Overexpression of C-Myc in ␤-Cells of Transgenic Mice Causes Proliferation and Apoptosis, Downregulation of Insulin Gene Expression, and Diabetes D

Home , Period (gene)

Overexpression of c-Myc in ␤-Cells of Transgenic Mice Causes Proliferation and Apoptosis, Downregulation of Insulin Gene Expression, and Diabetes D. Ross Laybutt,1 Gordon C. Weir,1 Hideaki Kaneto,1 Judith Lebet,1 Richard D. Palmiter,2 Arun Sharma,1 and Susan Bonner-Weir1

To test the hypothesis that c-Myc plays an important role in ␤-cell growth and differentiation, we generated transgenic mice overexpressing c-Myc in ␤-cells under ancreatic ␤-cell failure is fundamental to the control of the rat insulin II promoter. F1 transgenic pathogenesis of all forms of diabetes (1,2). Stud- mice from two founders developed neonatal diabetes ies from animal models suggest that, for the most (associated with reduced plasma insulin levels) and part, ␤-cells have a remarkable capacity to in- died of hyperglycemia 3 days after birth. In pancreata of P crease their mass and secretion to maintain plasma glu- transgenic mice, marked hyperplasia of cells with an altered phenotype and amorphous islet organization cose levels within a narrow range, even in the presence of was displayed: islet volume was increased threefold obesity and insulin resistance (1–4). Diabetes develops versus wild-type littermates. Apoptotic nuclei were in- only when this compensation is inadequate. creased fourfold in transgenic versus wild-type mice, In animal models of diabetes, ␤-cells have been found to suggesting an increased turnover of ␤-cells. Very few lose the unique differentiation that optimizes glucose- cells immunostained for insulin; pancreatic insulin induced insulin secretion and synthesis (5,6). Thus, mRNA and content were markedly reduced. GLUT2 genes that are highly expressed (insulin, GLUT2, and ␤ mRNA was decreased, but other -cell–associated genes PDX-1 [pancreatic and duodenal homeobox-1]) are de- (IAPP [islet amyloid pancreatic polypeptide], PDX-1 [pancreatic and duodenal homeobox-1], and BETA2/ creased with diabetes, whereas several genes that are NeuroD) were expressed at near-normal levels. Immu- normally suppressed (LDH-A [lactate dehydrogenase nostaining for both GLUT2 and Nkx6.1 was mainly A], hexokinase I, and glucose-6-phosphatase) have in- cytoplasmic. The defect in ␤-cell phenotype in trans- creased expression, which could be deleterious to func- genic embryos (embryonic days 17–18) and neonates tion. We hypothesized that this loss of ␤-cell differentiation (days 1–2) was similar and, therefore, was not second- contributes to a loss of glucose-induced insulin secretion ary to overt hyperglycemia. When pancreata were trans- (6,7). A reduction in ␤-cell mass is usually associated with planted under the kidney capsules of athymic mice to progression to the diabetic state, which appears, in some analyze the long-term effects of c-Myc activation, ␤-cell depletion was found, suggesting that, ultimately, apo- models, to be due to increased apoptosis (4,8,9). The ptosis predominates over proliferation. In conclusion, mechanisms responsible for the balance between compen- these studies demonstrate that activation of c-Myc in sation and decompensation are not clear. In the partially ␤-cells leads to 1) increased proliferation and apopto- pancreatectomized (Px) rat model of diabetes, we recently sis, 2) initial hyperplasia with amorphous islet organi- found a loss of ␤-cell differentiation, as well as ␤-cell zation, and 3) selective downregulation of insulin gene hypertrophy, that was associated with increased expres- expression and the development of overt diabetes. sion of the transcription factor c-Myc (6). Diabetes 51:1793–1804, 2002 c-Myc is a basic helix-loop-helix (bHLH) leucine zipper (bHLH-Zip) transcription factor that has been extensively studied as a protooncogene but is also essential for normal cell cycle progression (10–12). In some non–␤-cell tissues, c-Myc promotes cell growth and proliferation, whereas in others it induces or sensitizes cells to apoptosis (13–15). Importantly, c-Myc–induced activation of the cell cycle From the 1Section of Islet Transplantation and Cell Biology, Joslin Diabetes may inhibit differentiation (16), induce changes in gene Center, Boston, Massachusetts; and the 2Howard Hughes Medical Institute, expression including increased LDH-A (11,12,14), and lead University of Washington, Seattle, Washington. to cell hypertrophy (17). Address correspondence and reprint requests to Susan Bonner-Weir, Islet Transplantation and Cell Biology, Joslin Diabetes Center, One Joslin Place, Normal adult islets have low c-Myc expression (6,18), Boston, MA 02215. E-mail: [email protected]. which is then consistent with a low replication rate (1). Received for publication 27 August 2001 and accepted in revised form 27 February 2002. Because c-Myc expression is increased in islets of diabetic bHLH, basic helix-loop-helix; E, embryonic day; FITC, ﬂuorescein isothio- rats (6,19) and is known to stimulate proliferation, hyper- cyanate; hGH, human growth hormone; IAPP, islet amyloid polypeptide; trophy, and dedifferentiation of other cell types, we hy- LDH-A, lactate dehydrogenase A; PDX-1, pancreatic and duodenal ho- ␤ meobox-1; Px, partial pancreatectomy; TUNEL, terminal deoxynucleotidyl pothesized that overexpression of c-Myc in -cells might transferase–mediated dUTP nick-end labeling. lead to a phenotype resembling that found in diabetes. To

DIABETES, VOL. 51, JUNE 2002 1793 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

ﬁed with 40 cycles of PCR and visualized using ethidium bromide in 1.5% agarose gels (Fig. 1B). Tissue ﬁxation, histology, and immunohistochemistry. Pancreata from embryonic (embryonic day 17–18 [E17–18]) and neonate (day of birth and 1

and 2 days after birth) F1 progeny of RIP-II/c-myc transgenic mice were dissected and fixed by immersion in 4% buffered formaldehyde. After embedding in paraffin, 5- to 7-␮m sections were used for histology and immuno- chemistry. Hematoxylin-stained sections were used for direct microscopic examination. Islet relative volume was measured by point-counting morphom- etry. All sections were read by one observer (S.B.-W.). Apoptotic and mitotic cells were quantified in hematoxylin-stained pancreatic sections as mitotic figures or characteristic condensed or fragmented nuclei of apoptotic cells.

Proliferation was assessed with Ki-67 antibody (1:200; PharMingen) counter- stained with hematoxylin. Terminal deoxynucleotidyl transferase–mediated dUTP nick-end labeling (TUNEL) staining was performed according to the manufacturer’s instructions (in situ cell death detection POD kit; Roche) on

sections of blocks used for Ki-67 staining and apoptosis counting by morpho- logic criteria. For immunohistochemistry, primary antibodies were guinea-pig anti-human insulin (1:200; Linco Research, St. Charles, MO); a cocktail of rabbit anti-bovine glucagon (1:2,000, gift of M. Appel, Worcester, MA), rabbit anti-bovine pancreatic polypeptide (1:3,000, gift of R.E. Chance, Eli Lilly, Indianapolis, IN), and rabbit antisynthetic somatostatin (1:300, made in our laboratory) for identifying non–␤-cell hormones; rabbit anti-mouse GLUT2 (gift of B. Thorens, Lausanne, Switzerland); anti–PDX-1 (1:7,500, gift of J. Habener, Boston, MA); and anti-Nkx6.1 (1:2,000, gift of P. Serup, Hagedorn, Gentofte, Denmark). The secondary antibodies used for immunofluorescence were, for insulin, Texas red–conjugated Affinipure donkey anti–guinea pig IgG ␤ FIG. 1. Schematic of the transgene construct and genotype analysis. A: (1:100); for the non– -cell hormones, fluorescein isothiocyanate (FITC)- The 0.6-kb region of the rat insulin II promoter directs islet-specific conjugated donkey anti-rabbit IgG and streptavidin-conjugated FITC (1:100); expression of exons 2 and 3 of the mouse c-myc gene, which contain the for GLUT2, FITC-conjugated donkey anti-rabbit IgG (1:400); for PDX-1, -entire coding sequence. hGH polyA indicates the 3؅ untranslated region donkey biotinylated anti-rabbit IgG (1:400) followed by streptavidin-conju of the human growth hormone gene. The oligonucleotide primers, gated Texas red (1:400); and for Nkx6.1, donkey biotinylated anti-rabbit IgG restriction enzymes, and probes used for genotyping by PCR and (1:400) followed by streptavidin-conjugated FITC (1:400) (all from Jackson Southern blot are indicated. B: Autoradiograms of PCR and Southern blot analysis of DNA extracted from tail snips confirming the presence ImmunoResearch). Immunofluorescent images were taken on a Zeiss 410 of the transgene. For PCR, a 432-bp product specific for the transgene microscope in nonconfocal mode. Fresh frozen blocks of pancreata in tissue was amplified with 40 cycles; for Southern blot, after SspI digestion of freezing medium were prepared in molds immersed in chilled isopentane. DNA, the probe in exon 3 of the c-myc gene was hybridized to Frozen sections were stained with an antibody for c-Myc (C-33; Santa Cruz). endogenous c-myc and a 1.4-kb fragment specific for the transgene. M, Pancreatic tissue was processed for electron microscopy by fixing in 2.5% molecular weight marker (100 bp); Wt, wild type; Tg, transgenic. glutaraldehyde in 0.1 mol/l phosphate buffer and embedding in plastic resin (Araldite; E.F. Fullam, Lanthan, NY). Micrographs were taken on a Phillips 301 electron microscope. directly examine the role of c-Myc in ␤-cells in vivo, we Quantification of pancreatic insulin concentration. Pancreata were son- generated and analyzed transgenic mice overexpressing icated in 2 ml acid ethanol and stored overnight at 4°C. The next day, the homogenate was centrifuged (2,500 rpm for 10 min), and the supernatant was c-Myc under control of the rat insulin II promoter. In this stored at –20°C until insulin concentration was measured by radioimmunoas- situation, ␤-cells showed marked suppression of insulin say using commercially available kits (Linco Research). Total protein content gene expression, changes in the expression of other genes, of the extract was measured by the bicinchoninic acid protein assay kit and increased replication and apoptosis. (Pierce, Rockford, IL) using BSA as standard. RNA extraction and analysis. Total RNA was extracted from pancreata of

F1 progeny using Ultraspec RNA isolation reagent following the manufacturer- RESEARCH DESIGN AND METHODS suggested protocols (Biotecx Laboratories, Houston, TX). RNA (500 ng) was Construction of the RIP-II/c-myc chimeric gene and generation of then reverse-transcribed to cDNA using Supercript II RNase HϪ reverse transgenic mice. A 2.7-kb XbaI-XhoI fragment of cDNA containing exons 2 transcriptase (Life Technologies), as previously described (6). Aliquots of and 3 of the coding sequence of the mouse c-myc gene was cloned between 0.6 diluted cDNA (1.5–3 ␮l, equivalent to 10–20 ng RNA) were amplified in 25-␮l Ј ϫ kb of the rat insulin II promoter (20,21) and a 0.3-kb fragment containing a 3 reactions containing 1 GeneAmp PCR buffer, 1.5 mmol/l MgCl2 (Perkin- untranslated region of the human growth hormone (hGH) gene encoding the Elmer), 80–200 ␮mol/l dNTPs (Life Technologies), 10 pmol of appropriate polyadenylation signal (Fig. 1A). The 3.6-kb HindIII fragment of the RIP-II/ oligonucleotide primers (Genosys, Sigma), 2.5 U AmpliTaq Gold DNA poly- c-myc construct was microinjected into fertilized eggs of FVB mice, and viable merase (Perkin-Elmer), and 0.125 ␮Ci [␣-32P]dCTP (3,000 Ci/mmol; New embryos were implanted into the oviducts of pseudopregnant Swiss Webster England Nuclear). Oligonucleotide primers were designed with Eugene soft- mice in the Joslin Diabetes Center Transgenic Core facility to generate ware (Version 2.2; Daniben Systems, Cincinnati, OH). PCR amplification was founder transgenic mice. At 4 weeks of age, the offspring were tested for the performed in a Perkin-Elmer 9700 Thermocycler in which samples underwent presence of the transgene using Southern blot and PCR analysis on DNA a 3-min initial denaturing step, followed by cycling of 1 min at 94°C, 1 min at extracted from tail snips. Copy number of integrated transgene was estimated the annealing temperature indicated in Table 1, and 1 min at 72°C. The final from Southern blot signal intensity compared to indicator bands of a plasmid- extension step was 10 min at 72°C. Amplimers were resolved by 6% PAGE in ϫ ␣ 32 transgene construct. Transgenic F0 founder mice expressing the RIP-II/c-myc 1 Tris borate EDTA buffer. The amount of [ - P]dCTP incorporated into chimeric gene were backcrossed with FVB and C57BL6 mice (Taconic Farms, amplimers was measured with a PhosphoImager and quantified with Image- Germantown, NY). All animal procedures were approved by the Harvard quant software (Molecular Dynamics, Sunnyvale, CA). Preliminary reactions Microbiological Safety Committee and the Joslin Diabetes Center Animal Care were performed to optimize PCR conditions such that the product of each set Committee. of primers was linearly amplified. DNA analysis. Southern blots were performed with 5 ␮g genomic DNA Systemic glucose and insulin concentrations. Blood samples were col- ␣32 digested with SspI.A[ P]-labeled probe in exon 3 of the c-myc gene was lected from the F1 progeny before death for determination of blood glucose hybridized to a 1.4-kb fragment specific for the RIP-II/c-myc transgene (Fig. and plasma insulin concentrations. Blood glucose was measured with a 1A). Genotyping by PCR was performed with 250 ng DNA using oligonucleo- Medisense Precision QID glucometer (Abbott Laboratories, Bedford, MA) and tide primers designed to hybridize to the RIP-II promoter and exon 2 of the plasma insulin by radioimmunoassay (Linco Research). c-myc gene (Fig. 1B) or, alternatively, to exon 3 of the c-myc gene and the Transplantation of pancreata from RIP-II/c-myc transgenic mice. The hGH 3Ј untranslated sequence. The transgene-specific products were ampli- RIP-II/c-myc transgene resulted in neonatal lethality (see RESULTS), so to study

1794 DIABETES, VOL. 51, JUNE 2002 D.R. LAYBUTT AND ASSOCIATES Oiouloiesqec rmJnse l (6). al. et Jonas from sequence *Oligonucleotide mRNA of analysis PCR for conditions and primers oligonucleotide of Sequences 1 TABLE Gene k6122TTCTCCTCCT CTCCCCGTCA216 05 2TBP TBP rRNA 18S 32 TBP 32 26 TBP Cyclophilin* 30 TBP* 55 30 26 Cyclophilin 60 32 rRNA 18S 61 55 26 24 80 55 55 200 62 80 55 80 AF291666 55 X74342 160 80 100 Y00309 X16986 80 GCGTGCTCTCTCTGGTCC U28068 AAAGGGAGCTGGACGCGG M25389 80 L00038 ACTGGTAGGAGTAGGGATGCAC CCGGCTCTCCCCCTCTTG CCTGAGTGTGTTTGGAGCG TCTTCCTCCTCCTCCTCCTC Z46845 ACTCCAAGACCCAGAAACTGTC CGGACATCTCCCCATACG 212 X04724 CACGTTGGTTGGTGGGAG ACAGTTGTTGGGGTTGGTG 276 CTGTCCAACTTGGCCCTC ACTTCTTCTGGGAAGTCTCGC 172 CATTCTTTGGTGGGTGGC 249 CCTCATCCTCTCTGTGGCAC 221 ATGAATGAAGACAAACGCCAC GGTGCAGCACTGATCTAC Nkx6.1 175 GTCTTCCCCTACCCGCTC 269 BETA2 PDX-1 TCTTCTACACACCCATGTCCC 404 LDH-A GLUT2 149 Glucagon IAPP II) & (I Insulin c-Myc long-term effects of c-Myc overexpression in ␤-cells, we transplanted freshly excised pancreata from 1-day-old transgenic and wild-type mice under the kidney capsules of 6-week-old male immune-deﬁcient Swiss nude mice and followed graft development. After implantation, blood glucose levels and body weights of recipient mice were measured weekly. At 6 weeks after implantation, grafts were excised under anesthesia, trimmed of extraneous tissue, and either ﬁxed in 4% buffered formaldehyde for histology or lysed in RNA isolation solution for analysis of gene expression by RT-PCR as described b)5 (bp) Size above. Statistical analysis. All results are presented as means Ϯ SE. Statistical analyses were performed using unpaired Student’s t test or one-way ANOVA with post test of Dunnet as appropriate.

RESULTS

Ј Generation of RIP-II/c-myc transgenic mice. Of 20 lgncetd 3 Oligonucleotide mice born from embryos microinjected with the RIP-II/c- myc chimeric gene, 4 male mice were identiﬁed as carriers of the transgene by Southern blot and PCR analysis (Fig. † rmr rmAbo Asi,T) B,TT-idn protein. TATA-binding TBP, TX). (Austin, Ambion from Primers 1). The copy numbers of the founders, as determined by Southern blotting, were ϳ2, 7, 15, and 40. The studies presented here are from two of these founders (copy numbers 7 and 15) whose transgene was transmitted to F1 progeny. (The founder with two copies was infertile, and the founder with 40 copies did not transmit the transgene to offspring.) The studies in each line were performed in parallel and showed a similar phenotype. Presumably, the founders were mosaic and thus had some normal ␤-cells. RIP-II/c-myc transgenic mice are diabetic. F1 genera- Ј

Oligonucleotide tion mice were studied at four stages of life: at an embryonic age of 17–18 days, on the day of birth (within 15 h of birth), 1 day after birth, and 2 days after birth. Litters were killed at each stage for blood sampling and pancreas collection. The blood glucose levels at each of these stages are shown in Fig. 2A. Embryonic glycemia was variable among litters, and although marked hyperglycemia was absent at this stage of development, the RIP-II/c-myc transgenic embryos had blood glucose levels that were statistically elevated. When evaluated within each litter, blood glucose levels were modestly (36%) accession GenBank higher in transgenic compared with wild-type embryos no. (P Ͻ 0.001). Initially after birth, blood glucose levels of all mice decreased to Ͻ20 mg/dl. Within a few hours, the mice had fed normally, as indicated by milk in their stomachs. Within 12 h, milk was seen in the duodenum and ileum, ( ␮ dNTP and the blood glucose of transgenic mice had increased to mol/l) levels greater than in wild-type mice. By the ﬁrst day after birth, transgenic mice had developed severe diabetes. Marked hyperglycemia was present at days 1 and 2 after

temperature birth; blood glucose levels were ﬁvefold higher than those Annealing of wild-type littermates (Fig. 2A). Furthermore, plasma of

° transgenic neonates was milky and the liver pale, indica- C tive of elevated circulating triglycerides and liver steatosis. Transgenic mice not studied at the above time points died on day 3 after birth. The diabetic phenotype developed when the founders were bred with either FVB or C57BL6 ylsCnrlgene Control Cycles female mice. Transgenic pups were statistically lighter than their wild-type littermates (Fig. 2B). When body weights after birth were normalized between litters, the transgenic mice were 12% lighter than wild-type littermates (P Ͻ 0.01). The difference in weight was exacer- bated after the onset of hyperglycemia; transgenic mice gained less weight by day 1 after birth and had no

† signiﬁcant body weight change from day 1 to day 2 (Fig. 2B). Transgenic neonates had plasma insulin concentra-

DIABETES, VOL. 51, JUNE 2002 1795 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

TABLE 2 Reduced plasma and pancreatic insulin concentration in RIP-II/ c-myc transgenic mice Wild type Transgenic Plasma insulin (ng/ml) 1.21 Ϯ 0.15 (42) 0.42 Ϯ 0.05 (44)* Pancreatic insulin (ng insulin/␮g total protein) 5.2 Ϯ 1.4 (5) 0.005 Ϯ 0.004 (5)† .P Ͻ 0.001, †P Ͻ 0.01 vs. wild type by t-testء (Data are means Ϯ SE (n Plasma insulin concentration represents pooled data from day of birth, 1- and 2-day-old wild-type and transgenic mice. Pancreatic insulin concentration (expressed as insulin/total protein) was measured in protein extracted from pancreas of 1-day-old mice. content in the pancreata of transgenic mice was Ͼ50-fold the insulin content in the circulation. Hence, the insulin produced in the pancreata of transgenic mice can account for the presence of insulin in plasma, but clearly at a concentration insufﬁcient to achieve euglycemia. To clar- ify the mechanism responsible for the development of diabetes and to determine the ␤-cell phenotype of RIP-II/ c-myc transgenic mice, the following histological and gene expression analyses were performed. Disrupted islet morphology in RIP-II/c-myc transgenic mice. Transgenic mice had strikingly altered pancreatic morphology. Endocrine cells were viewed as an amorphous, compact mass around the ducts (Fig. 3B and D). The transgenic phenotype was in stark contrast to that of wild-type mice, in which endocrine cells were less compact and formed as distinct ovoid bodies (Fig. 3A and C). The proportion of islet cells (relative volume) in the pancreas was greatly increased. Morphometric analysis of hematoxylin-stained sections was performed to quantify the increase in islet relative volume (Table 3). Transgenic neonates had an endocrine-cell area threefold larger than that of wildtype neonates: endocrine cells comprised 7.6 Ϯ 1.2% of the pancreatic area in transgenic neonates compared with 2.5 Ϯ 0.5% in wild-type neonates (P Ͻ 0.05). Consistent with the profound reduction of insulin content, very few cells stained for insulin, and these were scattered within the “islets”(Fig. 3D). The expanded mass of cells in transgenic mice stained for GLUT2 (Fig. 4B), a FIG. 2. Blood glucose concentration and body weight of F1 generation mice. A: Blood glucose concentration of fetal (E17–18), day of birth protein commonly used as a ␤-cell marker. The intensity of (day 0), and 1- and 2-day-old wild-type (Ⅺ) and RIP-II/c-myc transgenic (f) mice. B: Body weight of 0-, 1-, and 2-day-old neonate mice. All GLUT2 staining in pancreatic sections from transgenic ,data are means ؎ SE for the indicated number of animals. *P < 0.05, mice was reduced and showed a more diffuse pattern **P < 0.01, ***P < 0.001 vs. wild type at the same stage. mainly cytoplasmic (Fig. 4B) instead of the usual plasma membrane location (Fig. 4A). Other ␤-cell markers were tions that were on average 65% lower than those of expressed in cells from transgenic mice. Staining for the wild-type neonates (P Ͻ 0.001) but still within the sensi- homeodomain protein transcription factor PDX-1 (Fig. 4F) tivity range of the assay (Table 2). Plasma insulin concen- was unremarkable, with typical nuclear staining. Nkx6.1 trations shown in Table 2 represent pooled data from day expression is normally restricted to ␤-cells in the mature of birth and from 1- and 2-day-old mice. At each stage, islet and is downstream of PDX-1 in the hierarchy of plasma insulin levels were similarly reduced in transgenic transcription factors that regulate ␤-cell differentiation mice. (22–24). In some cells of transgenic mice, Nkx6.1 staining Reduced pancreatic insulin concentration in RIP-II/ was nuclear, but in most cells, staining was cytoplasmic c-myc transgenic mice. Pancreatic insulin concentration (Fig. 4D) rather than the expected nuclear seen in wild of transgenic mice was only 0.1% of the wild-type level type (Fig. 4C). The observation was made in separate (Table 2), whereas plasma insulin concentrations were stainings of pancreata from three different litters from the only moderately reduced (65%) (Table 2). Normally, insu- same founder. The pattern of expression of non–␤-cell lin stores in the pancreas are in vast excess of the endocrine hormones was assessed by immunostaining circulating insulin content. Based on the measurements of with a mixture of antibodies for glucagon, somatostatin, pancreas and plasma insulin, we estimate that insulin and pancreatic polypeptide (Fig. 3C and D; Fig. 5B and C).

1796 DIABETES, VOL. 51, JUNE 2002 D.R. LAYBUTT AND ASSOCIATES

FIG. 3. ␤-Cell hyperplasia with infrequent insulin-positive cells in transgenic mice. In contrast to the islets distinct from both the ducts and acini in the wild-type pancreas (A and C), the extensive islet tissue in the transgenic pancreas (B and D) were amassed tightly around the ducts (*) and had only scattered insulin-positive cells. Representative images from neonatal pancreas (2 days old). Arrowheads indicate islet tissue. A and B, hematoxylin stained; C and D, immunostained for insulin (red) and non–␤-cell hormones (glucagon, somatostatin, and pancreatic polypeptide) (green). Note that the background (red) in D has been intensiﬁed so that the non–insulin-staining cells that surround a duct (*) are visible. Magniﬁcation bars: A and B, 100 ␮m; C and D,50␮m.

Whereas the wild-type mice showed a characteristic pat- of ␤ granules (Fig. 6). Many insulin granules were ob- tern of well-deﬁned islets with a ␤-cell core and the served in the cytoplasm of wild-type neonatal ␤-cells, non–␤-cell hormones distributed around the mantle (Fig. whereas only a few granules per cell were observed in 3C), the islet architecture in transgenic mice was per- transgenic mice. Other organelles, such as mitochondria, turbed, with the non–␤-cell hormones forming only rough endoplasmic reticulum, and Golgi, did not appear to clumps at the periphery (Fig. 3D; Fig. 5B and C). Further- be altered. The ultrastructure of these cells indicated that more, most of the insulin-positive cells in transgenic mice they were ␤-cells and not duct cells. The increased euchro- also stained for the non–␤-cell hormones (Fig. 5C). This matin and nucleolar hypertrophy were also revealed in phenomenon was apparent at both fetal and neonatal hematoxylin-stained sections (Fig. 7B and C). stages, precluding hyperglycemia as a contributing factor. Increased mitosis and apoptosis in RIP-II/c-myc From frozen sections of neonatal pancreata, an increased transgenic mice. Ki-67 is a marker of cell proliferation ␤ number of c-Myc–staining -cells was observed in trans- that stains in early to mid-G1 phase of the cell cycle genic mice (data not shown). through mitosis. Interestingly, there was a massive in- ␤ Ultrastructural analysis of pancreata from transgenic crease in the frequency of Ki-67–stained -cells of trans- mice revealed the presence of large euchromatic nuclei, genic mice within3hofbirth (Fig. 8B) that was not seen nucleolar hypertrophy, and the almost complete absence in 2-day-old transgenic mice (Fig. 8C). An increased inci-

DIABETES, VOL. 51, JUNE 2002 1797 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

TABLE 3 loid polypeptide (IAPP) mRNA levels were equivalent in Islet relative volume and frequency of mitotic and apoptotic transgenic embryos and tended to be elevated, although ␤-cell nuclei in wild-type and transgenic neonatal mice not significantly, in transgenic neonates, suggesting a Wild type Transgenic selective downregulation of insulin gene expression in ␤-cells. GLUT2 mRNA levels tended to be lower in the Islet relative volume (%) 2.5 Ϯ 0.5 7.6 Ϯ 1.2* pancreata of transgenic embryos (Fig. 10A) and neonates Ϯ Ϯ Mitotic nuclei (%) 1.10 0.31 1.84 0.35 (Fig. 10B), consistent with the diminished intensity of Apoptotic nuclei (%) 0.72 Ϯ 0.08 2.97 Ϯ 0.41† GLUT2 immunostaining. The increased mRNA levels for Data are means Ϯ SE for pooled data from day of birth, 1- and 2- the transcription factors BETA2 and Nkx6.1 in the trans- day-old wild-type and transgenic mice. *P Ͻ 0.05, †P Ͻ 0.01 vs. wild genic mice (Fig. 10A and B) probably reflect the expansion type by t test. Islet relative volume is expressed as the proportion of ␤ pancreatic tissue that was islet (mean number of cells counted ϭ in -cell volume because, when normalized for the ex- 1,635 Ϯ 204 per animal from 4 to 6 animals per group). The frequency panded mass, these mRNA levels are near normal. The of mitotic and apoptotic nuclei are expressed as a percentage of level of PDX-1 mRNA was similar in transgenic and endocrine cells (mean number of cells counted ϭ 795 Ϯ 74 per wild-type mice (Fig. 10A and B), perhaps because of its animal from 3 to 6 animals per group). expression in pancreatic duct cells. Alternatively, because the ␤-cell volume was increased, this lack of change may dence of apoptotic nuclei was observed in hematoxylin- indicate a decrease in PDX-1 mRNA per ␤-cell. With stained sections from transgenic mice (Fig. 7B and C), and respect to LDH-A mRNA levels (Fig. 10A and B), the they were confirmed as being in ␤-cells in sections double- relatively high expression in neonatal ducts and acinar stained with propidium iodide and GLUT2 (data not tissue (seen by immunostaining; data not shown) would be shown). Apoptotic nuclei were fourfold more abundant in ␤ transgenic compared with wild-type neonates (Table 3). expected to obscure any effect of the transgene in -cell As confirmation, an increase in TUNEL-positive staining expression. The level of glucagon mRNA was similar in was also observed in transgenic mice (Fig. 9). The TUNEL- transgenic and wild-type embryos (Fig. 10A). In neonates, positive cells were, as expected, more numerous than the glucagon mRNA level was increased approximately apoptotic bodies because of the indefinite but longer time twofold (Fig. 10B). This increase could have come from ␣ ␤ of DNA fragmentation. Apoptotic nuclei and bodies are either -cells or immature -cells that coexpress glucagon. ␤ thought to be short-lived in vivo. There was a tendency for -Cell depletion in transplanted pancreata from RIP- an increased frequency of mitotic nuclei in transgenic II/c-myc transgenic mice. Because c-Myc overexpression compared with wild-type neonates (Table 3). Mitotic fig- caused neonatal lethality, the question remained whether the ures are evident for only about 30 min, so any increase in ␤-cells would continue to proliferate with time. We trans- frequency is indicative of a greatly increased replication. planted pancreata from 1-day-old transgenic and wild-type The frequency of mitotic nuclei and apoptotic figures was mice under the kidney capsules of normal nude mice to already increased in transgenic embryos; mitotic nuclei assess the effects of long-term c-Myc overexpression in were increased 2-fold (wild type, 0.67 Ϯ 0.17%; transgenic, ␤-cells. Pancreata from transgenic and wild-type mice were 1.24 Ϯ 0.27%), and apoptotic figures were 13-fold more of comparable sizes when transplanted. Over the 6-week abundant (wild type, 0.17 Ϯ 0.17%; transgenic, 2.25 Ϯ posttransplantation period, the presence of the grafted pan- 0.45%) in transgenic compared with wild-type E17–18 creas (transgenic or wild type) had no effect on blood embryos. The embryonic data reveal the effects of c-Myc glucose levels or weight gain of recipient mice (data not overexpression without any confounding influence of hy- shown). At 6 weeks after transplantation, the grafts were perglycemia. The data suggest an increased turnover of well-vascularized and had increased in size, but the trans- cells in the islets of transgenic mice. This raises the genic grafts were approximately half the size of the wild-type possibility that the ␤-cells may have been replicating grafts. Histological examination revealed well-defined islets continuously at a very fast rate, leading to impaired in the wild-type grafts, but only ductal profiles and no islets in differentiation. transgenic grafts (images not shown). Indirectly, this sug- Gene expression analysis by RT-PCR. To further assess gests that with sustained c-Myc activation, apoptosis eventu- the extent of ␤-cell differentiation, mRNA levels were ally predominates over proliferation, causing ␤-cell loss. compared in transgenic and wild-type pancreata by semi- Further evidence for this was obtained with RT-PCR analysis quantitative RT-PCR. Representative gels for each gene of mRNAs extracted from the pancreatic grafts (Fig. 10C). are shown in Fig. 10. After normalization of the specific Not surprisingly, insulin mRNA levels in grafts from transgene to an invariant control gene (cyclophilin, TBP, or 18S genic mice remained markedly suppressed. However, IAPP, rRNA), mRNA levels are expressed as a percent of wild PDX-1, BETA2, and Nkx6.1 mRNA levels were also markedly type (Fig. 10). The transgenic mice showed c-Myc mRNA reduced in the 6-week-old grafts from transgenic mice. In levels that were increased three- to fourfold. Because particular, IAPP and Nkx6.1 mRNA were present with barely these measurements represent c-Myc expression in all detectable levels, whereas BETA2 and PDX-1 mRNA levels cells of the pancreas and the transgene was under control were reduced to 20% of the wild-type levels. This residual of the insulin promoter and should be expressed only in expression may be due to BETA2 expressed in other endo- ␤-cells, the actual increase in c-Myc mRNA level in ␤-cells crine cells and PDX-1 in ductal tissue. GLUT2 mRNA in the should be even greater. Further analysis revealed a dra- graft most likely represents expression derived from contam- matic decrease in insulin mRNA in the pancreata of both inating kidney tissue. Grafts retrieved from the kidney cap- fetal (Fig. 10A) and neonatal (Fig. 10B) transgenic mice, sule after transplantation can be contaminated with the findings consistent with the scarcity of insulin-positive kidney cortical tissue, which also expresses GLUT2 (25). We cells observed by immunostaining. In contrast, islet amy- tested this by checking for a kidney-specific marker, NKT

1798 DIABETES, VOL. 51, JUNE 2002 D.R. LAYBUTT AND ASSOCIATES

FIG. 4. Immunostaining for the ␤-cell markers GLUT2 (A and B), Nkx6.1 (C and D), and PDX-1 (E and F) in wild-type and c-Myc transgenic pancreas. A: The typical staining pattern for GLUT2 in wild-type ␤-cells, with bright staining of the plasma membranes, particularly around the vascular channel marked with the asterisk, and some cytoplasmic staining. C and E: The expected nuclear staining for Nkx6.1 (C) and PDX-1 (E) in a normal, well-deﬁned islet in wild-type mice. These markers also show that the irregular masses of non-acinar tissue in transgenic pancreas (B, C, and F) are endocrine cells. It is striking that the GLUT2 of the aberrant ␤-cells is cytoplasmic, with almost none of the bright plasma membrane staining found in normal ␤-cells. It is also of interest that the Nkx6.1 staining (D) is also cytoplasmic rather than nuclear. These striking differences in GLUT2 and Nkx6.1 staining were found in multiple sections from multiple animals. The PDX-1 staining in the c-Myc transgenic pancreas (E) was normal. A and B, neonatal (1 day old); C– F, fetal (E17–18). Magniﬁcation bars: A and B,25␮m, C– F,50␮m.

(26); it was expressed in the grafts but not in neonatal velopment, with alteration in ␤-cell proliferation and pancreata (data not shown). Glucagon mRNA was main- turnover, disruption of islet formation, and downregu- tained in the transgenic grafts, indicating that the loss of lation of insulin gene expression that result in early- mass was speciﬁctothe␤-cells. The maintenance of ␤-cell onset diabetes and neonatal lethality. The enhanced gene expression in the grafts from wild-type mice precludes ␤-cell turnover in transgenic mice resulted, in the short immune rejection as a mechanism for the loss of ␤-cells in term, in ␤-cell hyperplasia. However, the expanded grafts from transgenic mice. ␤-cell mass was not organized into discrete islets, and the pancreas had an altered gene expression pattern, DISCUSSION with markedly suppressed insulin levels, less severe These studies show that overexpression of c-Myc in reduction of GLUT2 expression, and abnormal cytoplas- ␤-cells of transgenic mice markedly perturbs islet de- mic expression of GLUT2 and Nkx6.1. The stimulation

DIABETES, VOL. 51, JUNE 2002 1799 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

FIG. 5. Immunostaining for insulin (red) and a cocktail of non–␤-cell hormones (glucagon, somatostatin, and pancreatic polypeptide) (green) in an islet of a transgenic neonate (1 day old). C is the merged image of A and B. Some insulin-positive cells costained for non–␤-cell endocrine hormones in islets of transgenic pancreas (yellow in C, indicated with arrowheads). Magnification bar, 20 ␮m. of apoptosis by overexpression of c-Myc was striking. apoptosis. Consistent with this suggestion, we have found There was a complete loss of ␤-cells in transplanted an increase in the expression of a variety of stress genes, pancreases of transgenic mice, indirectly suggesting some of which might be protective, in islets after Px (28). that apoptosis eventually predominated over prolifera- Nonetheless, in both situations, c-Myc was associated with tion. activation of ␤-cells to enter the cell cycle. In the trans- Potential relevance of results in RIP-II/c-myc transgenic mice, rapid cell proliferation occurred, whereas genic mice to a partial pancreatectomy model of hypertrophy was seen in the Px rats, which may have been diabetes. In normal islets, c-Myc expression is low, but it due to simultaneous expression of cell-cycle inhibitors is induced in diabetic rats, rats made hyperglycemic by ␤ that could trap -cells in G1. Indeed, we have found that glucose clamp, and isolated islets cultured under high- p21cip1 is induced after Px (G. Xu and S.B.-W, unpublished glucose conditions (6,19). The impetus for making these data). The characteristics of the transgenic mice closely transgenic mice was to see if the ␤-cell changes found resembled those recently reported in adult mice with after partial pancreatectomy would be recapitulated by conditional expression of c-Myc in ␤-cells. Activation of transgenic overexpression of c-Myc. We postulated that c-Myc by tamoxifen led to a rapid increase in ␤-cell ␤ the increased c-Myc found in -cells after Px contributed proliferation that was soon outstripped by apoptosis, ␤ to the observed changes in differentiation and -cell resulting in diabetes in only a few days (15). hypertrophy (6). Interestingly, at 4 weeks after Px, no c-Myc in the compensatory growth of ␤-cells. We increase in replication or apoptosis could be measured hypothesized that an increase in ␤-cell mass in the predi- (27). The failure of c-Myc to cause such a drastic change abetic stage of type 2 diabetes is an important compensa- after Px is not understood, but perhaps less c-Myc was tory response to insulin resistance (1,2). In support of this produced in the Px model. It is also possible that the hypothesis, expansion in the number (hyperplasia) and persistent hyperglycemia after Px led to a gradual change size (hypertrophy) of ␤-cells with increased insulin de- ␤ in -cell phenotype, which included genes that inhibit mand has been observed in Px rats (6,27), female Zucker entry into the cell cycle and others that protect against diabetic fatty (ZDF) rats with impaired glucose tolerance (4), and rats after 96-h glucose infusion (29); in pregnancy (30); and with the insulin resistance in mice induced by ablation of one allele of the insulin receptor and insulin receptor substrate-1 (3). Once the capacity for compensatory ␤-cell expansion is overwhelmed, diabetes develops (1,2,4,6). Our findings are consistent with a role for c-Myc in the compensatory growth of ␤-cells. Elevated c-Myc expression is associated with glucose stimulation of DNA synthesis in islet cell lines (31) and in insulinomas in combination with another oncogene such as ras (18,32). In combination with ras, c-Myc has been shown to stimulate ␤-cell replication in vitro (33), and as mentioned above, conditional expression of c-Myc in mice leads to increased ␤-cell proliferation (15). The finding of increased euchro- matin and prominent nuclei and nucleoli in the transgenic FIG. 6. Ultrastructural analysis showed that in contrast to the well- ␤-cells is consistent with the effects of c-Myc in the liver granulated ␤-cells of the 1-day-old wild-type mouse (A), ␤-cells of transgenic mice (B) have few ␤ granules, little endoplasmic reticulum, (34) and other cells (35) to induce ribosomal biogenesis and large euchromatic nuclei. Magnification bar, 1 ␮m. and increase cell mass.

1800 DIABETES, VOL. 51, JUNE 2002 D.R. LAYBUTT AND ASSOCIATES

FIG. 7. High turnover of ␤-cells in transgenic mice is suggested by the increased mitotic (arrowhead) and apoptotic (*) nuclei found in endocrine cells of transgenic (B and C) compared with wild-type (A) neonatal mice (2 days old). In all panels, the duct epithelium (d) has similar histology, whereas the endocrine cells in the transgenic mice have larger euchromatic nuclei than in wild-type mice. Hematoxylin stained; magniﬁcation bar, 10 ␮m.

␤ c-Myc activation of -cell apoptosis. Results obtained by the marked decrease in Ki-67–positive cells in 2-day-old in these transgenic mice indicate that c-Myc can promote mice (Fig. 8); c-Myc stimulation of apoptosis appeared to apoptosis in ␤-cells. Importantly, this contrasts with the be maintained. This later dominance of apoptosis is con- effects of c-Myc in different cell types (15). In epidermis sistent with the loss of ␤-cells noted in pancreatic tissue and lymph tissue, overexpression of c-Myc leads to prolif- transplanted under the kidney capsules of athymic mice. eration with little apoptosis (15,36,37). When c-Myc over- The susceptibility of ␤-cells to apoptosis may be related to expression is targeted to acinar cells of the pancreas, low levels of expression of the protective antioxidant mixed acinar/ductal adenocarcinomas develop (38). In the genes in islets (39). To transform ␤-cells, it is presumably late fetal period of the RIP-II/c-myc transgenic mice, there necessary to inhibit the apoptotic process. The develop- was an apparent link between replication and apoptosis ment of insulinomas with activated c-Myc may occur only that was quickly lost in the postnatal period, as evidenced with concomitant mutation in genes implicated in c-Myc–

FIG. 8. Ki-67 staining of pancreas sections. In the newborn wild-type mouse (A), cells in the replicative cell cycle, as indicated by Ki-67 (gray-brown) nuclear immunostaining, were frequent in both the well-deﬁned islet (*) and the exocrine portion. In the transgenic mouse, there is an increased frequency of Ki-67–positive endocrine cells within3hofbirth (B) but not in 2-day-old mice (C). The yellow line in C denotes the border between endocrine and acinar tissue. Magniﬁcation bar, 100 ␮m.

DIABETES, VOL. 51, JUNE 2002 1801 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

FIG. 9. TUNEL staining of neonatal pancreas sections. Compared with wild-type mice (A), increased TUNEL-positive staining (dark staining) is seen in pancreata of transgenic mice (B), indicating fragmentation of DNA and cell death. Apoptosis is seen during the neonatal period even in wild-type pancreata and is thought to be part of tissue remodeling. The TUNEL-positive cells are more numerous than apoptotic nuclei/bodies (Table 3), because DNA fragmentation is a longer process than the condensation and fragmentation of the nucleus. Magnification bar, 50 ␮m. induced pro-apoptotic pathways (p53, MEN1, or p19ARF) or upregulation of anti-apoptotic genes (Bcl family) (15,32,40). The role of c-Myc in ␤-cell differentiation. The ␤-cells of the transgenic mice exhibited abnormal differentiation, which is not surprising considering their rapid rate of proliferation, a condition well known to lead to dedifferentiation. This has been well shown in insulin-producing cell lines produced by overexpression of the simian virus 40 (SV40) tumor antigen gene under control of the rat insulin promoter. An inverse relationship between growth rate and insulin gene expression has been demonstrated (41–43). However, these cell lines can maintain some features of differentiated ␤-cells after many passages. It is impossible to say how much of the change in ␤-cell differentiation in the transgenic mice is directly due to c-Myc and how much is due to some general process that accompanies proliferation. Likewise, in the Px model, it is unclear how much of the change of gene expression is directly due to c-Myc and how much is caused by other hyperglycemia-induced mechanisms. It is of interest that most of the few insulin-positive cells in transgenic mice also stained for the non–␤-cell hormones. Coexpression of insulin and glucagon has been detected in the earliest stages of endocrine cell development (44–46), whereas a recent study showed that ␤-cell progenitor cells transcribe the pancreatic polypeptide gene and never glucagon (47). These dual-staining cells could be regarded as transient/immature cells that can also be called protodifferentiated. Normally, these cells are thought to produce non–␤-cell hormones only briefly before full ␤-cell differentiation takes over. In these transgenic mice, the protodifferentiated cells may represent very young cells that maintain insulin expression only FIG. 10. Comparison of mRNA levels in fetal (A), neonatal (B), and briefly before it is shut off by c-Myc. Other aspects of ␤-cell transplanted (C) pancreata of wild-type (Wt) and transgenic (Tg) mice. Representative gels are shown of RT-PCR with oligonucleotide differentiation are at least partially maintained. The RIP- primers (Table 1) for the indicated genes. After normalization of the II/c-myc transgenic mice had typical nuclear staining of gene-specific PCR product to a control gene (TBP, 18S rRNA, or PDX-1. The equivalent levels of PDX-1 mRNA in the cyclophilin), mRNA levels of transgenic mice (f) were expressed as a percent of the wild-type levels (Ⅺ). *P < 0.05, **P < 0.01, ***P < 0.001 pancreas of transgenic mice may indicate an actual reduc- vs. wild type for each gene. tion per ␤-cell (see RESULTS), but PDX-1 expression in the

1802 DIABETES, VOL. 51, JUNE 2002 D.R. LAYBUTT AND ASSOCIATES ducts may obscure any change (48). Important elements of Foundation. A.S. is a recipient of a career development the transcriptional machinery that determine islet devel- award from the American Diabetes Association. opment and activate ␤-cell transcription (BETA2, Nkx6.1, We thank Adam Groff for expert technical help; Nitin PDX-1) are present in spite of c-Myc overexpression. Trivedi and Jennifer Hollister-Lock for performing pan- However, finding staining of Nkx6.1 in the cytoplasm creas transplantation; Sanjoy Dutta for experimental ad- rather than in the nucleus raises questions about its vice; Chris Cahill of the Joslin Advanced Microscopy Core; function (23,24). the Joslin RIA Core for insulin assay; the Joslin Transgenic c-Myc repression of insulin gene expression. We Core; and the Animal Care Core. doubt that the marked reduction of insulin gene expression can be explained by competition between the endog- REFERENCES enous insulin promoter and the transgene insulin 1. Bonner-Weir S: Islet growth and development in the adult. J Mol Endocri- promoter for transcription factors, because this RIP-II nol 24:297–302, 2000 sequence has been used in the past without evident 2. Weir GC, Laybutt DR, Kaneto H, Bonner-Weir S, Sharma A: ␤-Cell interference (20,21,43,49–51). adaptation and decompensation during the progression of diabetes. Dia- A potential mechanism is suggested by studies showing betes 50 (Suppl. 1):S154–S159, 2001 3. Bruning JC, Winnay J, Bonner-Weir S, Taylor SI, Accili D, Kahn CR: that c-Myc can suppress insulin gene transcription by Development of a novel polygenic model of NIDDM in mice heterozygous inhibiting BETA2-mediated transcriptional activation (52). for IR and IRS-1 null alleles. Cell 88:561–572, 1997 If c-Myc does exert a potent inhibitory influence on insulin 4. Pick A, Clark J, Kubstrup C, Levisetti M, Pugh W, Bonner-Weir S, Polonsky gene expression, why are a few ␤-cells positively stained KS: Role of apoptosis in failure of ␤-cell mass compensation for insulin resistance and beta-cell defects in the male Zucker diabetic fatty rat. for insulin? We suspect that the rare insulin-positive Diabetes 47:358–364, 1998 ␤-cells in RIP-II/c-myc transgenic mice represent newly 5. Tokuyama Y, Sturis J, DePaoli AM, Takeda J, Stoffel M, Tang J, Sun X, formed ␤-cells still expressing insulin protein after tran- Polonsky KS, Bell GI: Evolution of beta-cell dysfunction in the male Zucker scription has been suppressed, this being facilitated by the diabetic fatty rat. Diabetes 44:1447–1457, 1995 long half-life of insulin mRNA (ϳ24 h). It remains to be 6. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic determined whether c-Myc downregulation of insulin pro- beta cell differentiation in an animal model of diabetes. J Biol Chem moter activity involves a direct or indirect mechanism. 274:14112–14121, 1999 c-Myc could act by binding directly to the insulin pro- 7. Weir GC, Sharma A, Zangen DH, Bonner-Weir S: Transcription factor moter, by physically interacting with an insulin gene- abnormalities as a cause of beta cell dysfunction in diabetes: a hypothesis. Acta Diabetol 34:177–184, 1997 activating complex, or by inducing the expression of other 8. Shimabukuro M, Zhou YT, Levi M, Unger RH: Fatty acid-induced beta cell proteins that repress insulin gene transcription. The ability apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci U S A of c-Myc to bind E-boxes suggests a possible physical 95:2498–2502, 1998 interaction of c-Myc with this important element that 9. Donath MY, Gross DJ, Cerasi E, Kaiser N: Hyperglycemia-induced ␤-cell binds heterodimers belonging to the bHLH family of apoptosis in pancreatic islets of Psammomys obesus during development of diabetes. Diabetes 48:738–744, 1999 transcription factors. The complex consists of BETA2, the 10. Davis AC, Wims M, Spotts GD, Hann SR, Bradley A: A null c-myc mutation tissue-restricted member of the family, and its het- causes lethality before 10.5 days of gestation in homozygotes and reduced erodimerizing, ubiquitously expressed bHLH family mem- fertility in heterozygous female mice. Genes Dev 7:671–682, 1993 bers E2A, E47/E12, or HEB (53). The binding of the 11. Facchini LM, Penn LZ: The molecular role of Myc in growth and transfor- mation: recent discoveries lead to new insights. FASEB J 12:633–651, 1998 Myc-Max complex to the insulin E-box may compete for 12. Dang CV, Resar LM, Emison E, Kim S, Li Q, Prescott JE, Wonsey D, Zeller binding by these bHLH proteins that might, in turn, inhibit K: Function of the c-Myc oncogenic transcription factor. Exp Cell Res insulin gene transcription. 253:63–77, 1999 In conclusion, our results suggest that the transcription 13. Klefstrom J, Arighi E, Littlewood T, Jaattela M, Saksela E, Evan GI, Alitalo factor c-Myc has major influence on the regulation of K: Induction of TNF-sensitive cellular phenotype by c-Myc involves p53 ␤ and impaired NF-kappaB activation. EMBO J 16:7382–7392, 1997 -cell mass, islet formation, gene expression, and glucose 14. Shim H, Chun YS, Lewis BC, Dang CV: A unique glucose-dependent homeostasis. The studies from RIP-II/c-myc transgenic apoptotic pathway induced by c-Myc. Proc Natl Acad SciUSA95:1511– mice demonstrate the effects of c-Myc overexpression on 1516, 1998 1) initial proliferation and expansion of ␤-cells; 2) marked 15. Pelengaris S, Rudolph B, Littlewood T: Action of Myc in vivo: proliferation and apoptosis. Curr Opin Genet Dev 10:100–105, 2000 suppression of insulin gene expression, reduced GLUT2 16. Langdon WY, Harris AW, Cory S, Adams JM: The c-myc oncogene perturbs expression, and the development of diabetes; and 3) B lymphocyte development in E-mu-myc transgenic mice. Cell 47:11–18, ultimate depletion of ␤-cell mass through increased rates 1986 of apoptosis. We suggest that c-Myc is a potentially 17. Schuhmacher M, Staege MS, Pajic A, Polack A, Weidle UH, Bornkamm GW, important regulator of ␤-cell growth, although its precise Eick D, Kohlhuber F: Control of cell growth by c-Myc in the absence of cell ␤ division. Curr Biol 9:1255–1258, 1999 contributions to normal -cell development, adaptation to 18. Katic M, Hadzija M, Wrischer M, Pavelic K: An in vitro model of the early insulin resistance, and the development of diabetes remain genetic events in multistage carcinogenesis of malignant insulinoma. to be determined. Carcinogenesis 20:1521–1527, 1999 19. Jonas JC, Laybutt DR, Steil GM, Trivedi N, Pertusa JA, Van de Casteele M, Weir GC, Henquin JC: High glucose stimulates early response gene c-Myc ACKNOWLEDGMENTS expression in rat pancreatic beta cells. J Biol Chem 276:35375–35381, 2001 20. Lo D, Burkly LC, Widera G, Cowing C, Flavell RA, Palmiter RD, Brinster The Diabetes Endocrinology Research Center Core facili- RL: Diabetes and tolerance in transgenic mice expressing class II MHC ties were supported by Grant DK-36836 from the National molecules in pancreatic beta cells. Cell 53:159–168, 1988 Institutes of Health. This work was supported by National 21. Verchere CB, D’Alessio DA, Palmiter RD, Weir GC, Bonner-Weir S, Baskin DG, Kahn SE: Islet amyloid formation associated with hyperglycemia in Institutes of Health Grant DK-35449 and the Diabetes transgenic mice with pancreatic beta cell expression of human islet Research and Wellness Foundation. D.R.L. is a recipient of amyloid polypeptide. Proc Natl Acad SciUSA93:3492–3496, 1996 a postdoctoral fellowship from the Juvenile Diabetes 22. Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H: Beta-cell-specific

DIABETES, VOL. 51, JUNE 2002 1803 C-MYC OVEREXPRESSION IN ␤-CELLS OF TRANSGENIC MICE

inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell atic tumor pathogenesis reﬂects the causative genetic lesion. Proc Natl phenotype and maturity onset diabetes. Genes Dev 12:1763–1768, 1998 Acad SciUSA88:93–97, 1991 23. Øster A, Jensen J, Serup P, Galante P, Madsen OD, Larsson LI: Rat 39. Tiedge M, Lortz S, Drinkgern J, Lenzen S: Relation between antioxidant endocrine pancreatic development in relation to two homeobox gene enzyme gene expression and antioxidative defense status of insulin- products (Pdx-1 and Nkx 6.1). J Histochem Cytochem 46:707–715, 1998 producing cells. Diabetes 46:1733–1742, 1997 24. Sander M, Sussel L, Conners J, Scheel D, Kalamaras J, Dela CF, Schwit- 40. Naik P, Karrim J, Hanahan D: The rise and fall of apoptosis during zgebel V, Hayes-Jordan A, German M: Homeobox gene nkx6.1 lies down- multistage tumorigenesis: down-modulation contributes to tumor progres- stream of nkx2.2 in the major pathway of beta-cell formation in the sion from angiogenic progenitors. Genes Dev 10:2105–2116, 1996 pancreas. Development 127:5533–5540, 2000 41. Philippe J, Drucker DJ, Chick WL, Habener JF: Transcriptional regulation 25. Thorens B, Sarkar HK, Kaback HR, Lodish HF: Cloning and functional of genes encoding insulin, glucagon, and angiotensinogen by sodium expression in bacteria of a novel glucose transporter present in liver, butyrate in a rat islet cell line. Mol Cell Biol 7:560–563, 1987 intestine, kidney, and beta-pancreatic islet cells. Cell 55:281–290, 1988 42. Fleischer N, Chen C, Surana M, Leiser M, Rossetti L, Pralong W, Efrat S: 26. Lopez-Nieto CE, You G, Bush KT, Barros EJ, Beier DR, Nigam SK: Functional analysis of a conditionally transformed pancreatic ␤-cell line. Molecular cloning and characterization of NKT, a gene product related to Diabetes 47:1419–1425, 1998 the organic cation transporter family that is almost exclusively expressed 43. Efrat S, Linde S, Kofod H, Spector D, Delannoy M, Grant S, Hanahan D, J Biol Chem in the kidney. 272:6471–6478, 1997 Baekkeskov S: Beta-cell lines derived from transgenic mice expressing a 27. Xu G, Stoffers DA, Habener JF, Bonner-Weir S: Exendin-4 stimulates both hybrid insulin gene-oncogene. Proc Natl Acad SciUSA85:9037–9041, 1988 ␤-cell replication and neogenesis, resulting in increased beta-cell mass and 44. Alpert S, Hanahan D, Teitelman G: Hybrid insulin genes reveal a develop- improved glucose tolerance in diabetic rats. Diabetes 48:2270–2276, 1999 mental lineage for pancreatic endocrine cells and imply a relationship with 28. Laybutt DR, Kaneto H, Hasenkamp W, Grey S, Jonas J-C, Sgroi DC, Groff neurons. Cell 53:295–308, 1988 A, Ferran C, Bonner-Weir S, Sharma A, Weir GC: Increased expression of 45. Hashimoto T, Kawano H, Daikoku S, Shima K, Taniguchi H, Baba S: antioxidant and antiapoptotic genes in islets that may contribute to ␤-cell Transient coappearance of glucagon and insulin in the progenitor cells of survival during chronic hyperglycemia. Diabetes 51:413–423, 2002 29. Bonner-Weir S, Deery D, Leahy JL, Weir GC: Compensatory growth of the rat pancreatic islets. Anat Embryol (Berlin) 178:489–497, 1988 pancreatic ␤-cells in adult rats after short-term glucose infusion. Diabetes 46. Jensen J, Heller RS, Funder-Nielsen T, Pedersen EE, Lindsell C, Weinmas- ␣ 38:49–53, 1989 ter G, Madsen OD, Serup P: Independent development of pancreatic - and ␤ 30. Scaglia L, Smith FE, Bonner-Weir S: Apoptosis contributes to the involu- -cells from neurogenin3-expressing precursors: a role for the notch tion of beta cell mass in the post partum rat pancreas. Endocrinology pathway in repression of premature differentiation. Diabetes 49:163–176, 136:5461–5468, 1995 2000 31. Yamashita S, Tobinaga T, Ashizawa K, Nagayama Y, Yokota A, Harakawa 47. Herrera PL: Adult insulin- and glucagon-producing cells differentiate from S, Inoue S, Hirayu H, Izumi M, Nagataki S: Glucose stimulation of two independent cell lineages. Development 127:2317–2322, 2000 protooncogene expression and deoxyribonucleic acid synthesis in rat islet 48. Sharma A, Zangen DH, Reitz P, Taneja M, Lissauer ME, Miller CP, Weir GC, cell line. Endocrinology 123:1825–1829, 1988 Habener JF, Bonner-Weir S: The homeodomain protein IDX-1 increases 32. Pavelic K, Hrascan R, Kapitanovic S, Vranes Z, Cabrijan T, Spaventi S, after an early burst of proliferation during pancreatic regeneration. Dia- Korsic M, Krizanac S, Li YQ, Stambrook P, Gluckman JL, Pavelic ZP: betes 48:507–513, 1999 Molecular genetics of malignant insulinoma. Anticancer Res 16:1707–1717, 49. Hanahan D: Heritable formation of pancreatic beta-cell tumours in trans- 1996 genic mice expressing recombinant insulin/simian virus 40 oncogenes. 33. Welsh M, Welsh N, Nilsson T, Arkhammar P, Pepinsky RB, Steiner DF, Nature 315:115–122, 1985 Berggren PO: Stimulation of pancreatic islet beta-cell replication by 50. Picarella DE, Kratz A, Li CB, Ruddle NH, Flavell RA: Insulitis in transgenic oncogenes. Proc Natl Acad SciUSA85:116–120, 1988 mice expressing tumor necrosis factor beta (lymphotoxin) in the pancreas. 34. Kim S, Li Q, Dang CV, Lee LA: Induction of ribosomal genes and Proc Natl Acad SciUSA89:10036–10040, 1992 hepatocyte hypertrophy by adenovirus-mediated expression of c-Myc in 51. Vasavada RC, Cavaliere C, D’Ercole AJ, Dann P, Burtis WJ, Madlener AL, vivo. Proc Natl Acad SciUSA97:11198–11202, 2000 Zawalich K, Zawalich W, Philbrick W, Stewart AF: Overexpression of 35. Boon K, Caron HN, van Asperen R, Valentijn L, Hermus MC, van Sluis P, parathyroid hormone-related protein in the pancreatic islets of transgenic Roobeek I, Weis I, Voute PA, Schwab M, Versteeg R: N-myc enhances the mice causes islet hyperplasia, hyperinsulinemia, and hypoglycemia. J Biol expression of a large set of genes functioning in ribosome biogenesis and Chem 271:1200–1208, 1996 protein synthesis. EMBO J 20:1383–1393, 2001 52. Kaneto H, Sharma A, Suzuma K, Laybutt DR, Xu G, Bonner-Weir S, Weir 36. Cory S, Vaux DL, Strasser A, Harris AW, Adams JM: Insights from Bcl-2 and GC: Induction of c-Myc expression suppresses insulin gene transcription Myc: malignancy involves abrogation of apoptosis as well as sustained by inhibiting NeuroD-mediated transcriptional activation (Abstract). Dia- proliferation. Cancer Res 59:1685s–1692s, 1999 betes 50 (Suppl. 2):A80, 2001 37. Waikel RL, Wang XJ, Roop DR: Targeted expression of c-Myc in the 53. Sharma A, Moore M, Marcora E, Lee JE, Qiu Y, Samaras S, Stein R: The epidermis alters normal proliferation, differentiation and UV-B induced NeuroD1/BETA2 sequences essential for insulin gene transcription colo- apoptosis. Oncogene 18:4870–4878, 1999 calize with those necessary for neurogenesis and p300/CREB binding 38. Sandgren EP, Quaife CJ, Paulovich AG, Palmiter RD, Brinster RL: Pancre- protein binding. Mol Cell Biol 19:704–713, 1999

1804 DIABETES, VOL. 51, JUNE 2002