MHC Class I-Related Neonatal Fc Receptor for Igg Is Functionally

MHC Class I-Related Neonatal Fc Receptor for IgG Is Functionally Expressed in Monocytes, Intestinal Macrophages, and Dendritic Cells This information is current as of September 26, 2021. Xiaoping Zhu, Gang Meng, Bonny L. Dickinson, Xiaotong Li, Emiko Mizoguchi, Lili Miao, Yuansheng Wang, Caroline Robert, Benyan Wu, Phillip D. Smith, Wayne I. Lencer and Richard S. Blumberg

J Immunol 2001; 166:3266-3276; ; Downloaded from doi: 10.4049/jimmunol.166.5.3266 http://www.jimmunol.org/content/166/5/3266 http://www.jimmunol.org/ References This article cites 59 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/166/5/3266.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. MHC Class I-Related Neonatal Fc Receptor for IgG Is Functionally Expressed in Monocytes, Intestinal Macrophages, and Dendritic Cells1

Xiaoping Zhu,* Gang Meng,§ Bonny L. Dickinson,‡ Xiaotong Li,† Emiko Mizoguchi,† Lili Miao,* Yuansheng Wang,† Caroline Robert,2† Benyan Wu,* Phillip D. Smith,§ Wayne I. Lencer,‡ and Richard S. Blumberg3*

The neonatal Fc receptor (FcRn) for IgG, an MHC class I-related molecule, functions to transport IgG across polarized epithelial cells and protect IgG from degradation. However, little is known about whether FcRn is functionally expressed in immune cells. We show here that FcRn mRNA was identifiable in human monocytes, macrophages, and dendritic cells. FcRn heavy chain was detectable as a 45-kDa protein in monocytic U937 and THP-1 cells and in purified human intestinal macrophages, peripheral blood Downloaded from monocytes, and dendritic cells by Western blot analysis. FcRn colocalized in vivo with macrosialin (CD68) and Ncl-Macro, two ␤ macrophage markers, in the lamina propria of human small intestine. The heavy chain of FcRn was associated with the 2- ␤ microglobulin ( 2m) light chain in U937 and THP-1 cells. FcRn bound human IgG at pH 6.0, but not at pH 7.5. This binding could be inhibited by human IgG Fc, but not Fab. FcRn could be detected on the cell surface of activated, but not resting, THP-1 cells. Furthermore, FcRn was uniformly present intracellularly in all blood monocytes and intestinal macrophages. FcRn was detectable on the cell surface of a significant fraction of monocytes at lower levels and on a small subset of tissue macrophages that expressed http://www.jimmunol.org/ high levels of FcRn on the cell surface. These data show that FcRn is functionally expressed and its cellular distribution is regulated in monocytes, macrophages, and dendritic cells, suggesting that it may confer novel IgG binding functions upon these cell types relative to typical Fc␥Rs: Fc␥RI, Fc␥RII, and Fc␥RIII. The Journal of Immunology, 2001, 166: 3266–3276.

4 ␤ he neonatal Fc receptor (FcRn) is structurally related to recent observations that mice deficient in 2m exhibit significant the MHC class I family (1–3) and consists of a mem- reduction in the serum half-life of IgG (15–17). Recent evidence T brane-bound heavy chain (45 kDa for human, 51 kDa for for FcRn expression by endothelial cells suggested that this may be ␤ ␤ rodents) in nonconvalent association with 2-microglobulin ( 2m; the cell type most prominently involved in IgG protection (18). by guest on September 26, 2021 12 kDa). FcRn was originally characterized as a transport receptor A hallmark of FcRn interaction with its ligand is its strictly involved in the uptake of maternal IgG by an intestinal route in pH-dependent IgG binding in both epithelial and endothelial cells. rodents (4–8) and probably via syncytiotrophoblastic cells within FcRn preferentially binds IgG at acidic pH (6–6.5), but is unable human placenta, respectively (9–13). Additionally, FcRn has been to bind IgG at neutral pH (7–7.4) (19–21). FcRn is expressed in a considered to function in the protection of IgG from degradation. variety of cell types and tissues, including intestinal epithelial cells This idea was first proposed by Brambell (14) and is supported by (IECs) of neonatal rodents, syncytiotrophoblasts of humans, endothelial cells of adult rodents and humans, adult rat hepatocytes, and adult epithelial cells of bovine mammary gland, human intes- † *Gastroenterology Division, Brigham and Women’s Hospital, and Departments of tine, and human kidney (22–27). Medicine and Pathology, and ‡Combined Program in Pediatric Gastroenterology and Nutrition, Children’s Hospital, Harvard Medical School, Boston, MA 02115; and Immune cells, such as B lymphocytes, macrophages, dendritic §Department of Medicine, University of Alabama and Veteran’s Affairs Medical Cen- cells, NK cells, mast cells, and granulocytes, typically express sin- ter, Birmingham, AL 35294 gle or multiple receptors for the Fc portion of IgG, including Received for publication August 22, 2000. Accepted for publication December ␥ ␥ ␥ 20, 2000. Fc RI (CD64), Fc RII (CD32), Fc RIII (CD16), and their splice variants. These Fc␥Rs play a pivotal role in linking the cellular and The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance humoral arms of the immune response. Specifically, these recep- with 18 U.S.C. Section 1734 solely to indicate this fact. tors are involved in internalization of immune complexes, Ag pre- 1 This work was supported by research grants from the National Institutes of Health sentation, Ab-dependent cellular cytotoxicity, negative regulation (DK/AI-53056 (to R.S.B. and W.I.L.), DK44319 and DK51362 (to R.S.B.), DK48107 ␥ (to W.I.L.), and DK-47322, AI-41530, DK-54495, and DE-72621 (to P.D.S.)), a of effector functions of Fc R-bearing cells, regulation of the in- Department of Veterans Affairs Merit Review Award (to P.D.S.), and the Harvard flammatory cascade, and autoimmunity (28–31). However, FcRn Digestive Disease Center. X.Z. was supported by a Career Development Award from expression has not been characterized in immune cells, especially the Crohn’s and Colitis Foundation of American. in Fc␥Rϩ cells. Therefore, we tested the hypothesis in this study 2 Current address: Department of Dermatology, Institute Gustave, Roussy, 39 rue Camille, Desmoulin, 94805 Villejuif, France. that FcRn is functionally expressed in human immune cells. We 3 Address correspondence and reprint requests to Dr. Richard S. Blumberg, Gastro- found by several criteria that FcRn was expressed in human mono- enterology Division, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA cytes, macrophages, and dendritic cells and in human monocytic 02115. E-mail address: [email protected] cell lines and exhibits pH-dependent binding of IgG in these cells. 4 ␤ ␤ Abbreviations used in this paper: FcRn, neonatal Fc receptor; 2m, 2-microglobu- Moreover, the cellular distribution of FcRn expression between lin; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; MFI, mean fluorescence intensity; IEC, intestinal epithelial cell; MIIC, MHC class II intracellular and cell surface locations appears to be differentially compartment. regulated. These studies indicate that FcRn is the fourth FcR for

IgG to be deﬁned on macrophages and dendritic cells and signif- CD13, CD14, CD20, and CD80 (Becton Dickinson, San Jose, CA) and icantly extend the potential function of FcRn and the cell types CD103 and CD83 (Immunotech, Westbrook, ME). Isotype-matched irrel- involved in the known functions of this novel MHC class I-like evant mAbs were used as controls. The monocyte-derived dendritic cells were obtained by a previously molecule. described method (35). Brieﬂy, monocytes were isolated from PBMCs by adherence to plastic for 2 h and were cultured for 8 days in RPMI 1640 Materials and Methods (Life Technologies) supplemented with 10% FCS, 10 mM HEPES, 2 mM Ϫ5 Human cell lines and tissues L-glutamine, 5 ϫ 10 2-mecaptoethanol, penicillin (100 U/ml), streptomycin (100 mg/ml), recombinant human GM-CSF (100 U/ml), and recom- HeLa (cervical epithelial cell line), Jurkat (thymoma cell line), U937 binant human IL-4 (1000 U/ml). The medium was replaced every 3–4 (monocyte cell line), Raji (B cell line), and 721.721 (HLA-A-, -B-, and days. After 8 days, cells displaying dendritic morphology and predomi- -C-negative B cell line) were purchased from American Type Culture Col- nantly expressing CD1a and HLA-DR, but that had lost most of the ex- lection (Manassas, VA). THP-1 (monocytic cell line), NK3.3 (NK cell pression of the monocyte marker CD14, were obtained. Immature dendritic line), and NKL (NK cell line) were gifts from Dr. Mark Birkenbach (Uni- cells were obtained by culturing the adherent fraction of normal human versity of Chicago, Chicago, IL), Dr. Paul Anderson (Harvard Medical PBMCs in the presence of GM-CSF and IL-4 for 3 days. School, Boston, MA), and Dr. Marco Colonna (Basel Institute for Immu- nology, Basel, Switzerland), respectively. The U937 (promonocytic cell line), Raji, and 721.721 cell lines were cultivated in suspension in RPMI RT-PCR 1640 medium (Life Technologies, Gaithersburg, MD) supplemented with Cells were pelleted and resuspended at 106 cells/ml in Tri-Reagent (Mo- 10% FCS, 1% L-glutamine, and 1% penicillin/streptomycin. A CD1d-trans- CD1d lecular Research Center, Cincinnati, OH). Total RNA was extracted ac- fected cell line, 721.721 , generated by transfecting the 721.221 cell cording to the method recommended by the manufacturer. First-strand ␣ line with the full-length CD1day cDNA in the PSR neo expression vector, cDNA was synthesized from 1 ␮g of total RNA using Moloney murine

␮ Downloaded from was cultivated in the same medium supplemented with 500 g/ml G418 leukemia virus reverse transcriptase (Promega, Madison, WI) and an oli- (Life Technologies). The THP-1 cell line was cultivated in the same me- go(dT) primer (Promega) as recommended by manufacturer. The human ϫ Ϫ5 dium with 5 10 M 2-ME (Sigma, St. Louis, MO). NK3.3 and NKL FcRn gene was amplified from cDNA by a primer pair (5Ј-CCGGAAT were cultivated in 10% RPMI 1640 medium with 10% human serum. HeLa TCGCAGAAAGCCACCTCTCCCT,5Ј-CGGAATTCTTAGCAGTCGGAA cells were cultivated with 10% FCS in DMEM (Life Technologies). Cell TGGCGGA-3Ј) that contained EcoRI sites in the 5Ј extension to facilitate viability was assessed by trypan blue dye exclusion. cloning. Amplification was performed by hot start PCR using 35 cycles Production of human FcRn domain-specific serum Abs each consisting of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min. At

the end of the 35 cycles, samples were run for an additional 10 min at 72°C http://www.jimmunol.org/ The human FcRn codons (11) corresponding to the ␣1 (1–87), the ␣2 and then maintained at 4°C until analyzed by agarose gel electrophoresis. (88–177), and the ␣3 (178–274) domains were amplified by PCR and The mRNA was also amplified by GAPDH-specific primers as an internal subcloned into the EcoRI sites of the pGEX4T-1 (Amersham Pharmacia control to monitor the quality of the RNA purification and cDNA synthesis. Biotech, Piscataway, NJ) expression vector. The primer pairs for ␣1(5Ј- CCGGAATTCGCAGAAAGCCACCTCTCCCT-3Ј,5Ј-GGCGAATTCT Ј ␣ Ј Transfection of HeLa cells with plasmid encoding human FcRn CAACCTTTTCCCCCCAA-3 ), 2(5-GGCGAATTCTACACTCTGCA ␤ GGGCCTGCT-3Ј,5Ј-CGCGAATTCTCACTTCCACTCCAGGTTT-3Ј), and 2m and ␣3(5Ј-CCGGAATTCGAGCCCCCCTCCAT,5Ј-GGCGAATTCG Ј The FcRn codon (1–343) was amplified from an FcRn-containing plasmid GAGGACTTGGCTGGAGATT-3 ) were used for amplification by Pfu (11) with the primer pair 5Ј-ATAAGAATGCGGCCGCGGCAGAAAGC polymerase (Stratagene, La Jolla, CA). The EcoRI site in the primers are Ј Ј

CACCTCTCCCT-3 and 5 -TGCTCTAGATTAGGCGGTGGCTGGAAT by guest on September 26, 2021 underlined, and human FcRn sequences are italicized. The plasmid encod- CA-3Ј. The upstream primer introduced a NotI site, and the downstream ing the full-length human FcRn, provided by Dr. Neil Simister (Brandeis primer introduced an XbaI site to facilitate cloning (underline). Amplifi- University, Waltham, MA), was used as a template. All subclones were cation was performed using Pfu DNA polymerase with initial heating to verified by sequencing. The production of recombinant proteins was per- 95°C for 5 min, followed by 35 cycles each consisting of 95°C for 1 min, formed by a method modified from that previously described (32) and 58°C for 1 min, and 74°C for 1.5 min, and was terminated by a final analyzed by SDS-PAGE electrophoresis. Five micrograms of the purified ␣ ␣ ␣ extension step at 72°C for 10 min. The PCR product was purified by aga- GST- 1, GST- 2, and GST- 3 proteins were respectively emulsified in rose gel using a GeneClean II kit (Bio 101, Vista, CA). The DNA fragment CFA and injected s.c. into each BALB/c mouse. Mice were boosted twice was digested with NotI and XbaI and ligated into the plasmid pFlagCMV-1 at 3-wk intervals with fusion protein emulsified with IFA. Sera were sam- (Sigma) to generate the plasmid, pFlagCMVhFcRn. In this plasmid a Flag pled 2 wk following the final dose. Furthermore, the immunization of rab- epitope (DYKDDDDK, single-letter amino acid code) was fused into the N bits with purified fusion protein was performed by Charles River Breeding ␤ terminus of the FcRn gene. The plasmid pCDNAh 2m was constructed as Laboratories (Wilmington, MA). previously described (36). The open reading frames of plasmids ␤ Isolation of lamina propria macrophages, blood monocytes, and pCDNAh 2m and pFlagCMVhFcRn were verified by sequencing both strands to confirm the fidelity of amplification and cloning. dendritic cells Transfection of HeLa was performed by electroporation (Electroporator ⌱⌱ ␮ ␮ Lamina propria macrophages were isolated from surgical human normal ; Invitrogen, San Diego, CA) using 20 g of pFlagCMVhFcRn and 2 g ␤ ␤ tissue by neutral protease digestion of intestinal tissue sections with coun- of pCDNAh 2m to ensure that 2m concentrations were not substrate lim- terflow centrifugal elutriation as previously described (33, 34). Briefly, iting for FcRn expression. Transfected cells were grown under selection sections of normal human jejunum were incubated in 0.2 M EDTA (Fisher with 1 mg/ml of G418 (Life Technologies). Single colonies of transfected ␮ Scientific, Norcross, GA) plus 10 mM 2-ME (Sigma) to remove the epi- HeLa were expanded under 500 g/ml of G418. Positive colonies were ␣ thelium, minced, and then treated twice (45 min, 200 rpm, 37°C) in RPMI confirmed by Western blotting using the FcRn anti- 2-specific serum as FcRnϩ␤2m (Mediatech, Washington, DC) containing 100 ␮g/ml DNase and 75 ␮g/ml described. The chosen positive transfectant was designated HeLa . of the neutral protease dispase (grade I; Roche, Indianapolis, IN) to release the lamina propria mononuclear cells (33). After straining to remove debris Western blotting, immunoprecipitation, and immunofluorescence and gradient sedimentation to remove residual nonmononuclear cells, the cells were separated into highly purified populations of lamina propria Cell lysates were prepared in PBS with 0.5% Nonidet P-40, 0.5% sodium macrophages and lymphocytes by counterflow centrifugal elutriation using deoxycholate, and 0.1% SDS by adding a protease inhibitor cocktail (Sig- a J-6 M elutriation centrifuge (Beckman, Palo Alto, CA) (33, 34). The cells ma). A postnuclear supernatant was analyzed for total protein concentra- isolated by this procedure contained Ͻ1% CD3ϩ lymphocytes and dis- tions by the Bradford method with BSA as a standard (Bio-Rad, Hercules, played the size distribution, morphological features, ultrastructure, and CA). The proteins were separated on 12% SDS-PAGE gels under reducing phagocytic activity of macrophages (33). conditions and transferred onto nitrocellulose (Schleicher & Schuell, Peripheral blood monocytes were isolated from leukopaks from healthy Keene, NH). The membranes were blocked with 5% nonfat milk and donors by elutriation. Both cell populations were rested for 2 days in probed with mouse anti-human FcRn ␣2 Ab (1/500) for 1 h, then with DMEM (Quality Biologicals, Gaithersburg, MD) plus 50 mg/ml gentami- HRP-conjugated goat anti-mouse IgG Fc Ab (1/10,000). All blocking, in- cin and 10% human AB serum (Atlanta Biologicals, Atlanta, GA) before cubation, and washing steps were performed in PBS containing 0.05% study. Cell purity was assessed by flow cytometry as previously described Tween 20 and 5% milk. The final product was visualized by ECL (Pierce, (3–5) using mAbs against the following cell markers: HLA-DR, CD3, Rockford, IL). 3268 EXPRESSION OF FcRn IN MONOCYTES, MACROPHAGES, AND DENDRITIC CELLS

Immunoprecipitations were performed as previously described (22). temperature. Surface staining was also conducted at 4°C to minimize in- Briefly, 5 ϫ 105 log-phase-grown THP-1 and U937 cells were metaboli- ternalization, and the results were identical with those observed at room cally labeled with 0.5 mCi of trans-35S-labeled methionine and cysteine temperature (data not shown). For intracellular staining, the cells were first (ICN Biomedicals, Costa Mesa, CA) in methionine- and cysteine-free permeabilized with Cytofix/Cytoperm (PharMingen) on ice for 20 min and RPMI 1640 medium (ICN Biomedicals) supplemented with 10% dialyzed then washed with 1ϫ perm/wash buffer. Anti-␣2-specific serum was added FCS and incubated at 37°C for 5 h. After washing with PBS, cells were as described. After washing, 20 ␮l of 1/50 diluted goat anti-mouse IgG- lysed in buffer (0.15 M NaCl, 1 mM EDTA, 50 mM Tris (pH 8), and 10 FITC Ab (Jackson ImmunoResearch) was added to each tube and incu- mM iodoacetamide) with protease inhibitors and detergent as described bated at room temperature for 15 min. After washing, cells were fixed with above. Cells were lysed and subsequently centrifuged at 14,000 ϫ g for 30 Cytofix and analyzed using a FACScan flow cytometer and CellQuest soft- min. Radioimmunoprecipitations were performed using mouse anti- ware (Becton Dickinson). The mouse IgG (0.5 ␮g/million cells) was used ␣ ␤ 2-specific serum coupled to protein G-Sepharose beads (Pierce). A 2m as a negative control. ␤ mAb (Sigma) was used to deplete 2m from cell lysates. For immunofluorescence assays, HeLaFcRnϩ␤2m was grown on glass Immunohistochemistry ϫ 5 coverslips overnight. A total of 1 10 U937 and THP-1 were mounted Normal adult human small intestine was obtained from patients undergoing onto adhesive microscope slides, air-dried, and fixed in 3.7% paraformal- gastric bypass surgery under a protocol that was approved by the human dehyde. After washes, cells were permeabilized with 0.1% digitonin in studies committee of the Brigham and Women’s Hospital. Tissue was em- PBS for 10 min at room temperature, washed, and blocked for 30 min at bedded in Tissue-Tek OCT compound (Sakura-Finite, Torrance, CA). room temperature with 10% heat-inactivated goat serum (Sigma) in PBS. ␣ Samples were sectioned on a Leach CM3050 cryomicrotome (Leica, Nus- Cells were then incubated with a mouse anti- 2-specific serum in PBS sloch, Germany). A frozen section (5 ␮m) was air-dried at room temper- (1/250) containing 10% goat serum (Sigma) for1hatroom temperature. ature, fixed in 4% paraformaldehyde in PBS, washed in PBS, and blocked Primary Ab was detected with an FITC-conjugated F(ab)2 goat anti-mouse in 10% nonimmune goat serum (Zymed, South San Francisco, CA). Sec- Ab (1/100) for1hatroom temperature. As a negative control, cells were tions were stained with an affinity-purified FcRn-specific anti-peptide Ab incubated with normal mouse serum. Nuclei were stained with 0.1 ␮g/ml Downloaded from Ј Ј (aa 174–188; provided by Dr. Neil Simister, Brandeis University) or 4 6 -diamidino-2-phenylindole (Molecular Probes, Eugene, OR) in PBS against Ncl-Macro (Novocastra, Newcastle upon Tyne, U.K.) diluted in for 5 min. After final washes, cells were mounted. Images were captured PBS containing 10% nonimmune goat serum and 0.02% Tween 20. Pri- using a fluorescence microscope (Microphot FXA; Nikon, Tokyo, Japan) mary Abs were detected with appropriate fluorophore-conjugated second- and processed with Adobe Photoshop 5.0. Positive samples and negative ary Abs for epifluorescence microscopy. All staining reactions were ac- controls were viewed using the same contrast and brightness settings. companied by a negative control that consisted of an affinity-purified, IgG binding and Fc blocking assay isotype-matched irrelevant Ab. Sections were mounted in ProLong antifade

reagent (Molecular Probes, Eugene, OR) and viewed with a Zeiss Axiophot http://www.jimmunol.org/ IgG Fc binding assays were performed as previously described (1, 18, 22) microscope (Zeiss, New York, NY) equipped with a Spot digital camera with the following modifications. Cells were lysed by shaking in sodium (Diagnostic Instruments, Sterling Height, CA). Electronic images were phosphate buffer (pH 6.0 or 7.5) with 0.5% 3-[(3-cholamidopropyl)dim- captured and edited using Adobe Photoshop. The sections were stained ethylammonio]-1-propanesulfonate (CHAPS; Sigma) and protease inhibi- with either mouse anti-␣2-specific serum or an FcRn-specific anti-peptide tor cocktail on ice for 1 h. Postnuclear supernatants containing 0.5–1 mg of Ab and anti-CD68 (Santa Cruz Biotechnology, Santa Cruz, CA) using an soluble proteins was diluted with an equal volume of sodium phosphate avidin-biotin complex method (37). buffer containing 0.1% CHAPS and incubated with human IgG-Sepharose (Amersham Pharmacia Biotech) at 4°C for4horovernight. The unbound Results proteins were removed with sodium phosphate buffer (pH 6.0 or 7.5) con- Generation of FcRn domain-specific Abs taining 0.1% CHAPS. The adsorbed proteins were eluted with sodium phosphate buffer (pH 8) or boiled with electrophoresis sample buffer at To generate FcRn-specific serum Abs, we fused the codons cor- by guest on September 26, 2021 100°C for 5 min. The eluted fractions were subjected to 12% reducing responding to the ␣1, ␣2, or ␣3 domains of FcRn in-frame to the SDS-PAGE analysis. Proteins were visualized by Western blot using anti- GST gene. The anti-GST Abs in the mouse sera were removed by ␣2-specific serum. For the blocking experiments, 250–500 ␮g/ml of hu- incubation with GST bound to glutathione-Sepharose beads. Sera man Fc or F(ab)2 (ICN Pharmaceuticals, Aurora, OH) were added to IgG- Sepharose beads before adding FcRn cell lysates. For the removal of contained only Abs specific for the FcRn as shown by Western CD64, CD32, and CD16 molecules, cell lysates (pH 7.5) were incubated blot. We selected the GST-␣2 for further immunization of rabbits. with protein G that was previously incubated with mAbs specific for CD64, To show specificity of the mouse and rabbit anti-human ␣2-spe- CD32, and CD16 (Caltag, Burlingame, CA) at 4°C overnight with shaking. cific serum Abs, we probed cell lysates from 721.221, Cell surface biotinylation 721.221CD1d, Jurkat, and HeLa cells by Western blotting. The ␣2 Cell surface biotinylation was performed as previously described (18). domain-specific serum did not react with classical MHC or non- THP-1 and U937 cells (5 ϫ 107) were suspended in 5 ml of PBS, pH 7.5, classical MHC class I-like CD1d molecules (data not shown). De- to which 2.5 ml of sulfo-NHS-biotin in PBS (1 mg/ml; Pierce) was added. spite the 22–29% similarity between the ␣2 domains of MHC class The mixture was incubated at room temperature with rotation for 30 min. I and FcRn (2), the anti-FcRn Abs recognized only a 45-kDa pro- After washing with sodium phosphate buffer (pH 6.0) containing 0.1% CHAPS, the pellet was resuspended in 5 ml of sodium phosphate buffer tein from HeLa cells transfected with plasmids encoding both ␤ (pH 6.0) with 0.5% CHAPS. A postnuclear supernatant was diluted 2-fold FcRn heavy chain and human 2m as defined by Western blotting by sodium phosphate buffer (pH 6.0) with 0.1% CHAPS, then incubated (Fig. 1) and immunoprecipitation of metabolically labeled protein with IgG-Sepharose. Following washings at pH 6.0, the bound protein was (data not shown). Mock-transfected HeLa cells were negative. eluted in loading buffer at 100°C or with sodium phosphate buffer, pH 7.5. The eluted proteins were resolved by SDS-PAGE followed by blotting with Expression of FcRn in macrophage and dendritic cells streptavidin-HRP (Pierce). To confirm the specificity, the proteins eluted with sodium phosphate buffer were immunoprecipitated by mouse anti-␣2- Expression of FcRn heavy chains in immune cells was examined specific serum bound to protein G-Sepharose beads. Following incubation by RT-PCR from a variety of cell lines and from isolated mono- at 4°C on ice, the beads were washed, resuspended in loading buffer, re- cytes, macrophages, and dendritic cells with FcRn-specific prim- solved by SDS-PAGE, transferred onto nitrocellulose, and blotted with streptavidin-HRP. The final product was visualized using ECL (Pierce). ers. The purity of the isolated cells is shown in Fig. 2. The results of RT-PCR screening are shown in Fig. 3. The amplified PCR Flow cytometry products had a size similar to that of a product amplified from an Surface and intracellular expressions of FcRn were examined in either FcRn-encoding plasmid or T84 cells, a polarized IEC line express- fixed or permeabilized monocytes, macrophages, or THP-1 cells by flow ing functional FcRn (25). Moreover, the FcRn heavy chain mRNA 6 cytometry. For staining, 1 ϫ 10 cells were washed with PharMingen stain detected in the human macrophage and dendritic cells had a DNA buffer (FBS; PharMingen, San Diego, CA), followed by blocking with PBS containing 10% normal goat sera (Jackson ImmunoResearch, West Grove, sequence identical with that previously described from human pla- PA) on ice for 20 min. For surface Ag staining, 10 ␮l of diluted anti-␣2- centa as defined by sequencing five independent bacterial colonies specific serum was added to each tube and incubated for 20 min at room (11) (data not shown). These results showed that human FcRn The Journal of Immunology 3269

into the N terminus of the FcRn gene. Untransfected and transfected HeLa cells also exhibited two minor nonspecific bands with Western blotting that migrated above the 45-kDa specific band (Fig. 4A). However, these were not observed when immunoprecipitation of radiolabeled HeLahFcRnϩ␤2m cells was performed (data not shown). Furthermore, Jurkat and untransfected HeLa cells lacked this 45-kDa band. In Jurkat, a band smaller than 45 kDa was detected, similar to a minor weak band present in the monocytic cell lines as well as macrophages and dendritic cells. This band probably represents a nonspecific immunoreactive protein given the absence of FcRn-specific mRNA in Jurkat cells (Fig. FIGURE 1. Detection of human FcRn heavy chain by immunoblotting 3). In addition, immunoprecipitation of radiolabeled proteins from with the mouse anti-␣2-specific serum. Total cellular proteins (60 ␮g) from the Jurkat and Raji cell lines failed to show expression of FcRn either HeLamock or HeLaFcRnϩ␤2m transfectant were resolved on a 12% (data not shown). SDS-PAGE gel under reducing conditions. Immunoblotting was performed To further document the expression of FcRn in mononuclear with the mouse anti-␣2-specific serum and HRP-conjugated goat anti- cells, we performed immunofluorescence studies on the monocytic mouse IgG, with detection accomplished by ECL. The arrow indicates the cell lines. Using the anti-␣2-specific serum, we observed that heavy chain of human FcRn. The M markers in kilodaltons are indicated r THP-1 (Fig. 4B, panel C) and U937 (Fig. 4B, panel E) cell lines on the right. FcRnϩ␤2m stained positively. For comparison, staining of the HeLa Downloaded from transfectants is shown in panel A. The negative control, normal mouse serum, failed to stain HeLa (data not shown), THP-1 (data transcripts were expressed in monocytes, macrophages, and den- not shown), or U937 cells (Fig. 4B, panel G), and the anti-␣2- dritic cells, but not in NK, T, and B cell lines (Fig. 3). specific serum failed to stain the untransfected HeLa cell line (data Western blotting studies confirmed these results. Fig. 4A shows not shown). Nuclear staining of all four cell lines is provided for that a band of 45 kDa was detected by the FcRn anti-␣2-specific

reference ( panels B, D, F, and H). http://www.jimmunol.org/ serum Abs in the promonocytic U937 and monocytic THP-1 cell lines as well as in freshly isolated monocytes, macrophages, and ␤ dendritic cells. A band was also observed in transfected, but not in Association of human FcRn heavy chain with 2m in THP-1 and untransfected, HeLa cells. It should be noted that the size of the U937 cells band in the transfected HeLa cells was slightly larger than that of FcRn is expressed as a 45-kDa membrane-bound heavy chain in ␤ the band detected in the monocytic cell lines, monocytes, macro- nonconvalent association with 12-kDa 2m. Immunoprecipitation phages, and dendritic cells due to a Flag epitope that was inserted of [35S]methionine- and [35S]cysteine-labeled THP-1 and U937 by guest on September 26, 2021

FIGURE 2. Purity of isolated dendritic cells and intestinal lamina propria macrophages. A, Primary lamina propria macrophages were isolated and purified from normal human jejunum as described in Materials and Methods and then analyzed by flow cytometry for the indicated surface Ags. Gates were set to include the total cell population. Insets display FACS profiles using the CD-specific Abs with the following purified control cells: CD103, intestinal lymphocytes; CD14, blood monocytes; CD3, blood lymphocytes; CD20, blood lymphocytes; and CD83, blood monocyte-derived dendritic cells. The FACS profiles are representative of lamina propria macrophages from intestinal tissue from a single donor (n ϭ 6). The MFI is shown on the x-axis, and the relative cell number on the y-axis. B, Monocytes were isolated from PBMCs and stimulated with recombinant human GM-CSF and recombinant human IL-4 for 8 days. After 8 days, cells displaying dendritic morphology, as shown by forward and side scatter, and predominantly expressed CD1a and HLA-DR but which had lost most of the expression of the monocyte marker CD14 were isolated. Stain- ing is shown with specific mAbs directly conjugated to PE. 3270 EXPRESSION OF FcRn IN MONOCYTES, MACROPHAGES, AND DENDRITIC CELLS

FIGURE 3. RT-PCR amplification of FcRn cDNA from immune cells. First-strand cDNA was prepared as described in Materials and Methods. Amplified PCR products (800 bp) were electrophoresed in 1.2% agarose gels and stained with ethidium bromide. Similar PCR products amplified with a GAPDH-specific primer pair was also fractionated in 1.2% agarose gels as internal controls. The arrow indicates the location of the amplification products for human FcRn heavy chain (hFcRn) and GAPDH. The m.w. markers in base pairs are indicated on the left. SI, small intestine; M␾, macrophages; DC, dendritic cells.

␣ cell lysates with an anti- 2-speciﬁc serum produced two bands, 45- mAb. Additionally, double-color staining revealed that some and 12-kDa proteins, that were coimmunoprecipitated by the pres- FcRn- and CD68-positive cells colocalized (data not shown). ence of anti-␣2-speciﬁc serum, but not by preimmune serum (Fig. Therefore, the same result was obtained when two different Abs

4C). This is consistent with an association between the FcRn heavy specific for FcRn in macrophages were used, thus confirming the Downloaded from ␤ chain and 2m in other cells. Further confirmation that the 12-kDa expression of FcRn in tissue macrophages. ␤ band was 2m was obtained when lysates from metabolically labeled THP-1 cells were subjected to three rounds of depletion with pH-dependent IgG binding by FcRn in macrophages and ␤ an anti- 2m mAb that removed the 12-kDa band from the autora- dendritic cells diogram. The molecular size of FcRn immunoprecipitated from IgG binding assays were performed at both pH 6.0 and 7.5. Be-

U937 lysates was slightly larger than that of FcRn from THP-1. cause macrophages and dendritic cells express conventional Fc http://www.jimmunol.org/ The explanation for this result is not clear. However, it may reflect receptors for IgG, which could confound the interpretation of func- different post-translational modifications of FcRn in the two cell tional IgG binding assays, we assessed pH-dependent binding by lines, which are immortalized at different stages of monocyte mat- biochemical methods. FcRn was specifically immunoprecipitated ␤ uration. We also observed that the associated 2m band did not from U937 and THP-1 cell lysates using human IgG bound to ␤ appear to be stoichiometric with FcRn. Because 2m contains Sepharose 4B as the ligand at pH 6.0, but not at pH 7.5 (Fig. 6A). three methionine and cysteine residues compared with the nine An ϳ32-kDa band was also detected in binding assays using the such residues contained in human FcRn, we believe that this is an U937 cells at both pH 7.5 and 6.0. Because this band was detect- artifact of the metabolic labeling technique. Another possibility is able in FcRn-negative cells (data not shown), it is presumed that ␤ by guest on September 26, 2021 that since mutations of the 2m molecule have been described in this represents a nonspecific precipitated protein. Isolated intestinal ␤ transformed cell lines (36), it may be that a 2m mutation has macrophages and monocyte-derived, peripheral blood dendritic occurred in the monocytic cell lines, resulting in a low affinity of cells also displayed the same pattern of pH-dependent binding ␤ association with FcRn. Therefore, we sequenced the cDNA of 2m (Fig. 6B). Because it is possible that FcRn failed to bind IgG at pH derived from the U937 cell line. The sequence aligned perfectly 7.5 due to competition from other Fc␥Rs, especially high affinity ␤ with the sequence of 2m deposited in GenBank (accession no. Fc␥RI (CD64), we removed CD64, CD32, and CD16 molecules by GI4757825), thus ruling out this possibility. incubating THP-1 cell lysates with excess amounts of anti-CD64, Colocalization of FcRn and macrophage markers in vivo CD32, and CD16 mAbs immunoadsorbed to protein G at pH 7.5. Despite preclearing the THP-1 cell lysates of these IgG binding There is a large population of macrophages in the normal human proteins, the 45-kDa protein binding of IgG could still not be de- intestinal mucosa (33). To determine whether FcRn is expressed in tected at pH 7.5 (data not shown). macrophages in vivo, we stained intestinal macrophages for FcRn and Ncl-Macro, a marker for human macrophages. Crypt and vil- pH-dependent binding by FcRn in macrophage is Fc mediated lus enterocytes exhibited a punctate apical membranous staining pattern for FcRn visible at the apical plasma membrane and in the To further demonstrate that the Fc portion of IgG is responsible for apical cytoplasm (Fig. 5, a, e, and f, arrowheads) as previously the FcRn interaction, we performed an IgG binding assay at pH 6.0 described (25). Resident lamina propria macrophages also ex- in the presence of soluble human IgG Fc and F(ab)2. The results pressed FcRn (Fig. 5a, arrow). FcRn staining was absent from both are shown in Fig. 7 and reveal that the binding of FcRn to IgG- enterocytes and macrophages in the presence of an irrelevant an- Sepharose was inhibited by the presence of excess human IgG Fc tiserum (Fig. 5b). Abs against Ncl-Macro specifically stained lam- fragments, but not by the presence of excess human IgG F(ab)2 ina propria macrophages (Fig. 5c, arrows), and this staining was (Fig. 7). Furthermore, this inhibition of IgG binding to FcRn by Fc not observed in the presence of an irrelevant isotype-matched mAb fragments was concentration dependent, indicating that the binding (Fig. 5d). Double labeling with both anti-FcRn and anti- of IgG Fc to FcRn in macrophage was specific and saturable. NCL-Macro Abs revealed colocalization of FcRn and Ncl-Macro in lamina propria macrophages of the villi (Fig. 5e, arrows) and Cellular distribution of FcRn in monocytes and macrophages crypts (Fig. 5f, arrows). We also colocalized FcRn and macrosialin Because FcRn binds IgG in a pH-dependent manner, it is important (CD68), an activated macrophage marker, in intestinal macro- to know whether FcRn is expressed on the cell surface and/or phages by an avidin-biotin complex method (37, 38). FcRn- and intracellularly. First, cell surface biotinylation experiments were CD68 positively stained cells were clearly detectable in normal performed. Following cell surface biotinylation, FcRn could not be lamina propria of intestine with either the mouse anti-␣2-specific detected on the cell surface of monocytic THP-1 cells (Fig. 8A). serum or with an FcRn-specific anti-peptide Ab and an anti-CD68 The failure to detect FcRn on the cell surface may be associated The Journal of Immunology 3271

FIGURE 4. FcRn expression in freshly isolated cells and cell lines. A, Detection of human FcRn protein in freshly isolated monocytes, small intestinal macrophages, dendritic cells, and cell lines by Western blot. SDS- PAGE gels were loaded with 60 ␮g of total protein per Downloaded from lane from the indicated sources, and the proteins were resolved under reducing conditions. The proteins were transferred onto nitrocellulose and probed with a rabbit anti-␣2-specific serum and HRP-conjugated donkey anti- rabbit IgG used for development. The protein bands were visualized by ECL. The arrow indicates the location of http://www.jimmunol.org/ the human FcRn heavy chain (hFcRn). B, Immunofluo- rescence staining of monocyte-like cell lines THP-1 and U937. The THP-1 and U937 cell lines were grown on glass coverslips, fixed with 3.7% paraformaldehyde, and permeabilized in 0.1% digitonin. Subsequently, the cells were incubated with mouse anti-␣2-specific serum, followed by staining with a FITC-conjugated F(ab)2 goat anti-mouse Ab (panels C and E). HeLaFcRnϩ␤2m cells were stained as positive controls (A). The U937 cell line was stained with normal mouse serum as nega- by guest on September 26, 2021 tive control (panel G). The nucleus was stained with 4Ј6Ј-diamidino-2-phenylindole (panels B, D, F, and H) and photographed through a fluorescence microscope. Positive samples and negative controls were viewed using the same contrast and brightness set- ␤ tings. C, Detection of FcRn association with 2min monocyte-like cell lines. Metabolically labeled THP-1 and U937 cells were immunoprecipitated with either rabbit anti-␣2-specific serum or nonimmune serum and analyzed by SDS-PAGE and auto- radiography. The 45- and 12-kDa bands were copre- cipitated in the presence of hFcRn-specific immune serum, but not in the presence of nonimmune serum.

The Mr markers in kilodaltons are indicted on the left. The locations of human FcRn heavy chain ␤ (hFcRn) and 2m are indicated by arrows.

C 3272 EXPRESSION OF FcRn IN MONOCYTES, MACROPHAGES, AND DENDRITIC CELLS

FIGURE 5. Immunolocalization of FcRn in macrophages of the lamina propria in adult human small intestine. Frozen sections of tissue samples obtained from normal human jejunum were stained with either rabbit anti-FcRn Ab or anti-Ncl-Macro mAb. a, e, and f, arrowheads, Crypt and villus enterocytes show Downloaded from a punctuate staining pattern of FcRn expression visible at the apical plasma membrane and in the apical cytoplasm. a, arrow, A nearby resident lamina propria macrophage expresses FcRn. b, FcRn staining was not observed in the presence of an irrelevant antiserum. c, arrows, Abs against Ncl-Macro-stained lamina propria macrophages. d, Macrophage staining was absent in http://www.jimmunol.org/ the presence of an irrelevant isotype-matched mAb. Double labeling with both anti-FcRn and anti-Ncl-Macro Abs revealed colocalization (yellow, arrow) of FcRn and Ncl-Macro in lamina propria macrophages of the villus (e) and crypt (f). by guest on September 26, 2021

with either the activation state or the degree of cellular differen- distribution of FcRn may be regulated by either cellular maturation tiation, because THP-1 is a monocyte-like cell without complete and/or activation in cells of the monocyte lineage. maturation. PMA treatment can activate THP-1 cells with mor- To assess the in vivo relevance of these observations with the phological changes consistent with differentiation. When THP-1 THP-1 cell line, we performed flow cytometry for FcRn expression cells were labeled with biotin after PMA treatment, FcRn was on monocytes and macrophages whose purities were described in readily detectable on the cell surface (Fig. 8A). Similar results Fig. 2. This type of analysis provided the following results (Fig. were obtained by flow cytometry (Fig. 8B). Whereas resting 8C). Virtually all peripheral blood monocytes expressed FcRn in- THP-1 cells expressed FcRn solely intracellularly, THP-1 cells tracellularly, and the majority (72.8%) exhibited detectable FcRn activated by PMA expressed FcRn both on the cell surface and on the cell surface, albeit at lower levels (mean fluorescence in- intracellularly. This appearance of FcRn on the cell surface was tensity (MFI): surface, 9.02; intracellular, 22.56). These data in- detectable within6hofPMAactivation and was sustained for up dicate that monocytes uniformly express FcRn with the majority of to 48 h. During this time period, intracellular levels of FcRn ex- the FcRn contained within intracellular compartments, and a pression were maintained or even increased, suggesting that redis- lesser, but still substantive, proportion displayed on the cell surface tribution of FcRn to the cell surface was associated with increases on a majority of cells. Although the macrophages purified from the in total cellular FcRn levels. Because PMA is reported to induce small intestine were also uniformly positive for FcRn expression apoptosis in the HL-60 cell line (39), it is possible that apoptosis (95.7% positive), only a small subset (23.2%) of these cells dis- could result in leakage of cell membranes in THP-1 cells. How- played FcRn on the cell surface. Interestingly, the MFI of these ever, we found that PMA-activated THP-1 cells did not stain with FcRn surface-positive macrophages was equivalent to that ob- trypan blue (data not shown). These data suggest that the cellular served intracellularly (MFI: surface, 40.59; intracellular, 42.51). The Journal of Immunology 3273

of FcRn is regulated in monocytes and macrophages. Moreover, they suggest that FcRn may function intracellularly and extracel- lularly in monocytes and predominantly intracellularly in the majority of tissue macrophages.

Discussion FcRn is highly expressed in mouse and rat during the ﬁrst 3 wk after birth. In IECs it plays a major function in the passive acquisition of neonatal immunity. Following weaning, the expression of FcRn in the IECs is rapidly and profoundly diminished (1, 4). However, it is also known that FcRn expression persists into adult life in human IECs and in a limited range of other cell types in mammalian, including hepatocytes and endothelial cells (22–24). This expression beyond neonatal life is potentially relevant to other postnatal functions, including, importantly, the protection of IgG from catabolism. This study examined the hypothesis that FcRn, an MHC class I-related Fc receptor for IgG, is functionally expressed in mono-

cytes, tissue macrophages, and dendritic cells that are already well Downloaded from known to abundantly express other conventional FcRs for IgG. Our study for the first time has demonstrated that FcRn is expressed by monocytes, macrophages, and dendritic cells. The presence of FcRn heavy chain in macrophages from small intestine and dendritic cells was specifically demonstrated by RT-PCR amplifi- FIGURE 6. Detection of pH-dependent FcRn binding of IgG in macro-

cation with FcRn-specific primer pairs (Fig. 3), Western blotting http://www.jimmunol.org/ phages and dendritic cells. IgG binding assays were performed at both pH (Fig. 4A), and immunofluorescence staining with FcRn specific 6.0 and 7.5 as described in Materials and Methods. The U937, THP-1, monocyte-derived dendritic cells, and intestinal macrophages were lysed in serum Abs (Fig. 4B) in vitro, and immunohistochemical colocal- sodium phosphate buffer (pH 6.0 or 7.5) with 0.5% CHAPS. Approxi- ization of FcRn heavy chain with the macrophage-specific marker mately 0.5–1 mg of soluble proteins were incubated with human IgG- Ncl-Macro (Fig. 5) and CD68 (data not shown) in the lamina pro- Sepharose at 4°C. The eluted proteins were subjected to 12% SDS-PAGE pria of human small intestine. We reason that macrophages in analysis under reducing conditions. Proteins were probed with a rabbit other tissues would also express FcRn, because monocytes express anti-␣2-specific serum and developed with HRP-conjugated donkey anti- FcRn, although this should be further confirmed. Additional evi- FcRnϩ␤2m rabbit Abs with visualization by ECL. Lysates of HeLa were dence to support this conclusion was that we were able to detect probed similarly as a positive control. The Mr markers in kilodaltons are murine FcRn, a homologue of human FcRn, in a macrophage cell by guest on September 26, 2021 indicated on the right. The location of the human FcRn heavy chain is line, RAW264.7 (data not shown). The association between FcRn indicated by an arrow. ␤ and 2m was also demonstrated in monocyte-like cell lines (Fig. 4C), proving that FcRn is structurally intact in this cell type. Thus, with differentiation to a macrophage, FcRn expression per- Therefore, our results support the previous finding that FcRn is sists, but is redistributed intracellularly, except for a minor subset expressed beyond neonatal life. In our examination of FcRn ex- of cells that exhibits extremely high levels of surface FcRn expression, we found that established cell lines derived from B lym- pression. Taken together with the observations generated with the phocyte, T lymphocyte, and NK cell lineages failed to express THP-1 cell line, these results suggest that the cellular distribution FcRn heavy chain (Fig. 3). However, we cannot exclude the possibility that FcRn is expressed in freshly isolated or activated T lymphocytes, B lymphocytes, and NK cells. We also do not know whether FcRn is expressed in other myeloid-derived lineages, such granulocytes and platelets. These issues will need further investigation. FcRn binds IgG at acidic pH in macrophages and dendritic cells. As described in the intestine of neonatal rodent, FcRn binds IgG in the slightly acidic pH of gut lumen and releases IgG into the blood- stream of newborn animals at the neutral pH of the interstitium, pH 7.4 (1, 40). The amino acid residues isoleucine 254 and histidine 310 within the CH2 domain and the sequence -H-N-H-Y (aa 433– 436) of the CH3 domain in mouse and human IgG1 appear to be of particular functional significance in this pH-dependent binding (41–43). Our results show that FcRn displays complete pH-depen- FIGURE 7. Blockade of FcRn-mediated IgG binding by IgG Fc frag- dent binding of IgG binding in monocyte-like cell lines and in vivo ment. IgG binding assays were performed as described in Fig. 6. For block- isolated macrophage and dendritic cells (Fig. 6). This pH-depen- ing, 250–500 ␮g of human Fc or F(ab) were added to IgG-Sepharose 2 dent IgG binding can be inhibited by Fc fragments that contain the beads before adding lysates from the THP-1 cell line. The eluted proteins were analyzed by 12% SDS-PAGE under reducing conditions, probed with IgG binding motifs, but not by Fab that do not contain these motifs a rabbit anti-␣2-specific serum, and developed with HRP-conjugated sec- (Fig. 7), supporting specificity for the Fc portion of IgG. ondary Abs with visualization by ECL. Lysates of HeLaFcRnϩ␤2m were Studies on transcytosis of IgG through yolk sac (44) and human probed similarly as a positive control. The Mr markers in kilodaltons are placenta (12, 13) have suggested that FcRn resides primarily indicated on the right. within acidified vesicles where ligand binding is likely to occur 3274 EXPRESSION OF FcRn IN MONOCYTES, MACROPHAGES, AND DENDRITIC CELLS after fluid phase uptake. Also, several in vitro studies that have modeled transcytosis of IgG in polarized epithelial cells support this idea (25, 45, 46). For example, pH gradient disruption in intracellular vesicles with bafilomycin A1 and monensin completely inhibited IgG transcytosis in a model human intestinal or rat kidney epithelial cell line (25, 46). We also reason that FcRn is likely to reside primarily within acidic vesicular compartments of cells of monocyte lineage. Our data support this conclusion, because FcRn was barely detectable on the cell surface of a resting monocyte-like cell line (Fig. 8A), and the majority of FcRn expressed by monocytes and tissue macrophages was intracellular (Fig. 8B). Interestingly, FcRn could also be expressed on the cell surface. When the THP-1 cell line was treated with the phorbol ester, PMA, which also drives THP-1 differentiation toward a macrophage-like phenotype (47), FcRn was readily detectable on the cell surface (Fig. 8, A and B). Similarly, a significant fraction of peripheral blood monocytes and a subset of tissue macrophages were observed to express FcRn on the cell surface, albeit at lower levels than intracellularly, except in the case of the tissue macrophage Downloaded from subset that expressed extremely high levels. This suggests that the cellular distribution of FcRn may be related to the activation and/or differentiation state of the cell, which has not been previously appreciated in other cell types. Because FcRn binds IgG strongly in a pH-dependent manner, the appearance of FcRn on the cell surface would suggest that FcRn may be nonfunctional on the http://www.jimmunol.org/ cell surface in terms of IgG binding under physiological conditions. However, it is possible that FcRn tethered on the cell surface of monocytes, macrophages, and dendritic cells might be functional in pathological conditions such as tissue inflammation (48, 49) and tumor infiltration (50, 51), where acidic conditions are created by alterations in tissue metabolism. The interstitial pH within solid tumors has been observed to be below physiological FIGURE 8. Cellular distribution of FcRn expression patterns of FcRn on

levels, ranging from 5.6–7.7, which includes the pH optimum of by guest on September 26, 2021 THP-1, monocytes, and macrophages. A, Surface biotinylation of FcRn on FcRn binding (50). Macrophages are recruited in the earliest resting THP-1 and PMA-activated THP-1 cell lines. THP-1 cells were treated phases of inflammation such as inflammatory bowel disease (52), with 100 nm/ml PMA for 48 h. Cell surface proteins were biotinylated and and they are widely infiltrated in solid tumor tissues (53). solubilized at pH 6.0 as described in the text. Lysates were incubated with Alternatively, the expression of FcRn on the cell surface may IgG-Sepharose beads. The eluted proteins were analyzed by SDS-PAGE elec- reflect other significant functions of FcRn on these cell types under trophoresis under reducing conditions, blotted with streptavidin-HRP, and de- physiological conditions: a role in shuttling IgG from the intracel- veloped with ECL. This experiment was conducted in a duplicate sample with lular to extracellular milieu in protecting IgG from catabolism. identical results. The specificity of the band identified in the avidin blot was With regard to IgG protection, there is a significant body of evi- provided by immunoprecipitation with an FcRn-specific Ab followed by avidin blotting (data not shown). B, Analysis of the surface and intracellular dence that suggests that FcRn is directly involved in the control of expression of FcRn on resting and PMA-activated THP-1 cells. Indirect im- serum IgG levels (14–17, 42). The proposed model is that pino- munofluorescence staining was performed on untreated cells or cells treated cytotic vacuole formation by cells expressing FcRn results in up- with PMA for the indicated time periods (hours). Cell surface and intracellular take of IgG from surrounding fluids, and following a lowering of expression of FcRn on resting or activated THP-1 cells was described in Ma- pH in early endosomes, some IgG molecules bind to FcRn. En- terials and Methods. Results are expressed as histograms of MFI (log scale) on zymes present in organelles downstream of endosomes, such as the x-axis. The open peak represents staining of cells with the anti-hFcRn Ab, lysosomes, digest the unbound IgG, but the IgG bound to FcRn is and the filled peak represents cells stained with irrelevant IgG. C, Expression protected and recycled into the surrounding tissue fluid. Data to of FcRn in monocytes and macrophages analyzed by flow cytometry. Cell surface and intracellular expression patterns of FcRn in either fixed or perme- support this model are the decrease in serum half-life of IgG in abilized blood monocytes and small intestinal macrophages were measured by ␤ Ϫ/Ϫ ␤ 2m mice (16), because loss of 2m presumably disables the flow cytometry. Cells were stained as described in Materials and Methods. function of FcRn, and the fact that mutated Fc fragments that ex- Results are expressed as histograms of fluorescence intensity (log scale). The hibit a higher affinity for FcRn have a longer serum half-life than filled histograms represent staining of cells with anti-␣2-specific serum, and wild-type Fc fragments (42). Currently, the cell type responsible the open histograms represent cells stained with irrelevant IgG. Values in the for this protection of IgG has not been clearly defined, although top right of each rectangle correspond to the proportion of cells stained with endothelial cells have been proposed. The monocytic U937 cell the anti-hFcRn Ab relative to the control Ab. The staining for macrophages line was shown to be capable of recycling monomeric IgG by an and monocytes was conducted three times with similar results. unknown mechanism (54). Therefore, we reason that the expression of FcRn by virtually all monocytes in peripheral blood and the significant levels of FcRn expression detectable on the cell surface on the cell surface of monocytes may reflect highly active sorting of this cell type may reflect a role of monocytic FcRn in the pro- of IgG by FcRn from the endocytic pathway to the cell surface. tection of IgG from catabolism and the maintenance of IgG levels However, the relative distribution of FcRn on tissue macro- in peripheral blood. Therefore, the prominent expression of FcRn phages was distinct from monocytes, with most FcRn in the former The Journal of Immunology 3275 cell type intracellularly except for a small subset of cells that re- 5. Abrahamson, D., and R. Rodewald. 1981. Evidence for sorting of endocytic sembled the distribution of FcRn in monocytes, i.e. intracellular vesicle contents during the receptor-mediated transport of IgG across the newborn rat intestine. J. Cell Biol. 91:270. and cell surface (Fig. 8C). This suggests that the function of FcRn 6. Ahouse, J. J., C. L. Hagerman, P. Mittal, D. J. Gilbert, N. G. Copeland, in most macrophages may be distinct and skewed toward protect- N. A. Jenkins, and N. E. Simister. 1993. Mouse MHC class I-like Fc receptor ing IgG from degradation intracellularly and thus prolonging the encoded outside the MHC. J. Immunol. 151:6076. 7. Israel, E. J., V. K. Patel, S. F. Taylor, A. Marshak-Rothstein, and N. E. Simister. ␤ intracellular half-life of IgG. For a macrophage involved in Ag 1995. Requirement for a 2-microglobulin-associated Fc receptor for acquisition presentation, such a property may be advantageous, and this sug- of maternal IgG by fetal and neonatal mice. J. Immunol. 154:6246. gests that FcRn may influence Ag presentation. In macrophages 8. Benlounes, N., R. Cedid, F. Thuillier, J. F. Desjeux, F. Rousselet, and M. Heyman. 1995. Intestinal transport and processing of immunoglobulin G in the neonatal and and dendritic cells, Fc␥Rs can promote the internalization of im- adult rat. Biol. Neonate 67:254. mune complexes into the endosomes, lysosomes, and MHC class 9. Koch, C., M. Boesman, and D. Gitlin. 1967. Maternofoetal transfer of ␥G im- II compartment (MIIC) to increase the efficiency of MHC class II munoglobulins. Nature 216:1116. ϩ 10. Israel, E. J., N. Simister, E. Freiberg, A. Caplan, and W. A. Walker. 1993. Im- presentation to CD4 T lymphocytes (28, 55, 56). FcRn, in con- munoglobulin G binding sites on the human foetal intestine: a possible mecha- trast, may influence Ag presentation pathways by protecting these nism for the passive transfer of immunity from mother to infant. Immunology immune complexes once inside cells in acidic compartments such 79:77. 11. Story, C. M., J. E. Mikulska, and N. E. Simister. 1994. A major histocompati- as early endosomes (pH 6.0–6.5), late endosomes (pH 5.0–6.0), bility complex class I-like Fc receptor cloned from human placenta: possible role lysosomes (pH 4.5–5.0), and MIIC (57). Generally, antigenic pep- in transfer of immunoglobulin G from mother to fetus. J. Exp. Med. 180:2377. tides, which are ultimately associated with MHC class II mole- 12. Simister, N. E., C. M. Story, H.-L. Chen, and J. S. Hunt. 1996. An IgG-trans- porting Fc receptor expressed in the syncytiotrophoblast of human placenta. Eur. cules, are generated from internalized exogenous Ags by the J. Immunol. 26:1527. movement of MHC class II sequentially through early endosomes, 13. Leach, J. L., D. D. Sedmark, J. M. Osborne, B. Rahill, M. D. Lairmore, and Downloaded from late endosomes, lysosomes, and MIICs (58). Several lines of ev- C. L. Anderson. 1996. Isolation from human placenta of the IgG transporter, FcRn, and localization to the syncytiotrophoblast. J. Immunol. 157:3317. idence support this probability. First, because FcRn is able to bind 14. Brambell, F. W. R., W. A. Hemmings, and I. G. Morris. 1964. A theoretical mode immune complexes (59), it may be able to maintain high levels of of gammaglobulin catabolism. Nature 203:1352. 15. Ghetie, V., J. G. Hubbard, J. K. Kim, M. F. Tsen, Y. Lee, and E. S. Ward. 1996. these immune complexes at the sites of Ag processing. Second, ␤ Abnormally short serum half-lives of IgG in 2-microglobulin deficient mice. FcRn binds IgG in the pH range of endosomes and lysosomes (pH Eur. J. Immunol. 26:690.

4.5–6.5; data not shown). Third, the appearance of a dileucine- 16. Israel, E. J., D. F. Wilsker, K. C. Hayes, D. Schoenfeld, and N. E. Simister. 1996. http://www.jimmunol.org/ ␤ based motif in the cytoplasmic tails of FcRn and the MHC class Increased clearance of IgG in mice that lack 2-microglobulin: possible protec- tive role of FcRn. Immunology 89:573. II-associated invariant chain suggests that FcRn and MHC class II 17. Junghans, R. P., and C. L. Anderson. 1996. The Brambell protection receptor ␤ molecules might be colocalized primarily in acidic compartments. (FcRp) for Ig is the 2-microglobulin-containing neo-intestinal transporter re- The invariant chain has been shown to target MHC class II to ceptor (FcRn). Proc. Natl. Acad. Sci. USA 93:5512. 18. Borvak, J., J. Richardson, C. Medesan, F. Antohe, C. Radu, M. Simionescu, acidic compartments (60). Therefore, the role of FcRn in protect- V. Ghetie, and E. S. Ward. 1998. Functional expression of the MHC class I-re- ing IgG may have an influence on Ag presentation in APCs such lated receptor, FcRn, in endothelial cells of mice. Int. Immunol. 10:1289. as macrophages and dendritic cells. 19. Rodewald, R. 1976. pH-dependent binding of immunoglobulins to intestinal cell of the neonatal rat. J. Cell Biol. 71:666. In summary, FcRn, the only known Fc receptor for IgG with 20. Raghavan, M., L. N. Gastine, and P. J. Bjorkman. 1993. The class I major his- MHC class I-like structure, is functionally expressed by mono- tocompatibility complex related Fc receptor shows pH-dependent stability dif- by guest on September 26, 2021 cytes, macrophages, and dendritic cells. Furthermore, the cellular ferences correlating with immunoglobulin binding and release. Biochemistry 32: 8654. distribution of FcRn expression on these cell types is regulated 21. Vaughn, D. E., and P. J. Bjorkman. 1998. Structural basis of pH-dependent an- between intracellular and extracellular sites. These features of tibody binding by the neonatal Fc receptor. Structure 6:63. FcRn expression may confer upon monocytes, macrophages, and 22. Blumberg, R. S., T. Koss, C. M. Story, D. Barisani, J. Polischuk, A. Lipin, L. Pablo, R. Green, and N. E. Simister. 1995. A major histocompatibility complex dendritic cells novel functions involving protection of IgG from class I-related Fc receptor for IgG on rat hepatocytes. J. Clin. Invest. 95:2397. catabolism that may relate to prolonging the IgG half-life in the 23. Israel, E. J., S. Taylor, Z. Wu, E. Mizoguchi, R. S. Blumberg, A. Bhan, and extracellular (monocytes) and intracellular (macrophages and den- N. E. Simister. 1997. Expression of the neonatal Fc receptor, FcRn, on human intestinal epithelial cells. Immunology 92:69. dritic cells) milieu, which may impact the Ag presentation func- 24. Cianga, P., C. Medesan, J. A. Richardson, V. Ghetie, and E. S. Ward. 1999. tions of these cells. Future studies must be aimed at testing these Identification and function of neonatal Fc receptor in mammary gland of lactating hypotheses. mice. Eur. J. Immunol. 29:2515. 25. Dickinson, B. L., K. Badizadegan, Z. Wu, J. C. Ahouse, X. Zhu, N. E. Simister, R. S. Blumberg, and W. I. Lender. 1999. Bidirectional FcRn-dependent IgG Acknowledgments transport in a polarized human intestinal epithelial cell line. J. Clin. Invest. 104: 903. We thank Dr. Sheldon Randall (Department of Surgery, Brigham and 26. Haymann, J.-P., J.-P. Levraud, S. Bouet, V. Kappes, J. Hagege, G. Nguyen, Women’s Hospital) for human intestinal tissue. We gratefully acknowledge Y. Xu, E. Rondeau, and J.-D. Sraer. 2000. Characterization and localization of the the FcRn-containing plasmid and peptide Ab from Dr. Neil Simister. We neonatal Fc receptor in adult human kidney. J. Am. Soc. Nephrol. 11:632. thank Drs. Victor M. Morales and Neil Simister for critically reviewing the 27. Kacskovics, I., Z. Wu, N. E. Simister, L. V. Frenyo, and L. Hammarstrom. 2000. manuscript. We thank Dr. Kamran Badizadegan and Atul Bhan for advice Cloning and characterization of the bovine MHC class I-like Fc receptor. J. Im- munol. 164:1889. about immunohistochemistry. We thank Dr. Tom Kupper for advice in 28. Lanzavecchia, A. 1990. Receptor-mediated antigen uptake and its effect on an- purification of dendritic cells. We thank Drs. Mark Birkenbach, Paul tigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. Anderson, and Marco Colonna for the cell lines THP-1, NK3.3, and 8:773. NKL. We also thank Dr. Jianhua Xu for human cDNA from PBMC, and 29. Ravetch, J. V., and J. P. Kinet. 1991. Fc receptors. Annu. Rev. Immunol. 9:457. Steven M. Claypool for technical help. 30. Sylvestre, D. L., and J. V. Ravetch. 1994. Fc receptors initiate the Arthus reac- tion: redefining the inflammatory cascade. Science 265:1095. 31. Perussia, B. 1998. Fc receptors on natural killer cells. Curr. Top. Microbiol. References Immunol. 230:63. 1. Simister, N. E., and A. R. Rees. 1985. Isolation and characterization of an Fc 32. Wu, S. X., X. P. Zhu, and G. J. Letchworth. 1998. Bovine herpesvirus 1 glyco- receptor from neonatal rat small intestine. Eur. J. Immunol. 15:733. protein M forms a disulfide-linked heterodimer with the UL-49.5 protein. J. Virol. 2. Simister, N. E., and K. E. Mostov. 1989. An Fc receptor structurally related to 72:3029. MHC class I antigens. Nature 337:184. 33. Smith, P. D., E. N. Janoff, M. Mosteller-Barnum, M. Merger, J. M. Orenstein, 3. Burmelster, W. P., L. N. Gastinel, N. E. Simister, M. L. Blum, and J. F. Kearney, and M. F. Graham. 1997. Isolation and purification of CD14- P. J. Bjorkman. 1994. Crystal structure at 2.2 Å resolution of the MHC-related negative mucosal macrophages from normal human small intestine. J. Immunol. neonatal Fc receptor. Nature 372:336. Methods 202:1. 4. Jones, E. A., and T. A. Waldmann. 1972. The mechanism of intestinal uptake and 34. Wahl, L. M., and P. D. Smith. 1991. Isolation of macrophages/monocytes from transcellular transport of IgG in the neonatal rat. J. Clin. Invest. 51:2916. human peripheral blood and tissues. Curr. Protocols Immunol. 7:6.1. 3276 EXPRESSION OF FcRn IN MONOCYTES, MACROPHAGES, AND DENDRITIC CELLS

35. Pickl, W. F., O. Majdic, P. Kohl, J. Stockl, E. Riedl, C. Scheinecker, 48. Edlow, D. W., and W. H. Sheldon. 1971. The pH of inflammatory exudates. Proc. C. Bello-Fernandez, and W. Knapp. 1996. Molecular and functional character- Soc. Exp. Biol. Med. 137:1328. ϩ istics of dendritic cells generated from highly purified CD14 peripheral blood 49. Ward, T. T., and R. T. Steibigel. 1978. Acidosis of synovial fluid correlates with monocytes. J. Immunol. 157:3850. synovial fluid leukocytosis. Am. J. Med. 64:933. 36. Hicklin, D. J., Z. Wang. F. Arienti, L. Rivoltini, G. Parmiani, and S. Ferrone. 50. Tannok, I. F., and D. Rotin. 1989. Acidic pH in tumors and its potential for 1998. ␤ -microglobulin mutations, HLA class I antigen loss, and tumor progres- 2 therapeutic exploitation. Cancer Res. 49:4373. sion in melanoma. J. Clin. Invest. 101:2720. 37. Mizoguchi, A., E. Mizoguchi, C. Chiba, G. M. Spiekermann, S. Tonegawa, 51. Gerweck, L. E., and K. Seetharaman. 1996. Cellular pH gradient in tumor versus C. Nagler-Anderson, and A. K. Bhan. 1996. Cytokine imbalance and autoanti- normal tissue: potential exploitation for the treatment of cancer. Cancer Res. body production in T cell receptor-␣ mutant mice with inflammatory bowel dis- 56:1194. ease. J. Exp. Med. 183:847. 52. Rugtveit, J., E. M. Nilsen, A. Bakka, H. Carlsen, P. Brandtzaeg, and H. Scott. 38. Rabinowitz, S., and S. Gordon. 1991. Macrosialin, a macrophage-restricted mem- 1997. Cytokine profiles differ in newly recruited and resident subsets of mucosal brane sialoprotein differentially glycosylated in response to inflammatory stimuli. macrophages from inflammatory bowel disease. Gastroenterology 112:1493. J. Exp. Med. 174:827. 53. Martinet, N., G. Beck, V. Bernard, F. Plenat, P. Vaillant, F. Schooneman, 39. Sakakura, C., E. A. Sweeney, T. Shirahama, S. Hakomori, and Y. Igarashi. 1996. J. M. Vignaud, and Y. Martinet. 1992. Mechanism for the recruitment of mac- Suppression of bcl-2 gene expression by sphingosine in the apoptosis of human rophages to cancer site: in vivo concentration gradient of monocyte chemotactic leukemic HL-60 cells during phorbol ester-induced terminal differentiation. activity. Cancer 70:854. FEBS Lett. 379:177. 54. Harrison, P. T., W. Davis, J. C. Norman, A. R. Hockaday, and J. M. Allen. 1994. 40. Rodewald, R., and J. P. Kraehenbuhl. 1984. Receptor-mediated transport of IgG. Binding of monomeric immunoglobulin G triggers Fc␥RI-mediated endocytosis. J. Cell Biol. 99:159. J. Biol. Chem. 269:24396. 41. Kim, J. K., M. F. Tsen, V. Ghetie, and E. S. Ward. 1994. Identifying amino acid residues that influence plasma clearance of mouse IgG1 fragments by site di- 55. Heijnen, I. A., M. J. van Vugt, N. A. Fanger, R. F. Graziano, T. P. de Wit, rected mutagenesis. Eur. J. Immunol. 24:542. F. M. Hofhuis, P. M. Guyre, P. J. Capel, J. S. Verbeek, and J. G. Winkel. 1996. ␥ 42. Ghetie, V., and E. S. Ward. 1997. FcRn: the MHC class I related receptor that is Antigen targeting to myeloid-specific human Fc RI/CD64 triggers enhanced an- more than an IgG transporter. Immunol. Today 18:592. tibody responses in transgenic mice. J. Clin. Invest. 15:331. 43. Kim, J. K., M. Firan, C. G. Radu, C. H. Kim, V. Ghetie, and E. S. Ward. Mapping 56. Liu, C., J. Goldsteine, R. F. Graziano, J. He, J. K. O’Shea, Y. Deo, and Downloaded from the site on human IgG for binding of the MHC class I-related receptor, FcRn. P. M. Guyre. 1996. Fc␥RI-targeted fusion proteins result in efficient presentation Eur. J. Immunol. 29:2819. by human monocytes of antigenic and antagonist T cell epitopes. J. Clin. Invest. 44. Roberts, D. M., M. Guenthert, and R. Rodewald. 1990. Isolation and character- 98:2001. ization of the Fc receptor from the fetal yolk sac of the rat. J. Cell Biol. 111:1867. 57. Geuze, H. J., 1998. The role of endosomes and lysosomes in MHC class II 45. Ellinger, I., M. Schwab, A. Stefanescu, W. Hunziker, and R. Fuchs. 1999. IgG functioning. Immunol. Today 19:282. transport across trophoblast-derived BeWo cells: a model system to study IgG 58. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules. transport in the placenta. Eur. J. Immunol. 29:733. Annu. Rev. Immunol. 12:259.

46. McCarthy, K. M., Y. Yoong, and N. E. Simister. 2000. Bidirectional transcytosis http://www.jimmunol.org/ of IgG by the rat neonatal Fc receptor expressed in a rat kidney cell line: a system 59. Abrahamson, D. R., A. Powers, and R. Rodewald. 1979. Intestinal absorption of to study protein transport across epithelia. J. Cell Sci. 113:1277. immune complexes by neonatal rats: a route of antigen transfer from mother to 47. Schwende, H., E. Fitzke, P. Ambs, and P. Dieter. 1996. Differences in the state young. Science 206:567. of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvi- 60. Bakke, O., and B. Dobberstein. 1990. MHC class II-associated invariant chain tamin D3. J. Leukocyte Biol. 59:555. contains a sorting signal for endosomal compartments. Cell 63:707. by guest on September 26, 2021