×0.0030.031105.5 p - × 0.39(0.19–212.32) 1.06)(1.16– 1.4680.9512.43 5.393.8610−−130521 × 0.00020.0050.001 0.39(0.19–212.32) 1.06)(1.16– TMOD3RPA1 1,280487 (top (top highlighted0.016−05 TMOD3RPA1 with a white 1.2461.152 dot next1,2804871.876.4810%)9%) to −(top− 7314(top01 ×their gene0.0130.0010.016 −symbol.05 0.414.85 (0.25– (1.20– 1.2461.152 1.876.4810−−731401 × 0.0130.001 0.414.850.66)0.60) (0.25–(1.20– THRAPNOA1Gene 2,0351,89811%)24%)25%)16%) (top p-Value10−04 THRAP Chang 1.7620.849 1,898p9.235.84-Value24%)25%)16%)10−− 0605(top × 0.001…10 −04 0.420.49Ratio2.91)0.80)0.59)0.69) …(0.26– (0.3– 0.849 5.8410−−0605 × 0.001 0.490.80)0.59)0.69) (0.3– SLC12APURA*RCC1* 1,914836.548782523%)22%) (top (top 4.210.0310.0020.0125.510−− 0604× × SLC12APURA*RCC1* 0.9511.0731.741898 1,914836.54878253.866.482.418.6723%)22%)10 (top−− 40(top01 × 0.0010.0040.0344.210.0310.0020.0125.510 − 04× × 4.855.800.39(0.19–0.653.47)0.69) (1.20–(2.72– (0.4– 0.9511.0731.74 3.866.482.418.6710−01 × 0.0010.0040.034 4.855.800.39(0.19–0.653.47)0.69) (1.20–(2.72– (0.4– n ClusterA TMOD3THRAPCBX37 Expressio 1,898Rank25%)15%)3%) (top A 0.01610 THRAPCBX3Expressio7 0.8491.1521.312 1,8985.8425%)15%)10−− 01(top0531 × Value0.0010.08510 0.492.09)0.65) (0.3– 0.8491.312 5.8410−−010531 × 0.0010.08505 0.492.09)0.65) (0.3– PDCD5*RCC1*3 1,54222%)16%)24%) (top THRAP3 0.0120.011−−0404 PDCD5*RCC1*3 1.1641.74 182.51,0821.0416%)24%)10−− 0105(top12 × 0.0020.00010.0341.060.0120.011 −− 0404 × 0.470.69)0.8) (0.28– 1.1641.741.073 9.955.58105.84−−0112 × 100.00010.034 0.360.480.0040.69)0.8) (0.20–(0.29– 0.49 (0.3–0.8) B 7 836.52,09379820325%)20%) (top (top B 3.760.0027.71×10 × HSPB1*TOP17 1.073e 836.52,0937982032.411.879.535.3925%)20%)10 (top−− 31(top05 × 0.0043.760.0027.71×0.00310 × 0.345.802(IC95) 0.65)1.06)(1.16– (0.18–(2.72– 0.5841.0731.468 2.411.879.535.3910−−3105 × 0.0010.0040.005− 0.345.802 0.65)1.06)(1.16– (0.18–(2.72– PDCD5*MX1*RPA13 n 1,28079329924%)15%)22%) (top (top 1.060.0110.031 × PDCD5*RPA13 n 1.1640.578(top1.246 24%)1,2807931.311.8724%)15%)22%)10 (top− 05(top × 0.00010.00440.013EXPRESSION0.011 − 04 1.770.300.4112.32)2.09)0.8) (1.08–(0.15–(0.25– 1.1641.246 1.8710−−240514 × × 0.00010.013SURVIVAL 1.770.4112.32)2.09)0.8) (1.08–(0.25– B ASPH*SFSR3NOA1 2,0932,035 (top B 0.0037.71×0.01−04 ASPH*SFSR3NOA1N/A 0.6131.762… 2,0932,0355.399.2311%)25%)…−− 0507(top06 × 0.0010.024…0.0037.71×100.01 −04 0.422 (1.16– …(0.26–N/A 0.6131.762… 5.399.2310…−−0506 × 0.0010.024… 0.422 0.66)0.80)(1.16– …(0.26– TMOD3SLC12APURA*EEF2 1,2801,91420348722%)19%)23%)9%) (top (top 3.760.0160.0315.510− 06 ×× TMOD3SLC12APURA* 1.1520.9512.43 1,2801,9144879.531.873.866.4822%)23%)109%) −(top− 13(top40 × 0.00020.0010.0160.0315.510 − 06× 0.414.850.39(0.19–12.32)0.66)0.80)3.47) (0.25–(1.20– 1.1520.951 1.873.866.4810−−1340 × 0.001 0.414.850.39(0.19–12.32)0.66)3.47) (0.25–(1.20– THRAPNOA1RPA1 2,0351,89811%)3%) (top 10−05 THRAPRPA1 1.7621.2460.849 Oncomine2,0351,8989.235.8411%)103%)−− 73(top0501 × 0.0130.001…10 0.420.492.91) …(0.26– (0.3– TCGA1.2460.849 9.235.8410−0501 × 0.0130.001Ross Adams0.420.492.91) (0.26– (0.3– SLC12APURA*RCC1* 1,91482524%)22%)16%) (top (top 4.210.0310.0125.510−− 060404× × SQSTMSLC12APURA*RCC1* 0.9511.74 1,9141,5813.868.6722%)16%)10−− 4006(top01 × 0.0010.0340.0310.0125.5 −− 0404× 0.39(0.19–0.650.59)0.69) (0.4– 0.9511.74 3.869.39×10−−0601 × 0.0010.034 0.39(0.19–0.400.69) (0.2– A TMOD3THRAPCBX37 1,89823%)25%)3%) (top 0.0160.00210 TMOD3THRAP7 1.1521.3121.0731914 1,898836.55.8423%)25%)10−− 01(top31 × 0.0010.0850.0040.0160.0021004 0.493.47)0.65) (0.3– 1.1521.073 5.842.4110−−0131 × 0.0010.00401 5.800.493.47)0.65) (2.72–(0.3– 3 182.579329916%)24%)15%) (top (top SLC12A7 1.06−04 × PDCD5*3 0.849 182.57932999.951.3116%)24%)15%)10 −(top− 05(top1205 × 5.5 0.001101.060.0030.011 × 0.361.770.300.69)2.09)0.8) (0.20–(1.08–(0.15– 0.8490.9611.1640.849 9.951.31103.86−−0505 × 100.00010.0090.001 0.361.770.300.0010.69)2.09)0.8) (0.20–(1.08–(0.15– 0.39(0.19–0.65) B HSPB1*SFSR37 1,5422,09379825%)22%)20%) (top (top B 0.0027.71×100.01−04 HSPB1*SFSR37 N/A Over- 0.5841.073 or… 1,5422,0931.871.045.3925%)22%)10…− 01(top × 0.0010.0040.0240.0027.71×−100.01 −04 0.340.472 0.69)0.65)1.06)(1.16– Over-(0.18–(0.28–N/A or 0.5841.073… 1.045.3910…−−0105 × 0.0010.0040.024− 0.472 0.69)0.65)(1.16– (0.28– MX1*EEF2 793203 (top 3.760.031−04 × MX1*EEF21* 0.578(top2.43 25%)7932039.5335%)22%) (top−2405 × ×0.00440.00023.760.031− 04 × 1.77 (1.08– 0.5782.43 9.5310−2405 × × 0.00440.0002 1.7712.32)0.79) (1.08– B ASPH*NOA1RPA13 2,0932,0351,28029924%)11%) (top (top B 1.060.0037.71×10−05 × NOA1RPA13 0.6131.7621.246 2,0932,0351,2805.391.319.231.8724%)11%)10−− 07(top73 × 0.0010.013…7.71×10 −05 0.300.420.412 0.66)2.91)(1.16–0.8) …(0.15–(0.26–(0.25– 1.7621.246Fold 5.399.231.8710−−0773 × 0.013… 0.420.41Hazards2 0.66)2.91)(1.16–0.8) …(0.26–(0.25– 3.3. mRNA ExpressionSLC12APURA*SFSR3EEF2 Profil es of HO-11,91420319%)24%) (top (topInteractors Expressio 3.760.0315.5100.01 − unde0604 ×× SLC12APURA*SFSR3r GeneticN/A InductionUnder- 0.9512.43… of 1,914203HO-1Median9.533.8619%)24%)10… (top−− 134006(top × 0.00020.0240.0013.760.0315.5100.01 − 0604 ×× 0.39(0.19–0.80)0.59)Under-N/A 0.951… 9.533.8610…−4006 × Cox0.0240.001 p - 0.39(0.19–0.80)0.59) TMOD3RPA1 B 1,28048723%)9%)3%) (top (top 0.01610−05 TMOD3RPA1 1.2461.152 1,2801331.876.4823%)103%) (top−− 73(top01 × 0.0130.0010.01610 0.414.850.66)3.47) (0.25–(1.20– 1.2461.152 4.481.8710−01 × 0.0130.001 0.400.413.47) (0.23–(0.25– A SLC12ARCC1*NOA1 1,91411%)24%)16%) (top A 0.0125.510− 04× SLC12ATHRAPNOA1Gene 1.7620.8491.74 1,9141,8983.8611%)16%)10−− 06(top05 × 0.0340.001…p-Value5.5 − 04× 0.39(0.19–2.91)0.59)0.69)… Chang1.7620.849 p3.865.84-Value10−−0605 × 0.001… 0.39(0.19–0.49Ratio2.91)0.69)… (0.3– SQSTMPURA*7 1,5811,54279823%)25%)22%) (top (top 0.03110−−0604 ANXA2*SQSTMPURA*7 0.9511280 1,5811,5427981.871.049.39×23%)25%)22%)10 −(top− 40(top3101 × 0.0010.0030.0310.00210 −−0604 0.340.470.403.47)0.69)0.65) (0.18–(0.28–(0.2– 0.4960.9511.073 1.871.049.39×10−−4001 × 0.0010.004 0.340.470.403.47)0.69)0.65) (0.18–(0.28–(0.2– A MX1* 182.579316%)15%)3%) (top (top n Cluster1.060.0030.03110 × MX1* Expressio 0.8490.9610.578 7939.95Rank16%)103%) −(top01 × 0.00440.0090.0010.0030.03110 0.361.770.69)2.09)Expressio (0.20–(1.08– 0.8490.9610.578 10−−190105 0.0044Value0.0090.00101 1.770.69) (1.08– B ASPH* 1,542299 (top (top PURAB 1.060.003 *−04 × ASPH*3 0.613 1,5422991.041.3116%)24%) −(top− 01(top07 × 0.0310.0011.060.003 −04 × 0.470.30 (0.28–(0.15– 0.6130.951e 1.041.31101.87−−0107 × 100.001− 0.470.300.001(IC95)0.70)0.8) (0.28–(0.15– 0.41 (0.25–0.69) In ourHSPB1* SFSR3EEF2previous1*7 work showing2,09379379820325%)35%)19%) (top (top a comparative3.767.71×100.01 × SFSR3EEF21* 7 RNA-seq N/A analysis0.584(top2.43… 16%)2,093793 2031.879.535.3925%)35%)between19%)10… (top− 13(top × 0.00020.001 0.024PC33.767.71×100.01 × cells 1.770.342 0.79)0.65)0.80)(1.16– (1.08–(0.18–over-N/A 2.43… 9.535.3910…−13 × 0.00020.024 1.772 0.79)0.65)0.80)(1.16– (1.08– ASPH*MX1*RPA1 1,2802999%) (top (top 1.060.0030.031−−0405 × MX1*RPA1 n 0.6130.578 1.246 1,2802991.311.87109%) (top−− 2473(top × 0.00440.0010.0131.060.031 − 05 × 0.300.410.66) (0.15–(0.25– n 0.5781.246 1.311.8710−73 × × 0.00440.013 0.300.410.66) (0.15–(0.25– B SFSR3NOA1 2,0932,03511%)24%) (top B 7.71×100.01−04 SFSR3NOA1N/A 1.762… 586.52,0935.399.2311%)24%)10…−− 1307(top06 × 0.024…7.71×100.01 −04 0.422 0.66)2.91)0.59)(1.16– …(0.26–N/A 1.762… 5.393.410…−− 0706× × 0.024… 0.272 2.91)0.59)(1.16– …(0.12– 3.3. mRNA TMOD3ExpressionPURA*EEF2 Profil es of HO-11,28019%)23%)9%) (topInteractors 3.3. mRNA0.0160.03110 −unde06 ExpressionSLC12APURA*EEF2r Genetic InductionProfil 1.1520.9512.43es of ofHO-11,280 1,914HO-11.8719%)23%)10− (top40Interactors × 0.00020.0010.0315.510 − unde06× 0.41r0.66)0.80)3.47) Genetic (0.25– Induction0.9512.43 of HO-11.873.8610−40 × 0.00020.001 0.410.39(0.19–0.80)3.47) (0.25– expressingA HO-1RPA1 and controls [8],182.513311%)16%) 3%)we (top (top found A 1.0610 that−05 × HO-1GSN*RPA1 induction 1.246 triggered 182.51334.489.9511%)16%)103%) (top−− 730501(top × the 0.013alteration1.060.00510 −05 × 0.400.36 2.91)0.69)of (0.23–(0.20– key 1.2460.5330.849 4.489.9510−−7301 × 0.0010.013 0.400.362.91)0.69) (0.23–(0.20– ANXA2*SQSTMPURA* 1,5811,54224%)23%)22%) (top 0.0030.03110−04 ANXA2*PURA* 0.4960.9512093 1,5428251.049.39×24%)23%)10 −(top 06(top × 0.0014.210.0030.03110 −−0404 × 0.470.403.47)0.59)0.69) (0.28–(0.2– 0.4960.951 8.671.0410−−210601 × 0.001 0.470.653.47)0.59) (0.28– (0.4– A HSPB1* 798 (top A HSPB1*CBX37 0.584 7981.8710%)25%) −(top1901 × 0.0011004 0.34 (0.18– 1.3120.584 1.8710−1901 × 0.0850.00106 0.340.60)0.65) (0.18– ASPH*MX1* 182.51,54279329916%) (top (top RPA11.060.0030.031−04 × ASPH*MX1* 0.9610.6130.578 1,5427932999.951.041.3116%)10 (top− (top24 ×7.71 0.00440.0090.001101.060.0030.031 − 04 × 0.360.471.770.300.70)0.69) (0.20–(0.28–(1.08–(0.15– 0.6130.5781.246 1.041.31105.39−1224 × 100.00440.001 0.471.770.300.0130.70)0.69) (0.28–(1.08–(0.15– 2 (1.16–3.47) 3.3. mRNA HSPB1*ExpressionSFSR3 Profil es of HO-12,09379811%)19%) (top (topInteractors 3.3. BmRNA 7.71×100.01 unde ExpressionSFSR3r GeneticN/A InductionProfil 0.584…es of ofHO-12,093 798HO-11.875.3911%)20%)19%)10… (top−− 011307(top Interactors× 0.0010.0247.71×10−0.01 unde 0.342r 0.66)0.80)(1.16– Genetic(0.18–N/A Induction… of HO-11.875.3910…−1307 × 0.024− 0.342 0.66)0.80)1.06)(1.16– (0.18– cytoskeletalIn our MX1*EEF2genesprevious1* leading work to showing a more79320335%)9%) (top adhesive a comparativeIn3.760.031 −anour04 × d MX1*lessEEF2previous RNA-seq invasive work analysis0.578(topphenotype,2.43 showing 23%)1,082793 9.53between109%) (top− 24(top ×further a comparative×0.00440.0002 PC3 0.031supporting cells1.770.79)0.66) (1.08–RNA-seqover- its analysis0.5782.43 5.58between10 × × 0.00440.0002 PC3 cells1.770.480.66) (1.08–(0.29–over- ASPH*NOA1RPA1 2,09311%) (top 0.0037.71×10−05 ASPH*RPA1 0.6131.7621.246 2,0931,2805.3911%)10−− 07(top73 × 0.0010.013…0.0037.71× −05 2 0.66)2.91)(1.16–… 0.6131.246 5.391.87−−0773 × 0.0010.013 0.412 2.91)(1.16– (0.25– 3.3. mRNA ExpressionSQSTMSFSR3 Profiles of HO-1586.51,58119%)24%)23%) (topInteractors 3.3. mRNA100.01 −unde0604 ExpressionSQSTMPURA*SFSR3TOP1r GeneticN/A InductionProfil …es of ofHO-1586.5 1,581HO-119%)9.39×3.424%)23%)10…−− 13(top4006Interactors× 0.0240.0030.031100.01 −unde04 0.270.40r0.80)3.47)0.59) Genetic (0.12– (0.2–N/A Induction1.4680.951… of HO-19.39×3.410…−− 1306× 0.0050.0240.001 0.270.400.80)3.47)0.59) (0.12– (0.2– A GSN*RPA1 13311%)9%)3%) (top A 0.00510 GSN*RPA1 1.2460.533 4874.4811%)109%) (top × 0.0010.0130.005 0.402.91)0.66) (0.23– 1.2460.533 6.4810−−1401 × 0.0010.013 4.852.91)0.66) (1.20– expressinganti-tumoral HO-1 function and incontrols PCa [8]. [8],182.5 Here, we (top expressingfoundwe asse1.060.003 that−04ssed × HO-1RCC1*HO-1 whether andinduction HO-1controls 0.961 wastriggered [8], 182.5ca9.9525%)16%) pablewe− 2106(top × thefound of 0.009alteration modulating1.060.0120.003 that −04 × 0.36HO-1 of (0.20– keythe induction 0.9611.74 triggered 9.9510−2106 × the 0.0340.009alteration 0.36 0.80)0.69)of (0.20– key ANXA2*SQSTMHSPB1* 1,5811,54279810%)23%) (top (top 0.00310 HSPB1* 0.4960.584793 1,5427981.871.049.39×10%)23%)10 (top− 01(top × 0.00110 0.340.470.400.60)3.47) (0.18–(0.28–(0.2– 0.584 1.871.0410−3101 × 0.001 0.340.470.60)3.47) (0.18–(0.28– In our MX1*previous1* work showing182.579335%) (top (top a comparativeIn1.060.0030.031 −our04 × MX1*previous1* RNA-seq work analysis0.9610.578 showing 182.5793 9.9515%)35%)between10 −(top− 19(top24 × a comparative0.00440.009 PC31.060.031 − 04 × cells0.361.770.79) (0.20–(1.08–RNA-seqover- analysis0.578 9.95between10−24 × 0.0044 PC3 cells0.361.772.09)0.79) (0.20–(1.08–over- ASPH* 1,54229916%)11%) (top (top SFSR31.060.00310 × ASPH* 0.613 836.51,5421.041.3111%)10−− 01(top07 × 0.010.0010.00310 0.470.300.70)0.66) (0.28–(0.15– N /A 0.613...... 2.411.0410−07 × 0.001 5.800.470.0240.66) (2.72–(0.28– 1.77 (1.08–2.91) genecytoskeletal3.3. mRNA Inexpression our HSPB1*Expression SFSR3EEF2genesprevious1* of leadingthe Profil workselected esto showing ofa HO-1more79335%)19%) (top Interactors interactorsadhesive acytoskeletal3.3. comparative mRNAIn0.01 anourunde (Td HSPB1*Expressionable SFSR3lessgenespreviousr GeneticRNA-seq 2,N/Ainvasive asterisks).leading InductionProfilwork analysis0.584(topphenotype,2.43 …esto Resultsshowingof 11%)a ofHO-1more2,093 793 HO-1between19%)10… (top−showed 13(topInteractors adhesivefurther a comparative0.00020.001 0.024PC3 7.71×that0.01supporting anunde cellswhend1.77 lessr0.79)0.80) Genetic(1.08–RNA-seqover- N/APC3invasive its Induction analysis0.584phenotype,… of HO-15.39between10…−13 ×further 0.001 0.024PC3 supporting cells1.772 0.80)(1.16– (1.08–over- its MX1* 1,08213311%)9%) (top (top 0.031−−0405 PDCD5*MX1*RPA1 0.578 1,0821335.584.4811%)109%) −(top− 24(top73 × 0.00440.0110.031− 04 0.480.402.91)0.66) (0.29–(0.23– 1.1640.5781.246 5.584.4810−24 × 0.00010.00440.013 0.480.402.91)0.66) (0.29–(0.23– 3.3.expressing mRNA ExpressionSFSR3HO-1TOP1 and Profil controls es of HO-1[8],586.511%)19%)24%) we (topInteractors 3.3.expressingfound mRNA0.003100.01 that unde ExpressionSFSR3HO-1TOP1HO-1r GeneticN/A andinduction InductionProfil controls 1.468…es triggeredof ofHO-1[8], 2,035HO-111%)19%)3.410 …we− 07(topInteractors× thefound 0.0050.024alteration0.003100.01 that −unde04 0.27 HO-1r 0.66)0.80)0.59) ofGenetic (0.12– N/Akey induction Induction1.468… triggered of HO-19.2310…−−050706 × the 0.0050.024alteration 0.42 0.66)0.80)of (0.26– key ANXA2*SQSTM 1,581 (top 0.003 ANXA2*TMOD3SQSTM 0.496 1,58122%)9.39×23%)− 14(top 0.0010.0030.01610 0.40 (0.2– 0.4961.152 9.39×10−14 0.001 0.4012.32)3.47) (0.2– cellsexpressinganti-tumoralA were transientlyHO-1GSN* function and transfectedincontrols PCa [8]. [8],182.5 133Here,with11%)25%) we (top (top the anti-tumoralexpressing foundwe vectorasse1.060.0050.003 thatssed × pcDNA3HO-1 HO-1HO-1 functionwhether andinduction inHO-1controls PCaor0.5330.961 thewastriggered [8]. [8],empty 182.5 caHere,4.489.9511%)25%)10 pablewe− 19(top × thevector foundwe of 0.0010.009alteration assemodulating1.060.003 asthat ssed ×the 0.400.36HO-1 2.91)0.80)controlwhetherof (0.23–(0.20– key the induction HO-10.961 wastriggered ca9.9510pable−0519 × the of 0.009alteration modulating 0.36 2.91)0.80)of (0.20– key the ANXA2*SQSTM 1,5811,54216%) (top 0.003 SQSTM 0.4961542 1,5811,5421.049.39×16%)22%)10−− 21(top01 × 0.001 0.470.400.70) (0.28–(0.2– 1.049.39×10−01 × 0.470.400.69)0.70) (0.28–(0.2– cytoskeletalIn ourHSPB1* genesprevious1* leading work to showing a more79810%)35%) (top adhesive acytoskeletal comparativeIn anourdTHRAPHSPB1* lessgenesprevious1* RNA-seq invasive leading work analysis0.584phenotype, to showing a more1,898 1.8735%)between10− 19(top ×adhesivefurther a comparative0.001 PC3 supporting an cellsd0.34 less0.60)0.79) (0.18–RNA-seqover- invasive its analysis0.584phenotype, 5.84between10 ×further 0.001 PC3 07supporting cells0.490.79) (0.3–over- its ASPH*MX1* 1,54216%) (top MX10.0030.031 * −04 MX1* 0.9610.6130.578 1,5427931.0410 (top− (top24 × 0.0310.00440.0090.0010.0030.031 − 04 0.470.70) (0.28– 0.9610.5780.578 1.041.04−24 × 100.00440.009 0.471.770.0044 (0.28–(1.08– 0.47 (0.28–0.80) 836.5586.511%) (top 10 SFSR3 836.5586.52.4111%)3.410−− 01(top1307 ×× 0.002100.01 5.800.270.66) (2.72–(0.12–N/A 1.073… 2.413.410…−− 0107 ×× 0.0040.024− 5.800.270.66) (2.72–(0.12– (pcDNA3),genecytoskeletal3.3. mRNA Inexpression ourPDCD5* Expression there MX1*genesprevious1* of was leadingthe Profila workselected significant esto showing ofa HO-1more1,082 35%)19%)chan9%) (topInteractors interactorsadhesive acytoskeletalgenege3.3. comparative in mRNA In expression0.0110.031the anourunde (T expressiond PDCD5*Expressionable MX1*lessgenespreviousr1* GeneticRNA-seq 2,of invasive asterisks). leadingthe profile InductionProfil workselected analysis1.1640.578(topphenotype, esto of Resultsshowing of 19%)a MX1 ofHO-1more 203HO-15.5835%)between19%)10 (Figure(topshowed Interactors interactors×adhesivefurther a comparative0.00010.0044 PC32A). 3.76 0.0110.031thatsupporting anunde ×(T Thecells whend0.48able lessr0.79) 0.66)0.80) rest Genetic(0.29–RNA-seqover- 2,PC3invasive itsasterisks).of Induction analysis1.1640.578phenotype, Results of HO-19.53between10 −showed05 ×further × 0.00010.0044 PC3 thatsupporting cellswhen0.79)0.80) over- PC3 its expressinganti-tumoral HO-1GSN* function and incontrols PCa [8]. [8], 133Here, we (top anti-tumoralexpressing foundwe asse0.005 thatssed HO-1NOA1HO-1GSN* functionwhether3 andinduction inHO-1controls PCa0.533 wastriggered [8]. [8], 133caHere,4.4824%)11%) pablewe −(top0507 × the foundwe of 0.001alteration assemodulating0.005 that ssed 0.40HO-1 whetherof (0.23– keythe induction HO-11.7620.533 wastriggered ca4.4810pable−0507 × the of 0.001alteration …modulating 0.40 2.91)0.8)of …(0.23– key the 3.3. mRNA ANXA2*ExpressionSQSTMTOP1 Profil es of HO-1586.51,58122%)19%) (topInteractors 3.3. mRNA0.003 unde ANXA2*ExpressionSQSTMr Genetic InductionProfil 1.4680.496es of ofHO-1 1,581HO-122%)19%)9.39×3.410− 21(topInteractors× 0.0050.0010.003 −unde06 0.270.40r12.32)0.80) Genetic (0.12– (0.2– Induction0.496 of HO-19.39×10−4021 0.001 0.4012.32)0.80) (0.2– GSN* 13310%) (top 0.005 0.533 1334.4810%)103%) (top−−1419 × 0.00110 0.400.60) (0.23– 4.4810−19 × 0.400.60) (0.23– cellsexpressinganti-tumoralthe genes were assessed transientlyHO-1 function and presented transfectedincontrols PCa [8].no [8],182.5 Here,withsignificant25%)16%) we (top the anti-tumoralexpressingcellsfoundwe vectorasse were1.06alterati0.003 thatssed × pcDNA3HO-1 transiently SLC12AHO-1HO-1 onfunctionwhether under andinduction transfectedinHO-1controlsHO-1 PCaor0.961 the wastriggered induction. [8]. [8],empty1,914 caHere,with9.9516%)10 pablewe− 21(top × thethevector foundweInterestingly, of 0.009alteration vector assemodulating0.0035.5 asthat ssed× the pcDNA3HO-1 0.36HO-1 0.80)controlwhether0.70)of (0.20–while key the induction HO-1 or0.961 thewastriggered empty ca3.8610pable × thevector of 0.009alteration modulating as the0.39(0.19– control0.70)of key the ANXA2*HSPB1* 10%) 0.003 ANXA2* 0.4960.584 1,54210− 01(top 0.0010.003 0.60) 0.496 1.04−01 × 0.001 0.47 (0.28– genecytoskeletal Inexpression ourTHRAP genesprevious1* of leadingthe workselected to showing a HO-1more1,8981,08235%) (top interactorsadhesive acytoskeletalgene comparative Inexpression −anour04 (TdTHRAPable MX1*lessgenesprevious1* RNA-seq 2,of invasive asterisks). leadingthe workselected analysisphenotype, to Resultsshowing a HO-1more1,8981,082 5.845.5835%)between10 −− showed19(top24 ×interactorsadhesivefurther a comparative PC3 0.031thatsupporting an (T cellswhend0.480.49able less0.79) (0.29–(0.3–RNA-seqover- 2,PC3invasive itsasterisks). analysis0.8490.578phenotype, Results 5.845.58between10 −showed19 ×further 0.00440.001 PC3 thatsupporting cellswhen0.480.490.79) (0.29–(0.3–over- PC3 its 836.516%)11%) (top 0.00210 1.073 2992.4116%)10 (top × 0.0041.060.002 −04 × 5.800.70)0.66) (2.72– 1.073 1.3110−−0107 × 0.004 0.300.70) (0.15– (pcDNA3),genecytoskeletalMX13.3. mRNAIn expressionappeared our Expression there TOP1genesprevious as of was downregulated leadingthe Profila workselected significant esto showing ofa HO-1more586.5 in chan PCa (topInteractors interactorsadhesiveacytoskeletal(pcDNA3),genege3.3. comparativecompared in mRNA In expression0.003the anourunde (Texpression d Expressionable there toTOP1lessEEF2genespreviousr7 Geneticnormal RNA-seq 2, ofinvasive was asterisks). leadingthe profile InductionProfilagland workselected significant analysis1.468phenotype, esto of and Resultsshowing of a MX1 ofHO-1more 586.5 was HO-1 25%)between19%)3.4chan (Figure−showed 05(topassociatedInteractors× interactorsadhesivefurther a ge comparative in 0.005 PC32A). 0.003thatthe10supporting an unde with (T expressionThecellswhend0.27able lessr poorer restGenetic (0.12–RNA-seqover- 2,PC3invasive itsasterisks).of profile Induction analysis1.468phenotype,2.43 of Results MX1of HO-1between103.4 (Figure−showed 05×further 0.0002 0.005 PC32A). thatsupporting Thecellswhen0.270.65) 0.80) rest (0.12–over- PC3 itsof PDCD5*GSN*3 1,08213324%) (top (top B 0.0110.005 GSN*3 1.1640.533 1335.584.4824%)10 (top−14 × 0.00010.0010.005 − 05 0.480.400.8) (0.29–(0.23– 0.533 4.4810−7314 × 0.001 0.400.8) (0.23– 3.3.cellsexpressinganti-tumoral mRNA were transientlyExpressionHO-1TOP1 function and Profil transfectedincontrols PCaes of [8]. HO-1[8],586.5 Here,with25%) we (topInteractors the 3.3.anti-tumoralexpressingcellsfoundwe vectormRNAasse were0.003 that undessed pcDNA3HO-1 transiently ExpressionHO-1HO-1r functionwhether Genetic andinduction InductionProfil transfectedinHO-1controls PCa1.468ores the wastriggeredof [8]. ofHO-1 [8],empty586.5 HO-1caHere,with3.424%)25%)10 pablewe−− 05(top21Interactors× thethevector foundwe of 0.005alteration vector assemodulating10 asthat undessed the pcDNA3HO-10.27 HO-1r 0.80)controlwhether ofGenetic (0.12– key the induction Induction HO-1 or thewastriggered of empty HO-1ca3.410pable− 21× thevector of alteration modulating as the0.27 0.80)0.59)controlof (0.12– key the ANXA2*SQSTM 1,58122%)10%) (top 0.003 ANXA2* 0.496 1,2809.39×10%)10− 14(top 0.0010.003 0.4012.32)0.60) (0.2– 0.496 1.8710 × 0.001 0.410.60) (0.25– cellsexpressinganti-tumoralRFSthe genes (Figurewere assessed transientlyHO-1 GSN*1 function and andTable presented transfectedincontrols3.3. 2), PCa HO-1 mRNA [8].no [8], modulationHere,withsignificant25%) we Expressionthe anti-tumoralexpressingcellsthefoundwe vectorAgenesasse were 0.005 alterati0.003 wasthatssed pcDNA3HO-1assessedcapable transiently HO-1HO-1GSN* on Profilesfunctionwhether under and inductionof presented inducing transfectedinHO-1controlsHO-1 of PCaor0.5330.961 HO-1 the wastriggered induction. [8]. no its [8],empty caexpression. InteractorsHere,withsignificant10 pablewe−19 thethevector foundweInterestingly, of 0.0010.009alteration vector asse modulating 0.005alterati asthat underssed the pcDNA3HO-1 HO-1 on 0.80)controlwhetherof while underGenetic key the induction HO-1HO-1 or0.533 Induction the wastriggeredinduction. empty capable−19 ofthevector Interestingly, HO-1of 0.001alteration modulating as the controlof while keythe SLC12A 1,914836.510%)16%) (top 5.5 × SLC12APURA* 1,914836.57983.862.4110%)16%)10 −(top− 21(top01 × 0.0315.5 × 5.800.39(0.19–0.60)0.70) (2.72– 0.951 3.862.411.8710−21 × 0.001 0.345.800.39(0.19–0.60)0.70) (0.18–(2.72– (pcDNA3),genecytoskeletal Inexpression ourPDCD5* THRAP there genesprevious1* of was leadingthe a workselected significant to showing a HO-1more1,8981,082 35%)chan (top interactorsadhesive acytoskeletal(pcDNA3),genege comparative in In expression0.011the anour (T expressiondPDCD5* able there lessgenesprevious RNA-seq 2,of invasivewas asterisks). leadingthe profile a workselected significant analysis0.8491.164phenotype, to of Resultsshowing a MX1 HO-1more1,082 5.845.58 16%)between10chan (Figure showed (top ×interactorsadhesivefurther age comparative 0.00010.001in PC32A). 0.011thatthesupporting an (T expressionThecellswhend0.480.49able less0.79) rest (0.29–(0.3–RNA-seqover- 2,PC3invasive itsasterisks).of profile analysis0.8491.164phenotype, of Results MX1 5.58between10 −(Figureshowed01 ×further 0.00010.001 PC32A). thatsupporting Thecellswhen0.480.69) rest (0.29–over- PC3 itsof 836.5 (top 0.002−04 ASPH* 1.073 2.41−−0105 × 0.0040.003 −04 5.80 (2.72– 0.613 −−0105 0.001 (pcDNA3),genecytoskeletalMX1In expressionappeared our there TOP1genesprevious7 as of was downregulated leadingthe a workselected significant to showing a HO-1more586.5 in 25%)22%)chan PCa (top interactorsadhesive acytoskeletal(pcDNA3),geneMX1ge3.3. comparativecompared in mRNAIn expressionappeared0.003the10 anour (Texpression d Expressionable there toTOP1lessgenesprevious7 normal RNA-seqas 2,of invasivewas downregulated asterisks). leadingthe profile Profilagland workselected significant analysis1.468phenotype, esto of and Resultsshowing of a MX1 HO-1more 586.5was in 25%)between22%)103.4chan PCa(Figure−showed 05(topassociatedInteractors× interactorsadhesivefurther age comparativecompared in 0.005 PC32A). 0.003thatthe10supporting an unde with (T expressionThecellswhend0.27able tolessr12.32) 0.65) poorer restGenetic normal(0.12–RNA-seqover- 2,PC3invasive itsasterisks).of profile Inductiongland analysis1.468phenotype, of andResults MX1of was HO-1between103.4 (Figure−showed 13 associated×further 0.005 PC32A). thatsupporting with Thecellswhen0.2712.32) 0.65) poorer rest (0.12–over- PC3 itsof B PDCD5*GSN*3 1,08213324%)25%) (top (top B 0.0110.005 GSN* 1.1640.533 1,0825.584.4825%)109%)− (top14 × 0.00010.0010.005 0.480.400.80)0.8) (0.29–(0.23– 0.533 5.5810−14 × 0.001 0.480.80)0.66) (0.29– cellsexpressinganti-tumoralthe genes were assessed transientlyANXA2*HO-1TOP1 function and presented transfectedincontrols PCa [8].no [8], Here,withsignificant22%) we the anti-tumoralexpressingcellsthefoundwe vectorgenesasse were0.003alterati thatssed pcDNA3HO-1assessed transiently HO-1TOP1HO-1 onfunctionwhether under andinduction presented transfectedinHO-1controlsHO-1 PCa1.468or0.496 the wastriggered induction. [8].no [8],empty2,093 caHere,withsignificant10 pablewe−− 05(top21 thethevector foundwe Interestingly, of 0.0050.001alteration vector asse modulating7.71×0.003alterati asthat ssed the pcDNA3HO-1 HO-1 on12.32) controlwhetherof while under keythe induction HO-1HO-1 1.468or the wastriggeredinduction. empty ca5.39pable−21 × thevector Interestingly, of 0.005alteration modulating as the2 control(1.16–of while keythe THRAP In1,2801,898 our10%) (top previous workTHRAPRPA1 showing a comparative1,2801,8981.875.8410%)10−− 14(top19 × RNA-seq0.410.490.60) (0.25– (0.3– analysis1.246 between1.875.8410−14 × 0.013 PC3 cells0.410.490.60) (0.25– (0.3– over-expressing cellsexpressinganti-tumoralRFSthe genes (Figurewere assessed transientlySLC12APURA*HO-1 1 function and andTable presented transfectedincontrols 2), PCa HO-1 [8].no [8],1,914 modulationHere,withsignificant25%)16%) we (top the anti-tumoralexpressingcellsRFSthefoundwe vector genesasse (Figure were0.031 alterati5.5 wasthat ssed× pcDNA3HO-1assessedcapable transiently PURA*HO-1 HO-11 onfunctionwhether and under and inductionTableof presented inducing transfectedinHO-1controlsHO-1 2), PCaor0.951 HO-1 the wastriggered induction. [8]. no its [8],empty 182.5 camodulationexpression.Here,withsignificant3.8625%)10 pablewe (top × thethevector foundweInterestingly, of 0.001alteration vector asse modulating 1.060.031 alterati wasasthat −04ssed ×the pcDNA3HO-1capable 0.39(0.19–HO-1 on 0.80)controlwhether0.70)of while under key the inductionof inducing HO-1HO-1 or0.951 the wastriggeredinduction. its empty caexpression.9.9510pable−06 × thevector Interestingly, of 0.001alteration modulating as the0.36 0.80)controlof (0.20–while key the cytoskeletal genes leading to a more836.5 (topadhesivecytoskeletal In0.002 anour dHSPB1* lessgenesprevious invasive leading work 1.073phenotype, to showing a more836.52.4123%)− 01 (top ×adhesivefurther a comparative0.004 0.00210supporting an d5.80 less (2.72–RNA-seq invasive its analysis0.5841.073phenotype, 2.41between10−01 ×further 0.0010.004 PC3 supporting cells5.803.47) (2.72–over- its (pcDNA3),geneMX1 expressionappearedPDCD5* THRAPthere3 as of was downregulated the a selected significant HO-11,8981,082 in 16%)24%)chan PCa (top interactors (pcDNA3),geneMX1ge compared in expressionappeared0.011the (T expressionPDCD5* able thereto3 normal as 2,of was downregulatedasterisks). the profile agland selected significant 0.8491.164 of andResults MX1 HO-1 1,082was in5.845.58 16%)24%)10chan PCa(Figure− showed 05(top associated×interactors ge compared 0.00010.001in 2A). 0.011thatthe − 04with (T expressionThewhen0.480.49able to0.69) poorer0.8) rest normal (0.29–(0.3– 2,PC3 asterisks).of profile gland1.164 of andResults MX1 was5.5810 (Figure−showed 2405 associated× 0.0001 2A). that with Thewhen0.480.69) poorer0.8)rest (0.29– PC3 of cytoskeletal TOP1genes7 leading to a more836.5586.525%) (topadhesive cytoskeletal 0.0020.00310 −an04 d TOP1lessgenes invasive leading 1.0731.468phenotype, to a more836.52.4111%)103.4−− 01(top05 ××adhesivefurther 0.0040.005 0.00310supporting an d5.800.27 less0.65) (2.72–(0.12– invasive its 1.468phenotype, 2.4110−05 ×further 0.005 supporting 5.800.66) (2.72– its (pcDNA3),geneMX1 expressionappearedPDCD5* there as of was downregulated the a selected HO-1significant HO-1 and in 22%)chan PCa controlsinteractors (pcDNA3),geneMX1ge compared in expressionappeared0.011the [(T expression8PDCD5* able], thereto wenormal as 2,of was downregulatedasterisks). foundthe profile agland selected significant 1.164 that of andResults MX1 HO-1 HO-1was793 in 22%)10chan PCa(Figure(top−−showed 0514associatedinteractors ge inductioncompared 0.0001in 2A). 0.011thatthe with (T expressionThewhenable to12.32) poorer rest triggerednormal 2,PC3 asterisks).of profile gland1.164 the of andResults MX1 alteration was10 (Figure−showed 14associated 0.0001 2A). ofthat with key Thewhen1.7712.32) poorerrest cytoskeletal(1.08– PC3 of genes cellsanti-tumoralRFSthe B genes (Figure were assessedtransiently GSN*1 function 3and Table presented transfectedin 2),PCa HO-1 [8].no2,093 modulationHere,withsignificant24%)25%) (top the anti-tumoralexpressingcellsRFSthewe vector genesasse (Figure were7.71×0.005 alteratiwasssed pcDNA3HO-1assessedcapable transientlySFSR3HO-1 1 onfunctionwhether and under and Tableof presented inducing transfectedinHO-1controlsHO-1 2), PCaor0.533 HO-1 the was induction. [8]. no its [8],empty2,093 camodulationexpression.Here,withsignificant5.3925%)10 pablewe− 05(top × thevector foundwe Interestingly, of 0.001 vector asse modulating7.71× alterati0.01 wasasthat ssed the pcDNA3HO-1capable HO-12 on 0.80)control(1.16–whether0.8) while N/Aunder the inductionof inducing HO-1HO-1 or… the wastriggeredinduction. its empty caexpression.5.3910…pable−05 × thevector Interestingly, of 0.024alteration modulating as the2 0.80)control(1.16–of while key the SLC12ARPA1 1,2801,91422%)10%) (top 5.5 × SQSTMSLC12ARPA1 1.246 1,9141,5811.873.8622%)10− 21(top × 0.0135.5 × 0.410.39(0.19–12.32)0.60) (0.25– 1.246 3.869.39×10 × 0.013 0.39(0.19–0.4012.32) (0.2– cellsanti-tumoralRFSthe genes (Figurewere assessedtransientlyTHRAP 1 function and Table presented transfectedin 2), PCa HO-1 [8].no1,898 modulationHere,withsignificant (top the anti-tumoralcellsRFSthewe vector genesasse (Figure were alteratiwas−04ssed pcDNA3HO-1assessedcapabletransientlyTHRAP 1 onfunctionwhether and under Tableof presented inducing transfectedinHO-1HO-1 2), PCaor0.849 HO-1 the was induction. [8]. noits empty 1,898 camodulationexpression.Here,withsignificant5.8411%)pable− 06(top × thevector weInterestingly, of 0.001 vector asse modulating alterati0.003 wasas −04ssed the pcDNA3HO-1capable0.49 oncontrolwhether while (0.3–under the of inducing HO-1HO-1 or0.8490.961 the wasinduction. its empty caexpression.5.84pable−06 × vector Interestingly, of0.0090.001 modulating as the0.49 2.91)control while (0.3– the SLC12APURA* 1,914836.523%) (top 0.0310.0025.510− 04× 0.9511.073 836.53.862.4123%)10− 01(top × 0.0010.0040.00210 −04 5.800.39(0.19–3.47) (2.72– 1.073 2.4110−01 × 0.004 5.803.47) (2.72– (pcDNA3),geneMX1 expressionappeared THRAPthere7 as of was downregulated the a selected significant HO-11,898 in 25%)chan PCa (top interactors cytoskeletal(pcDNA3),geneMX1ge compared in expressionappearedthe10 (Texpression THRAPable there togenes1*7 normal as 2,of was downregulated asterisks). leadingthe profile agland selected significant0.849 to of andResults a MX1 HO-1more 1,898was in5.84 25%)35%)10chan −PCa(Figure− showed 01(top05 associated×interactorsadhesive ge compared 0.001in 2A). thatthe10 an with (T expressionThewhend0.49able toless 0.65) poorer restnormal (0.3– 2,PC3invasive asterisks).of profile gland phenotype, of andResults MX1 was5.8410 (Figure−showed 05 associated×further 2A). thatsupporting with Thewhen0.49 0.79)0.65) poorerrest (0.3– PC3 itsof PDCD5*3 leading 1,082 to16%)24%) (top a more 0.011− adhesive04 PDCD5*3 and 1.164 less invasive1,5425.5824%)10− 01(top × 0.0001 phenotype,0.011 0.480.69)0.8) (0.29– further1.164 supporting1.0410 × 0.0001 its anti-tumoral0.470.8) (0.28– function (pcDNA3),geneB expression thereTOP17 of was the a selected significant HO-1 25%)chan interactors (pcDNA3),genege inB expression0.0020.003the10 (T expression ablethere 2,of was asterisks). the profile a selected significant 1.0731.468 of Results MX1 HO-1 10chan (Figure−showed 05interactors ge in0.0040.005 2A). 0.002thatthe (T expressionThewhenable0.65) rest 2,PC3 asterisks).of profile1.073 of Results MX1 (Figure−showed05 0.004 2A). that Thewhen rest PC3 of MX1 appeared3 as downregulated1,280793 in24%)22%) PCa(top (top MX1 compared appeared toMX1*3 normal as downregulated gland and 1,280was793 133in1.8724%)22%)10 PCa(top−− 0514(topassociated × compared0.031 with 1.770.41 to12.32) poorer0.8) normal(1.08–(0.25– gland0.578 and was4.481.8710− 05associated × 0.0044 with1.770.400.4112.32) poorer0.8) (1.08–(0.23–(0.25– cellsRFSthe B genes (Figure were assessedtransientlySLC12APURA*SFSR3 1 and Table presented transfected 2), HO-1 no2,0931,914 modulationwithsignificant25%) (top theanti-tumoralcellsRFSthe vector genes (Figure were7.71×0.031 alterati5.50.01was × pcDNA3HO-1assessedcapabletransientlySLC12APURA*SFSR3 1 onfunction and N/Aunder Tableof presented inducing transfectedinHO-1 2), PCaor0.951… HO-1 the induction. [8]. noits empty1,914 modulationexpression.Here,withsignificant5.393.8619%)10… (top × thevector weInterestingly, 0.0240.001 vectorasse 0.031 alterati5.50.01 wasas ssed× the pcDNA3HO-1capable0.39(0.19–2 on 0.80)control(1.16–whether while N/Aunder of inducing HO-1HO-1 or0.951… the wasinduction. its empty caexpression.3.8610…pable−07 × vector Interestingly, of0.0240.001 modulating as the0.39(0.19– 0.80)control while the RPA1 1,280 (top ANXA2* 1.246 1.87−01 × 0.0130.003 0.41 (0.25– 0.496 −01 0.001 cells were transientlyTHRAP transfectedin PCa1,898 [with11%)816%)]. (top Here,thecells vector were we−04 pcDNA3HO-1transientlyTHRAP assessed transfected whether or0.849 the empty1,898 with5.8411%)16%)10 HO-1− 06(top × thevector 0.001vector was as the pcDNA3HO-1 capable0.49 2.91)control0.69) (0.3– of or0.849 modulating the empty5.8410−19 × vector the0.001 as gene the0.49 2.91)control0.69) expression(0.3– of the RFSthe genes(Figure assessedSLC12APURA* 1 and Table presented 2), HO-1 no1,914836.5 modulationsignificant23%) (top RFSthe genes(Figure 0.031 alterati0.0025.510was− 04× assessedcapableSLC12A 1on and under Tableof presented inducing HO-1 2), 0.9511.073 HO-1 induction. noits1,914 modulationexpression.significant3.862.4116%)10− (top01 × Interestingly, 0.0010.004 alterati0.0025.5was − 04× capable5.800.39(0.19–on3.47) (2.72–while under of inducing HO-11.073 induction. its expression.3.8610−01 × Interestingly,0.004 0.39(0.19–0.70) while (pcDNA3),MX1 appeared there7 as was downregulated a significant in 25%)chan PCa (pcDNA3),geneMX1ge compared in expressionappearedthe10 expression thereto7 normal as of was downregulated the profile agland selected significant 0.849 ofand MX1 HO-1 was in 25%)10chan −PCa(Figure− 0105associatedinteractors ge compared 0.001in 2A). the10 with (TexpressionTheable to 0.65) poorer restnormal 2, asterisks).of profile gland0.849 of andResults MX1 was10 (Figure−showed 05associated 0.001 2A). that with Thewhen 0.65) poorerrest PC3 of B PDCD5*3 1,54216%)24%) (top B 0.011−04 3 1.164 1,5421.0424%)10− 01(top × 0.0001− 04 0.470.69)0.8) (0.28– 1.0410−01 × 0.470.8) (0.28– (pcDNA3),MX1 appeared thereMX1*7 as was downregulated a significant 2,093793 in 25%)22%)chan PCa(top (top (pcDNA3),MX1ge compared in appeared0.0317.71×the10 expression theretoMX1*7 normal as was downregulated profile agland significant 0.578 ofand MX1 586.52,093was in 5.3925%)10chan PCa(Figure− 05(topassociated × ge compared 0.0044in 2A). 0.0317.71×the10 with expressionThe1.77 to212.32) 0.65) (1.16–poorer rest normal(1.08– of profile gland0.578 ofand MX1 was5.39103.4 (Figure associated× × 0.0044 2A). with The0.272 0.65) (1.16–poorerrest (0.12– of B RPA1 selected 1,280 HO-1 (top B interactors GSN*RPA1 (Table 1.2462, asterisks).1,2801.87− 07(top × 0.013 Results0.005 0.41 (0.25– showed 1.2460.533 that when1.87−07 × PC30.0010.013 cells0.41 (0.25– were transiently RFSthe genes(Figure assessedSLC12APURA*SFSR3 1 and Table presented 2), HO-1 no2,0931,914 modulationsignificant19%)23%) (top 3.3.cellsRFSthe mRNA genes (Figure were7.71×0.031 alterati5.5100.01was− 04× assessedcapabletransientlyExpressionSLC12APURA* 1on and N/Aunder Tableof presented inducing Profil transfectedHO-1 2), 0.951…es HO-1 ofinduction. no itsHO-11,914 modulationexpression.withsignificant5.393.8619%)23%)10…− 06(topInteractors × the Interestingly, 0.0240.001vector 0.031 alterati5.510was − unde04× pcDNA3HO-1capable0.39(0.19–2ron 0.80)3.47)(1.16– Geneticwhile under of inducingInduction HO-1 or0.951 the induction. itsof empty HO-1 expression.3.8610−2106 × vector Interestingly,0.001 as the0.39(0.19– 0.80)3.47)control while THRAPRPA1 1,2801,89811%)16%) (top 1.2460.849 1,2801.875.8410%)16%)10− (top01 × 0.0130.001 0.410.492.91)0.69) (0.25– (0.3– 0.849 1.8710−01 × 0.001 0.410.69)0.60) (0.25– RFSthe genes(Figure assessedPURA* 1 and Table presented 2), HO-1 no modulationsignificant23%) RFSthe genes(Figure 0.031 alterati0.00210was−−0404 assessedcapablePURA* 1on and under Tableof presented inducing HO-1 2), 0.9511.073 HO-1 induction. noits modulationexpression.significant10−−0601 Interestingly,0.0010.004 0.031 alteratiwas −04 capableon3.47) while under of inducing HO-10.951 induction. its expression.−01 Interestingly,0.001 while MX1 appeared7 as downregulated in25%) PCa (pcDNA3),MX1 compared appeared10 thereto7 normal as was downregulated agland significant and was in 25%)10chan −PCa− 0105associated ge compared in the10 with expression to 0.65)poorer normal profile gland ofand MX1 was10 −(Figure 01associated 2A). with The 0.65) poorerrest of B 3 transfected 1,54279316%)24%) (top (top with B the vector pcDNA3HO-1 1,0827931.0416%)10 (top (top × or the empty0.471.770.69)0.8) (0.28–(1.08– vector as the5.5810 control × (pcDNA3),1.770.480.69) (1.08–(0.29– there was a MX1 appearedSFSR3MX1* as downregulated 2,093793 in PCa(top (topMX1 comparedIn appeared0.0317.71×0.01 our SFSR3toTOP1previous normal asN/A downregulated glandwork 0.578… and showing 2,093was in5.39… PCa (topassociated ×a comparativecompared0.00440.0247.71×0.0030.01 with 1.77 to2 (1.16–poorer normal(1.08–RNA-seqN/A gland analysis1.468… and was 5.39between… associated × 0.0050.024PC3 withcells2 (1.16–poorer over- RPA1 1,28011%) (top RPA1 1.246 1,2801.8711%)− 07(top × 0.013 0.412.91) (0.25– 1.246 1.87−14 × 0.013 0.412.91) (0.25– 3.3.RFS mRNA (Figure ExpressionSLC12APURA*SFSR3 1 and Table Profil 2), es HO-1 of HO-12,0931,914 modulation19%)23%) (topInteractors 3.3.RFSthe mRNA genes(Figure7.71×0.031 5.5100.01was − unde04× assessedcapableExpressionPURA* 1r GeneticandN/A Tableof presented inducingInductionProfil 2), 0.951…es HO-1 of no itsofHO-12,093 HO-1 modulationexpression.significant5.393.8623%)25%)10…− (top06Interactors × 0.0240.001 7.71× 0.031 alterati10was −unde04 capable0.39(0.19–2ron 0.80)3.47)(1.16– Genetic under of inducingInduction HO-10.951 induction. itsof HO-1 expression.5.3910−06 × Interestingly,0.001 2 0.80)3.47)(1.16– while RPA1 significant 11%) change expressing in theHO-1RPA1 expression and controls 1.2460.849 profile [8], we−01 offoundMX10.0130.001 that (Figure HO-12.91) induction2A). The1.246 triggered rest of−01 the the 0.013alteration genes assessed of key presented RFS (Figure 1 and Table 2), HO-11,542 modulation23%)16%) (top RFS (Figure 10was−−0404 capable 1 and Tableof inducing 2), HO-1 its836.51,542 modulationexpression.1.0423%)16%)10−− 0601(top × 10was−04 capable0.473.47)0.69) (0.28– of inducing its expression.2.411.0410−06 × 5.800.473.47)0.69) (2.72–(0.28– MX1*7 79325%) (top MX1 appeared0.03110 MX1* as downregulated 0.578 793 in10 PCa(top compared0.00440.031 1.77 to0.65) normal(1.08– gland0.578 and was associated0.0044 with1.77 poorer (1.08– B 1,542 (top PDCD5* 1.04−07 × 0.011 0.47 (0.28– 1.164 −07 0.0001 In our SFSR3MX1*previous work showing2,09379319%) (top (top acytoskeletal comparativeIn0.0317.71×0.01 our SFSR3genesprevious RNA-seqN/A leading work analysis0.578 …to showing a more2,093793 5.39between22%)19%)10… (top (top adhesive× a comparative0.0044 0.024PC37.71×0.01 an cellsd1.77 2less 0.80)(1.16– (1.08–RNA-seqover- N/Ainvasive analysisphenotype,… 5.39between10…−05 ×further 0.024PC3 supporting cells1.77212.32) 0.80)(1.16– (1.08–over- its RPA1 no significant1,28011%) (top alterationRPA1 under HO-1 1.246 induction.1.8711%)−07 × 0.013 Interestingly,0.412.91) (0.25– while1.246 MX1 appeared0.013 2.91) as downregulated 3.3. mRNA ExpressionPURA*SFSR3 Profil es of HO-119%)23%) Interactors RFS (Figure0.031100.01 −unde04 SFSR3 1r GeneticandN/A Table Induction 2),0.951… HO-1 of HO-1modulation23%)10…−06 0.0240.001 100.01was −04 capable0.80)3.47)N/A of inducing… its expression.10…−06 0.024 3.47) expressing HO-1 and controls [8],11%) we expressingfound that THRAPHO-1HO-1 andinduction controls triggered [8],1,89811%) we− 01(top thefound alteration that HO-1 2.91)of key induction triggered5.84 × the alteration0.49 2.91)of (0.3– key 1,54216%) (top anti-tumoral function in PCa [8].1,542 Here,1.0410 (top × we asse0.002ssed 0.47 whether0.69) (0.28– HO-11.073 was ca1.04pable × of0.004 modulating 0.47 (0.28– the MX1* 793 (top 0.031 MX1* 0.578 793 (top 0.00440.031 1.77 (1.08– 0.578 −05 0.0044 1.77 (1.08– 3.3. mRNA ExpressionSFSR3 Profil es of HO-11,5422,093 (topInteractors3.3. mRNA7.71×0.01 unde ExpressionSFSR3r 3Genetic N/A InductionProfil …es of ofHO-11,542 HO-11.045.3924%)…− (top07 Interactors× 0.0240.01 unde 0.472r (1.16– Genetic(0.28–N/A Induction… of HO-11.0410…−07 × 0.024 0.470.8) (0.28– cytoskeletalIn our MX1*RPA1genesprevious leading work to showing a more19%) adhesive acytoskeletalgene comparative expression0.031 an d MX1*lessgenes RNA-seq of invasive leadingthe selected analysis0.5781.246phenotype, to a HO-1more between19%)10 interactorsadhesivefurther 0.0044 0.013PC3 0.031supporting an (T cellsdable less0.80) over- 2,invasive itsasterisks). 0.578phenotype, Results 10 showed further 0.0044 thatsupporting when0.80) PC3 its 3.3. mRNA Expression Profiles of HO-119%)11%) Interactors −unde04 SLC12Ar Genetic Induction of 1,914HO-119%)11%)10−− 0706(top 5.5 × 0.80)2.91) 3.8610−07 × 0.39(0.19–0.80)2.91) 23%) 10 10 3.47) 0.849 0.001 expressinganti-tumoral HO-1 function and incontrols PCa [8]. [8],1,542 Here, we (top anti-tumoralcellsfoundwe asse were thatssed transiently HO-1 functionwhether induction transfectedinHO-1 PCa wastriggered [8]. 1,542 caHere,with1.04pable (top × thethe we of alteration vector assemodulating−04ssed pcDNA3HO-10.47 whetherof (0.28– keythe HO-1 or thewas empty ca1.04pable−01 × vector of modulating as the0.47 control (0.28– the In our MX1*previous work showing793 (top a comparativeIn0.031 our MX1*previous 7 RNA-seq work analysis0.578 showing 25%)between a comparative0.0044 PC30.03110 cells1.77 (1.08–RNA-seqover- analysis0.578 between10 0.0044 PC3 cells0.65) over- B −07 −07 genecytoskeletal3.3. mRNA Inexpression our Expression SFSR3genesprevious of leadingthe Profil workselected esto showing ofa HO-1more19%) Interactors interactorsadhesive a(pcDNA3),gene3.3. comparative mRNA expression0.01 anunde (Td Expressionablethere lessr GeneticRNA-seq 2,N/Aof invasivewas asterisks). the InductionProfila selected significant analysisphenotype,…es Resultsof ofHO-11,280 HO-1 between19%)10chan… showed (topInteractors interactorsfurther ge in 0.024PC3 thatthesupporting unde (T expressioncellswhenabler0.80) Geneticover- 2,PC3 itsasterisks). profile Induction of Results MX1of HO-11.8710 (Figureshowed × 2A). that Thewhen0.41 0.80)rest (0.25– PC3 of 3.3.expressing mRNA ExpressionHO-1 and Profil controlses of HO-1[8],11%) we Interactors 3.3.expressingfound mRNA that unde ExpressionPURA*HO-1HO-1r Genetic andinduction InductionProfil controls es triggeredof ofHO-1[8], HO-1 we Interactors thefound alteration0.031 that unde HO-1r 2.91) ofGenetic key induction Induction0.951 triggered of HO-1 the 0.001alteration of key cellsexpressinganti-tumoral were transientlyHO-1 function and transfectedincontrols PCa [8]. [8],1,542 Here,with we (top the cellsthefoundwe vectorgenesasse were thatssed pcDNA3HO-1assessedtransiently HO-1 whether induction presented transfectedHO-1 or thewastriggered no empty cawithsignificant1.0416%)pable × thethevector of alterationvector modulatingalterati as the pcDNA3HO-10.47 on controlof (0.28– under keythe HO-1 or the induction. empty10−01 vector Interestingly, as the control0.69) while cytoskeletalIn our MX1*genesprevious leading work to showing a more adhesiveacytoskeletal comparativeIn0.031 anour d lessgenesprevious RNA-seq invasive leading work analysis0.578phenotype, to showing a more between adhesivefurthera comparative0.0044 PC3 supporting an cellsd less RNA-seqover- invasive its analysisphenotype, between further PC3 supporting cells over- its 3.3. mRNA Expression Profiles of HO-1 Interactors3.3. mRNA unde Expressionr Genetic InductionProfiles of ofHO-12,093 HO-1− 07(topInteractors 7.71× unde r Genetic Induction of HO-15.39 × 2 (1.16– (pcDNA3),genecytoskeletal Inexpression our there genesprevious of was leadingthe a workselected significant to showing a HO-1more 19%)chan interactorsadhesive a(pcDNA3),MX1ge comparative inIn appearedthe anour (Texpressiond able thereRPA1lessprevious RNA-seqas 2, invasivewas downregulatedasterisks). profile awork significant analysisphenotype, of Resultsshowing MX1 in between10chan PCa(Figureshowed further age comparativecompared in PC32A). thatthesupporting expressionThecellswhen to 0.80) restnormalRNA-seqover- PC3 itsof profile gland analysis1.246 ofand MX1 was between (Figure associated 0.013 PC32A). with Thecells poorer restover- of expressinganti-tumoral HO-1 function and incontrols PCa [8]. [8], Here, we anti-tumoralexpressingfoundwe asse thatssed HO-1HO-1 functionwhether andinduction inHO-1controls PCa wastriggered [8]. [8], caHere, pablewe the foundwe of alteration assemodulating that−04ssed HO-1 whetherof keythe induction HO-1 wastriggered capable−06 the of alteration modulating of keythe cellsexpressinganti-tumoralthe genes were assessed transientlyHO-1 function and presented transfectedincontrols PCa [8].no [8], Here,withsignificant we the expressingRFSthefoundwe vector genesasse(Figure alterati thatssed pcDNA3HO-1assessed HO-1 HO-11on whether and under andinductionTable presented HO-1controlsHO-1 2), or HO-1 the wastriggeredinduction. no [8],empty camodulationsignificant23%) pablewe thevector foundInterestingly, of alteration modulating alterati10 wasasthat the capable HO-1 on controlof while under keythe inductionof inducing HO-1 triggeredinduction. its expression.10 the Interestingly, alteration 3.47)of while key genecytoskeletal Inexpression our genesprevious of leadingthe workselected to showing a HO-1more interactorsadhesiveacytoskeletalgene comparative Inexpression anour (Tdable lessgenesprevious RNA-seq 2,ofinvasive asterisks). leadingthe workselected analysisphenotype, to Resultsshowing a HO-1more793 between (topshowed interactorsadhesivefurthera comparative PC3 thatsupporting an (T cellswhendable less RNA-seqover- 2,PC3invasive itsasterisks). analysisphenotype, Results between showed further PC3 thatsupporting cellswhen1.77 (1.08–over- PC3 its (pcDNA3),genecytoskeletalMX13.3. mRNA expressionappeared Expressionthere genes as of was downregulated leadingthe Profila selected significant esto ofa HO-1more in chan PCa InteractorsinteractorsadhesivecytoskeletalMX1ge compared in appearedthe anunde (Texpressiondable SFSR3tolessgenesr Geneticnormal as 2,invasive downregulated asterisks).leading profile Inductiongland phenotype, to of andResults a MX1 ofmore was HO-1in PCa(Figureshowed associatedadhesivefurther compared 2A). that0.01supporting an with Thewhend toless poorer restnormal N/APC3invasive itsof gland phenotype,… and was… associated further0.024 supporting with poorer its cellsexpressinganti-tumoral were transientlyHO-1 function and transfectedincontrols PCa [8]. [8], Here,with we the anti-tumoralexpressingcellsfoundwe vectorasse were thatssed pcDNA3HO-1 transiently HO-1HO-1 functionwhether andinduction transfectedinHO-1controls PCaor thewastriggered [8]. [8],empty caHere,with11%) pablewe thethevector foundwe of alteration vector assemodulating asthatssed the pcDNA3HO-1 HO-1 controlwhetherof keythe induction HO-1 or thewastriggered empty capable thevector of alteration modulating as the 2.91)controlof key the cellsanti-tumoralRFSthe genes (Figurewere assessedtransiently 1 function and Table presented transfectedin 2),PCa HO-1 [8].no modulationHere,withsignificant the anti-tumoralRFSwe vector asse(Figure alteratiwasssed pcDNA3HO-1capable 1 onfunctionwhether and under Tableof inducing inHO-1HO-1 2), PCaor HO-1 the was induction.[8]. its empty 1,542 camodulationexpression.Here,pable (top vector weInterestingly, of assemodulating wasasssed the capable controlwhether while the of inducing HO-1 was its caexpression.1.04pable × of modulating 0.47 (0.28– the (pcDNA3),genecytoskeletal Inexpression our there genesprevious of was leadingthe a workselected significant to showing a HO-1more chan interactorsadhesiveacytoskeletal(pcDNA3),genege comparative in expressionthe an (Texpressiond ablethere MX1*lessgenes RNA-seq 2,of invasivewas asterisks). leadingthe profile a selected significant analysisphenotype, to of Results a MX1 HO-1more betweenchan (Figureshowed interactorsadhesivefurtherge in PC32A). 0.031thatthesupporting an (T expressionThecellswhendable less restover- 2,PC3invasive itsasterisks).of profile 0.578phenotype, of Results MX1 (Figureshowed further0.0044 2A). thatsupporting Thewhen rest PC3 itsof (pcDNA3),geneMX1 expressionappeared there as of was downregulated the a selected significant HO-1 in chan PCa interactorsgenege compared in expressionthe (Texpressionable to normal 2,of asterisks). the profile gland selected of andResults MX1 HO-1 was19%) (Figureshowed associatedinteractors 2A). that with (T Thewhenable poorerrest 2,PC3 asterisks).of Results10 −showed07 that when0.80) PC3 cellsexpressinganti-tumoralthe genes were assessed transientlyHO-1 function and presented transfectedincontrols PCa [8].no [8], Here,withsignificant we the anti-tumoralcellsthefoundwe vectorgenesasse werealterati thatssed pcDNA3HO-1assessedtransiently HO-1 onfunctionwhether under induction presented transfectedinHO-1HO-1 PCaor the wastriggered induction. [8].no empty caHere,withsignificantpable thethevector weInterestingly, of alteration vector asse modulatingalterati asssed the pcDNA3HO-1 on controlwhetherof while under keythe HO-1HO-1 or the wasinduction. empty capable vector Interestingly, of modulating as the control while the cellsRFSthe genes (Figurewere assessedtransiently 1 and Table presented transfected 2), HO-1 no modulationwithsignificant thecells vector were alteratiwas pcDNA3HO-1capabletransientlyon under of inducing transfectedHO-1 or the induction. its empty expression.with thevector Interestingly, vector as the pcDNA3HO-1 control while or the empty vector as the control (pcDNA3),genecytoskeletalMX1 expressionappeared there genes as of was downregulated leadingthe a selected significant to a HO-1more in chan PCa interactorsadhesive(pcDNA3),geneMX1ge compared in expressionappearedthe an (Texpressiond able theretoless normal as 2,of invasivewas downregulatedasterisks). the profile agland selected significant phenotype, of andResults MX1 HO-1 was in chan PCa(Figureshowed associatedinteractorsfurtherge compared in 2A). thatthesupporting with (T expressionThewhenable to poorer restnormal 2,PC3 itsasterisks).of profile gland of andResults MX1 was (Figureshowed associated 2A). that with Thewhen poorerrest PC3 of (pcDNA3),MX1 appeared there as was downregulated a significant in chan PCa(pcDNA3),ge3.3. compared in mRNA the expression Expression thereto normal was profile Profilagland significantes ofand of MX1 HO-1 was chan (Figure associatedInteractorsge in 2A). the undewith expressionTher poorerrestGenetic of profile Induction of MX1of HO-1 (Figure 2A). The rest of cellsanti-tumoralRFSthe genes (Figurewere assessedtransiently 1 function and Table presented transfectedin 2),PCa HO-1 [8].no modulationHere,withsignificant the cellsRFSthewe vector genesasse (Figure were alteratiwasssed pcDNA3HO-1assessedcapabletransiently 1on whether and under Tableof presented inducing transfectedHO-1HO-1 2), or HO-1 the wasinduction. noits empty camodulationexpression.withsignificantpable thevector Interestingly, of vector modulating alterati wasas the pcDNA3HO-1capable oncontrol while under the of inducing HO-1 or the induction. its empty expression. vector Interestingly, as the control while RFSthe genes(Figure assessed 1 and Table presented 2), HO-1 no modulationsignificantthe genes alteratiwas assessedcapableon under of presented inducing HO-1 induction. noits expression.significant Interestingly, alteration while under HO-1 induction. Interestingly, while (pcDNA3),geneMX1 expressionappeared there as of was downregulated the a selected significant HO-1 in chan PCa interactors(pcDNA3),MX1ge compared inIn appearedthe our (Texpression able theretoprevious normal as 2, was downregulatedasterisks). profile aglandwork significant of andResultsshowing MX1 was in chan PCa(Figureshowed associated age comparativecompared in 2A). thatthe with expressionThewhen to poorer restnormalRNA-seq PC3 of profile gland analysis ofand MX1 was between (Figure associated PC32A). with Thecells poorer restover- of MX1 appeared as downregulated in PCaMX1 compared appeared to normal as downregulated gland and was in PCa associated compared with to poorer normal gland and was associated with poorer cellsRFSthe genes (Figurewere assessedtransiently 1 and Table presented transfected 2), HO-1 no modulationwithsignificant theexpressingRFSthe vector genes(Figure alteratiwas pcDNA3HO-1assessedcapable HO-1 1on and under and Tableof presented inducing controlsHO-1 2), or HO-1 the induction. no its [8],empty modulationexpression.significant we vector foundInterestingly, alterati wasasthat the capable HO-1 oncontrol while under inductionof inducing HO-1 triggeredinduction. its expression. the Interestingly, alteration of while key RFS (Figure 1 and Table 2), HO-1 modulationRFS (Figure was capable 1 and Tableof inducing 2), HO-1 its modulationexpression. was capable of inducing its expression. (pcDNA3),MX1 appeared there as was downregulated a significant in chan PCacytoskeletalMX1ge compared in appearedthe expression togenes normal as downregulated leading profile gland to ofand a MX1 more was in PCa(Figure associatedadhesive compared 2A). an with Thed toless poorer restnormal invasive of gland phenotype, and was associatedfurther supporting with poorer its RFSthe genes(Figure assessed 1 and Table presented 2), HO-1 no modulationsignificantanti-tumoralRFS (Figure alteratiwas capable 1 onfunction and under Tableof inducing inHO-1 2),PCa HO-1 induction.[8]. its modulationexpression.Here, weInterestingly, asse wasssed capable whether while of inducing HO-1 was its caexpression.pable of modulating the MX1 appeared as downregulated in PCagene compared expression to normal of the gland selected and HO-1 was associatedinteractors with (Table poorer 2, asterisks). Results showed that when PC3 RFS (Figure 1 and Table 2), HO-1 modulationcells were was capabletransiently of inducing transfected its expression.with the vector pcDNA3HO-1 or the empty vector as the control (pcDNA3), there was a significant change in the expression profile of MX1 (Figure 2A). The rest of the genes assessed presented no significant alteration under HO-1 induction. Interestingly, while MX1 appeared as downregulated in PCa compared to normal gland and was associated with poorer RFS (Figure 1 and Table 2), HO-1 modulation was capable of inducing its expression. Biomolecules 2020, 10, 1005 10 of 23 in PCa compared to normal gland and was associated with poorer RFS (Figure1 and Table2), HO-1 modulationBiomolecules was2020, capable10, x FOR PEER of inducing REVIEW its expression. 11 of 24

FigureFigure 2. E2.ﬀ ectEffect of HO-1 of HO-1 modulation modulation on the on expression the expression and localization and localization of MX1. of (A )MX1. RNA-seq (A) RNA-seq expression expression for the selected genes in Table 2 under HO-1 induction. PC3 cells were transiently transfected with the pcDNA3HO-1 expression plasmid or empty vector. Forty-eight hours later, RNA was extracted, purified, and sequenced. (B) MX1 assessed by real-time PCR (RT-qPCR) in PC3 cells treated with hemin (80 µM, 24 h) or PBS or transfected with the expression plasmids Biomolecules 2020, 10, 1005 11 of 23

for the selected genes in Table2 under HO-1 induction. PC3 cells were transiently transfected with the pcDNA3HO-1 expression plasmid or empty vector. Forty-eight hours later, RNA was extracted, purified, and sequenced. (B) MX1 assessed by real-time PCR (RT-qPCR) in PC3 cells treated with hemin (80 µM, 24 h) or PBS or transfected with the expression plasmids pcDNA3/pcDNA3HO-1 and FLAG/FLAGHO-1. The values were relativized using PPIA as a reference gene and normalized to the controls. (C) Immunofluorescence (IF) staining and confocal microscopy analysis (magnification: 60 ) × for HO-1 (green) and MX1 (red) on PC3 cells transfected with the expression plasmids pcDNA3 or pcDNA3HO-1. (D) Semi-quantitative analyses of the IF for MX1 by segmentation of the whole cell and nucleus (DAPI). The fluorescence intensity for MX1 and HO-1 was determined using ImageJ software and normalized to cell size (n 20 cells for each condition), and the ratios of nuclear label/total label ≥ and total fluorescence/cell were calculated. (E) MX1 staining in the membrane, cytoplasm, and nucleus. (F) Co-localization analysis of MX1 and HO-1 expressed as the Manders correlation coefficient. Error bars correspond to the standard deviation. (G) HMOX1 and MX1 Pearson correlation analysis in normal prostate (Genotype-Tissue Expression (GTEx) database, n = 100), normal adjacent to tumor, or prostate cancer tissues (TCGA-PRAD, n = 52 and n = 497, respectively). One representative of at least three independent experiments is shown. Results are shown as the mean S.D. Statistical significance: ± ** p < 0.01; *** p < 0.001. Thus, we decided to focus our attention on the MX1 gene. First, we validated the RNA-seq analysis by real-time PCR (RT-qPCR). PC3 cells treated with hemin, a potent inducer of HO-1, showed a significant increase of MX1 expression (fold induction: 4.88, p < 0.01). Further, genetic induction of HO-1 in PC3 cells, using two different expression vectors (pcDNA3HO-1 and FLAGHO-1), also caused a significant increase in MX1 mRNA levels compared with cells transfected with empty vectors (fold induction: 1.33, p < 0.01 and 3.91, p < 0.001, respectively) (Figure2B).

3.4. Effect of HO-1 Modulation on the Expression and Localization of MX1 Subsequently, in order to assess whether the increase in MX1 was also reflected at the protein level and whether it showed changes in its subcellular localization, we performed an immunofluorescence analysis by confocal microscopy, using specific anti-MX1 and anti-HO-1 antibodies (Figure2C). Results showed that induction of HO-1 in prostate tumor cells caused a significant increase in MX1 protein levels, observed by an enhancement in the total nuclei fluorescence and in the total cell fluorescence compared with cells transfected with empty vector (Figure2C–E). Furthermore, we were able to determine by the Manders coefficient that there was a greater co-localization of HO-1 and MX1 when cells over-expressed HO-1 (pcDNA3HO-1) compared with controls (Figure2F, p < 0.001). Altogether, HO-1 over-expression in PC3 cells triggered an increase in MX1 mRNA and protein levels and altered its subcellular localization, reflecting a clear association between both proteins.

3.5. Correlation of Expression between MX1 and HMOX1 Genes in Normal Prostate and Prostate Cancer Samples We next assessed whether there was any correlation between MX1 and HMOX1 in tissues from healthy donors and PCa patients. Using the TCGA-PRAD database, we observed a positive correlation in the expression proﬁles of MX1 and HMOX1, both in normal adjacent to tumor (Pearson = 0.3718; p = 0.0066) and in tumor tissue samples (Pearson = 0.4681; p < 0.0001) (Figure2G). The MX1 and HMOX1 correlation was not detected in normal tissue. This evidenced a potential association between both genes in PCa.

3.6. Exome and RNA-Seq Correlation Analyses of MX1 and HMOX1 in Prostate Cancer We extended the bioinformatics analysis, using cBioPortal for Cancer Genomics (https://www. cbioportal.org). Eleven datasets were selected that met our eligibility criteria (Figure3A). We assessed whole exome and RNA-seq data to evaluate MX1 and HMOX1. This analysis performed on PCa patient samples (n = 3211), showed that the most frequent gene alteration of MX1 was deletion (Figure3B, left Biomolecules 2020, 10, 1005 12 of 23 panel). It should be noted that for the TCGA-PRAD dataset, such an alteration reached a frequency of 13.21% (Figure3B, left panel). Next, we analyzed whether there was a correlation between MX1 gene alterations and its expression profile. Results showed that for the TCGA-PRAD dataset, those samples withBiomolecules a complete 2020, 10MX1, x FORdeletion PEER REVIEW presented lower mRNA expression, compared with the13unaltered of 24 samples (diploid) (Figure3B, right panel). The same analysis was carried out for HMOX1, and the expression, compared with the unaltered samples (diploid) (Figure 3B, right panel). The same results showed that the most common alterations were amplification and deep deletion (Figure3C, analysis was carried out for HMOX1, and the results showed that the most common alterations were left panel). However, the frequency of alterations in PCa patients was substantially lower (0.6%) amplification and deep deletion (Figure 3C, left panel). However, the frequency of alterations in PCa comparedpatients with was MX1substantially(14%) (Figurelower (0.6%)3B,C). compared Additionally, with MX1 while (14%) most (Figure of the 3B,C). samples Additionally, presented while the two copiesmost of ofHMOX1 the samples, only presented a smaller the proportion two copies of of HMOX1 the samples, only a showed smaller propor superficialtion of deletion the samples (shallow deletion)showed without superficial it being deletion associated (shallow with deletion) a lower without level of it mRNAbeing associated expression with (Figure a lower3C, level right of panel). In summary,mRNA expression in silico analysis(Figure 3C, showed right panel). that PCa In summar patientsy, with in silicoMX1 analysisdeletion showed correlated that PCa with patients lower MX1 mRNAwith levels. MX1 deletion correlated with lower MX1 mRNA levels.

Figure 3. MX1 and HMOX1 exome and RNA-seq analysis in PCa patients. (A) Selected studies from Figure 3. MX1 and HMOX1 exome and RNA-seq analysis in PCa patients. (A) Selected studies from cBioPortal for the genetic alterations’ analysis in MX1 and HMOX1 in PCa patients. The table shows the number of samples and the number of patients with alterations in target genes. (B) and (C) (left Biomolecules 2020, 10, 1005 13 of 23

cBioPortal for the genetic alterations’ analysis in MX1 and HMOX1 in PCa patients. The table shows the number of samples and the number of patients with alterations in target genes. (B,C) (left panels): Percentage of cases with alterations and the type of alteration observed: Point mutations (green), amplifications (red), fusion (purple), or complete deletions (blue) for MX1 (B) and HMOX1 (C), through 11 selected dataset (x-axis). Right panels: correlation between gene expression and copy number alterations for MX1 (B) and HMOX1 (C) in TCGA-PRAD (n = 333). Statistical significance: ** p < 0.01; *** p < 0.001. N/A = not available. 3.7. MX1 and Endoplasmic Reticulum Stress in Prostate Cancer Taking into account the results observed so far, the next step was to explore in PCa the possible functional role of MX1, the main IFN-inducible gene, and its association with ERS and with ERS-mediated apoptosis. To address this goal, we generated ERS conditions in the tumor cells using a specific ERS inducer, thapsigargin. This drug inhibits the proper functioning of the sarco-/endo-plasmic reticulum Ca++-ATPase. This inhibition generates an imbalance in the Ca2+ ion homeostasis, which triggers ERS signaling [25]. In this work, we studied the expression of X-box binding protein 1 (XBP1), which participates downstream of the IRE1 activator; DNA damage inducible transcript 3 (DDIT3), a gene coding for the protein inducible by DNA damage and growth arrest (CHOP); and heat shock protein family A (Hsp70) member 5 (HSPA5), a gene encoding for BiP. This chaperone is the main activator of the ERS pathway [26]; therefore, an increase in HSPA5 levels is considered a strong ERS marker [10]. PC3 cells treated with thapsigargin showed a significant increase in HSPA5 mRNA expression compared with the control (fold induction: 4.71, p < 0.001 and 9.41, p < 0.001, for 0.1 µM and 0.25 µM, respectively) (Figure4A). Similarly, we could see a significant increase in mRNA levels of the UPR intermediate genes, DDIT3 (fold induction: 8.21, p < 0.001 and 8.46, p < 0.001, 0.1 µM and 0.25 µM, respectively) and XBP1 (fold induction: 5.17, p < 0.001 and 8.13, p < 0.001, 0.1 µM or 0.25 µM, respectively) (Figure4A). These results demonstrated that ERS was triggered in PC3 cells in a thapsigargin concentration-dependent manner. We also assessed MX1 expression under ERS induction. Results showed increased MX1 mRNA levels compared with controls under thapsigargin treatment (fold induction: six, p < 0.01 and 7.4, p < 0.01, 0.1 µM or 0.25 µM, respectively) (Figure4A). In summary, we reported MX1 induction under ERS conditions, something not previously described in PCa. We also confirmed MX1 induction under IFNγ treatment (fold induction: 16.79, p < 0.001) (Supplementary Figure S2A). Since thapsigargin not only triggered an increase in ERS, but also generated an induction of MX1 expression in PC3 cells, this led us to hypothesize if those conditions that raised MX1 levels, such as hemin or IFNγ, were capable of inducing the expression of ERS genes. The results showed that IFNγ treatment caused a significant increase in DDIT3, XBP1, and HSPA5 expression (Supplementary Figure S2B). On the other hand, when treating PC3 cells with hemin, a significant decrease in DDIT3 and HSPA5 expression was observed compared with controls. No change in XBP1 expression was observed (Supplementary Figure S2C). These results indicated that hemin reduced the basal levels of ERS, contributing to reverse the state of cellular ERS. Further, we knocked down MX1 using MX1 small interfering RNA (siMX1). As expected, thapsigargin-induced levels of MX1 were significantly decreased by siMX1 (75%, p < 0.001) (Figure4B). Moreover, a significant decrease by siMX1 was also observed for HSPA5 (19.64%, p < 0.01), DDIT3 (26.93%, p < 0.05), and XBP1 (24.19%, p < 0.01), relativized to the transfection control (thapsigargin + scrambled) (Figure4B). In summary, these results showed that MX1 could regulate these genes under ERS conditions. BiomoleculesBiomolecules2020 2020,,10 10,, 1005x FOR PEER REVIEW 15 of14 24 of 23

Figure 4. Implications of MX1 and endoplasmic reticulum stress (ERS)-associated genes in PCa. Figure 4. Implications of MX1 and endoplasmic reticulum stress (ERS)-associated genes in PCa. (A) (A) HSPA5, DDIT3, XBP1, and MX1 expression assessed by RT-qPCR in PC3 cells treated with HSPA5, DDIT3, XBP1, and MX1 expression assessed by RT-qPCR in PC3 cells treated with thapsigargin (0.1 and 0.25 µM; 24 h) or PBS as the control. Values were relativized using PPIA as a thapsigargin (0.1 and 0.25 µM; 24 h) or PBS as the control. Values were relativized using PPIA as a reference gene and normalized to the control. (B) MX1, HSPA5, DDIT3, and XBP1 expression levels assessed by RT-qPCR in PC3 cells transfected with a MX1-targeted siRNA or a scrambled siRNA for 72 h and treated with 0.25 µM thapsigargin during the last 24 h of silencing. Values were relativized to Biomolecules 2020, 10, 1005 15 of 23

PPIA as a reference gene and normalized to the control. (C) Flow cytometry graphs showing cell viability and apoptosis populations in PC3 cells treated with thapsigargin (0.1 and 0.25 µM; 24 h) or PBS as the control. Cells were treated with FITC-labeled Annexin V and PI staining. X axis: FITC channel; Y axis: PI channel. (D) LC3 I and LC3 II protein levels assessed by Western blot in PC3 cells treated with thapsigargin (0.1 and 0.25 µM; 24 h) or PBS as the control. Protein bands were quantified using ImageJ 1.52a software (NIH), normalized to GAPDH as a reference protein, and relativized to the control (right panel). One representative of at least three independent experiments is shown. Results are shown as the mean S.D. Statistical significance: * p < 0.05; ** p < 0.01, *** p < 0.001. ± 3.8. Effect of Thapsigargin-Induced Endoplasmic Reticulum Stress in Apoptosis and Autophagy in Prostate Cancer We then evaluated whether ERS induction affected cellular processes such as apoptosis and autophagy. For this purpose, we performed flow cytometry analysis (Annexin V-FITC/IP) on PC3 cells, exposed to thapsigargin. The results clearly showed that this compound was able to trigger a significant increase in apoptosis compared with the control (Figure4C). As observed earlier, cells grown in the presence of thapsigargin showed high levels of ERS and MX1 induction. Faced with a stimulus that triggers ERS, cells seek to reestablish homeostasis through the UPR signaling pathway. Autophagy is considered one of the highly characterized effectors of the UPR pathways. For this reason, we also analyzed the implication of this cellular process under ERS conditions in PCa. We assessed LC3 lipidation, indicated by the conversion of LC3-I into LC3-II. The results showed that endogenous levels of LC3-II accumulated upon thapsigargin treatment compared with controls (Figure4D). These results supported the ideas that propose autophagy as an effector pathway of UPR once ERS is triggered in the cell.

3.9. Analysis of HMOX1, MX1, and Endoplasmic Reticulum Stress Genes as Risk Predictors of Clinical Outcome in Prostate Cancer We next analyzed whether the alteration in HMOX1, MX1, and ERS genes’ expression could influence PCa patients’ RFS. Kaplan-Meier curves for the Ross–Adams dataset (GSE70770, n = 206) showed that higher expression levels for both MX1 and HMOX1 were associated with a better RFS in PCa patients (HR = 0.47, p = 0.0044 for MX1 and HR = 0.50, p = 0.021 for HMOX1) (Figure5A). Next, we assessed the association between the expression profiles of HMOX1 and MX1 in the same dataset. In accordance with the TCGA-PRAD dataset (Figure2G), we observed a positive correlation between HMOX1 and MX1 expression (Pearson = 0.4865, p < 0.0001) (Figure5B). Next, we categorized PCa patients based on MX1 expression and performed KM curves to evaluate the effect of HMOX1 in RFS of these patient subgroups (low or high MX1 expression). Interestingly, while it was observed that patients with low MX1 had a higher risk of biochemical relapse (Figure5A), this risk decreased significantly in those patients who exhibited higher levels of HMOX1 (HR = 0.13; p = 0.048) (Figure5C, left panel). In contrast, the expression profile of HMOX1 did not seem to influence the risk of biochemical relapse in those patients with high levels of MX1 (HR = 0.6; p = 0.253) (Figure5C, right panel). We then expanded the analysis for HSPA5 and DDIT3 and found similar results to those observed for MX1 and HMOX1. Patients with higher expression for ERS genes showed a significantly lower risk of relapse than patients with lower expression for these genes (Figure5D; HR = 0.23, p < 0.0001 for HSPA5 and HR = 0.49, p = 0.008 for DDIT3). We also evaluated the effect of co-occurrent high expression for all genes. It is interesting to note that patients with high expression of two or more factors (MX1, HMOX1, HSPA5, or DDIT3) had a lower risk of biochemical relapse than patients with one or none of the highly expressed genes (HR = 0.36; p < 0.001) (Figure5E). These results suggested that higher levels of MX1, HMOX1, DDIT3, and HSPA5 resulted in a better prognosis for PCa patients that have undergone radical prostatectomy. Biomolecules 2020, 10, 1005 16 of 23 Biomolecules 2020, 10, x FOR PEER REVIEW 17 of 24

FigureFigure 5. 5.RFS RFS and and correlation correlation analysisanalysis for MX1MX1, ,HMOX1HMOX1, and, and ERS ERS related related genes genes in PCa in PCa patients patients (Ross– (Ross–Adams,Adams, GSE70770). GSE70770). (A) Kaplan–Meier (A) Kaplan–Meier (KM) (KM)curves curves for RFS for in RFS months in months for PCa for patients PCa patients with low with (blue) lowor (blue) high (red) or high MX1 (red) (leftMX1 panel)(left or panel) HMOX1 or HMOX1 (right panel)(right expressions. panel) expressions. (B) Gene ( Bexpression) Gene expression correlation correlationanalysis analysisbetween between HMOX1HMOX1 and MX1and, expressedMX1, expressed as Pearson’s as Pearson’s coefficient. coeﬃ cient.(C) KM (C curves) KM curves for RFS for for PCa patients with high (red) or low (blue) expression of HMOX1 segregated based on low (left panel) or high (right panel) MX1 levels. (D) KM curves for RFS for PCa patients with high (red) or low (blue) Biomolecules 2020, 10, 1005 17 of 23

RFS for PCa patients with high (red) or low (blue) expression of HMOX1 segregated based on low (left panel) or high (right panel) MX1 levels. (D) KM curves for RFS for PCa patients with high (red) or low (blue) expression of HSPA5 (left panel) or DDIT3 (right panel). (E) KM curve for the co-occurrent expression of MX1, HMOX1, HSPA5, or DDIT3 in patients with two or more (red) or one/none (blue) highly expressed genes. All comparisons considered low expression patients as the reference group. HR: hazards ratio. Statistical significance: p < 0.05. 4. Discussion The induction of HO-1 represents an essential event in cellular responses to pro-oxidative and pro-inflammatory insults maintaining cellular homeostasis [1]. Thus, HO-1 has been proposed to act as a biosensor regulating cell destination [27]. Our previous reports have documented the nuclear expression of HO-1 in human primary prostate carcinomas naive of treatment [28]. We also showed that HO-1 is further implicated in PCa, demonstrating that endogenous HO-1 inhibits bone-derived prostate cancer cell migration, invasion, and proliferation [4] and negatively modulates the expression of pro-inflammatory and pro-angiogenic genes. Further, using a fully immunocompetent murine model, our reports revealed how stromal conditioning with hemin impaired PCa development by targeting both the tumor vasculature and the cytotoxic T-cell immune response [29]. These data, together with the reported bibliography, clearly suggest that HO-1 fulfills a key molecular and cellular function, beyond its enzymatic function. It seems as if HO-1 could suppress the sustained inflammation in PCa, halting tumor progression [4,5]. However, it is logical to think that this anti-tumoral action directed by HO-1 is associated with other factors capable of interacting with HO-1 to carry out these functions. Hence, we sought to analyze the HO-1 interactome in PCa to unravel some of the molecular mechanisms underlying its anti-tumoral role and the acquisition of a less aggressive phenotype in PCa. In our previous work, we optimized the purifying technique to isolate HO-1 interacting proteins in PCa cells and build the HO-1 interactome. This provided a framework for identifying novel partners that could reprogram PCa cells, favoring the less aggressive tumor phenotype observed under HO-1 forced expression [4,5,8,30]. Although we studied prostate tumor tissues at the transcriptomic level, proteins involved in tumor evolution have been less explored in PCa. Different groups of genes, proteins, and metabolites are responsible for the progression from a precursor lesion to a localized disease and finally leading to a metastatic stage. To understand the clinical-pathological importance of proteins associated with HO-1, we carried out an in-depth bioinformatics analysis (Oncomine, n = 1045) using public datasets that allowed us to assess their clinical relevance in the disease. HO-1 interactor proteins were analyzed, and an expression profile was elaborated for each one of them. We clustered interactors according to their mRNA expression profiles in three groups, highlighting those genes that were over- or under-expressed in approximately >60% (Cluster A) or 50% (Cluster B) of all datasets in prostate adenocarcinoma vs. normal prostate gland and lied within 35% of the most consistently high or low expressed genes across this comparison. In parallel, we studied the expression of HO-1 interactors in TCGA-PRAD, which has information on gene expression in 497 primary PCa tumor samples compared with normal adjacent to tumor tissue. Although the comparisons made in TCGA-PRAD and Oncomine were not exactly on the same tissues, a similarity could be observed between the expression profiles obtained in both analyses for most of the genes studied. Likewise, we evaluated the protein expression of these genes using The Human Protein Atlas database, in tumor and normal tissue samples. The protein profiles observed in this platform for most of the HO-1 interactors correlated with those already observed at the mRNA level in the datasets analyzed in Oncomine and TCGA-PRAD, thus evidencing that the expression profile of HO-1 interactors in PCa is dysregulated at the transcriptomic and protein levels. Our next aim was to evaluate the risk of relapse associated with the expression of the genes of interest in PCa patients who had undergone radical prostatectomy. Results showed that upregulation Biomolecules 2020, 10, 1005 18 of 23 of RCC1 and PDCD5 and downregulation of ASPH, HSPB1, SQSTM1, ANXA2, GSN, PURA, and MX1, comparing PCa vs. normal prostate or normal adjacent to tumor tissue, correlated with a decrease in relapse-free survival of PCa patients, revealing the clinical importance of the HO-1 interactors classified into Groups A or B. In order to assess whether HO-1 was capable of modulating its interactors at the transcriptional level, we evaluated the transcriptomic profile of PC3 cells under genetic induction of HO-1 by RNA-seq. We paid special attention to MX1, since HO-1 modulation was capable of inducing MX1 expression. Altogether, the evidence obtained from the different analyses performed led us to focus on MX1, since: (1) it showed a significant over-expression under HO-1 induction; (2) it was under-expressed in PCa vs. normal prostate; and (3) its low expression was associated with a significant decrease in RFS for PCa patients. Further, there was a significant positive correlation between MX1 and HMOX1 expression in PCa patients. Little is known about MX1 and its association with tumorigenesis. Mushinski et al. [31] explored the molecular mechanisms of PCa metastasis using PC3 and PC3M (derived from a liver metastasis from a nude mouse bearing a splenic explant of PC3) cell lines. Results showed that MX1 was expressed in PC3 and not in PC3M. Further, it was demonstrated that MX1 transcription was inducible by type I, II, and III IFNs [32–34]. Both, type I and II IFNs have been used in the treatment of various types of cancer, including melanoma, follicular lymphoma, hairy cell leukemia, chronic myeloid leukemia, Kaposi’s sarcoma, and renal cell carcinoma, but the mechanisms of their anti-tumoral activity have not been fully deciphered [35]. Direct anti-proliferative effects on the tumor and indirect immunomodulatory effects on the host have been reported for type I and II IFNs. Shou et al. [36], Nagano et al. [33], and Schulz et al. [37] demonstrated that a significant proportion of genes whose downregulation is associated with PCa tumorigenesis were IFN-inducible genes, including MX1. However, MX1 has been mostly studied for its antiviral properties [14–16]. To test the hypothesis that MX1 played a role in reducing the motility and metastasis of PCa and other cancers, Mushinski et al. [31] over-expressed MX1 in PC3M and LOX melanoma cells. MX1 over-expression induced a clear reduction in motility and invasiveness in both cell lines compared with controls. Similarly, in vivo assays in SCID mice showed a significant reduction of liver metastases after intra-splenic injection of PC3M cells expressing MX1 [31]. As shown in this study, genetic or pharmacological induction of HO-1 was able to induce MX1 expression. Moreover, immunofluorescence assays revealed a significant increase in MX1 intensity under HO-1 induction. Interestingly, increased co-localization of HO-1 and MX1 was observed when cells over-expressed HO-1 compared with controls. Taking these results into account, we evaluated whether there was any correlation between these two genes in PCa patient tissues. The results evidenced a significant positive correlation between MX1 and HMOX1 expression profiles, both in human tumor and normal adjacent to tumor tissue samples. No correlation was observed in normal tissue samples, which highlights a potential association between both factors in prostate tumor tissues. In 2008, Tomlins et al. first reported that approximately 50% of PCa cohorts had a fusion between TMPRSS2 and ERG on chromosome 21 [38], which correlated with an invasive phenotype and was frequently associated with interstitial DNA deletions spanning the MX1 locus [39]. These deletions are associated with an increase in PCa aggressiveness. In this work, we also analyzed whether there were genetic alterations in MX1 associated with PCa and whether these alterations were related to the decreased expression profile seen in the disease. The cBioPortal platform, which included studies of RNA-seq and copy-number alterations for PCa patient samples (n = 3211), showed that deletion was the most frequent genetic alteration in MX1. Subsequently, we analyzed whether there was a correlation between MX1 copy number alterations and its expression profile. Results evidenced that samples with a complete deletion for MX1 displayed decreased mRNA expression. The same analysis was carried out for HMOX1, in which deletions were rarely observed throughout the samples, without it being associated with decreased HMOX1 mRNA levels. Biomolecules 2020, 10, 1005 19 of 23

As mentioned before, MX1 plays an important role in anti-viral activity [14–16]. Previous literature reported the association between viral infection and regulation of ERS [40]. Numajiri et al. demonstrated that MX1 potentiates ERS signaling and ERS-induced cell death after Swiss 3T3 cells (cell line derived from mouse embryo fibroblasts) were infected with the Influenza virus [41]. Furthermore, MX1 induction increased HSPA5 (BiP) and DDIT3 (CHOP) mRNA levels and XBP1 alternative splicing, leading to the expression of genes involved in endoplasmic reticulum degradation and cell death [41]. Therefore, MX1 may function as an accelerator of ERS-mediated apoptosis. Hence, we set out to analyze the role of MX1 in ERS, UPR pathways, and ERS-associated apoptosis in PCa. UPR activation is considered the criterion that defines ERS [10]. This mechanism aims to safeguard cell survival against injury or initiate cell apoptosis in cases of excessive stress. To address this goal, we generated ERS using thapsigargin, which was confirmed by a significant induction of HSPA5, DDIT3, and XBP1. MX1 was also significantly induced under ERS, and strikingly, MX1 silencing was able to decrease thapsigargin-induced ERS significantly, mainly evidenced by HSPA5 downregulation. Further, we evaluated the effect of ERS on apoptosis and autophagy. Results showed that, under ERS stimulus, apoptosis and autophagy significantly increased in PC3 cells. Considering that HMOX1 was able to modulate MX1, we proposed to study whether the alteration of MX1, HMOX1, and ERS genes’ expression could alter the biochemical RFS of PCa patients. Results showed that an increase in MX1, HMOX1, DDIT3, and HSPA5 expression reduced the risk of biochemical relapse in PCa patients who had undergone radical prostatectomy. Additionally, patients with a higher risk of relapse due to low MX1 expression, had a better prognosis with higher HMOX1 levels. This work is the first to associate HMOX1, MX1, and ERS in PCa. The toxicity caused by the accumulation of misfolded proteins can be so severe for the cell that UPR has evolved as the main mechanism to deal with this threat, and depending on the intensity and duration of stress, UPR can tip the balance towards cell survival or death [10]. When cells experience a mild to moderate stress signal with a short duration, UPR activates the pro-survival module that seeks to neutralize the initial stress so that cells can adapt to it. Conversely, if the stress signal is intense and/or lasts over time, the UPR activates the pro-death module, which aims to lead the cell to apoptosis [26]. The pro-survival module is well represented by BiP [10], which is encoded by HSPA5. The pro-death module is represented by CHOP, encoded by DDIT3 (Figure6A). In the absence of stress, the BiP chaperone is associated with transmembrane sensors: Endoplasmic reticulum pancreatic kinase (PERK), enzyme 1 with inositol requirement (IRE1), and factor 6 transcription activator (ATF6). The UPR mechanism starts when the BiP chaperone is sequestered by the misfolded proteins that begin to accumulate in the reticular lumen [26]. This event causes the release of the transmembrane sensors IRE1, ATF6, and PERK from the ER, triggering the activation of UPR, ultimately determining cell fate (Figure6A). Reports have evidenced that: (1) MX1 improves ERS signaling via CHOP induction and promotes ERS-mediated apoptosis [41]; (2) the C-terminal region of MX1 is critical for interaction with BiP [42]; and (3) our results showed that MX1 silencing directly decreases DDIT3 expression; therefore, we may suggest that MX1 over-expression causes BiP sequestering, enhancing PERK-mediated pathway activation, leading to cell death (Figure6B). Further, HO-1 may favor this ERS axis, enhancing MX1 levels, tilting the balance to pro-death events in PCa. Biomolecules 2020, 10, x FOR PEER REVIEW 21 of 24

Reports have evidenced that: (1) MX1 improves ERS signaling via CHOP induction and promotes ERS-mediated apoptosis [41]; (2) the C-terminal region of MX1 is critical for interaction with BiP [42]; and (3) our results showed that MX1 silencing directly decreases DDIT3 expression; therefore, we may suggest that MX1 over-expression causes BiP sequestering, enhancing PERK- Biomoleculesmediated2020 pathway, 10, 1005 activation, leading to cell death (Figure 6B). Further, HO-1 may favor this ERS20 of 23 axis, enhancing MX1 levels, tilting the balance to pro-death events in PCa.

FigureFigure 6.6. SchematicSchematic representation representation of the of theproposed proposed model model for MX1’s for MX1’s role in roleERS-mediated in ERS-mediated cell fate. cell fate.(A) When (A) When misfolded misfolded proteins proteins begin to begin accumulate to accumulate within the within ER lumen, the ER the lumen, BiP chaperone the BiP chaperonebreaks breaksfree from free PERK, from PERK,IRE1, and IRE1, ATF6 and to ATF6bind to to misf bindolded to misfolded proteins, activating proteins, activatingthe unfolded the protein unfolded proteinresponse response (UPR). The (UPR). intensity The intensity and duration andduration of ERS are of decisive ERS are factors decisive that factors define that the deﬁnecellular the fate cellular to fatesurvival to survival or death or [10]. death (B) [MX110]. may (B) MX1sequester may BiP, sequester enhancing BiP, PERK-mediated enhancing PERK-mediated pathway activation, pathway activation,leading to leadingcell death. to cellFurther, death. HO-1 Further, may favor HO-1 this may ERS favor axis, this enhancing ERS axis, MX1 enhancing levels. ERAD MX1 levels.= ERADEndoplasmic-reticulum-associ= Endoplasmic-reticulum-associatedated protein degradation. protein degradation.

5.5. Conclusions Conclusions TheThe resultsresults ofof thisthis study evidenced that that MX1 MX1 could could drive drive the the ERS ERS balance balance towards towards pro-death pro-death eventsevents inin malignantmalignant prostatic pathology, pathology, making making it ita apromising promising target target for for the the development development of new of new therapiestherapies for for PCa. PCa. Therefore, Therefore, generating generating drugs drugs that that could could induce induce MX1 mightMX1 might be a promising be a promising therapeutic tooltherapeutic to provide tool more to provide speciﬁc more antitumor specific activity antitumor and activity less toxicity and less than toxicity other than treatments. other treatments. In this sense, HO-1In this induction sense, HO-1 by hemin, induction an FDA-approvedby hemin, an FD drug,A-approved could be drug, an alternative could be an route alternative to boost route MX1. to boost MX1. Supplementary Materials: The following are available online at http://www.mdpi.com/2218-273X/10/7/1005/s1, Figure S1: Analysis of HO-1 interactors as risk predictors of clinical outcome, Figure S2: Modulation of MX1 and ERS genes expression by IFNγ and hemin. Author Contributions: Conceptualization, E.O., E.V., and G.G.; methodology, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; formal analysis, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; investigation, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; resources, E.L., J.C., N.N., E.V., and G.G.; data curation, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; writing, original draft preparation, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; writing, review and editing, E.O., P.S., J.B., S.L.-V., E.L., N.N., J.C., E.V., and G.G.; visualization, E.O., P.S., J.B., S.L.-V., J.C., E.V., and G.G.; supervision, J.C., Biomolecules 2020, 10, 1005 21 of 23

E.V., and G.G.; project administration, G.G.; funding acquisition, J.C., E.V., and G.G. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by grants from AGENCIA-PICT 2016-1366 (ARGENTINA), AGENCIA-PICT 2016-0056 (ARGENTINA), UBACyT 2018-20020170100585BA (Argentina), and AGENCIA-PICT-RAICES-2018-02639 (Argentina). Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; nor in the decision to publish the results.

References

1. Dulak, J.; Jozkowicz, A. Novel Faces of Heme Oxygenase-1: Mechanisms and Therapeutic Potentials. Antioxidants Redox Signal. 2014, 20, 1673–1676. [CrossRef] 2. Chau, L.-Y. Heme oxygenase-1: Emerging target of cancer therapy. J. Biomed. Sci. 2015, 22, 22. [CrossRef] [PubMed] 3. Nitti, M.; Piras, S.; Marinari, U.M.; Moretta, L.; Pronzato, M.A.; Furfaro, A.L. HO-1 Induction in Cancer Progression: A Matter of Cell Adaptation. Antioxidants 2017, 6, 29. [CrossRef][PubMed] 4. Gueron, G.; De Siervi, A.; Ferrando, M.; Salierno, M.; De Luca, P.; Elguero, B.; Meiss, R.; Navone, N.; Vazquez, E. Critical Role of Endogenous Heme Oxygenase 1 as a Tuner of the Invasive Potential of Prostate Cancer Cells. Mol. Cancer Res. 2009, 7, 1745–1755. [CrossRef] 5. Ferrando, M.; Gueron, G.; Elguero, B.; Giudice, J.; Salles, A.; Leskow, F.C.; Jares-Erijman, E.A.; Colombo, L.; Meiss, R.; Navone, N.; et al. Heme oxygenase 1 (HO-1) challenges the angiogenic switch in prostate cancer. Angiogenesis 2011, 14, 467–479. [CrossRef][PubMed] 6. Gueron, G.; Giudice, J.; Valacco, P.; Paez, A.; Elguero, B.; Toscani, M.; Jaworski, F.; Leskow, F.C.; Cotignola, J.; Martí, M.A.; et al. Heme-oxygenase-1 implications in cell morphology and the adhesive behavior of prostate cancer cells. Oncotarget 2014, 5, 4087–4102. [CrossRef] 7. Paez, A.; Vazquez, E.; Gueron, G. Heme oxygenase 1 governs the cytoskeleton at filopodia: Pulling the brakes on the migratory capacity of prostate tumoral cells. Cell Death Discov. 2017, 3, 17020. [CrossRef] 8. Paez, A.V.; Pallavicini, C.; Schuster, F.; Valacco, M.P.; Giudice, J.; Ortiz, E.G.; Anselmino, N.; Labanca, E.; Binaghi, M.; Salierno, M.; et al. Heme oxygenase-1 in the forefront of a multi-molecular network that governs cell-cell contacts and filopodia-induced zippering in prostate cancer. Cell Death Dis. 2016, 7, e2570. [CrossRef] 9. Łoboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [CrossRef] 10. Schönthal, A.H. Endoplasmic Reticulum Stress: Its Role in Disease and Novel Prospects for Therapy. Scientifica 2012, 2012, 1–26. [CrossRef] 11. Malhotra, J.D.; Kaufman, R.J. Endoplasmic Reticulum Stress and Oxidative Stress: A Vicious Cycle or a Double-Edged Sword? Antioxidants Redox Signal. 2007, 9, 2277–2294. [CrossRef] 12. McCullough, K.D.; Martindale, J.L.; Klotz, L.-O.; Aw, T.-Y.; Holbrook, N.J. Gadd153 Sensitizes Cells to Endoplasmic Reticulum Stress by Down-Regulating Bcl2 and Perturbing the Cellular Redox State. Mol. Cell. Boil. 2001, 21, 1249–1259. [CrossRef] 13. Rutkowski, D.T.; Arnold, S.M.; Miller, C.N.; Wu, J.; Li, J.; Gunnison, K.M.; Mori, K.; Akha, A.A.S.; Raden, D.; Kaufman, R.J. Adaptation to ER Stress Is Mediated by Differential Stabilities of Pro-Survival and Pro-Apoptotic mRNAs and Proteins. PLoS Boil. 2006, 4, e374. [CrossRef][PubMed] 14. Pavlovic, J.; Zürcher, T.; Haller, O.; Staeheli, P. Resistance to influenza virus and vesicular stomatitis virus conferred by expression of human MxA protein. J. Virol. 1990, 64, 3370–3375. [CrossRef][PubMed] 15. Kochs, G.; Janzen, C.; Hohenberg, H.; Haller, O. Antivirally active MxA protein sequesters La Crosse virus nucleocapsid protein into perinuclear complexes. Proc. Natl. Acad. Sci. USA 2002, 99, 3153–3158. [CrossRef] [PubMed] 16. Haller, O.; Staeheli, P.; Schwemmle, M.; Kochs, G. Mx GTPases: Dynamin-like antiviral machines of innate immunity. Trends Microbiol. 2015, 23, 154–163. [CrossRef] 17. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [CrossRef] Biomolecules 2020, 10, 1005 22 of 23

18. Anselmino, N.; Bizzotto, J.; Sanchis, P.; Lage-Vickers, S.; Ortiz, E.; Valacco, P.; Paez, A.; Labanca, E.; Meiss, R.; Navone, N.; et al. HO-1 Interactors Involved in the Colonization of the Bone Niche: Role of ANXA2 in Prostate Cancer Progression. Biomolecules 2020, 10, 467. [CrossRef] 19. Ross-Adams, H.; Lamb, A.D.; Dunning, M.; Halim, S.; Lindberg, J.; Massie, C.E.; Egevad, L.; Russell, R.; Ramos-Montoya, A.; Vowler, S.; et al. Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study. EBioMedicine 2015, 2, 1133–1144. [CrossRef] 20. Kassambara, A.; Kosinski, M.; Biecek, P. survminer: Drawing Survival Curves using “ggplot2” 2019. Computer program. 21. Budczies, J.; Klauschen, F.; Sinn, B.V.; Gy˝orffy, B.; Schmitt, W.; Darb-Esfahani, S.; Denkert, C. Cutoff Finder: A Comprehensive and Straightforward Web Application Enabling Rapid Biomarker Cutoff Optimization. PLoS ONE 2012, 7, e51862. [CrossRef] 22. Bussolati, B.; Ahmed, A.; Pemberton, H.; Landis, R.C.; Di Carlo, F.; Haskard, D.; Mason, J.C. Bifunctional role for VEGF-induced heme oxygenase-1 in vivo: Induction of angiogenesis and inhibition of leukocytic infiltration. Blood 2004, 103, 761–766. [CrossRef][PubMed] 23. Wegiel, B.; Chin, B.Y.; Otterbein, L.E. Inhale to survive, cycle or die? Carbon monoxide and cellular proliferation. Cell Cycle 2008, 7, 1379–1384. [CrossRef] 24. Weinstein, J.N.; The Cancer Genome Atlas Research Network; Li, J.; Mills, G.B.; Shaw, K.R.M.; Ozenberger, B.A.; Ellrott, K.; Shmulevich, I.; Sander, C.; Stuart, J.M. The Cancer Genome Atlas Pan-Cancer analysis project. Nat. Genet. 2013, 45, 1113–1120. [CrossRef] 25. Wang, M.; Kaufman, R.J. The impact of the endoplasmic reticulum protein-folding environment on cancer development. Nat. Rev. Cancer 2014, 14, 581–597. [CrossRef] 26. Verfaillie, T.; Garg, A.D.; Agostinis, P. Targeting ER stress induced apoptosis and inflammation in cancer. Cancer Lett. 2013, 332, 249–264. [CrossRef] 27. Jozkowicz, A.; Was, H.; Dulak, J. Heme Oxygenase-1 in Tumors: Is It a False Friend? Antioxidants Redox Signal. 2007, 9, 2099–2118. [CrossRef] 28. Saccà, P.; Meiss, R.; Casas, G.; Mazza, O.; Calvo, J.C.; Navone, N.; Vazquez, E. Nuclear translocation of haeme oxygenase-1 is associated to prostate cancer. Br. J. Cancer 2007, 97, 1683–1689. [CrossRef][PubMed] 29. Jaworski, F.M.; Gentilini, L.; Gueron, G.; Meiss, R.P.; Ortiz, E.G.; Berguer, P.M.; Ahmed, A.; Navone, N.; Rabinovich, G.A.; Compagno, D.; et al. In Vivo Hemin Conditioning Targets the Vascular and Immunologic Compartments and Restrains Prostate Tumor Development. Clin. Cancer Res. 2017, 23, 5135–5148. [CrossRef] 30. Elguero, B.; Gueron, G.; Giudice, J.; A Toscani, M.; De Luca, P.; Zalazar, F.; Leskow, F.C.; Meiss, R.; Navone, N.; De Siervi, A.; et al. Unveiling the Association of STAT3 and HO-1 in Prostate Cancer: Role beyond Heme Degradation. Neoplasia 2012, 14, 1043–1056. [CrossRef] 31. Mushinski, J.F.; Nguyen, P.; Stevens, L.M.; Khanna, C.; Lee, S.; Chung, E.J.; Lee, M.-J.; Kim, Y.S.; Linehan, W.M.; Horisberger, M.A.; et al. Inhibition of Tumor Cell Motility by the Interferon-inducible GTPase MxA. J. Boil. Chem. 2009, 284, 15206–15214. [CrossRef] 32. A Horisberger, M. Interferon-induced human protein MxA is a GTPase which binds transiently to cellular proteins. J. Virol. 1992, 66, 4705–4709. [CrossRef][PubMed] 33. Nagano, K.; Masters, J.R.; Akpan, A.; Yang, A.; Corless, S.; Wood, C.; Hastie, C.; Zvelebil, M.; Cramer, R.; Naaby-Hansen, S. Differential protein synthesis and expression levels in normal and neoplastic human prostate cells and their regulation by type I and II interferons. Oncogene 2003, 23, 1693–1703. [CrossRef] 34. Kotenko, S.V.; Gallagher, G.; Baurin, V.V.; Lewis-Antes, A.; Shen, M.; Shah, N.K.; Langer, J.; Sheikh, F.; Dickensheets, H.; Donnelly, R.P. IFN-λs mediate antiviral protection through a distinct class II cytokine receptor complex. Nat. Immunol. 2002, 4, 69–77. [CrossRef] 35. Jonasch, E.; Haluska, F.G. Interferon in Oncological Practice: Review of Interferon Biology, Clinical Applications, and Toxicities. Oncologist 2001, 6, 34–55. [CrossRef][PubMed] 36. Shou, J.; Soriano, R.; Hayward, S.W.; Cunha, G.R.; Williams, P.M.; Gao, W.-Q. Expression profiling of a human cell line model of prostatic cancer reveals a direct involvement of interferon signaling in prostate tumor progression. Proc. Natl. Acad. Sci. USA 2002, 99, 2830–2835. [CrossRef] Biomolecules 2020, 10, 1005 23 of 23

37. Schulz, W.A.; Alexa, A.; Jung, V.; Hader, C.; Hoﬀmann, M.J.; Yamanaka, M.; Fritzsche, S.; Wlazlinski, A.; Müller, M.; Lengauer, T.; et al. Factor interaction analysis for chromosome 8 and DNA methylation alterations highlights innate immune response suppression and cytoskeletal changes in prostate cancer. Mol. Cancer 2007, 6, 14. [CrossRef][PubMed] 38. Tomlins, S.; Laxman, B.; Varambally, S.; Cao, X.; Yu, J.; Helgeson, B.E.; Cao, Q.; Prensner, J.R.; Rubin, M.A.; Shah, R.B.; et al. Role of the TMPRSS2-ERG Gene Fusion in Prostate Cancer. Neoplasia 2008, 10, 177-IN9. [CrossRef] 39. Attard, G.; Clark, J.; Ambroisine, L.; Fisher, G.; Kovacs, G.; Flohr, P.; Berney, D.M.; Foster, C.S.; Fletcher, A.; Gerald, W.L.; et al. Duplication of the fusion of TMPRSS2 to ERG sequences identiﬁes fatal human prostate cancer. Oncogene 2007, 27, 253–263. [CrossRef] 40. Isler, J.A.; Skalet, A.H.; Alwine, J.C. Human Cytomegalovirus Infection Activates and Regulates the Unfolded Protein Response. J. Virol. 2005, 79, 6890–6899. [CrossRef] 41. Haruki, A.N.; Naito, T.; Nishie, T.; Saito, S.; Nagata, K. Interferon-Inducible Antiviral Protein MxA Enhances Cell Death Triggered by Endoplasmic Reticulum Stress. J. Interf. Cytokine Res. 2011, 31, 847–856. [CrossRef] 42. Medigeshi, G.R.; Lancaster, A.M.; Hirsch, A.J.; Briese, T.; Lipkin, W.I.; DeFilippis, V.; Früh, K.; Mason, P.W.; Nikolich-Žugich, J.; Nelson, J.A. West Nile Virus Infection Activates the Unfolded Protein Response, Leading to CHOP Induction and Apoptosis. J. Virol. 2007, 81, 10849–10860. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).