CHI SITES, Recbc ENZYME , and GENENERALIZED RECOMBINATION

STADLER SYMP. Vol. 13 (1981) University of Missouri, Columbia 25 CHI SITES, RecBC ENZYME , AND GENENERALIZED RECOMBINATION

GERALD R. SMITH, DENNIS W. SCHULTZ, ANDREW F. TAYLOR and KATHLEEN TRIMAN

Institute of Molecular Biology University of Oregon Eugene, Oregon 97403

SUMMARY

With the goal of elucidating the moleculaP basis of genetic Pecombination, ouP laboPatoPy has studied special sites that pPomote Pecombination in theiP neighboPhood and enzymes essential fop r>ecom bination in Escherichia coli. The genetic pPopePties of C'hi sites of E.coli and phag~ ~,detePmined by the laboPatoPy of F. Stahl, suggest that C'hi is a Pecognition sequence fop a Pecombination-pPomoting enzyme. OuP laboPatoPy's finding that C'hi is the unique nucleotide sequence 5' G-C-T-G-G-T-G-G 3' (op its complement OP both) substantiates this view. Genetic studies suggest that C'hi nny be r>ecognized by the E.coli RecBC enzyme. Based upon electPon micPogPaphic studies of Peaction intePmediates we have pPoposed a model by which RecBC enzyme unwinds and Pewinds DNA. We discuss a mechanism whePeby RecBC's hypothesized nicking of DNA at C'hi sites during DNA unwinding can pPomote rocom bination in a nnnneP consistent with the established genetic pPopePties of C'hi.

INTRODUCTION

Determining the mechanism by which two homologous chromosomes interact to produce recombinant chromosomes has remained a challenging problem to molecular biologists. St~dies of recombination-deficient mutants have permitted the definition of pathways of recombination (reviewed by CLARK 1973) and the identification of some enzymes cata lyzing steps in these pathways (reviewed by RADDING 1973). Additional genetic studies have revealed special sites which influence recom bination in their neighborhood (reyiewed by STAHL 1979a). Understanding the molecular basis of recombination requires study both of the enzymes promoting recombination and of the special sites which are presumably recognized and acted upon by one or more of the recombination-promoting enzymes.

Our laboratory is studying the RecBC pathway of recombination of Escherichia coli. In this paper we review our laboratory's recent studies on RecBC enzyme (one of the enzymes of the RecBC pathway) and on Chi sites, which stimulate the RecBC pathway. In addition, we discuss a hypothetical mechanism by which RecA protein (the other identified enzyme of the RecBC pathway), RecBC enzyme, and Chi sites may promote genetic recombination. 26 SMITH, SCHULTZ, TAYLOR & TRIMAN

GENETIC PROPERTIES OF CHI SITES

STAHL (1979a) has extensively reviewed the genetic properties of Chi sites. Here we will briefly discuss these properties to place in context the research described below.

Chi sites were first studied as mutations in bacteriophage A which enhance the growth of A Red- Garn- mutants (HENDERSON & WEIL 1975). A Red- Garn- phages grow poorly for the following reasons~ 1) E, coli's RecBC enzyme, unless inhibited by the Garn+ protein of A, prevents A rolling circle replication (UNGER & CLARK 1972; ENQUIST & SKALKA 1973). 2) Circular monomeric A DNA is not packaged with high efficiency (ENQUIST & SKALKA 1973; IKEDA & KOBAYASHI 1979), 3) In the absence of rolling circle replication, recombination between monomer circles to produce dimers is the only route to packageable DNA, In the absence of the. A Red-dependent general recombination system, significant amounts of dimers are produced only by the E. coli RecBC pathway (ZISSLER et al. 1971; ENQUIST & SKALKA 1973). This system acts inefficiently on A, resulting in low phage yields and small plaques. Mutations creating Chi arise spontaneously and are selected in a Red- Garn- phage population since Chi sites enhance Rec recombination, resulting in higher phage yields and larger plaques (HENDERSON & WEIL 1975; MCMILIN et al . 1974; LAM et -al. 1974; MALONE & CHATTORAJ 1975),

Chi sites arise by mutation at four (or more) widely separated loci in A (STAHL, CRASEMANN & STAHL 1975). Enhanced frequency of recom bination in the interval containing Chi demonstrates that these muta tions affect sites rather than diffusible products. Chi sites occur in the wild-type E, coli chromosome at an average density of once per 5000 basepairs (MALONE et al. 1978). These sites, when introduced into A, manifest recombination-enhancing properties indistinguishable from those of the Chi sites arising by mutation in A•

Of the several pathways of recombination potentially available to A, only the E. coli RecBC pathway is influenced by Chi (GILLEN & CLARK 1974; STAHL & STAHL 1977), Stated another way, Chi lacks detectable activity in E, coli hosts mutant in the recA, recB or recC genes coding for the two known proteins (the RecA and RecBC enzymes discussed later) of the RecBC pathway (CLARK 1973). Chi does not measurably stimulate the E, coli RecE or RecF pathways of generalized recombination or the A Red pathway of gener alized recombination or the A Int-promoted site specific recombination.

The occurrence in wild-type E. co li of Chi sites and of the recom bination pathway they stimulate makes plausible the possibility that Chi plays a role in E, coli recombination. In fact, DOWER (1980) found that Chi within repressed A prophages alters the distribution of crossovers in certain Pl-mediated transductions. Unless there is a feature of A prophages which distinguishes their DNA from the rest of E, coli DNA, one can conclude that Chi can act in E, col i crosses. With the isolation of a mutation inactivating a Chi site in an E, coli gene (TRIMAN, CHATTORAJ & SMITH 1981) we can now test the action of_ Chi in E~- co-Z i crosses in the absence of ~ . -

Although Chi is a site, its effect on recombination is very dif ferent from the prophage attachment site (att) of ~- More than 99% of Int-promoted exchanges occur within the 15~se-pair (bp) att site Chi Sites and RecBC Enzyme 27,

(ENQUIST et al. 1979·; ECHOLS & GREEN 1979). In contrast, nearly all of the Chi-stimulated exchanges occur outside the Chi site. Stimulation is maximal near Chi but extends, with decreasing magnitude, more than 10,000 bp from Chi (STAHL et al. 1975). This observation suggests that something "moves" away from Chi to the point of exchange. In A stimula tion is greater to the left (on the conventional A map) than 'to the right of Chi (STAHL et al. 1980).

The active form of Chi is "dominant" to the inactive form. In other words, Chi in one parent is nearly as active as Chi in both (LAM et al. 1974). Perhaps even more striking is the observation that Chi in one parent is active when the other parent contains a non homology of >10 3 bp opposite the Chi (STAHL & STAHL 1975). This result would appear to be consistent with the view noted above that something "moves" from Chi to the point of exchange, which is necessarily outside (and to the left of) the region of non-homology.

The observation that Chi sites in A act to their left prompted FAULDS et al. (1979) to invert Chi-containing DNA segments of >." Instead of acting to their right, the inverted Chi sites fail'ed to act at all. This result indicates that some other site in A acts in con junction with Chi. YAGIL et al. (1980) found that the active orien tation of Chi was the same throughout a large region of the;\ chromosome and suggested that active Chi sites may have to be correctly oriented with respect to the ends of the A chromosome.

In summary, Chi sites ·l) arise by mutation at 4 loci in phage A, 2) occur in the E. coli chromosome once per 5000 bp on the average, 3) stimulate the E. coli RecBC pathway of recombination, 4) act when only one parent in the cross carries Chi, 5) act when one parent carries a large heterology opposite the Chi in the other parent, 6) act over a long distance (more than 10,000 bp), 7) act principally to their left, relative to the conventional;\ map, and 8) act only if the Chi is in one orient at ion in A •

NUCLEOTIDE SEQUENCE OF CHI SITES

The genetic properties of Chi sites suggest that Chi is a recogni tion sequence for some enzyme in the RecBC pathway. To obtain biochemi cal support for this view, our laboratory has determined the nucleotide sequence surrounding several Chi sites. We anticipated that if Chi is a recognition sequence these sites would have similar or identical sequen ces and that mutations altering the activity of Chi would be located within these common sequences. We summarize here our evidence that Chi is indeed a unique nucleotide sequence.

For nucleotide sequence analysis of Chi it was necessary to iden tify an interval of A containing Chi and small enough for convenient nucleotide sequence determination. A solution to this problem was to locate Chi between the endpoints of deletions on the physical map using restriction endonuclease cleavage analysis of the deletion DNA. Figure 1 illustrates this approach for the first Chi site sequenced, x+c within the ell gene of/.. (SPRAGUE, FAULDS & SMITH 1978). [In the nomenclature of MALONE et al. (1978) x + designates the active form of Chi sites in A and x - the inactive form in >., while chi+ and chi- designate the active and inactive forms of Chi sites in E. coli.] The x+c mutation 28 SMITH, SCHULTZ, TAYLOR & TRIMAN

Taq I Hind]: t t

Deletion spi-71

Deletion spi-380

FIGURE 1, Genetic and physical localization of a Chi site, x+c in phage A, Genetic crosses placed x+c between the endpoints of deletions spi-7l and spi-380, Restriction endonuclease cleavage analyses placed sites for Taq I and HindII beyond the deletion endpoints as indicated. From SPRAGUE, FAULDS & SMITH (1978).

recombines with the deletion spi-71 to produce wild-type, but not with the deletion spi-380, Analysis of the DNA from A phages with these deletions showed that both deletions remove a Taq I endonuclease ~leavage site while neither deletion removes a HindII site to the right of the Taq I site. These results place x+c in the 150-bp interval between these cleavage sites.

, To precisely locate the Chi site we determined the nucleotide sequence of the Taq I - HindII interval from wild-type (inactive Chi) and x+c (active Chi) phage (SPRAGUE, FAULDS & SMITH 1978). Four inde pendent x+c mutants of spontaneous origin differ from wild type at a single hp: within the sequence shown in Figure 2 the x+c mutants have a T where wild type has an A. This result demonstrates that this hp is essential for Chi activity. Surrounding this bp we saw no remarkable sequence feature, such as a palindrome or unusual base composition, which could be readily identified as an enzyme recognition sequence.

Analysis of other Chi sites has allowed us to identify a unique sequence sufficient and perhaps necessary for Chi activity. Following the approach outlined above we analyzed the x+B site between the A xis and ~ed genes (SMITH et ai. 1980) and the x+D site near the A S gene (SMITH et al, 1981a). As with x+c, single hp changes create the active Chi sites. A continuous block of 8 bp is common to all three Chi sites and contains the sites of the mutations creating Chi (Figure 2), To further define the sequence essential for Chi activity, we isolated mutations which create Chi within the E, eoli plasmid pBR322 (inserted into A), A combination of ' genetic mapping of these mutations and scanning of the complete nucleotide sequence of this DNA (SUTCLIFFE 1979) readily identified sequences at which the x+ mutations likely were located (SMITH et al, 1981b), Sequence determination showed that these mutations were located within a sequence common to the other Chi sites analyzed (Figure 2). We have also analyzed a naturally occurring Chi site within the E, eoli laeZ gene (TRIMAN et al, 1981). Isolation of a mutation inactivating this site, coupled with deletion mapping and scanning of the amino acid sequence of the laeZ gene product s -galactosidase (FOWLER & ZABIN 1978), allowed determination of the ehi+iaeZ sequence (Figure 2), All of the seven Chi-containing sequences contain the sequence 5' G-C-T-G-G-T-G-G 3'. Within 46 bp to each side Chi Sites and RecBC Enzyme 29

Chi locus Location of Site Seguence of i strand in A

x+B A (xis-Ped interval) 5' GGCAGATATAGCTGGTGGTTCAGGCGGC 3' - x+c A ( cII gene) 5' TCGCAGATCAGCTGGTGGAAGAGGGACT-- 3' x +v " ( Q- S region) 5' CTTCGTGAAAGCTGGTGGCAGGAGGTCG 3' x +E pBR322 (bp 983-990) 5' GCGACGCGAGGCTGGTGGCCTTCCCCAT 3' x +F pBR322 (bp 1492-1499) 5' ACCCGGCTAGGCTGGTGGGGTTGCCTTA 3'

X +c pBR322 (bp 3061-3068) 5' ACAAACCACCGCTGGTGGCGGTGGTTTT 3'

chi+iacz E. coZi ZacZ gene 5' AATCCATTTCGCTGGTGGTCAGATGCGG 3'

Chi 5' GCTGGTGG 3' Mutations affecting Chi H H H CTAA CA A G

FIGURE 2. Comparison of nucleotide sequences at active Chi loci. Nucleotide sequences are aligned at the 8 base sequence deduced to be Chi (see text). Bases underlined within the octamer indicate positions of x+ mutations which create active Chi sites. The x+E mutation deletes an A between the two underlined bases (SMITH et al. 1981b). Sequences and positions of the mutations are from the following references: x+B (SMITH, SCHULTZ & CRASEMANN 1980); x+c (SPRAGUE, FAULDS & SMITH 1978); x +v (SMITH et al. 1981) ; x +E, x+F, and x+G (SMITH et al. 1981b); chi+zacZ (TRIMAN, CHATTORAJ & SMITH 1981). Numbering of the bp in pBR322 is from SUTCLIFFE (1979). Bases overlined within the octamer indicate positions of x-C mutations which inactivate Chi (SCHULTZ, SWINDLE & SMITH 1981). These mutations, many of which have been repeatedly isolated (see references above), are summarized at the bottom.

of this sequence, no remarkable sequence homologies were found (SMITH et aZ . 1981b, TRIMAN et aZ . 1981). We conclude that the 8-bp sequence 5' G-C-T-G-G-T-G-G 3' (or its complement or both) is sufficient for Chi activit~ and will refer to this sequence as Chi.

The mutations creating Chi occur at four different bases within the 8-bp sequence. This result shows that these four bases are essential for Chi activity. We extended this analysis by isolating mutations which inactivate Chi. We obtained nine x- mutations at four different base pairs (SCHULTZ et aZ. 1981) and one chi- zacZ mutation (TRIMAN et aZ. 1981). One of the x -c mutants, with the sequence 5' G-C-T-A-G-T-G-G 3', has appreciable residual Chi activity, while the others have little or no activity. Together , all of the mutations we have analyzed change 6 of the 8 bp of Chi. F. SANGER and B. BARRELL (personal communication) searched for Chi and sequences related to it within their sequences of wild-type A , which has no Chi site in either orientation (HENDERSON & WEIL 1975; I. KOBAYASHI, J. CRASEMANN, M. STAHL & F. STAHL personal communication). They did not find Chi or the sequence of the x- mutant with partial activity. However, 19 different sequences differing from Chi by a single base were found at a total of 60 sites. Since these 19 sequence s do not have Chi activity, we could conclude that the two bp 30 SMITH, SCHULTZ, TAYLOR & TRIMAN

not altered by the mutations which we sequenced are also essential for Chi activity. (See SMITH et aZ. 1981b). Four sequences differing by one bp from Chi remain untested at present. With reservation about the activity of these four sequences and of other sequences not closely related, we conclude that S'G-C-T-G-G-T-G-G 3' is the only sequence with full Chi activity. The conclusion that Chi is a unique nucleotide sequence substantiates the view, but does not prove, that Chi is a recognition sequence for an enzyme.

SEARCH FOR A PROTEIN RECOGNIZING CHI SITES

To elucidate the biochemical basis by which Chi stimulates recombination, it is important to identify the enzyme which we presume, for the reasons outlined above, recognizes Chi . Since Chi stimulates the RecBC pathway exclusively, we are led to consider the two known enzymes, RecA and RecBC, of that pathway as likely candidates for Chi recognition. Since RecA is necessary for the RecF pathway acting on A, and since Chi does not stimulate the RecF pathway, RecA appears unlikely to be the Chi-recognizing protein (GILLEN 1974; GILLEN & CLARK 1974, STAHL & STAHL 1977). By elimination, RecBC is a likely candidate for the Chi-recognizing protein.

We have obtained evidence supporting the view that RecBC recogni zes Chi. N. KLECKNER and V. LUNDBLAD (personal communication) isolated mutants of E. coZi in which the transposon TnlO excises with higher than normal frequency. Three of the mutants had mutations close to or within the PecB and PecC genes. We have analyzed two of these mutants and found that although they are recombination proficient, as evidenced by near normal frequency of Pl-mediated transduction, Chi has reduced activity in these mutants, as measured by the hotspot crosses described by STAHL & STAHL (1977). In these crosses fully active Chi has a rela tive activity of about 6, while inactive Chi has an activity of 1. In the mutant bacteria Chi has an activity of 1.9 to 2.5. This reduction of Chi activity is seen even when the RecE and RecF pathways are inac tivated by mutation. At present we are determining by mapping and complementation experiments whether the mutations in these bacteria are in PecB, PecC or some other closely linked gene involved with recom bination but not yet reported. In addition we are investigating whether the reduced Chi activity in the mutants is due to direct loss of Chi recognition or to an indirect physiological alteration of the RecBC pathway in the mutants.

UNWINDING AND REWINDING DNA BY RECBC ENZYME

A full elucidation of the molecular basis of recombination requires study not only of the structure and action of special sites such as Chi but also of the activity of the several enzymes in the recombination pathway. To this end we have extended studies by others on the RecBC enzyme of E. coZi. The many biochemical activities of this enzyme can be summarized as unwinding of duplex DNA with concomitant ATP hydrolysis and subsequent degradation of the single-stranded DNA to oligonucleo tides (see TELANDER-MUSKAVITCH & LINN 1981 for a review). Study of unwinding in the absence of degradation was greatly sim~lified by the discovery by ROSAMOND, TELANDER and LINN (1979) that Ca+ ions inhibit degradation but not unwinding. These authors noted that in the presence Chi Sites and RecBC Enzyme 31 of Ca+~ RecBC enzyme travelled through duplex DNA,making occasional nicks and releasing long single-stranded fragments.

We have studied the initial unwinding of DNA by RecBC enzyme, uti lizing similar reaction conditions, but more vigorous conditions for fixing the molecules for observation in the electron microscope (TAYLOR & SMITH 1980). After brief reaction (1 minute or less) RecBC enzyme converts as many as one-half of the linear duplex substrate molecules to structures like those in Figure 3. Figure 3a shows a loop-tail structure, first noted by TELANDER-MUSKAVITCH & LINN (1980), which has at one end a single-stranded loop, a short tail and a long tail . Measurement of many molecules showed that the sum of the length of the loop plus that of the short tail is frequently very similar to the length of the long tail. Figure 3b shows a twin-loop structure, which has two single-stranded loops in the interior of the duplex. Measurement of many molecules showed that the lengths of the two loops are nearly equal. These observations showed that the unwound structures were being produced without significant degradation.

A series of kinetic experiments and a study of the effects of single-strand binding protein (SSB) on the relative abundance of the two structures provided insight into the mechanism by which RecBC enzyme unwinds DNA. By fixing the molecules after various incubation times and measuring the lengths of the single-stranded regions and their distance from the end of the DNA,we deduced that the unwound structures advance through the DNA at about 300 hp per second and that the loops of both

a) b)

FIGURE 3. Unwinding DNA structures produced by RecBC enzyme, single strand binding protein, ATP, Mg++ and Ca++ and visualized with the electron microscope. a) Loop-tail structure. b) Twin-loop structure. See text and TAYLOR & SMITH (1980) for further description. 32 SMITH, SCHULTZ, TAYLOR & TRIMAN

structures grow at about 100 bases per second. Consequently the enzyme must rewind DNA in the twin-loop structures at about 200 bp per second. Apparently the enzyme advances through the DNA,unwinding DNA ahead of itself and rewinding DNA behind itself, but at a slower rate, so that loops of ever increasing size accumulate, moving along the DNA. By noting that at high SSB concentrations loop-tail structures predominate over twin-loop structures, while the opposite relation holds at low SSB concentration, we reasoned that loop-tails are precursors to twin loops.

The preceding observations led to the model of RecBC unwinding and rewinding shown in Figure 4. RecBC attaches to one end of the DNA, as has been shown for ExoV enzyme from Haemophilus influenzae by WILCOX and SMITH (1976). We propose that this attachment is on one strand, perhaps with a preference for one end (5' or 3') over the other. RecBC moves along the DNA strand, bringing 300 nucleotides per second into its "front", letting 200 nucleotides per second out its "back" and thereby accumulating a loop on that strand. The other strand is displaced with the formation of a loop-tail. In the absence of SSB, complementary base-pairing between the tails forms a twin-loop. RecBC continues to advance along the chromosome, promoting "breathing" of the DNA with the production of single-stranded loops thousands of nucleotides long. This single-stranded DNA may be involved in synapsis, as we discuss in the next section-.- Alternatively, if recombination does not proceed, the chromosome is returned to its original state by the rewinding action of RecBC. It may be important in the cell's economy to have a mechanism by which recombination can be initiated but by which the chromosome can be readily retrieved intact if recombination cannot proceed to completion.

-□ - - - RecBC

FIGURE 4. Model of DNA unwinding by RecBC enzyme. RecBC attaches to one end of a linear DNA molecule and slides along one strand to produce a loop-tail structure. The tails anneal to produce a twin-loop struc ture which advances and grows in size as RecBC moves along the DNA. See text and TAYLOR & SMITH (1980) for further description.

A MODEL OF GENETIC RECOMBINATION PROMOTED BY CHI SITES, RECA AND RECBC ENZYMES

From the preceding observations and from the studies of RecA pro tein by others comes the following possibility by which the Chi sites, RecA protein and RecBC enzyme may promote genetic recombination. Let us consider a cross in which one of the parental DNA molecules is at some time linear while the other may be either linear or circular. Such a situation occurs in A crosses, Pl-mediated transductions, and F-mediated conjugation in E. coli.

As outlined in Figure 5, we suppose that RecBC enzyme attaches to Chi Sites and RecBC Enzyme 33

___n___ --□ - - - - RecBC ~ A C ChiD _()_ ~- -Eµ - - ---F7---=r-- - R~c_A~---- - __ ,t..=..:: __ - -r . -- - ~ · ------E F G H

+ or + J

FIGURES. Model of genetic recombination promoted by RecBC enzyme, Chi sites and RecA protein. RecBC enzyme is represented by a box. One parental DNA is represented as a pair of solid lines, while the other is represented as a pair of dashed lines. See text for furt~er description.

and travels along the linear chromosome, making twin-loops (SC). When RecBC encounters the Chi sequence on the strand it is holding, it cuts that strand to make a broken twin-loop (SD). As RecBC advances, it con tinues to unwind and to rewind DNA as before. Rewinding must stop, however, when the nick at Chi is encountered because the enzyme has lost hold of the end of the DNA (SE). This end may be thousands ~nucl~o tides from the enzyme. As RecBC advances another step, the"-other loop collapses since it has not been actively held in place by RecB~~ A gap is thus created, with a single-stranded tail sticking out (SF) •. ', Annealing of this tail with the gap may be prevented by SSB, which appears to be needed for recombination (GLASSB$RG, MEYER & KORNBERG 1979). '1 RecA protein could insert the RecBC-produced free tail into the other parental DNA duplex to form a D-loop (Figure SG) by the reaction well studied with purified RecA enzyme by others. (See for example McENTEE, WEINSTOCK & LEHMAN 1980 and DAS GUPTA, SHIBATA, CUNNINGHAM & RADDING 1980.) At this point, or perhaps before D-loop formation, DNA synthesis might occur to partially fill in the gap';- This reaction would be particularly feasible if RecBC had initi~unwindJng by attaching to the S' end at step SA, since this would leave a 3' - end as primer for DNA synthesis at step SF. With or wy=hout DNA__s~thesis, a nick in the displaced strand of the D-loop would / produce a free tail able to pair, with the aid of RecA enzyme, with ·the remaining gap in the first paren tal duplex. 34 SMITH, SCHULTZ, TAYLOR & TRIMAN

The RecA-RecBC-promoted pairing results in the half chiasma struc ture (SH) first postulated by HOLLIDAY (1964) and which has been visualized (see for example BENBOW, ZUCCARELLI & SINSHEIMER 1975 and POTTER & DRESSLER 1976), Subsequent migration of the Holliday junction could conceivably be promoted by RecBC enzyme if it were to continue unwinding the first parental duplex, It is convenient to suppose that rewinding at this stage is promoted not by RecBC but by other proteins such as RecA and SSB, In this way unwinding and rewinding could occur at the same rates and the Holliday junction could be preserved without the accumulation of the interfering loops that RecBC makes, Finally the "outside" or "inside" chains of the Holliday junction are cut and the ends are exchanged and ligated to produce either "spliced" (SI) or "patched" (SJ) recombinant chromosomes.

The model of recombination just presented has many features of models proposed by others. In particular the exchange first of one pair of strands and then the other as proposed by HOLLIDAY (1964) ensures that recombination occurs at a point of homology between chromosomes and that the chromosomes are never completely broken. The production of a single-stranded tail from one chromosome was proposed by MESELSON & RADDING (1975) to occur by displacement of that strand by DNA polymerase during limited DNA synthesis associated with recombination. - As-simi-lat-ion of th-e- displaceos trano- into the homologous chromosome results in asylllilletric hybrid DNA, DNA synthesis at step SF after strand displacement in the model proposed here would have the same result, STAHL (1979b) suggested the possibility that RecBC enzyme might nick or gap DNA at Chi, from which strand displacement could occur. _A new feature of the model proposed here is the involvement of RecBC-produced twin-loops and the associated displacement of a single-stranded tail many thousands of nucleotides long from Chi, In addition, as discussed below, the asymmetry of the Chi sequence allows the possibility that the single-stranded tail occurs to only one side of Chi,

The following genetic properties of Chi are accounted for in this model. Chi stimulation uniquely of the RecBC pathway is implicit in the recognition and nicking of DNA at Chi by RecBC enzyme, The dominance of Chi is apparent at step SG in which the chromosome receiving the displaced tail need not have Chi. Action of Chi over many thousands of bp is consistent with the rapid rate (300 bp/sec) at which RecBC unwinds DNA outside the cell (TAYLOR & SMITH 1980); the rate inside the cell might be even faster. RecA protein may initiate assimilation at any point along the displaced tail and hence anywhere up to several thousand bp from Chi. These reactions can therefore account for the action of Chi wheri one parental chromosome contains a heterology of a few thousand bp opposite the Chi.

With the assumption that RecBC enzyme holds onto one DNA strand as it travels along the chromosome and with the fact that Chi is an asym metric sequence, one can account for the action of Chi to only one side of itself. For example RecBC might nick DNA when it encounters the sequence 5' C-C-A-C-C-A-G-C 3' but not when it encounters the complement of this sequence. If in addition RecBC always slides along a DNA strand in- tne same oirection, say from 5' end to 3' end, then it would nick the DNA and displace a tail always from the same side of Chi, The speci ficities just described of direction of sliding and of the base sequence recognized by RecBC enzyme would account for the leftward action of Chi in >-. Chi Sites and RecBC Enzyme 35

Loss of action of Chi when it is inverted in A is less readily accounted for. If RecBC were always to initiate unwinding of A DNA in a given direction, say from right to left on the chromosome, then when the sequence recognized, say 5' C-C-A-C-C-A-G-C 3', is on one DNA strand, RecBC would encounter it and nick, while if the sequence were on the other strand, RecBC would not encounter it and the inverted Chi would not act. The fact that Chi on a>- prophage or on a A plasmid stimulates recombination with an infecting, non-Chi-containing phage (L. YOUNG, F. STAHL & M. STAHL personal communication) indicates that RecBC need not initiate unwinding from a unique end upon injection in order for Chi to be active. Perhaps RecBC enters some site in A which dictates a unique direction of unwinding, or perhaps some quite different feature of the life cycle, such as packaging (FAULDS et al. 1979), accounts for orientation-dependence of Chi activity.

Our current efforts to test the model just discussed are aimed at identification of the protein recognizing Chi, detection of Chi-specific nicks, and visualization of chromosome fusion promoted by RecA and RecBC enzymes.

ACKNOWLEDGEMENTS

We are grateful to our many colleagues, past and present, in our lab and in the Institute of Molecular Biology, who have shared in this work and who have generously given us material and intellectual support. Special thanks go to Frank Stahl and the people in his lab for con tinuous congenial and fruitful interactions. Julie Dunn and Mary Gilland skillfully prepared the manuscript. Research in our lab has been supported by grants from the National Science Foundation and the National Institutes of Health to G.R.S., who is a recipient of an NIH Research Career Development Award. K.L.T. is supported by an NIH Predoctoral Traineeship.

LITERATURE CITED

BENBOW, R.M., A.J. ZUCCARELLI and R.L. SINSHEIMER 1975 Recombinant DNA molecules of bacteriophage ~Xl74. Proc. Nat. Acad. Sci, USA 72: 235-239. CHATTORAJ, D.K., J.M. CRASEMANN, N. DOWER, D. FAULDS, P. FAULDS, R.E. MALONE, F.W, STAHL and M.M. STAHL 1979. Chi. Cold Spring Harbor Symp. Quant. Biol. 43: 1063-1066. CLARK, A.J. 1973 Recombination deficient mutants of E, coli and other bacteria. Ann, Rev. Genet. 7: 67-86, DASGUPTA, C., T. SHIBATA, R,P, CUNNINGHAM and C.M. RADDING 1980 The topology of homologous pairing promoted by RecA protein. Cell 22: 437-446. DOWER, N.A. 1980 Chi sites--rec:'ombination hotspots in EschePichia coU? Ph.D. Thesis, University of Oregon, Eugene. ECHOLS, H. and L. GREEN 1979 Some properties of site-specific and general recombination inferred from Int-initiated exchanges by bacteriophage lambda, Genetics 93: 297-307, ENQUIST, L.W., H. NASH and R.A. WEISBERG 1979 Strand exchange in site specific recombination. Proc. Nat, Acad, Sci. USA 76: 1363-1367, 36 SMITH, SCHULTZ, TAYLOR & TRIMAN

ENQUIST, L. and A. SKALKA 1973 Replication of bacteriophage A DNA dependent on the function of host and viral genes. I. Interaction of Ped, gam, and Pee. J. Mol. Biol. 75: 185-212. FAULDS, D., N. DOWER, M.M. STAHL and F.W. STAHL 1979 Orientation dependent recombination hotspot activity in phage>,.. J. Mol. Biol. 131, 681-695. FOWLER, A.V. and I. ZABIN 1978 Amino acid sequence of B-galactosidase. XI. Peptide ordering procedures and the complete sequence. J. Biol. Chem. 253: 5521-5525. GILLEN, J.a:-1974 The RecE pathway of genetic recombination in Eschepichia coli. Ph.D. thesis, University of California, Berkeley. GILLEN, J.R. ind A.J. CL~ 1974 The RecE pathway of bacterial recombination. In Mechanisms in Recombination (Grell, R.F., Ed.) Plenum Press, New York, pp. 123-136. GLASSBERG, J., R.R. MEYER, and A. KORNBERG 1979 Mutant single~strand binding protein of EschePichia coli: Genetic and physiological characterization. J. Bacteriol. 140: 14-19. HENDERSON, D. and J. WEIL 1975 Recombination-deficient deletions in bac teriophage >,. and their interaction with chi mutations. Genetics 79: 143-174. HOLLIDAY, R. 1964 A mechanism for gene conversion in fungi. Genet. Res. 5: 282-304. IKEDA,- H. and- I. KOBAYASHI :t979 PeCA411ediated recombination of bac teriophage >,. : Structure of recombinant and intermediate DNA molecules and their packaging in vitro. Cold Spring Harbor Symp. Quant. Biol. 43: 1009-1021. LAM, S.T., M.M. STAHL, K.D. MCMILIN and F.W. STAHL 1974 Rec-mediated recombination hotspot activity in bacteriophage\. II. A mutation which causes hotspot activity. Genetics 77: 425-433. MALONE, R.E. and D. CHATTORAJ 1975 The role of Chi mutations in the Spi- phenotype of phage>,.: Lack of evidence for a gene Delta. Mol. Gen. Genet. 143: 35-41. MALONE, R.E., D.K. CHATTORAJ, D.H. FAULDS, M.M. STAHL and F.W. STAHL 1978 Hotspots for generalized recombination in the E. coli chromosome. J. Mol. Biol. 121: 473-491. MCENTEE, K., G.M. WEINSTOCK andI.R. LEHMAN 1980 PecA protein-catalyzed strand assimilation: Stimulation by EschePichia coli single stranded DNA-binding protein. Proc. Nat. Acad. Sci. USA 77: 857-861. MCMILIN, K.D., M.M. STAHL and F.W. STAHL 1974 Rec-mediated recom binational hotspot activity in bacteriophage lambda. I. Hotspot activity associated with Spi- deletions and bio substitutions. Genetics 77: 409-423. MESELSON, M.s-:-and C.M. RADDING 1975 A general model for genetic recombination. Proc. Nat. Acad. Sci. USA 72: 358-361. POTTER, H. and D. DRESSLER 1976 On the mechanism of genetic recombination: Electron microscopic observation of recombination intermediates. Proc. Nat. Acad. Sci. USA 73: 3000-3004. RADDING, R.M. 1973 Molecular mechanisms in recombination. Ann. Rev. Genetics 7: 87-111. ROSAMOND, J. ,-K.M. TELANDER and S. LINN 1979 Modulation ·of the action of the PecBC enzyme of EschePichia coli Kl2 by ca++. J. Biol._Qiem. 254: 8646-8652. SCHULTZ, D.W., J. SWINDLE and G.R. SMITH 1981 Clustering of mutations inactivating a Chi recombinational hotspot. J. Mol. Biol. 146: 275-286. Chi Sites and RecBC Enzyme 37

SMITH, G.R., M. COMB, D.W. SCHULTZ, D.L. -DANIELS and F.R. BLATTNER 1981a Nucleotide sequence of the Chi recombination hotspot x+D in phage l. J. Virol. 31: 336-342. SMITH, G.R., S. KUNES, D.W. SCHULTZ, A. TAYLOR and K.L. TRIMAN 1981b Structure of Chi hotspots of generalized recombination. Cell 24: 429-436. SMITH, G.R., D.W. SCHULTZ and J.M. CRASEMANN 1980 Generalized recom bination: Nucleotide sequence homology between Chi recombinational hotspots. Cell 19: 785-793. SPRAGUE, K.U., D.H. FAULDS and G.R. SMITH 1978 A single base-pair change creates a Chi recombination hotspot in bacteriophage l. Proc. Nat. Acad. Sci. USA 75: 6182-6186. STAHL, F.W. 1979a Special sites in generalized recombination. Ann. Rev. Genetics 13: 7-24. STAHL, F.W. 1979b Genetic Recombination, Thinking About It in Phage and Fungi. W.R. Freeman, San Francisco. 'STAHL, F.W., J.M. CRASEMANN and M.M. STAHL 1975 Rec-mediated hotspot activity in bacteriophage A• III. Chi mutations are site-mutations stimulating Rec-mediated recombination. J. Mol. Biol. 94: 203-212. STAHL, F.W. and M.M. STAHL 1975 Rec-mediated recombinational hotspots in bacteriophage A• IV. Effect of heterology on Chi-stimulated crossing over. Molec. Gen. Genet. 140: 29-37. STAHL, F.W. and M.M. STAHL 1977 Recombination pathway specificity of Chi. Genetics 86: 715-725. STAHL, F.W., M.M. STAHL, R.E. MALONE and J.M. CRASEMANN 1980 Directionality and non-reciprocality of Chi-stimulated recom bination in phage A• Genetics 94: 235-248. SUTCLIFFE, J.G. 1979 Complete nucleotide sequence of the Eseher>iehia eoZi plasmid pBR322. Cold Spring Harbor Symp. Quant. Biol. 43: 77-90. TAYLOR, A. and G.R. SMITH 1980 Unwinding and rewinding of DNA by the RecBC enzyme. Cell 22: 447-457. TELANDER-MUSKAVITCH, K.M:-and S. LINN 1980 Electron microscopy of E. eoZi PeeBC enzyme reaction intermediates. In Mechanistic Studies of DNA Replication and Genetic Recombination. ICN-UCLA Symposium on Molecular and Cellular Biology, XIX, (Alberts, B. and Fox, 'c.F., Eds.) Academic Press, New York, pp. 901-908. TELANDER-MUSKAVITCH, K.M. and S. LINN 1981 RecBC-like enzymes: The exonuclease V deoxyribonucleases. In The Enzymes, Vol XIV (Boyer, P.D., Ed.) Academic Press, New York, in press. TRIMAN, K.L., D.K. CHATTORAJ and G.R. SMITH 1981 Identity of a Chi site of EsehePiehia eoZi and Chi recombinational hotspots of bacterio phage l • Submitted. UNGER, R.C. and A.J. CLARK 1972 Interaction of the recombination pathways of bacteriophage l and its host EsehePiehia eoZi Kl2: Effects on exonuclease V activity. J. Mol. Biol. 70: 539-548. WILCOX, K.W. and H.O. SMITH 1976 Binding of the ATP-dependent DNase from HaemophiZus infZuenzae to duplex DNA molecules. J. Biol. Chem. 251: 6127-6134. YAGI~E., N, DOWER, D. CHATTORAJ, M. STAHL, C. PIERSON and F.W. STAHL 1981 Chi mutation in a transposon and the orientation-dependence of Chi phenotype. Genetics 96: 43-57. ZISSLER, J., E. SIGNER and F.SCHAEFER 1971 The role of recombination in growth of bacteriophage lambda. I. The gamma gene. In The Bacteriophage Lambda (Hershey, A.D., Ed.) Cold Spring Harbor Press, New York, PP• 455-468. 38 STADLER SYMP. Vol. 13 (1981) University of Missouri, Columbia

Carbon, Smith and Slater

John Carbon and Gerald Smith