United States Patent (19) 11 Patent Number: 4,871,835 Aviv et al. (45) Date of Patent: Oct. 3, 1989

54 ANALOGS OF HGH HAVING Lewis et al., Biochem. Biophys, Res. Comm., 92(2), 1980, ANTAGONISTIC ACTIVITY, AND USES pp. 511-516. THEREOF DeGeeter, CA, vol. 99, 1983, #157232u. Russell et al., JBC, 256, 1981, pp. 296-300. (75) Inventors: Haim Aviv; Marian Gorecki, both of Lewis et al., JBC, 253(8), 1978, pp. 2679-2687. Rehovot; Avigdor Levanon, Netania; Goeddel et al., Nature, 281, 1979, pp. 544-548. Amos Oppenheim, Jerusalem; Tikva Seebury et al., Nature, 276, 1978, pp. 795-798. Vogel, Rehovot; Pinhas E. Zeelon, Ross et al., Hormone Design, 1982, pp. 313-318. Hashiva; Menachen Zeevi, Ramat Arieh Gertler et al., Endocrinology, 116(4): 1636-1644 Gan, all of Israel (1985). Alejandro C. Paladini et al., CRC Critical Reviews in 73) Assignee: Bio-Technology General Corp., New Biochemistry, 15(1): 25-56. . York, N.Y. Primary Examiner-J. R. Brown 21 Appl. No.: 691,230 Assistant Examiner-Garnette D. Draper Attorney, Agent, or Firm-John P. White 22 Filed: Jan. 14, 1985 57 ABSTRACT Related U.S. Application Data Analogs of hCGH having the activity of naturally occur ring hCH and a similar amino acid sequence varying 63 Continuation-in-part of Ser. No. 514,188, Jul. 15, 1983. from the sequence of natural hCGh by the addition of one or more amino acids, e.g. methione or methionine-leu 511 Int. Cl." ...... CO7K 13/00 cine, to the N-terminus of natural hCGH have been pro 52 U.S. Cl...... 530/399; 530/350; duced, recovered and purified. Such analogs may be 530/806; 530/820; 530/808; 435/68; 435/70; incorporated into pharmaceutical compositions and 435/172.2; 514/2 administered to a subject to increase the level of hCGH in 58 Field of Search ...... 530/350, 399,806, 820, the subject. 530/808; 435/68, 70; 514/2 Analogs of hCGH which comprise the amino acid se 56) References Cited quence of natural hCGH from the N-terminus of which one or more amino acids have been deleted, e.g. U.S. PATENT DOCUMENTS Meth0h, have been produced, recovered and puri 4,443,539 4/1984 Fraser et al...... 435/68

fied. Such analogs may be incorporated into pharma 4,658,021 4/1987 Goeddel et al. ... 530/399 ceutical compositions and administered to a subject to 4,665,160 5/1987 Seebury ...... 530/399 lower the level of hCGH in the subject. FOREIGN PATENT DOCUMENTS A plasmid has been constructed which directs the ex 0020147 12/1980 European Pat. Off. . pression of an analog of hCGH having the amino acid 0121764 10/1984 European Pat. Off. . sequence methionine-leucine added to the N-terminus WO84/02534 7/1984 PCT Int'l Appl. , of natural hCH. This plasmid has been introduced into 2073245 10/1981 United Kingdom . Escherichia coli, the resulting Escherichia coli grown and OTHER PUBLICATIONS the analog recovered and purified. Seebury, DNA, 1982, vol. 1(3), p. 239. 3 Claims, No Drawings 4,871,835 1. 2 containing the PL promoter from A bacteriophage. (Ber ANALOGS OF HIGH HAVING ANTAGONSTC nard, H. V. et al., Gene (1979) 5, 59; Derom, C. et al., ACTIVITY, AND USES THEREOF Gene (1982) 17, 45; Gheysen, D. et al., Gene (1982) 17, 55; Hedgpeth, J. et al., Mol. Gen. Genet. (1978) 163, This application is a continuation in part of U.S. Ser. 5 197; Remaut, E. et al., (1981) Gene 15, 81; and Derynck, No. 514,188, filed July 15, 1983, the contents of which R., et al., Nature (1980) 287, 193. In addition, European are hereby incorporated by reference into the present patent application No. 041.767, published Dec. 16, 1981 application. describes expression vectors containing the PL pro moter from A bacteriophage. However, none of these BACKGROUND OF THE INVENTION 10 references describe the use of the CII ribosomal binding One aspect of genetic engineering involves insertion site. of foreign DNA sequences derived from eukaryotic The use of a vector containing the PL promoter from sources into Escherichia coli or other microorganisms. A A bacteriophage and the CII ribosomal binding site has further refinement concerns inducing the resulting mi been described. (Oppenheim, A. B. et al., J. Mol. Biol. croorganisms to produce polypeptides encoded by the 15 (1982) 158, 327 and Shimatake, H. and Rosenberg, M., foreign DNA. Production of polypeptides can be con Nature (1981) 292, 128.) These publications describe the sidered a two-step process, each step including numer production of increased levels of CII protein but do not ous substeps. The two steps are transcription and trans involve or describe the production of eucaryotic prote lation. To produce a polypeptide efficiently and in S. quantity both steps must be efficient. Transcription is 20 In 1982 Shatzman and Rosenberg presented a poster the production of mRNA from the gene (DNA). Trans at the 14th Miami Winter Symposium (Shatzman, A. R. lation is the production of polypeptide from the mRNA. and Rosenberg, M., 14 Miami Winter Symposium, ab A critical substep of the transcription process is initia stract p981982). This abstract provides a non-enabling tion, i.e., the binding of RNA polymerase to a promot disclosure of the use of a vector containing PL from A er-operator region. The sequence of deoxyribonucleo 25 bacteriophage, Nut and the CII ribosomal binding site to tide bases which is the promoter region may vary and synthesize a “eucaryotic' polypeptide (SV40 small T thereby effect the promoter's relative efficiency which antigen is actually not a eucaryotic polypeptide but a depends on the affinity of the RNA polymerase for the viral protein) in an amount greater than 5% of the cell promoter. protein in an unnamed bacterial host. The operator used The efficiency of translation is affected by mRNA 30 is not defined. Neither an origin of replication nor a stability. Increased mRNA stability permits improved gene for a selectable phenotype is identified. This sys translation. Although the exact determinants of mRNA tem with which the vector is used is described as includ stability are not precisely known, it is known that ing certain host lysogens into which the vector can be mRNA secondary structure as determined by the se stably transformed. The present invention in one em quence of its bases has a role in stability. ' 35 bodiment, i.e., pMG100, may have certain similarities to The initial substep of translation involves binding of this vector. However, it is not transformed into a host the ribosome to a base sequence on the mRNA known lysogen, but rather into suitable E. coli host strains a the Shine-Dalgarno sequence or the ribosomal binding which contain the thermolabile repressor CI and the N site (RBS). The synthesis of polypeptides begins when gene but from which the rest of the lysogen has been the ribosome migrates along the mRNA to the AUG removed. Moreover, it has been employed to produce start codon for translation. Generally these codons are bGH and hCGH analogs in amounts in excess of 20% to . found approximately 10 bases "downstream' from the total cell protein. Shine-Dalgarno site. Factors which increase the effi In addition, in other embodiments of this invention ciency of translation include those which enhance bind ribosomal binding sites which differ from CII are em ing of the ribosomes to the Shine-Dalgarno site. It has 45 ployed. Also, in the presently most preferred vectors, been shown that the secondary structure of the mRNA pND5 and its derivatives, nonessential sequences have in the region of the Shine-Dalgarno sequence and the been removed to create a vector permitting polypeptide AUG codon and the distance between the Shine-Dal production in amounts which are more than 10% garno sequence and the AUG codon each plate a criti greater than those obtained with pMG100. cal role in determining the efficiency of translation are SO Recently, applicants have learned of the existence of premature termination and attenuation. Efficiency of a pending M. Rosenberg U.S. patent application Ser. translation can be improved by removing the attenua No. 457,352 by the National Institutes of Health, Dept. tion sites. of Health and Human Services, U.S.A. Portions of this A difficulty encountered in attempts to produce high application have been obtained from the National Tech amounts of eukaryotic polypeptides in bacterial cells 55 nical Information Service, U.S. Dept. of Commerce. involves the inability of cells producing large amounts However, the claims are not available and are main of mRNA to grow efficiently. This difficulty can be tained in confidence. The available portions of the ap eliminated by preventing transcription by a process plication have been reviewed. This disclosure is not known as repression. In repression genes are switched enabling. It indicates that the host is important (p8, line off due to the action of protein inhibitor (repressor 17) but fails to identify any suitable host. It further protein) which prevents transcription by binding to the depends upon the use of a M. mutant which is not speci operator region. After microorganisms have grown to fied (p4, line 20). It indicates that the host contains desired cell densities, the repressed genes are activated lysogens (p8, line 18) unlike the present invention in by destruction of the repressor or by addition of the which the host is not lysogenic. It mentions cloning and molecules known as inducers which overcome the ef 65 expression of a eucaryotic gene, monkey metalloth fect of the repressor. ionein gene, (p7, line 18) but does not provide details. It Numerous reports may be found in the literature specifies that neither the sequence nor the position of concerning the cloning of eucaryotic genes in plasmids any nucleotide in the CII ribosomal inding region has 4,871,835 3. been altered. (p3, line 27). In the present invention such GGAATTCC alteration is possible. No disclosure is present in the art concerning: suc CCTTAAGG cessful expression with a PL-CII containing vector sys tem of bovine or human growth hormones; production 5 was attached by ligation. The product was cleaved with of both or hCGH analogs having biological activity; EcoR1 and inserted into pBR322 which has been compositions containing such analogs or uses of them; cleaved with EcoR1. A clone, paLR1, was isolated or induction methods for achieving polypeptide pro which upon cleavage with EcoR1 released a 1200 bp duction in amounts greater than 20% of the total pro fragment with the sequence: tein produced by the host. O The only disclosure in the art concerning production of boH analogs by hosts transformed with genetically AATTCCCA. . . engineered vectors involves the use of the Trp pro GGGT, , , . moter to produce a bOH analog having the amino acid Met at the N-terminus of the phenylalanine form of 15 at the 5' end. Formation of this sequence demonstrates natural b0H (Seeburg, P. H. et al., DNA (1983) 2, 37. that pALR1 contains an EcoR1 restriction site which The only disclosure in the art concerning production includes the TTC codon for residue number 1 (phenyl of hCH analogs by hosts transformed with genetically alanine) of authentic both. p.ALR1 was subjected to a engineered vectors involves the use of the Lac and Trps partial cleavage with Pst1. The digest was ligated with promoters to produce an analog of hCGH having the 20 HindIII linkers and cleaved with EcoR1 and HindIII. amino acid Met at the N-terminus of the natural hCGH. The fragment containing bOH cDNA was isolated and (Goedell, D. V. et al., Nature (1979) 281, 544) subcloned into pbR322 between EcoR1 and HindIII restriction sites to give paL500. The subcloned bGH SUMMARY OF THE INVENTION cDNA fragment was then excised from paL500 with Analogs of hCH having the activity of naturally 25 EcoR1 and HindIII, "filled in” with DNA polymerase occurring hCGH and a similar amino acid sequence vary "Klenow' fragment and inserted into the pMG100 ex ing from the sequence of natural hCGH by the addition of pression vector (FIG. 1) opened at the BamH1 site and one or more amino acids, e.g. methione or meth also "filled in” as above. The resulting vector pREC ionineleucine, to the N-terminus of natural hCGH have 2/2, expresses a modified bOH which is altered at its been produced, recovered and purified. Such analogs 30 amino terminus as follows: may be incorporated into pharmaceutical compositions and administered to a subject to increase the level of MetAspGlnPhelPro2... bc.H hGH in the subject. Analogs of hCH which comprise the amino acid The plasmid pREC2/2 was disgested with Pst1 and the sequence of natural hCGH from the N-terminus of which 35 fragment containing the PL promoter and the 5' end of one or more amino acids have been deleted, e.g. the bCH gene (designated fragment A) was isolated. MethoH, have been produced, recovered and puri This fragment was ligated to a Pst1 fragment from pal fied. Such analogs may be incorporated into pharma 500 (designated fragment B). The then resulting vector, ceutical compositions and administered to a subject to pRec , expresses a modified bGH which is altered at its lower the level of hCGH in the subject. w amino terminus as follows: A plasmid has been constructed which directs the expression of an analog of hCGH having the amino acid MetAspG in PhelPro... boH sequence methionine-leucine added to the N-terminus of natural hCGH. This plasmid has been introduced into FIG. 3. Construction of expression vectors pND5, Escherichia coli, the resulting Escherichia coli grown and 45 pND55 and prC11. A plasmid poG7 (A. Oppenheim, the analog recovered and purified. S. Gottesman and M. Gottesman, J. Mol. Biol. (1982) 158, 327) was cleaved with Ndel. The ends of the large DESCRIPTION OF THE FIGURES fragment carrying the PL promoter nuti, tR and Cir FIG. 1 Construction of pMH100 expression vector. RBS were ligated to give the pND5 expression vector. This plasmid was built by inserting a fragment of M 50 This pND5 vector DNA is opened with Ndel. Insertion phage DNA contained between restriction sites HaeIII of that Ndel fragment from pRec (FIG. 2) which (location 38150) and Sau3a (location 38362) into a containsbGH cDNA results in a plasmid pRO11 which pKC30 plasmid DNA cleaved with Hpal and BamH. appears to be a better expressor of the modified bGH The Hae-Sau3a fragment carries nutr, tRi, cy- and described in FIG. 2 than pRec. Insertion of synthetic ribosomal binding site of CII protein (CII-RBS). Sub 55 linkers with the sequence: cloning of the Cir-RBS containing DNA into pKC30 creates pMG100 which contains a unique BamH1 re striction site right after the ATG initiation codon of TATGAGCTCA CII-RBS and an Ndel restriction site within the ATG ACTCGAGTAT triplet (bottom inset). Numbers in parentheses denote 60 location of restriction sites on the A phage DNA. into pog7 cleaved with Ndel results in a expression FIG. 2. Construction of pRec plasmid. A boH vector pND55 which contains a unique Sac1 restriction cDNA containing plasmid, D4, was digested with Ha site in front of ATG. When pND55 is cleaved with Sac1 eII. A resulting 1600 bp large fragment was purified and and treated with DNA polymerase “Klenow' fragment subjected to digestion at 37 C. for 5 minutes with 5 65 an ATG initiation codon results which follows the PL units of S1 exonuclease. A synthetic EcoR1 linker with promoter and CH-RBS. This vector is suitable for ex the sequence: pression of a wide variety of eukaryotic genes lacking an ATG initiation codon. 4,871,835 5 6 FIG. 4. Construction of pTV 18(1) and pTV 104(2). (b) a linker formed by synthesizing two DNA strands A plasmid, pTVHGH was prepared by cloning cDNA which after purification were annealed to form:

CCATATGTCCTTGTCCGGCCTGTTTGCCAACGCTGTGC GCGACACGAGGCCCGAGTCGTGGACGTGGTCGACG encoding hCGH into the HindIII site of pBR 322 using which was "filled in' with DNA polymerase “Kle standard methods. Meth. Enzymol. (1979) 68, 75. This now' fragment and then cleaved with Nde1 and plasmid was digested with HindIII. The resulting 800 10 PvuI to prepare a 58 base pair fragment which was base pair fragment was purified and further digested recovered and purified. with FnuDII and "filled in' with DNA polymerase (c) pND11 which was prepared as follows. An expres “Klenow' fragment. This treatment removes codons sion vector pCG7 was altered by elimination of Hin for the first 16 amino acids of hCGH. The resulting DNA dIII and one of the Ndel sites (distant from the ATG fragment is ligated with a synthetic linker which re- 15 initiator codon) to obtain pND6. Then HindIII link stores the codons for the sequence of hCGH from Met ers were introduced into a Sall site to give pND11. and regenerates an Ndel restriction site in front of the FIG. 14. Construction of authentic boH modified ATG codon for Met1. After treatment with Ndel this with methionine at the amino terminus and various semisynthetic DNA was inserted into the pND5 vector analogs of boh. opened with Nde1. The resulting plasmid pTV 1801) 20 (a) Plasmid pa A01 is treated with Ndel. A synthetic (formerly designated pTV 1(8) expresses hCH under DNA linker containing an ATG initiation signal and control of the PL promoter. This hCGH is an analog the code for the first three amino acids at the amino missing the first 13 amino acid residues and having at its terminus of native bCH is ligated into the Ndel site. N-terminus Met1. The resulting vector paL601 leads to the expression Plasmid pTV 18(1) was partially digested with Ndel 25 of native bCH containing an extra methionine residue and ligated with a synthetic linker which contains the at the amino terminus. codons for amino acids 1-13 of hCGH: (b) Using the strategy described in (a) but modifying the

TATGTCCCAACCATCCATTATCCCGTCTGTTCGACAACGC ACAAGGGTTGGTAAGGTAATAGGGCAGACAAGCTGTTGCGAT. The linker is also complementary to the Ndel site on structure of the oligodeoxyribonucleotide linker a pTV 18(1) and positions the complete hCH gene in class of vectors coding for a series of modified bovine phase with the ATG initiation codon of the pND5 ex- 35 growth hormones is constructed. The modified pression vector (FIG. 3). Thus, the resulting plasmid, growth hormones start with methionine at the N-ter pTV 104(2), expresses native hCGH with an extra methi- minus and are followed by any of the twenty natu onine at the N-terminus. rally occurring amino acids in each of positions 1 and FIG. 5 shows the vector paL Trp 46 which contains 2, and any of the twenty amino acids other than Glu, the Trp promoter and the first seven amino acids of the 40 Gln, Lys, Met or Trp in position.3. Proceeding from Trp E gene transcriptionally fused to the g-galactosi- position 4 to the COOH-terminus the sequence is dase gene. identical to that of native bGH. FIGS. 6, 7 and 8 show a series of expression vectors FIG. 15. Tibia test. This figure shows the comparison (Tac) containing a part of the Trp promoter and Lac between effect of pRec bGH analog and authentic operator followed by restriction sites for insertion of a 45 bOH on the bone plate growth of hypophysectomized desired gene and expression of bcH under the control rats. FIG. 16. Construction of pV 333(31). of Tac promoter. pTV333(31) (ATCC accession No. 39981) directs the FIGS. 9 and 10 show expression vectors containing expression of a novel hCGH analog having the sequence bGH cDNA under the control of the histidine pro- met-leu-hGH. pTV333(31) was constructed by adding note. 50 a synthetic oligonucleotide sequence to the 5' terminus FIG. 11 shows insertion of the bCH gene into an of the Met14.hgH of pTV18(1). (See FIG. 4). The syn expression vector under the control of the Lac pro- thetic oligonucleotide sequence added was:

TATGTTGTTCCCAACCATTCCATTATCCAGATTTTTGACAACGC 5' ACAACAAGGGTTGGTAAGGTAATAGGTCTGAAAAACTGTGCGAT

note. FIG. 12 shows expression of boH gene under control FIG. 17. Construction of pTV304(10).pTV304(10) is of Omp F promoter. 60 similar to pTV104(2) in that it directs the expression of FIG. 13. Construction of Met-bCH analog paL401 Met-hGH. and expression vectors pND6 and pND11 with altered It differs from pV104(2) in that the nucleotide se restriction sites: pAL401 which expresses a modified quence at the 5' end of the gene corresponds exactly to form of b0H which is lacking the first three amino that found in the human genome. pTV304(10) was con acids at the amino terminus of the bCH (MettbGH) was 65 structed by adding a synthetic oligonucleotide sequence constructed by triple ligation of the following: at the 5' end of the hCH gene in the plasmid pTV18(1). (a) abCH DNA fragment of 623 base pairs with PvulI (See FIG. 4). The sequence of the synthetic oligonucle and HindIII excised from paL500. otide was: 4,871,835 7

TATGTTCCCAACCATTCCATTATCCAGACTTTTTGACAACGC ACAAGGGTTGGTAAGGTAATAGGTCTGAAAAACTGTTGCGAT FIGS. 18-23 set forth results obtained in tests of the 5 the CI repressor is destroyed. A temperature above activity of hCGH analogs produced by pTV18(1) and about 42 C. is effective for this purpose and since it is pTV104(2). The tests are described more fully in Exam desired that unnecessary heat damage to the host cells ple 9. be avoided to as great an extent as possible, it is gener ally desirable that the temperature never exceed 42 C. DETAILED DESCRIPTION OF THE 10 by more than a few degrees. INVENTION One important component of the vector is the ribo A vector has been developed which enables the somal binding site. Suitable sites are CII from lambda achievement of enhanced levels of gene expression and bacteriophage having the sequence: polypeptide expression. The vector is a double-stranded DNA molecule. Upon introduction into a suitable bac- 15 TAAGGAAATACTTACAT terial host cell containing the thermolabile repressor CI and increasing the temperature of the host to a tempera ATTCCTTTATGAATGTA; ture at which the repressor is destroyed, the vector renders the host cell capable of effecting expression of a a synthetic oligonucleotide having the sequence: desired gene inserted into the vector and production of 20 polypeptide encoded by the gene. TAAGGAAGTACTTACAT The vector includes in 5' to 3’ order the following: a DNA sequence which contains the promoter and ATTCCTTCATGAATGTA; operator PLOL from lambda bacteriophage; and the N utilization site for binding antiterminator N 25 the major head protein gene of bacteriophage lambda protein produced by the host cell; having the sequence: a DNA sequence which contains a ribosomal binding site for rendering the mRNA of the desired gene capa TTTTTTTACGGGATTTTTTTATG ble of binding the ribosomes within the host cell; an ATG initiation codon or a DNA sequence which 30 AAAAAAATGCCCTAAAAAAATAC. is converted into an ATG initiation codon upon inser tion of the desired gene into the vector; and Another component of the vector is the restriction a restriction enzyme site for inserting the desired gene enzyme site for insertion of desired genes into the vec into the vector in phase with the ATG initiation codon. tor in phase with the ATG initiation codon. Numerous The vector also includes a DNA sequence which 35 such sites may be used. The presently preferred sites are contains an origin of replication from a bacterial plas BamH1, Sac1 and Ndel. mid capable of autonomous replication in the host cell The vector also includes an origin of replication from and a DNA sequence which contains a gene associated a bacterial plasmid capable of autonomous replication in with a selectable or identifiable phenotypic trait which the host cell. Suitable such origins of replication may be is manifested when the vector is present in the host cell. obtained from a number of sources. Presently preferred The host for use with the vector is Escherichia coli. are origins of replication derived from pBR322 or pR1. The presently preferred strains are A1637, A1645, A DNA sequence which contains a gene associated A2602 and A1563. Al637 is presently the most pre with a selectable or identifiable phenotypic trait which ferred strain. It was obtained from C600 by inserting is manifested when the vector is present in the host cell transposon containing tetracycline resistance gene 45 is also a component of the vector. Suitable genes in within the galactose operon as well as the lambda sys clude those associated with temperature sensitivity or tem for expression which is close to galactose operon. It drug resistance, e.g., resistance to ampicillin, chloram has been deposited with the American Type Culture phenicol or tetracycline. Collection in Rockville, Maryland, U.S.A. containing Relative to vectors previously described in the scien various plasmids as described more fully hereinafter. 50 tific literature, the vectors of this invention may be used All such deposits were made pursuant to the Budapest to obtain enhanced expression of a wide variety of genes Treaty on the International Recognition of the Deposit encoding desirable polypeptide products. Suitable of Microorganisms. genes include those encoding growth hormones, e.g., A1645 was obtained from A1637 by selection for bovine, porcine, chicken or human growth hormones; Gal (ability to ferment galactose) as well as loss of 55 superoxide dismutase; apoprotein E.; viral protein 1 of tetracycline resistance. It still contains the lambda ex foot and mouth disease virus, protein. A from S. aureus, pression system but part of the transposon has been interleukin III, enzymes, or analogs of any of the pre removed by selection. Its phenotype is C600 r-mit ceding. By analog is meant a polypeptide having the gait thr leu lac Z (AcI857 A. H1 ABAM N-(-). same activity as the naturally occurring polypeptide but A2602 and A1563 are derived from SA500. Their 60 having one or more different amino acids at the N-ter phenotypes are SA500 his ilu gall A8(MCI857AH1 minus of the polypeptide. ABAM N-- and SA500 his 0 illugal A8 lac ZXA21 The vector may be formed by methods well known (ACI859 int2xis1 nutL3 AH1), respectively. to those skilled in the art to which the invention relates. Preferably the vector is a covalently closed circular Such methods are described in greater detail in various double-stranded molecule. However, it is not essential 65 publications identified herein, the contents of which are that the vector be covalently closed. hereby incorporated by reference into the present dis The vector achieves its enhanced expression levels closure in order to provide complete information con after the host cell is heated to a temperature at which cerning the state of the art. 4,871,835 10 One presently preferred vector is pMG100 having (3) amino acid sequence Met-Asp-Gln added to N-ter the restriction map shown in FIG. 1. This vector has minus of the phenylalanine form of b0H. had cDNA encoding bovine growth hormone inserted (4) amino acid sequence Ala-Gly added to N-terminus into its BamH1 restriction site. The resulting plasmid is of the alanine form of both. designated pRec bGH. Its restriction map is shown in (5) amino acid sequence Met-Gly added to N-terminus FIG. 2. The plasmid pRec bGH was introduced into of the alanine form of b0H. Escherichia coli strain A1637 using conventional trans (6) amino acid sequence Met-Asp-Pro-Met-Gly added formation methods. The resulting host vector system to N-terminus of the alanine form of b0H. has been deposited under ATCC No. 39385. (7) amino acid sequence Met-Asp-Pro added to N-ter A second presently preferred vector is pND5 having 10 minus of the phenylalanine form of b0H. the restriction map shown in FIG. 3. Bovine growth (8) amino acid sequence Met-Thr-Arg added to N-ter hormone cDNA has been inserted into its Ndel restric minus of the phenylalanine form of boH. tion site. The resulting plasmid is designated pRO11. Its (9) amino acids up to methionine (4 position) removed restriction map is also shown in FIG. 3. The plasmid from N-terminus of phenylalanine form of boH. pRO11 was introduced into E. coli strain A1637 via 15 transformation. The host vector system which resulted An analog of b0H having the amino acid sequence: has been deposited under ATCC No. 39390. Met-CX-Y-Met ... The vector pND5 has also been used to clone human growth hormone. One plasmid designated plV 18(1) wherein Met is the N-terminus, X is any of the twenty and another designated pTV 104(2) have been created O naturally occurring amino acids, Y is any of the twenty by inserting hCGH cDNA into the Ndel restriction sites. amino acids other than Glu, Gln, Lys, Met or Trp, n is pTV 1801) is shown in FIG. 4. It has been introduced an integer from 0 to 6 and Met . . . is the sequence of into E. coli strain A1637 via transformation. The result natural boH from position 4 to the COOH-terminus ing host vector system has been deposited under ATCC (position 191). NO. 39386.pTV 104(2) is shown in FIG. 4. It also has 25 been introduced into E. coli strain A1637. The resulting hCGH analogs have the activity of natural hCGH and an host vector system has been deposited under ATCC identical amino acid sequence except for variations at No. 39384. the N-terminus. Examples include the following: Under the same approach other plasmids may be (1) amino acid methionine added to N-terminus of natu prepared by inserting into the restriction enzyme site of 30 ral hCGH, a vector of the invention a gene encoding a desired (2) amino acid sequence methionine-leucine added to polypeptide. the N-terminus of natural hCGh. The preceding specific host vector systems involve Each of these variations involve the addition of one E. coli A1637. However, as previously indicated other or more amino acids to the N-terminus of natural hCGH. strains have been used including A1645, A2606 and 35 In addition, this invention provides antagonists of A1563. These host vector systems may be used to pro hCGH activity which comprise the amino acid sequence duce polypeptides such as bovine and human growth of natural hCGH from which one or more amino acids hormones. To do so the host vector system is grown have been deleted. under suitable conditions permitting production of the One such analog of hCGH has the amino acid se polypeptide which is then recovered. quence: Suitable conditions involve growth of the host vector system for an appropriate period of time at about 42 C. Met-CX-Y-Met . . . followed by continued growth at about 37'-39 C. for an additional period of time, the growth being carried wherein Met is the N-terminus, X is any of the twenty out on a suitable medium. 45 naturally occurring amino acids, Y is any of the twenty Desirably the initial period of growth is about 10 to amino acids other than Glu, Gln, Lys, Met or Trp, n is 30 minutes at 42 C. followed by growth at 37-39 C. an integer from 0 to 13 and Met ... is the sequence of for a sufficient period of time such that the total period natural hCGH from position 14 to the COOH-terminus of growth is about 60 to 90 minutes. Preferably the (position 191). growth is for about 15 minutes at 42" C. followed by 50 Another such analog has the amino acid sequence of about 75 minutes at 38-39 C. Suitable media include natural hCGH from which the first thirteen amino acids lactalbumin hydrolysate with addition of glucose and have been removed to yield methione (14 position) at brain heart infusion. In order to stably maintain the the N-terminus followed by amino acids 15-191 of natu vector in the host it is critical that the host be main ral hCGH. tained under selective pressure, e.g., addition of antibi 55 Pharmaceutical compositions may be prepared which otic. contain effective amounts of one or more hCGH analog By means of the preceding method a number of boH having hCH activity and a suitable carrier. Such carri and hCGH analogs has been prepared. These have or ers are well-known to those skilled in the art. The ana may have the activity of the naturally occurring hor logs may be administered directly or in the form of a Oes. composition to a human subject, e.g., one afflicted by bGH analogs have the activity of natural boH and an dwarfism, to treat deficiencies in hCGH production by identical amino acid sequence except for variations at the subject. the N-terminus of up to five (5)amino acids. Examples Similarly, pharmaceutical compositions may be pre include the following: pared which contain effective amounts of one or more (1) amino acid methionine added to N-terminus of the 65 hGH analog having antagonistic hoH activity and a phenylalanine form of both. suitable carrier. Such carriers are well known to those (2) amino acid methionine added to N-terminus of the skilled in the art. The analogs may be administered alanine form of bOSH. directly or in the form of a composition to a human 4,871,835 11 12 subject, e.g. one producing excess hCH, to treat or titermination N protein. (Gottesman, M. E. et al., reduce such excess hCGH production by the subject. J.Mol.Biol. (1978) 140, 197). This vector has numerous advantages over previ EXAMPLES ously described expression vectors including: The examples which follow are set forth to aid in 5 1. Extremely High Levels of Expression: This vector understanding the invention by are not intended to, and is capable of directing expression of foreign proteins in should not be so construed as to, limit its scope in any E. coli at levels as high as 15-25% of the total cellular way. The examples do not include detailed descriptions protein. for conventional methods employed in the construction 2. Thermoinducible Regulation of Expression: The of vectors, the insertion of genes encoding polypeptides O PL promoter is inactive when the CI repressor is bound of interest into such vectors or the introduction of the to it. The CI857 repressor is thermosensitive, that is, it resulting plasmids into bacterial hosts. Such methods binds to the promoter at 30 C. but is inactivated at 42 are well-known to those skilled in the art and are de C. Thus, by increasing the temperature of fermentation scribed in numerous publications including the follow to 42 C. the host bacteria are induced to produce the ing: 15 desired protein. Principles of Gene Manipulation, An Introduction to The advantages of such a system include the follow Genetic Engineering, 2nd Edition, edited by R. W. Old 1ng: and S. B. Primrose, University of California Press (a) a foreign protein which is toxic to E. coli can be (1981). produced when desired thus avoiding cell death early Met. Enzymol. Vol. 68, Recombinant DNA, edited in the fermentation process. by Ray Wu, (b) overproduction of a protein may stabilize it and Met. Enzymol. Vol. 65, Nucleic Acids (Part 1), ed prevent proteolytic degradation. (Cheng, Y. E. et al., ited by Lawrence Grossman and Kivie Moldave. Gene (1981) 14, 121) Thus, “instantaneous' overpro T. Maniatis, E. F. Fritsch and J. Sambrook, Molecu duction using a tightly regulated promoter such as lar Cloning; A Laboratory Manual, Cold Spring Harbor PL may be preferable to continuous low level produc Laboratory, NY (1982). tion. H. V. Bernard et al., Gene (1979) 5, 59. 3. High Copy Number: The PL promoter in pMG100 A. B. Oppenheim et al., J. Mol. Biol. (1982) 158, 327. is found on a plasmid with a high copy number in dis E. Remaut et al., Gene (1981) 15, 81. tinction to A itself which is present in low copy numbers 30 in E. coli. This increases expression levels. EXAMPLE 1. 4. Ribosome Binding Site and Initiation Codon: This EXPRESSION VECTORS expression vector contains a strong procaryotic ribo somal binding site (RBS) as well as a translation initia As used herein the term expression vector refers to a tion codon (ATG). Thus, any eukaryotic gene may be group of plasmids useful for expressing desired genes in 35 bacteria, particularly in E. coli. The desired gene may be cloned without the need for adding an initiation codon. inserted into the expression vector or alternatively, the Furthermore, the efficient RBS increases levels of ex promoters on the expression vector may be excised and pression. 5. Convenient Restriction Site: The expression vector placed in front of the desired gene. has a BamHI site located directly following the ATG I. P. Expression Vectors initiation codon which permits proper positioning of the A. pMG 100 desired gene in order to achieve optimal expression. pMG 100, as shown in FIG. 1 and described in detail 6. Nut Site; N protein which is provided by the host under Description of the Figures is composed of A binds to Nut site on the expression vector and thereby DNA inserted into a multicopy plasmid pBR322. The 45 prevents termination of transcription at the tR site. salient features of the A DNA is that it contains the A B. pND5 PL promoter, Nutilization sites L and R (nutL and nutr) As shown in Fig. 3, pND5 contains the PL promoter termination R1 site (tR1), the CII ribosomal binding site and the other important components of the expression and an ATG initiation codon. Other features are shown vectors of this invention. It includes a unique Ndel site in F.G. 1, 50 immediately after the ribosomal binding site. The ribo pMG100 was prepared form pKC30, pKC30 in turn somal binding site differs from the normal CII site. It has was prepared by subcloning of A PL promoter in the the sequence: following manner. A phage DNA was digested with Xhol and Smal TAAGGAAGTACTTACAT restriction endonucleases and the unique fragment com 55 ATTCCTTCATGAATGTA prised of 6393 base pairs was purified and subsequently digested with HindIII and Ban.H1 restriction endonu It may be derived from a mutant or may be chemi cleases. The resulting fragment comprised of 2397 base cally synthesized. As described in detail under Descrip pairs and containing PL promoter was purified and li tion of the Figures pND5 was derived from pCO7. gated into a p3R322 DNA large fragmentisolated from 60 (Oppenheim, A., et. al., J.Mol.Biol. (1982) 158, 327) the HindIII and BamH1 digest. The subclone was iden This vector does not contain a translation initiation tified by colony hybridization, recovered and plasmid codon. It appears to provide superior expression of DNA isolated (Oppenheim, A. et al., J.Mol.Biol. (1982). modified bGH and hCGH, particularly enhanced yield 158, 327). relative to pMG100 containing a bOH analog. This plasmid and its derivatives containing eukary 65 C. pND55 otic genes may be maintained in suitable E. coli hosts. pND55 is a derivative of pND5 which contains the The most important feature of the host is that it pro convenient restriction site Sac1 in front of CII-RBS and vides the thermosensitive repressor CI857 and the an ATG initiation codon. Cleavage of the plasmid at this 4,871,835 13 14 site and subsequent treatment with DNA polymerase Ndel fragment from pRec (FIG. 2) which contains Klenow fragment allows one to obtain an ATG initia bGH cDNA results in the plasmid pRO11. tion codon to which any desired gene can be ligated. pRO11 has been introduced into E. coli A1637 by (FIG. 3 and Description of FIG. 3.) transformation. The resulting host vector system has been deposited under ATCC No. 39390. This strain was II. Trp Expression Vectors grown and induced produces the same analog as pRec A. pAL Trp 46 . Preliminary results indicate that pRO11 produces up pAL Trp 46 contains the Trp promoter and the first to 20% more bCH analog than pRec. The methods seven amino acids of the Trp E gene fused to the B used to grow the strain, recover the bCH analog pro galactosidase gene. (FIG. 5). The desired gene can be 10 duced and purify it are the same as those described for inserted into a BamHI site which follows the 7 amino pRec in Example 4. acids of Trp E. B. pal Trp 47; Trp 46 Deleted of Attenuator III. pal A01 This is a construction based on Trp 46 in which the The construction of pal A01 is shown in FIG. 13 and attenuator region of the Trp promoter has been deleted. 5 described in the Description of the Figures, b0H C. Trp-Lac Fusions cDNA from D4 by way of pa -500 (FIG. 2) was in The construction of this promoter, found on plasmid serted into pND11 as shown in FIG. 13. p4754 is illustrated in FIGS. 6 and 7. A variation of this pAL401 may be introduced into E. coli A1637 by construction is outlined in FIG. 8. 20 transformation. The resulting strain produces an analog III. Histidine Promoter Expression Vectors of boH in which Met of natural boH is at the N-ter minus and the amino acids preceding Met have been The construction of this expression vector is illus deleted. trated in FIGS. 9 and 10. IV. p.AL601 IV. Other Promoters Used 25 A. Lac The construction of pal601 is shown in FIG. 14 and This promoter was used in the construction of pYL described in the Description of the Figures. It is a deriv 301 as shown in FIG. 11. ative of palA01 (FIG. 13). B. Omp F pAL601 may be introduced into E. coli A1637 by This is a promoter system which expresses a protein 30 transformation. The resulting strain produces an analog attached to a signal sequence. The signal sequence is of both in which Met has been added to the N-terminus removed when the protein is translocated across the of the phenylalanine form of boH. membrane. (FIG. 12) EXAMPLE 3 EXAMPLE 2. 35 Human Growth Hormone Bovine Growth Hormone The starting point for hCGH cDNA was cloning of the The starting point for b6H cDNA modifications is cDNA from mRNA purified from hypophyses tumor plasmid D4 which has been described previously. from acromegalic patients into the HindIII site of (Keshet, E. et al, Nucleic Acids Research (1981) 9, 19). pBR322. The D4 plasmid is also described in pending U.S. patent I. p.TV 18(1) application, Ser. No. 245,943, filed Mar. 20, 1981, claim ing priority of Israel patent application, Ser. No. 59,690 The construction of PTV 18(1) is shown in FIG. 4 filed Mar. 24, 1980. It has previously been deposited and described in the Description of the Figures. hCGH with the American Type Culture Collection in an E. coli 45 cDNA was manipulated prior to insertion into pND5 to host under ATCC No. 31826. provide the correct reading frame. pTV 18(1) was introduced into E. coli A1637 by I. pRec bGH transformation. The resulting bacteria have been depos The construction of prec is shown in FIG. 2 and ited under ATCC No. 39386. This strain upon growth described in the Description of the Figures, b0H 50 and induction produces an analog of hCH having the cDNA from D4 has been manipulated prior to insertion sequence of natural hCGH beginning with Met1 and into PMG100 to provide the correct reading frame. lacking amino acids 1-13. The amount of hCH analog pRec has been introduced into various E. coli strains produced by pTV 18(1) was about 8% of the total pro including A1637 by transformation using known meth tein produced by the bacteria. ods. A1637 containing prec has been deposited under 55 ATCC No. 39385. This strain produces upon growth II. pTV 104(2) and induction an analog of both having the amino acid The construction of pTV 104(2) is shown in FIG. 4 sequence Met-Asp-Gln added to the N-terminus of the and described in the Description of the Figures. hCGH phenylalanine form of natural both. The amount of cDNA was manipulated prior to insertion into pND5 to bGH analog produced by prec was about 23% of the 60 provide the correct reading frame. total protein produced by the bacteria as calculated pTV 104(2) was introduced into E. coli A1637 by from scanning of Coomasie stained SDS polyacryl transformation. The resulting bacteria have been depos amide gels. ited under ATCC No. 39384. This strain upon growth and induction produces an analog of hCH having the pRO11 65 sequence of natural hCGH preceded by Met at the N-ter The construction of pRO11 is shown in FIG.3 and minus. The amount of hCGH analog produced by pTV described in the Description of the Figures. The pND5 104(2) was above 25% of the total protein produced by vector DNA is restricted with Nde1. Insertion of the the bacteria. 4,871,835 15 16 itate from both centrifugation steps is collected, washed EXAMPLE 4 with 50 mM Tris-Cl (pH 7.4) and resuspended in 500 ml Growth of pRec of the same buffer. Lysozyme is added to a final concen Stock Cultures: Stock cultures of prec in A1637 tration of 2 mg/ml and the suspension is incubated for 1 are grown on BHI medium (see inoculum), then diluted hour at 37 C. Triton X-100 is then added to a final twofold with 87% glycerol containing phosphate ci concentration of 1%, the suspension is cooled to 4' C. trate buffer, and stored at -70' C. and centrifuged at 20,000 rpm for 20 minutes in a Sor Inoculum: Inoculum is propagated in BHI medium vall SS34 rotor. The precipitate is collected, washed (37 g/1) brain heart infusion (DIFCO). Sterile medium twice with 50 mM Tris-Cl, resuspended in 500 ml of 50 in shake flask is inoculated from stock culture and incu 10 mM Tris-Cl (pH 7.4),5 mMMgCl2 and deoxyribonucle bated 15 hours on shaker at 30 C, 200 rp.m. Subse ase is added to a final concentration of 20 ug/ml. After quent stages in inoculum propagation are carried out in incubation for 30 minutes at room temperature the pre stirred aerated fermentors. Sterile medium is inoculated cipitate is collected as above, washed twice with 500 ml with 0.2 ml flask culture per l, and incubated 15 hours at of 20 mM Tris-Cl (pH 7.4), 100 mM. NaCl and 10 mM 30 C, pH 7-0.5 with agitation and aeration to main 15 EDTA, followed by two washings with 500 ml of dis tain dissolved oxygen level above 20% air saturation. tilled water. The precipitate is collected by centrifuga Production: Production medium contains: tion and can be stored at -20 C. for an indefinite time. At this stage the bCH is 80% pure as judged by sodium dodecyl sulfate-gel electrophoresis. The yield is approx Lactalbumin hydrolysate 20 (enzymatic) 20 g/1 imately 15 g of boH. Yeast extract 10 g/1 K2HPO4 2.5 g/1 Purification of boH NaC 10 g/1 Ampicillin 0.1 g/1 One hundred gr of precipitate is suspended in 40 ml Biotin 0.1 mg/1 distilled water and solubilized by titration with 0.5M Thiamine 1 mg/ 25 NaOH, pH 11.8. The solution is then sonicated for 2 Trace elements solution 3 m/ minutes and clarified by centrifugation at 20,000 rpm in a Sorval SS34 rotor for 20 minutes. The solution is then Ampicillin, biotin and thiamine in solution are filter applied onto a Sepharose CL-6B column (5X 100 cm) sterilized separately and added to the sterile production equilibrated with 6.5 mM borate buffer, pH 11.8. Col medium before inoculation. Sterile glucose solution is 30 umn is developed at the rate of 100 ml/hr and fractions added initially to supply 10 g/l, and during the induc of 12 ml are collected. The first peak off the column is tion and expression procedure to maintain glucose discarded. The following two peaks are separated and above 10 g/1 pooled. The first represents aggregated bGH with low Trace elements solution contains: activity; the second bOH with high ADEAE-Sephacel 35 (25 g/100 gr. equiv. ppt) column is equilibrated with 6.5 mM borate buffer, pH 9.0. The second bOH peak is MgSO4·7H2O brought to pH 9.0 with HCl loaded on the DEAE Se FeCl3 r ZnCl2.4H2O phacel column at a rate of 250 ml/hr. The column is CoCl26H2O washed with 7.5 ml of 6.5 mM borate buffer, pH 9.0, Na2MoC)4.2H2O eluted with 6.5 mM borate buffer, pH 9.0 containing 75 CaCl2.H2O mM NaCl. The fractions with OD280 above 0.3 are CuCl2 HBO3 0. pooled, dialysed against H2O in Millipore Pellicon dial Conic, HC 100 ysis apparatus and then lyophilized. 45 EXAMPLE 5 The medium is inoculated with 5-10% inoculum culture and incubated at 30 C. Agitation-aeration rates Activity of boHAnalog Produced by pRec 2/3 are set to maintain dissolved oxygen level above 20% 1. Radioimmunoassay comparison of boH analog air saturation. The pH is maintained at 7-0.2 with NH3. with natural both Once cell concentration reaches about 3 g/1 SO A solution containing 100 mg/ml bog analog was (OD660=10) induction is started. prepared in phosphate buffered saline (1% BSA). This Temperature is raised to 42 C. Maintained there for solution was diluted serially to concentrations of 50, 25, 15 minutes, then lowered to 38 C. Following incuba 12.5, 6.25, 3.12, 1.56 and 0.78 ng/l. Duplicate 0.1 ml tion at 38 C. for 1-1 hours, the culture is chilled, and aliquots of these solutions were submitted to RIA using cells are recovered by centrifugation for hormone puri 55 a double antibody procedure. The dilution curve was fication. comparable to that obtained with natural both. 2. Radioreceptor binding Assay Recovery of boH A radioreceptor binding assay was performed with One kilogram of bacterial cells is suspended in 10 rabbit liver membranes as described by T. Tushima and volumes of the solution containing 50 mM Tris-Cl (pH H. G. Freisen (Y. Chin, Endocr. Metab. (1973) 37,334 7.4), 50 mM EDTA and 25% sucrose in a Warring using 125I-hGH as the tracer and authentic boH solu blender, with a control of blender's speed to minimize tions for the construction of calibration curves. Samples foaming. The homogeneous suspension is continuously were incubated in triplicate for two hours at room tem passed through a Dynomill cell disruptor (Willy A. perature in 0.3 ml of assay buffer (50 mM Tris, 15 mM Bachofen, Basel) and the homogeneous suspension of 65 CaCl2 and 5 mg/ml bovine serum albumin, pH 7.6). The disrupted cells is clarified first by centrifugation in a tubes contained 125I-hGH (20,000 cpm of preparation of Sharpless centrifuge followed by a continuous centrifu 30-60 uci/ug), 150-250 ug liver membrane protein and gation at 20,000 rpm in a Sorvall centrifuge. The precip either natural b0H (1-100 ng) or extracts of bacterial 4,871,835 17 18 bGH. The result demonstrated that the bCH activity of The bCHs were put in solution with 0.1M NaHCO3 the bCH analog is comparable to that of natural boH. aqueous buffer (pH = 8.2) at the concentration of 1 3. Tibia Test mg/ml immediately prior to each day's injections. The The bioactivity of the pRec bGH analog recovered cows were injected with placebo or b6H solution daily from engineering bacterial cells according to Example 4 for 10 days in a subcutaneous site in the neck region. No was evaluated by a tibia test. (Parlow, A. F., et al., injections were given during the 5-day pretreatment Endocrinology (1965) 77, 1126.) Rats were hypophy period. sectomized at 28-30 days of age, then kept for 10-14 The cows were milked twice daily at approximately days without treatment. Bovine growth hormone de 6:00 a.m. and 5:00 p.m. Milk weights were recorded by rived from bovine pituitaries or from recombinant E. O coli was dissolved in 0.15M NaCl=0.01 Mborate, pH the Boumatic system and recorded in the dairy data 10.0. Rats (4-7 per group) received daily subcutaneous system. injections of b0H solutions (5-125 g/day in 0.2cc) for The average milk production values for the pretreat 5 days while kept on a normal diet (Purina Rat-Chow ment and bOH treatment periods are shown in Table II. and water ad-libitun). The animals were sacrificed on 15 The production level of the control cows was un the 6th day, their foreleg knee-bones taken out, cut changed while the milk volume increased to a similar longitudinally, fixed with acetone and stained with 2% degree in both the bCH groups. The natural boH AgNO3. The width of the epiphyseal plates were mea caused an 11.9% increase in milk for a 10-day period sured by observation through a dissecting binocular and bOH analog treatment resulted in a 10.2% increase. (Nikon). Mean values (of 40 readings per rat) were used 20 The data were not analyzed for statistical significance for the construction of log dose-response curves. Re due to the small number of animals, however, the mag sults are shown in FIG. 15. nitudes of the increases are similar to those reported in the literature. EXAMPLE 6 It was concluded that prec bOH stimulates lacto bGH Analogs 25 genesis in dairy cows similar to natural b0H. Table I sets forth a series of plasmids which have TABLE I been constructed and the analogs which were produced Bovine Growth Hormone Effect on Lactogenesis from them. Natural bgh vs prec bGH TABLE I Av. Daily Milk Production 30 b/day PLASMID AMNOTERMINUS OF b ANALOGS Treatinent Pretreatment During GH 76 Increase Over Rec Met Asp Gin Phe Group No. 5 days 10 days Pretreatment pB 1 Met Asp Pro Met Gly Ala Phe pM 4 Met Asp Pro Phe Control 6 57.23 57.26 w pM i Met Alal Phe Natural 5 58.54 65.50 11.9 pM2 Met Alal Phe 35 pAL 401 Met 25 mg/day pYL 301 Met Gly Alal Phe pRec 6 S7.48 63,34 10.2 pAL 302 11 A.A -- Ala Phe pHis 129 Met Thr Arg Phe 25 mg/day pAL 312 Met Gly Alal Phe pAL 322 Met Gly Alai Phe? pAL 601R Met Gly Alai Phe2 Each cow was injected daily subcutaneously will p 18 Met Gly Ala Phe PBTG-800 Met Glu Phe2 either placebo or b0H solution once daily for 10 days. pORF 2-12 Ala Giy Ala Phe EXAMPLE 8 45 Human Growth Hormone Analog EXAMPLE 7 The construction of pTV333(31) (ATCC accession Effect of prec bGH analog on Lactogenesis in Dairy No. 39981) is shown in FIG. 16 and described in the Cows Description of the Figures. The intermediate plasmids in the construction of pTV333(31) are shown in FIG. 4 The lactogenic effect of both has been well docu 50 mented in the scientific literature in the reports of Bines, and described in the Description of the Figures. J. etal, Brit J. Nutri. (1980) 43, 179 and Peel, C. et al., J. pTV333(31) was introduced into E. coli strain A2097 Nutr. (1981) 111, 1662. Bauman, D. et al, J. Dairy Sci. by transformation. This strain produces upon growth Vol. Supp. 1, Abst86 (1982) reported that milk produc and induction an analog of human growth hormone tion was increased by rDNA bGH. An experiment was 55 (hGH) having the amino acid sequence Met-Leu added conducted to determine the effects of pRec bGH on to the N-terminal amino acid phenylalanine of natural lactogenesis in comparison with natural boH. Eighteen hCH. The amount of hCH analog produced by this Holstein cows ranging from 141 to 154 days postpartum strain was about 6% of the total protein produced by were randomly assigned to treatment and blocked ac the bacteria as calculated by scanning the hCGH band on cording to milk production according to the following Coomassie blue stained SDS polyacrylamide gels and design. determining the total protein by the method of Lowry. Growth of prV333(31) Pretreatment Treatment Daily GH Injection I. Stock Cultures Control 5 days Saline 65 Stock cultures of pTV333(31) were grown on casein Natural bgh 5 days 25 mg/day for i0 days medium (see Inoculum), then diluted two-fold with pRec bOH 5 days 25 mg/day for 10 days freezing medium and stored at -80 C. Freezing me dium contains per 500 ml: 4,871,835 19 in FIG. 18. Duplicate 0.1 ml aliquots of these solutions K2HPO4 6.3 g were submitted to RIA using a double antibody proce KH2PO4 1.8 g. dure. The dilution curves are shown in FIG. 18. Na Citrate 0.45 g II. Radioreceptor binding assay MgSO4·7H2O 0.09 g A radioreceptor binding assay was performed with (NH4)2SO4 0.9 g Glycerol 44.0 g rabbit liver membranes as described by T. Tushima and H. G. Freisen Y. Chin, Endocr. Meta. (1973) 37, 334) using 125I-hGH as the tracer and authentic hoh solu II. Inoculum tions for the construction of calibration curves. Samples The inoculum was propagated in 20 g/l Tryptone 10, 10 g/ yeast extract and 2 NaCl. Sterile medium in a shake were incubated in triplicate for two hours at room tem flask was inoculated from stock culture and incubated perature 0.3 ml of assay buffer 50 mM Tris, 15 mM 15 hours on a shaker at 30 C. and approximately 200 Cacl2 and 5 mg/ml in bovine serum albumin, pH 7.6). r.p.m. As needed subsequent stages in inoculum propa The tubes contained 125hCGH (20,000 cpm of prepara gation were carried out in stirred aerated fermenters. 15 tion of 30-60 ci/ug), 150-250 ug liver membrane pro Sterile medium was inoculated with 2-10% inoculum tein and either natural hCGH (1-1,000 ng) or extracts of and incubated 15 hours at 30 C, pH 7-0.5 with agita bacterial hCGH analogs. The results shown in FIG. 19 tion and aeration to maintain a dissolved oxygen level demonstrated that the hCGH activity of the Met-hGH above 20% air saturation. analog is comparable to that of natural hCGH. III. Production. III. Tibia and Weight gain test The production medium contains: The bioactivity of the hCH analogs recovered from genetically engineered bacterial cells was evaluated by Tryptone 20 g/l. a tibia test. Parlow, A. F., et al., Endocrinology (1965) yeast extract 10 g/1 77, 1126. Rats were hypophysectomized at 28-30 days KHPO4 2.5 g/1 25 of age, then kept for 10-14 days without treatment. MgSO47H2O 1 g/1 Human growth hormone analogs derived from recom NaC 5 g/l. Biotin 0.1 mg/l binant Escherichia coli was dissolved in 0.15M Thiamine 1 mg/ NaCl=0.01M borate, pH 10.0. Rats (4-7 per group) Trace elements solution 3 m/ received daily subcutaneous injections of boH solu 30 tions in 0.2 cc for five days while kept on a normal diets The medium also contains 100 mg/liter amplicillin. (Purina Rat Chow and water ad-libitum). The amplicillin is optional for production but is always The rats were weighed at the start of the experiment found in the medium used for growing the inoculum. and before being sacrificed. FIGS. 20 and 21 show the Biotin, thiamine and amplicillin in concentrated solu increases in total body weight as a function of the tion were filter sterilized separately and added to the 35 growth hormone concentration in the daily injection. sterile production medium before inoculation. Sterile The animals were sacrificed on the sixth day, their glucose solution was added initially to supply 10 g/l. At foreleg knee bones taken out, cut longitudinally, fixed the induction step another 10 g/l of glucose was added. with acetone and stained with 2% AgNO3. The width The trace elements solution contains: of the epiphyseal plates were measured by observation 40 through a dissecting binocular (Nikon). Mean values (of FeCl3 40 readings per rat) were used for the construction of ZnCl24H2O log dose-response curves. Results are shown in FIGS. CoCl26H2O 22 and 23. Na2MoC)4.2H2O CaC22H2O 45 Purification of hCGH Analogs CuCl2 HBO3 One hundredg of precipitate is suspended in 40 ml Conc, HC s distilled water and solubilized by titration with 0.5M NaOH to pH 10.0. The solution was centrifuged (20,000 The medium is inoculated with 0.5-10% inoculum rpm in a Sorvall SS34 rotor for 20 minutes.) The super culture and incubated at 30 C. Agitation-aeration rates 50 natant was further titrated to pH 11.5 and then soni are set to maintain a dissolved oxygen level above 20% cated for two minutes and clarified by centrifugation at air saturation. The pHis maintained at 7-0.2 with NH3. 20,000 rpm in Sorvall SS34 rotor for 20 minutes. The Once cell concentration reaches about 3.5 g/1 solution is then applied onto a Sepharose CL-6B col (OD660=10) induction is started. umn (5x100 cm) equilibratd with 6.5 mMborate buffer, The temperature is raised to 42 C. and maintained at 55 pH 11.5. The column is developed at the rate of 100 42 C. for 1-5 hours. The culture is then chilled and mi/hr and fractions of 12 ml are collected. The first cells are recovered by centrifugation for hormone puri peak off the column is discarded. The following two fication. peaks are separated and pooled. The first represents aggregated hCH with low activity; the second hCGH EXAMPLE 9 with high activity. Activity of hCHAnalogs Produced by pTV18(1) and A DEAE-Sephacel (25 g/100 g equiv. ppt) column is pTV104(2) equilibrated with 6.5 mM borate buffer, pH 9.8. The I. Radioimmunoassay comparison of hCGH analogs second hCH peak is brought to pH 9.8 with HCl loaded with natural hCGH 65 on the DEAE Sephacel column at a rate of 250 ml/hr. Solutions containing 1000 ng/ml hCGH analogs were The Column is washed with 7.5 ml of 6.5 mM borate prepared in phosphate buffered saline (1% BSA). These buffer, pH 9.8 containing 100 mM. NaCl. The fractions solutions were diluted serially to concentrations shown with OD280 above 0.3 are pooled, dialysed against H2O 4,871,835 21 22 in Millipore Pellicon dialysis apparatus and then lyophi HS (10%), 2-mercaptoethanol (10M), penicillin (50 lized. U/ml) and streptomycin 50 g/ml), which produced a doubling time of approximately 20 h. Stationary cul EXAMPLE O tures were obtained by removing FCS from the medium Activity of hCGH Analog Produced by pTV18(1) 20-24 hr prior to the addition of the hormone. An incu Lactogenic properties of human growth hormone bation atmosphere of 5% CO2-95% are used for cell were described over 20 years ago (1) and were con culture. Growth of Nb2 cells was quantified according firmed in several species including mice (2) parimates to the bioassay of Tanaka, et al. (6) with minor modifi (3) and cows (4). One of the most specific, accurate and cations. Growing cells were transferred to a non sensitive bioassays for lactogenic hormones is based on 10 growth medium (i.e. without FCS) for 20-24 h. Cells its mitogenic effect on NB2 rat lymphoma cells. These were collected by centrifugation (500Xg) and resus cells are absolutely dependent on PRL, hCGH or other pended or directly diluted in a fresh medium (without lactogenic hormones for their proliferation when cul FCS) at a concentration of 1-2 x 105 cells/ml. Two ml tured in 10% horse serum supplemented medium (5-7). aliquots were pipetted into 35 mm tissue cultures dishes This assay therefore was chosen to study the in vitro 15 (Nunc, Kamstrup, Denmark). Samples to be assayed for effect of the new 20K derivative of hCGH (Met1.hCGH, growth-promoting or inhibiting activity were added to 14-191) obtained by recombinant DNA technology. An additional bioassay used in the present study was the the dishes in a volume of 0.05-0.10 ml. Following a stimulation of fat synthesis in explants from bovine 3-day incubation period, the contents of each dish were 20 added to 8 ml Isoton (Fisher Scientific Co., Pittsburgh, lactating mammary tissue which was found (4) to be PA) and cell number was determined using a Coulter highly dependent upon the presence of bRRL, oPRL or Counter (Coulter Electronics Inc., Hialeah, FL). Each hCGH, sample was assayed in duplicate. Materials and Methods Bovine lactating mammary gland explants culture Materials 25 Preparation of explants from bovine lactating mam Human growth hormone (hGH-83-8-29 H 2.2 mary tissue was carried out as described previously and IU/mg) was prepared in our laboratory; Ovine PRL the media were changed every 24 h (11). Fat synthesis (oPRL, (oPRL; NIH-P-S12, 35 IU/mg) and bovine was determined by measuring incorporation of PRL (bFRL, 86) were obtained from the Hormone CH31COOH to the fatty acid fraction for 4 h, after 4 Distribution Program, National Institutes of Health, 30 days of culture and a selected hormonal regime (4). Department of Health and Human Services, U.S.A. Glucose uptake was determined by measuring the glu Radioiodinated hCGH (125I-hGH) was prepared as cose content of the medium prior to and after incuba described earlier (8, 9). Carrier-free Na125I and tion. CH3(1CHOOH (56 mCi/mmole) were purchased Binding experiments from New England Nuclear Corp. (Boston, MA, 35 Binding studies were performed using 125I-hCGH in U.S.A.). Monoclonal antibodies against hCGH were pre intact Nb2 cells (12) or microsomal solubilized fraction pared (10). Human growth hormone analog lacking 13 prepared from lactating bovine mammary gland (9). amino acids at the amino terminus, beginning with the The non-specific binding was determined in the pres amino acid methionine which is naturally located at ence of 1 g/ml and 4 g/ml of hCH respectively. residue no. 14 (Met1.hCGH) was produced in the effi 40 Statistical analysis : cient host-vector system described herein which ex Statistical analyses were performed by a two-tailed pressed this polypeptide at a level of more than 15% of Student's t test for unpaired comparisons. All paramet total bacterial protein. Gram quantities of the hormone were purified to a high degree (generally 80% purity). ric data were exposed as an average SEM. 15% NaDodSO4/polyacrylamide gel electrophoresis in 45 Results presence of 3-mercaptoethanol gave an expected 20K Antagonistic effect of MetlhCGH on oPRL or hCGH dalton band, and analytical isoelectrofocusing revealed stimulated proliferation of Nb2 cells that the isoelectric point is close to that of native hCGH. Simultaneous addition of MethoH and either When lypholized and kept at 4 C. or lower, the protein oPRL or hCGH resulted in an obvious inhibition of the was quite stable, although after a few months of storage 50 low molecular weight products could be detected even proliferation rate as compared to controls without in the absence of mercaptoethanol. Thus the material MethoH. The inhibition was dose-dependent and used in this study consisted of the main 20K band competitive, that is, it could be reduced by increased (~80%) and few low molecular wight bands (-20%). levels of oPRL or hCGH, while the maximal prolifera However, the molecule exhibited a marked degree of 55 tion rate was not affected. The inhibition could be to instability upon storage in neutral solutions with rapid tally abolished by increasing the concentration of the accumulation of breakdown products. Met1.hGH was agonist (Table 1). Meth0H alone had no effect on cell tested for immunological cross-reactivity with rabbit growth and the number of cells in cultures containing anti-hGH. It was found to be capable of displacing the 1-10000 ng/ml of Meth0H did not differ significantly 2I-hGH but the displacement curve did not parallel from controls without any hormones. In an additional that of hCH, indicating only partial cross-reactivity. experiment, the cells were preincubated for 24 h in the Nb2 lymphoma cells culture presence of 20 g/ml of MetlhCGH. Then they were Suspension cultures of Nb2 lymphoma cells (Nb2 washed extensively and incubated for an additional 3 11C) were maintained in 75 cm2 tissue culture flasks days in the presence of 0.125 and 1.0 ng hoH/ml. The (Nunc, Kamstrup, Denmark). Culture conditions were 65 increase in cell numbers was measured every day and those described by Gout, et al. (5). To stimulate maxi no difference in the proliferation rate, as compared to mal cell growth, cells were cultured in Fischer's me cells preincubated in medium only, was observed. In all dium (for leukemic mouse cells) containing FCS (10%) experiments, the inclusion of Met1.h6H in the medium 4,871,835 23 24 did not affect cell shape or viability as observed micro- Inhibition of PRL stimulated fat synthesis in explants scopically. from bovine lactating mammary glands by Meth0H TABLE 1. The results presented in Table 3 clearly indicate that bPRL-stimulated fat synthesis was drastically inhibited inhibitionEffect of ofexcess Nb2 hoHlymphoma or oPRL cells on by the MethgH growth 5 in explants cultured in the presence of 10-50 g/ml No. of doublings in presence of Meth0H/ml. Moreover, in explants from Cows no. 1 Hormone MethoH (g/ml). and 4, MethoH also significantly inhibited fat synthe added ng/ml None 2 10 sis in the absence of bPRL Analysis of the data again GH 100 2.25 0.01 2.29 0,0. 2,31 - 0.02 suggested competitive inhibition although it was less 25 2.29 0.02 2.29 0.01 2.30 0.01 10 obvious than in the experiments using Nb2 cells. Glu 2.20 at 0.02 1.91 - 0.01$ 0.97 -- 0.02S cose uptake, which served as an index of explant viabil OPR 2. i i 88: i. i 8: i. i 88s ity (4) was not affected by various hormonal regimes 2 2.20 - 0.01X- 2.06 - 0.03a 1.22 a : 0.01Sve including addition of MethoH.i4 It should be noted Througha seM,68 h, initial concentration of cells was 150000 cell/ml 15 thatsignificantly in the absence(p<0.05) of increased Met14.hGH fat synthesis,addition ofalthough bPRL * Significantly different from the control without MethoH. (p < 0.01). in explants from some cows (2, 3 and 5) the maximal Sas above (p<0.001). effect was not reached at 0.2 g PRL/ml. Binding studies In order to validate the similarity of MethoH to the Binding studies with intact Nb2 cells or with solubi native hormone, growth of Nb2 cells was stimulated by 2O lized microsomal fraction from bovine lactating mam oPRL and inhibited by addition of Met1-hGH. Then mary gland revealed Meth0H to be capable of inhib the inhibitory effect of the latter was abolished by iting the specific binding of 125I-hGH in both cases. TABLE 2. Effect of monoclonal antibodies against high on the growth of oPRL-stimulated Nb2 lymphoma cells by MethoH No. of doublings in presence of oPRL (ng/ml): Antibody Final 1,000 0,125 added dilution -MethoH --MethoH -MethoH --MethoH None m 2.13 - 0.01 1.23 - 0.04 1.14 - 0.03 0.42 + 0.05 anti-hige 1:100 2.11 - 0,02 23 0.01 .16 0.03 0.44 - 0.02 anti-hGH 1:100 2.1 0.02 2.09 it 0.06 1.19 - 0.03 1.4 - 0.01 anti-hGH 1:400 2.0 0.02 1.92 0.03 1.4 0.01 0.98 - 0.03 anti-hGH 1:600 2.1 0.01 168 0.01 1.1 - 0.02 0.62- 0.02 anti-hGH i:6400 2.0 - 0.02 1.46 - 0.01 1.12 - 0.01 0.5 - 0.02 Asciitic fluids tav ESEM, n = 2, through 66 h. 12 g/ml Significantly different from the respective control without MethoH (p<0.001).

TABLE 3 Effect of various concentrations of bpril on the inhibition of the bPRL stimulated . fatty acid synthesis by Methgh in explants from bovine lactating mammary gland Fatty acid synthesis (dipm/ng/4 h) in the presence of various MethoH concentrations of bPRL (ug/ml):'t Cow no. (ug/ml) 0 0.2 10 2.0 20.0 O 3814 - 89 5064 326 5809 393 ND ND O ND 320 - 93 4812 - 258 ND ND 50 322 88 32S7 - 259 2682 - 19 ND NO 2 O 476 55 8S9 47 1033 57 ND Nd 10 ND 549 47 598 39 ND ND 50 486 - 45 525, 29 52s 57 ND ND 3 O 822 - 3S 496 366 ND ND 2080 322 20 793 - 80 06 6 ND NO 1300 181 4. O 2046 - 241 2981 24 ND 2979 - 236 2280 - 258 20 088 148 1266 ND 1496 175 1696 186 5 O 449 - 37 735 - 50 ND 1150 118 1048 - 88 44 21 778 - 56 ND 896 - 50 881 - 80 2S 514 12 612 60 ND 994 57 724 - 47 10 430 - 12 43 45 ND 743 - 56 64S 58 "All treatments included insulin ( 1 g/ml) and hydrocortisone (0.5 g/ml) hav SEM, n = 6 Significantly different from the respective treatment without MethoH: (p < 0.05) as above (p<0.01) as above (p<0.0001) monoclonal antibodies against high. As shown in Table 2, the abolition was dose dependent and specific since asciitic fluid containing anti-higE antibodies failed to affect the response. It should be noted that two other 65 Full or almost full displacement of the ligand could be anti-hGH monoclonal antibodies also abolished the achieved but the amounts of Meth0H required for inhibitory activity of Met14.hCGH while anti-hPRL 50% of displacement were respectively 83- and 35-fold monoclonal antibody was devoid of this effect. higher than those of hCGH. 4,871,835 25 26 material gave a single 20K band on NaDodSO4/polya Discussion crylamide gel electrophoresis and retained its full inhib Utilization of two separate bioassay systems enabled itory activity against oRRL-stimulated proliferation of us to demonstrate clearly that the recombinant Nb2 cells (data not shown). MetlhCGH inhibits hCGH- and opRL-stimulated mito To our knowledge this is the first report describing genesis of Nb2 lymphoma cells and bpRL-stimulated inhibition of hCGH activity by a modified hCGH. Careful fat synthesis in explants of bovine lactating mammary examination of the data compiled by Paladini, et al. (13) gland. In the latter system Meth0H also inhibited reveals that removal of the N-terminal portion of hCGH (cows no. 3-5) bpRL stimulated secretion of a-lactalbu drastically reduced and in most cases absolutely abol min (not shown), thus implying more general inhibition ished its lactogenic or somatotrophic activity. The in of prolactic action. It should be noted that in both sys O portance of the N-terminal part of oPRL for its in vivo tems the inhibition did not result from impaired cell mitogenic activity also has been reported (14). In view viability. No cytotoxic effect was found in Nb2 cells of these results and our present findings it seems that the exposed to Meth0H. Glucose uptake in mammary N-terminal part of these hormones is obligatory for gland explants was not affected by various treatments. expression of activity. Its removal may cause inactiva It should be noted that in cows no. 1 and 4 MethoH 15 tion or even conversion of an agonist to antagonist. It also inhibited basal activity. The reason for this is not should also be remembered that in both systems used in clear but may be related to a much higher intrinsic fat synthesis in these cows. Whether the latter results from our experiments the hormonal effect was mediated carryover of endogenous prolactic or PRL-stimulated through lactogenic receptors. Whether similar inhibi activity is not clear. tory effect of MethoH can be found in somatotrophic Binding experiments revealed that MethoH com receptor-mediated activity has yet to be investigated. petes with 125I-hGH although its affinity is lower than REFERENCES that of hCGH. These results imply that Meth0H may 1. Chadwick, S., Folley, S.J., & Forsyth, I. A. (1961) act as an antagonist, namely blocking the agonist at the Lancet, 2, 241-243. receptor or post-receptor level. The maximal rate of 25 proliferation was not changed by the inhibitor but the 2. Doneen, B. (1976) Gen. Comp. Endocrinol., 34, apparent affinity of either oPRL or hCGH was de 34-42. creased. Although the biological significance of this 3. Kleinberg, D. L. & Todd, J. (1980) J. Clin. Endo constant is not clear since it is a function of both binding crinol, Met. 51, 1009-1013. and post-binding events its value in the absence of 4. Gertler, A., Cohen, N. & Maoz, A. (1983) Mol. Cell. Met14.h6H(3.85 pM for hCGH and 2.95 pM for oPRL) is 30 Endocrinol, 33, 169-182. close to the value of 5.8 pM of 125I-hPRL required for 5. Gout, P. W., Beer, C.T. & Nobel, P.R. (1980) Cancer half-maximal growth of the cells (7). It was found that Res., 40, 2433-2446. in order to achieve 50% growth inhibition 103-10 6. Tanaka, T., Shieu, R. P. C., Gout, P. W., Beer, C. T., molar excess of MethoH were needed, despite the Noble, R. L. & Friesen, H. G. (1980) J. Clin. Endo fact that the affinity to bind to intact cells in only -85 35 crinol, Met, 51, 1058-1063. fold lower. This may be related to the finding that full 7. Shiu, R. P. C., Elsholtz, H. P., Tanaka, T., Friesen, H. growth response may be achieved at 35% receptor G., Gout, P. W., Beer, C. T. & Noble, R. L. (1983) occupancy (7). Endocrinology, 113, 159-165. Unlike in Nb2 cells, the competitive inhibition of 8. Shiu, R. P. C., (1979) Cancer Res, 39, 4381-4386. bPRL stimulated fat synthesis in explants is much less 40 9. Gertler, A., Ashkenazi, A. & Madar, Z. (1984) Mol. obvious. A trend showing this direction was seen in Cell. Endocrinol, 34, 51-57. cow number 1 where the inhibition with 10 g/ml of 10. Bundeson, P., Drake, R. G., Kelly, K., Worsley, I. MetgoH was significantly lower at 0.2 g/ml, than at G., Friesen, H. G. & Sehon, A. (1981) J. Clin Endo 1.0 g/ml, and to a lesser degree in cow numbers 2, 4 crinol Met, 51, 1472-1474. and 5. In the latter case, 10 g/ml of Met1-hCGH abso 45 11. Gertler, A., Weil, A. & Cohen, N. (1982) J. Dairy lutely abolished PRL stimulation at the 0.2 g/ml, Res., 49, 387-398. while at 2 and 20 g bFRL/ml there was only partial 12. Gertler, A., Walker, A. & Friesen, H. G. (1985) inhibition. It should be remembered that the explants Endocrinology (in press). consist of primary cultures that are much more variable 13. Paladini, A. C., Pena, C. & Poskus, E. (1983) CRC, to the absolute and relative hormonal stimulation than Critical Reviews in Biochemistry, 15, 1-56. 14. Mittra, the Nb2 cells. The explant system seems also to be more 50 I. (1980) Biochem. Biophys. Res. Commun, 95, sensitive, and significant inhibition was achieved in 1760-1767. 0.5-50 MethoH/bPRL molar ratios. Although the What is claimed is: apparent affinity constant for the binding of hCGH to the 1. A polypeptide which inhibits the activity of natu mammary gland receptors is 20-35 fold higher than for rally-occurring human growth hormone (hGH) or natu Meth0H we have previously demonstrated (9) that it 55 rally-occurring prolactin (PRL), said polypeptide hav is also 20-fold higher than for bpRL thus making the ing the sequence of naturally-occurring high from binding constant of the latter and the Met1.hgH quite what the first thirteen amino acids have been deleted comparable. and which has the methionine which occurs at position The finding that the preparation of MetlhCGH used 14 of the naturally-occurring polypeptide at the N-ter in this investigation also contained some low molecular minus. weight degradation products raises a possibility that 2. A pharmaceutical composition comprising an ef. they, rather than the main 20K band, may be responsi fective amount of the polypeptide of claim 1 and a suit ble for the inhibitory effect. The fact that monoclonal able carrier. antibodies against hoH abolished the inhibitory activity 3. A method of treating human growth hormone of Meth0H argues against this suggestion. In addi 65 (hGH) excess or prolactin (PRL) excess which com tion, we have purified small amounts of Met14.hGH by prises administering to a subject having such an excess immunoaffinity chromatography on anti-hGH mono an effective amount of the polypeptide of claim 1. clonal antibody coupled to Sepharose. The purified