Phylogenetic Analyses of Pilosocereus (Cactaceae) Inferred from Plastid and Nuclear Sequences

Botanical Journal of the Linnean Linnean Society Society,, 2017,2016. 183 With, 25–38. 2 ﬁgures With 2 figures

Phylogenetic analyses of Pilosocereus (Cactaceae) inferred from plastid and nuclear sequences

ALICE CALVENTE1*, EVANDRO M. MORAES2,PAMELA^ LAVOR1, ISABEL A. S. BONATELLI2, PAMELA NACAGUMA2, LEONARDO M. VERSIEUX1, NIGEL P. TAYLOR3 and DANIELA C. ZAPPI4

1Laboratorio� de Botanica^ Sistematica,� Departamento de Botanica^ e Zoologia, Centro de Biociencias,^ Universidade Federal do Rio Grande do Norte, Campus Central, Lagoa Nova, Natal, CEP 59078-970, RN, Brazil 2 Laboratorio� de Diversidade Genetica� e Evolucßao,~ Departamento de Biologia, Centro de Ciencias^ Humanas e Biologicas,� Universidade Federal de Sao~ Carlos, Sorocaba, Sao~ Paulo, CEP 18052-780, Brazil 3Singapore Botanic Gardens, 1 Cluny Road 259569, Singapore 4Jardim Botanico^ do Rio de Janeiro, Rua Pacheco Leao~ 915, Rio de Janeiro, CEP 22460-030 RJ, Brazil

Received 1 March 2016; revised 1 June 2016; accepted for publication 29 August 2016

Pilosocereus is a large genus of Cactaceae with 42 species of columnar cacti distributed in the Americas. In this work we investigate the phylogenetics and evolutionary history of Pilosocereus based in plastid and nuclear DNA sequences. We use phylogenetic trees obtained as a basis to analyse infrageneric relationships and to study the evolution of selected morphological characters and geographical distribution in the group. Thirty-three species of the genus were sampled and five molecular regions were selected, four non-coding intergenic spacers of plastid DNA (trnS-trnG, psbD-trnT, trnL-trnT, petL-psbE) and one nuclear low-copy gene (phytochrome C). The phylogenetic analyses obtained point to a paraphyletic Pilosocereus, with P. bohlei and P. gounellei emerging nested in a clade of outgroup species (i.e. other genera of Cereinae). However, the majority of species of the genus form one well supported clade (excluding P. bohlei and P. gounellei) corresponding mostly to Pilosocereus subgenus Pilosocereus. Evidence indicates that the ancestor of Pilosocereus subgenus Pilosocereus clade was a shrub with a straight floral tube occurring in Brazil and the ancestor of Pilosocereus subgenus Gounellea was a shrub with a curved floral tube also occurring in Brazil. The ancestral distribution in central and eastern Brazil resulted in the diversification of most lineages in the same area, whereas the P. leucocephalus clade was able to disperse through the Amazonian areas and diversify further north and reach Central and North America. © 2016 The Linnean Society of London, Botanical Journal of the Linnean Society, 2016

ADDITIONAL KEYWORDS: Brazil – character evolution – molecular phylogeny – South America.

INTRODUCTION or absent leaves, presence of spines, ribs and tuber- cles, photosynthetic stems and aquiferous parench- Cactaceae are one of the most conspicuous lineages yma in the cortex and pith (Boke, 1941; Gibson & occupying Neotropical arid regions (Hernandez-� Nobel, 1986), associated in different manners, pro- Ledesma et al., 2015). The synapomorphy of the fam- duce an array of diverse forms and adaptation ily is the presence of axillary meristematic structures strategies for resisting prolonged periods of drought. known as areoles, which can produce spines, wool, The great diversity of cactus growth forms con- ﬂowers, fruits and branches (Hernandez-Ledesma� tributes to the success and survival of species in a et al., 2015). This, with characters such as the recep- wide range of climatic and ecological conditions (Tay- tacular ovary sunken into the stem tissue, reduced lor & Zappi, 2004; Hernandez-Hern� andez� et al., 2014). In some instances, cacti are habitat dominant *Corresponding author. E-mail: [email protected] or co-dominant and act as important elements

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 262 A.A. CALVENTE CALVENTEET ET AL. AL.

associated with the survival of pollinators and the occupy mainly dry or rocky formations in Caatinga, dispersing fauna in their environment (Taylor & Cerrado and the Atlantic Forest in central and east- Zappi, 2004). ern Brazil. In these locations the diversity of Piloso- Cactaceae currently include 124 genera and cereus is remarkable, with conspicuous species > 1400 species distributed in the Americas [with a richness and, sometimes, high population density, single exception, Rhipsalis baccifera (Muell.) Stearn, often dominating the landscape with several species also occurring in Africa and Asia] and are divided occurring sympatrically. The ten almost entirely into subfamilies Pereskioideae, Opuntioideae, Cac- extra-Brazilian species span from northern Brazil, toideae and Maihuenioideae (Hunt, Taylor & northern South America, the Caribbean and Mexico Charles, 2006). Cactoideae are by far the richest in to the Florida Keys (Zappi, 1994). Humid Amazonian number of genera and species, including forms that forests may have acted as barriers for species distri- vary from columnar and tree-like to small and glo- butions dividing the geographical range of the genus bose, grouped or solitary plants (Barthlott & Hunt, in these two large core areas (Taylor & Zappi, 2004). 1993). Tribe Cereeae are among the six tribes placed Recent research including Pilosocereus species in Cactoideae and include the majority of columnar embraces phylogeography, molecular systematics cacti representing primarily South American lin- (e.g. Bonatelli et al., 2014; Perez et al., 2016), repro- eages (Nyffeler & Eggli, 2010; Barcenas, Yesson & ductive biology (e.g. Rivera-Marchand & Ackerman, Hawkins, 2011; Hernandez-Hern andez et al., 2011). 2006) and the economic potential of a few species. A Pilosocereus Byles & Rowley is one of the largest comprehensive taxonomic revision treated all species genera of Cactoideae and, with six other genera, using extensive field and herbarium research (Zappi, makes up c. 30% of the specific diversity in the 1994). Subsequent taxonomic work focusing on the family (Hunt et al., 2006). Brazilian species has taken place for over 2 decades Pilosocereus belongs to Cereeae subtribe Cereinae and resulted in many species being treated in floris- and includes 42 species of columnar cacti (Hunt tic accounts and in the description of new taxa (Tay- et al., 2006; Nyffeler & Eggli, 2010). The genus has lor & Zappi, 1997, 2004; Braun & Esteves, 1999; consistently emerged nested in the BCT clade (corre- Zappi & Taylor, 2011). Reproductive biology studies sponding to tribe Cereeae sensu Nyffeler & Eggli, indicate the continuous flowering of species in the 2010), with other South American cereoid genera Caatinga, highlighting the important role of species such as Coleocephalocereus Backeb., Melocactus Link in the genus as providers of constant and reliable & Otto, Uebelmannia Buining, Cereus Mill. and resources for pollinators; the association with bats is Micranthocereus Backeb. in overall molecular phylo- the most common, but other groups of floral visitors genetic hypotheses produced for Cactaceae (Barcenas have been documented indicating a wide use of floral et al., 2011; Hernandez-Hern andez et al., 2011). resources in the genus (Locatelli, Machado & However, resolution for deeper nodes of the BCT Medeiros, 1997; Rivera-Marchand & Ackerman, clade is poor and still needs to be investigated with 2006; Rocha, Machado & Zappi, 2007a, b; Meiado wider sampling; phylogenetic relationships in Cere- et al., 2008; Abud et al., 2010; Munguıa-Rosas, Sosa inae are unclear so far (Barcenas et al., 2011; & Jacome-Flores, 2010). Some Pilosocereus spp. are Hernandez-Hern andez et al., 2011). Pilosocereus is used as cattle fodder and a few studies have investi- currently divided in subgenera Gounellea Zappi gated the conditions for their cultivation and the sus- (three species) and Pilosocereus (39 species), mainly tainable use of natural populations (e.g. Silva et al., on the basis of their branching patterns and fruit 2005; Cavalcanti & Resende, 2007). In addition, a morphology. Pilosocereus subgenus Gounellea recent family level phylogenetic analysis produced includes P. gounellei (F.A.C.Weber ex K.Schum.) for Cactaceae (Barcenas et al., 2011) including Pilo- Byles & G.D.Rowley, P. frewenii Zappi & N.P.Taylor socereus spp. has shown evidences of a monophyletic and P. tuberculatus Byles & G.D.Rowley and was genus. However, this analysis included only a few described by Zappi (1994) based on exclusive features Pilosocereus spp. and is insufficient to test the mono- such as the candelabriform type of branching and phyly of the genus and estimate relationships at the the circular insertion point of the perianth remnant generic and infrageneric level. in the fruit (not deeply immersed). Pilosocereus sub- In this work we investigate the phylogenetics and genus Pilosocereus is separated into five informal the evolutionary history of Pilosocereus based on groups on the basis of variation in habit, floral mor- plastid and nuclear DNA sequences. We used phylo- phology, spine morphology and geographical distribu- genetic trees obtained as a basis to analyse infra- tion patterns (Zappi, 1994; Hunt et al., 2006). generic relationships and to study the evolution of The genus is disjunct over two core areas. Most selected morphological characters and the geographi- species (31 species) are restricted to Brazil and cal distribution in the genus.

MATERIAL AND METHODS 40 cycles of 95 °C for 1 min, 62 °C for 1 min, 65 °C for 5 min, and a final extension of 65 °C for 5 min; Representatives of both subgenera and the five (psbD-trnT, trnL-trnT and petL-psbE) 80 °C for informal taxonomic groups of Pilosocereus were 5 min, followed by 30 cycles of 95 °C for 1 min, included in this work with the aim of examining 50 °C for 1 min, 65 °C for 4 min, and a final exten- the relationships at the generic level following the sion of 65 °C for 5 min; (PhyC) 94 °C for 5 min, fol- circumscription adopted in the latest more compre- lowed by 33–35 cycles of 94 °C for 1 min, 55 °C for hensive classification produced for Cactaceae (Hunt 90 s, 72 °C for 2 min, and a final extension of 72 °C et al., 2006). Thirty-three of the 42 species of the for 9 min. Amplification products were purified using genus were sampled (Table 1). Voucher information the NucleoSpin Gel and PCR clean-up Kit and GenBank accession numbers are presented in (Macherey-Nagel, Duren,€ Germany) or the QIAquick Appendix 1. Four species belonging to tribe PCR Purification Kit (Qiagen, Crawley, UK), follow- Cereeae were included as outgroups: Melocactus ing the manufacturer’s protocol. Automated sequenc- zehntneri (Britton & Rose) Luetzelb., Cereus jama- ing was performed by Macrogen Inc. (Seoul, Korea) caru DC, Arrojadoa rhodantha Britton & Rose and on both strands of each amplicon using the same Stephanocereus leucostele (Guerke) A.Berger. primers of the PCR amplification. Throughout the text we refer to subgenera and informal taxonomic groups following the circum- Phylogenetic analyses scription adopted (Hunt et al., 2006; Table 1), Complementary sequences were assembled in unless otherwise mentioned. Sequencher 4.1.4 (Gene Codes, Ann Arbor, MI, USA) or Chromas 1.42 software (Technelysium Pty Ltd., Brisbane, Qld, Australia) and aligned manually in DNA EXTRACTION, AMPLIFICATION AND SEQUENCING Mesquite v. 3.04 (Maddison & Maddison, 2015). Genomic DNA was extracted from silica-dried Indels were coded using the simple indel coding stems or roots using the NucleoSpin Plant II Kit method (Simmons & Ochoterena, 2000) as presence/ (Macherey-Nagel, Duren,€ Germany) or the Qiagen absence data and included in all analyses. DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Maximum parsimony (MP) analyses were per- Five molecular regions were selected based on pre- formed in PAUP*, version 4.0b10 (Swofford, 2002) vious studies with Pilosocereus spp. (Bonatelli with heuristic searches using 1000 replicates of ran- et al., 2013, 2014): four non-coding intergenic spac- dom taxon addition (retaining 20 trees at each repli- ers of plastid DNA (trnS-trnG, psbD-trnT, trnL- cate), tree bisection reconnection (TBR) branch trnT, petL-psbE) and one nuclear low-copy gene swapping and equal weighting of all characters. Sup- (phytochrome C; PhyC), using primers from port was assessed with non-parametric bootstrap sequences previously published in the literature analysis (BS) using 1000 replicates of random taxon (Appendix 2). addition, and TBR branch swapping. Clades with Amplifications were conducted in 25-lL reactions bootstrap percentages of 50–74% are described as containing the following reagents (adding water to weakly supported, 75–89% as moderately supported complete the final volume): (trnS-trnG)5lL59 and 90–100% as strongly supported. GoTaq Buffer, 0.5 lL bovine serum albumin (BSA), Bayesian inference was performed with MrBayes 2.75 lL 25 mM MgCl2, 0.25 lL each primer (10 lM), 3.2.2 (Ronquist et al., 2011). Searches were con- 0.2 lL GoTaq (Promega, Southampton, UK), 0.6 lL ducted using two independent runs, each performed 10 mM dNTPs, 1 lL template DNA; (psbD-trnT) with four simultaneous chains. Each Markov chain 5 lL59 GoTaq Buffer, 0.5 lL BSA, 2.5 lL 25 mM was initiated with a random tree and run for 6 MgCl2, 0.25 lL each primer (10 lM), 0.2 lL GoTaq, 5 9 10 generations, sampled every 500 genera- 0.5 lL 10 mM dNTPs, 1 lL template DNA; (trnL- tions. The value of the standard deviation of split trnT)5lL59 GoTaq Buffer, 3 lL 25 mM MgCl2, frequency < 0.01 and the likelihood values moni- 0.25 lL each primer (10 lM), 0.2 lL GoTaq, 0.5 lL tored graphically were used as methods to access 10 mM dNTPs, 1 lL template DNA; (petL-psbE) stationarity. The burn-in was set to discard 25% of 5 lL59 GoTaq Buffer, 0.5 lL BSA, 2.5 lL 25 mM initial samples. Models of sequence evolution were MgCl2, 0.5 lL each primer (10 lM), 0.2 lL GoTaq, selected using jModelTest 2.1.5 (Guindon & Gas- 0.5 lL 10 mM dNTPs, 1 lL template DNA; (PhyC) cuel, 2003; Darriba et al., 2012), with default set- 5 lL59 GoTaq Buffer, 3 lL 25 mM MgCl2, 0.4 lL tings, for two datasets separately: all plastid each primer (10 lM), 0.2 lL GoTaq, 0.5 lL 10 mM markers combined and PhyC. TPM1uf+I+G and dNTPs, 1 lL template DNA. PCR reaction conditions HKY+G were selected as the best-fit models for for the amplification were as follows: (trnS-trnG each partition, respectively. Posterior probabilities amplified in two halves) 80 °C for 5 min, followed by (PP) were used to evaluate support for nodes;

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 284 A.A. CALVENTE CALVENTEET ET AL.AL. Brazil (BA, MG) Brazil (AL, BA, CE,SE) PB, PE, RN, Brazil (BA, ES, MG) HG, QT, SP, TS, VZ) Brazil (BA, MG) Ecuador, Peru, Venezuela Brazil (AL, BA, CE, PB, PE, PI, RN) OC, SL, SR) Brazil (MG) AL, SE, MG) Brazil (BA, MG) Brazil (PE, BA, SE, MG) Brazil (BA) Brazil (BA, MG, ES, RJ) Mexico (CH, DG, GR, JC, MC, MN, Brazil (GO) Netherlands Antiles, Colombia, Brazil (RJ) Brazil (BA, ES, RJ) Brazil (RR), Guyana Brazil (BA, MG) Brazil (MG) Guatemala, Honduras, Mexico (CS, Brazil (BA, MG) Mexico (OC, PL) Geographical distribution Brazil (BA, GO, MG) Brazil (TO, MA, PI, CE) Brazil (PE, BA, SE) Brazil (TO, BA, GO) Brazil (BA) Brazil (MG) Mexico (OC) Brazil (MG) Brazil (MG) Brazil (BA) Brazil (MA, PI, CE, RN, PB, PE, BA, * * floccosus fulvilanatus pentaedrophorus * catingicola (2006) brasiliensis et al. (F.Ritter) Zappi (F.Ritter) Zappi (Buining & Brederoo) Zappi (Britton & Rose) Zappi (P.J.Braun) Zappi subsp. pachycladus rosae ruschianus (Labour.) Byles & G.D.Rowley subsp. robustus Zappi (Buining & Brederoo) F.Ritter zehntneri (F.A.C.Weber ex K.Schum.) Byles & G.D.Rowley quadricostatus P.J.Braun & Esteves* (Poselg.) Byles & G.D.Rowley (Werderm.) Blyles & G.D.Rowley F.Ritter € (Buining & Brederoo) F.Ritter subsp. (L.) Byles & G.D.Rowley* urke) Byles & G.D.Rowley subsp. P.J.Braun & Esteves* (Werderm.) Byles & G.D.Rowley* P.J.Braun & Esteves (Buining & Brederoo) F.Ritter subsp. (Britton & Rose) Backeb subsp. subsp. (G F.Ritter (Vaupel) Byles & G.D.Rowley* subsp. salvadorensis (Werderm.) Zappi (Backeb. & Voll) Byles & G.D.Rowley subsp. (Lem.) Byles & G.D.Rowley N.P.Taylor & Zappi (Britton & Rose) Byles & G.D.Rowley (F.A.C.Weber ex K.Schum.) Byles & G.D.Rowley subsp. subsp. subsp. (F.A.C.Weber ex Rol.-Goss.) Byles & G.D.Rowley Zappi & N.P.Taylor* (K.Schum.) Byles & G.D.Rowley P. mollispinus P. flavipulvinatus P. lanuginosus P. pentaedrophorus P. collinsii P. flexibilispinus P. floccosus P. glaucochrous P. oligolepis P. alensis P. leucocephalus P. pachycladus P. ulei P. chrysacanthus P. fulvilanatus P. magnificus P. splendidus P. freweni P. azulensis P. catingicola P. brasiliensis P. arrabidae P. albisummus P. gounellei P. tuberculatus P. pentaedrophorus P. catingicola P. brasiliensis P. floccosus P. pachycladus subsp. pernambucoensis P. fulvilanatus gounellei P. gounellei 16. 7. 10. 17. 24. 15. Species 23. 11. 12. 13. 14. 3. 5. 6. 21. 25. 9. 19. 20. 22. 8. 4. 18. 1. 2. and infrageneric division according to Hunt Pilosocereus Gounellea Pilosocereus group group group subgenus subgenus Species listed in P. leucocephalus P. arrabidae P. pentaedrophorus Taxonomic group Pilosocereus Table 1. Pilosocereus

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 PHYLOGENETICSPHYLOGENETICS OF OF PILOSOCEREUS PILOSOCEREUS 295 Brazil (CE) Brazil (MG) Cayman Islands, Mexico (YN) Haiti, United States of America Brazil (BA, MG) Brazil (PI) Brazil (GO) Brazil (MG) Bahamas, Cuba, Dominican Republic, Brazil (BA) Brazil (GO, MA, PI, TO) Brazil (CE, RN, PB, PE) Brazil (MG) Bahamas, Cuba, Dominican Republic, Brazil (RO, MT, GO, MS) Brazil (TO, GO, MG, SP) Mexico (CS, OC) Brazil (BA) Brazil (GO) Geographical distribution Brazil (BA, GO) Mexico (JC, MN, NT, OC, SL) aurisetus chrysostele* (2016); acronym abbreviations indicate Brazilian and Mexican states. (F.Ritter) Zappi P.J.Braun & Esteves et al. cearensis (E.Y.Dawson) Backeb. P.J.Braun & Esteves aurilanatus F.Ritter € urke) Byles & G.D.Rowley* F.Ritter (G (Buining & Brederoo) F.Ritter (Diers & Esteves) P.J.Braun (Vaupel) Byles & G.D.Rowley subsp. (Esteves) P.J.Braun* (Buining & Brederoo) P.J.Braun (Lam.) Byles & G.D.Rowley* (E.Y.Dawson) Backeb. (Werderm.) Byles & G.D.Rowley subsp. subsp. (Britton & Rose) Byles & G.D.Rowley subsp. (Diers & Esteves) P.J.Braun (L.) Byles & G.D.Rowley Hofacker (2006) and Zappi et al. P. piauhyensis P. diersianus P. multicostatus P. pusillibaccatus P. vilaboensis P. machrisii P. parvus P. jauruensis P. chrysostele P. densiareolatus P. royenii P. aurisetus P. bohlei P. quadricentralis P. aureispinus P. purpusii P. polygonus P. chrysostele P. aurisetus 42. 40. 41. 38. 30. 36. 37. 34. 35. 33. 39. 29. 31. 32. 28. Species 27. 26. group group Continued P. piauhyensis P. aurisetus *Taxa not sampled in this study. Geographical distribution according to Hunt Table 1. Taxonomic group

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 306 A.A. CALVENTE CALVENTEET ET AL. AL.

clades with posterior probabilities > 0.95 are con- RESULTS sidered strongly supported. Sequences for 43 terminals, including ingroup and Incongruence between two datasets (plastid data outgroup taxa, were produced for each marker. We and nuclear data) was evaluated using the incongru- were unable to obtain sequences for Pilosocereus ence length difference test (ILD; Farris et al., 1994) glaucochrous (Werderm.) Blyles & G.D.Rowley for implemented in PAUP*. Separate partitions were PhyC and for outgroup Cereus jamacaru for the sec- created for each marker and a heuristic search was ond half of trnS-trnG, and, therefore ran analyses performed with 1000 homogeneity replicates. with this absent information coded as missing data (‘?’). The sizes of individual matrices and variation RECONSTRUCTION OF ANCESTRAL CHARACTER STATES obtained for each marker are listed in Table 2. The psbD-trnT dataset included 636 bp of which 1.4% Morphological data were compiled from the examina- were potentially parsimony informative; the MP tion of plant material combined with information analysis of this dataset led to 100 most-parsimonious obtained in descriptions and monographs (Taylor & trees of length 40 (CI = 0.90, RI = 0.79). The petL- Zappi, 2004; Hunt et al., 2006). Morphological char- psbE dataset included 539 bp of which 3.3% were acters used in the infrageneric classification of Pilo- potentially parsimony informative; the MP analysis socereus were chosen for ancestral state of this dataset led to 675 most-parsimonious trees of reconstructions and to identify potential synapomor- length 59 (CI = 0.83, RI = 0.94). The trnL-trnT data- phies for clades (habit, branching, number of ribs, set included 308 bp of which 2.9% were potentially distance of areoles, wood, differentiation of central parsimony informative; the MP analysis of this data- spine, pattern of flowering areoles, shape of flower set led to 143 most-parsimonious trees of length 25 bud and flower tube, flower and fruit size, fruit pulp (CI = 0.69, RI = 0.78). The trnS-trnG dataset colour). All characters were discrete. Three charac- included 1294 bp of which 4.8% were potentially par- ters were selected for display and were coded as fol- simony informative; the MP analysis of this dataset lows: (I) habit, (0) shrub, (1) tree; (II) pattern of led to 4079 most-parsimonious trees of length 176 flowering areoles, (0) differentiated, (1) not or weakly (CI = 0.70, RI = 0.80). The PhyC dataset included differentiated; and (III) shape of flower tube, (0) 933 bp of which 1.4% were potentially parsimony straight, (1) curved. The ancestral state reconstruc- informative; the MP analysis of this dataset led to tions using parsimony were performed in Mesquite 5159 most-parsimonious trees of length 69 v. 3.04 (Maddison & Maddison, 2015). The MP strict (CI = 0.78, RI = 0.87). consensus tree derived from the analysis of the com- Topologies obtained with each individual dataset bined dataset was used for character mapping. offered low resolution at various points at the infra- Ancestral geographical distribution was also exam- generic level (data not shown), but were generally ined using the same approach. Geographical distri- visually compatible with each other and we did not bution of species was coded according to information observe relevant contradicting relationships. The available in the literature (Table 1; Hunt et al., ILD test did not indicate significant incongruence 2006; Zappi et al., 2016). Geographical distribution among plastid data and nuclear data (P = 0.157) and was coded using two discrete states as follows: (0) we used a total evidence approach combining all Brazil, (1) Central and North America.

Table 2. Data derived from the maximum parsimony analyses of the individuals and combined datasets used in the phylogenetic analysis of Pilosocereus (CI, consistency index, calculated excluding uninformative characters; RI, retention index)

Size of Potentially informative sites Number of aligned Length of most-parsimonious Region matrix N (bp) % of total best tree trees CI RI

psbD-trnT 636 9 1.4 40 100 0.90 0.97 petL-psbE 539 18 3.3 59 675 0.83 0.94 trnL-trnT 308 9 2.9 25 143 0.69 0.78 trnS-trnG 1294 62 4.8 176 4079 0.70 0.80 PhyC 933 13 1.4 69 5159 0.78 0.87 Combined dataset 3710 111 3.0 382 8341 0.69 0.82

Figure 1. Bayesian inference tree for Pilosocereus based on the combined analysis of trnS-trnG, psbD-trnT, trnL-trnT, petL-psbE and PhyC sequences. Support values posterior probabilities/maximum parsimony bootstrap are shown above branches; strong support values are in bold. Names of species of Pilosocereus subgenus Pilosocereus are coloured according to informal taxonomic groups (Hunt et al., 2006).

markers in a single dataset. The combined dataset floral tube occurring in Brazil. The reconstruction of MP analysis resulted in 8341 most-parsimonious the ancestral state for the flowering areoles pattern trees of length 382 (CI = 0.69, RI = 0.82). in this node was uncertain. Several independent Relationships indicated in the 50% majority rule shifts (nine) were observed for tree habit and to consensus derived from the Bayesian analysis curved floral tube (ten) in this group. One transition (Fig. 1) were similar to the strict consensus tree of only occurred to the Central/North American distri- the MP analysis (topology shown in Fig. 2). The bution. Evolution of flowering areoles was highly topology obtained showed that the majority of Piloso- homoplasious in Pilosocereus subgenus Pilosocereus cereus spp. formed one well supported clade (pp = 1, s.s. with several shifts observed between differenti- BS = 99), here named Pilosocereus subgenus Piloso- ated to not or weakly differentiated throughout the cereus s.s., excluding P. bohlei Hofacker and P. gou- group. However, a consistent pattern was observed nellei. The Bayesian topology offered better in the P. leucocephalus group s.s. with only one resolution in more inclusive nodes of Pilosocereus transition to not or weakly differentiated flowering subgenus Pilosocereus s.s., but the majority of these areoles. are weakly supported (Fig. 1). Well supported relationships in this clade include one subclade formed by the majority of species of the P. leucocephalus DISCUSSION (Poselg.) Byles & G.D.Rowley group, here named the P. leucocephalus group s.s. and four small clades The phylogenetic analyses of Pilosocereus obtained composed each of two or three species (Fig. 1). here point to a paraphyletic Pilosocereus, because The ancestral state reconstruction analyses (Fig. 2) Pilosocereus subgenus Gounellea and P. bohlei indicated that the ancestor of Pilosocereus subgenus emerge nested in a clade of other Cereeae genera Pilosocereus s.s. clade was a shrub with a straight (outgroups). However, the connection of these species

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 328 A.A. CALVENTE CALVENTEET ET AL. AL.

Figure 2. Reconstruction of ancestral states of selected morphological traits and geographical distributions in Pilosocer- eus using parsimony. Topology is a strict consensus tree of the most-parsimonious trees derived from the maximum parsimony analysis based on the combined dataset of trnS-trnG, psbD-trnT, trnL-trnT, petL-psbE and PhyC sequences. Support values posterior probabilities/maximum parsimony bootstrap are shown above branches.

with the outgroup taxa is weakly supported (one In Pilosocereus subgenus Pilosocereus s.s., the P. clade with PP = 0.83/BS = 68 and a second clade leucocephalus group s.s. clade is strongly supported with PP = 0.59 and no BS support; Fig. 1). Pilosocer- and includes all species with a Central/North Ameri- eus subgenus Gounellea is unique morphologically can distribution, i.e. not occurring in Brazil (Fig. 1, among eastern Brazilian cereoid genera because of Table 1), whereas the remaining species of Pilosocer- the candelabriform type of branching and the circu- eus subgenus Pilosocereus s.s. clade have an exclu- lar insertion point of the perianth remnant in the sively Brazilian distribution. Besides having a fruit and may indeed represent a distinct lineage, similar distribution, outside the core area of diversifi- which probably deserves recognition at generic level. cation of the genus, these species share common Pilosocereus subgenus Gounellea and P. bohlei share morphological features, such as the large flowers the absence of a cephalium, the mostly naked peri- (> 5 cm) with a straight, wide opening floral tube carpel and typical flower morphology (short and fle- and not or weakly differentiated flowering areoles. shy with short and wide perianth segments) with the However, we could not identify potential synapomor- remaining species of Pilosocereus. These taxonomic phies for this northern group as all studied morpho- characters defining the genus occur, in different com- logical characters may also appear in other Brazilian binations, in other eastern Brazilian cereoid genera species not belonging to this clade. and it is possible that they represent plesiomorphic Four clades in Pilosocereus subgenus Pilosocereus features of a lineage of Cereinae to be confirmed in a s.s. received strong support values for bootstrap and broader sampled analysis for the entire subtribe. PP. Each is composed of species belonging to distinct The positioning of P. bohlei suggests a para- informal taxonomic groups in Pilosocereus (Zappi, phyletic Pilosocereus subgenus Pilosocereus, but this 1994; Hunt et al., 2006) and without a clearly needs further investigation in a phylogenetic analy- defined morphological unity. Taxa in the clade (P. sis including more taxa of Cereinae in order to pachycladus F.Ritter subsp. pernambucoensis (F.Rit- resolve and support better the position of this species ter) Zappi (P. glaucochrous (Werderm.) Blyles & in the subtribe. Pilosocereus bohlei, despite having G.D.Rowley, P. pentaedrophorus (Labour.) Byles & an overall morphology congruent with Pilosocereus G.D.Rowley)) are trees, strongly woody, with curved spp. (e.g. lacking a cephalium, mostly naked peri- floral tube, undifferentiated flowering areoles and carpel and typical flower morphology), seems some- purplish fruit pulp. None of these characters is what morphologically distinct from the other species exclusive of this clade, but it seems that this lineage of the genus, with unique features such as the tuber- is mostly uniform morphologically. The purplish fruit ous root and the stem swollen at the base tapering pulp is a rare character in Pilosocereus and is only towards the apex, this feature also being present in observed in this clade and in two other taxa: P. Stephanocereus luetzelburgii. This indicates that it pachycladus subsp. pachycladus and P. pentae- may belong to a different lineage in Cereinae and it drophorus subsp. robustus Zappi. Although the phy- should probably be excluded from Pilosocereus. logenetic tree obtained here does not group these two The majority of Pilosocereus spp. (Pilosocereus sub- taxa closer to the (P. pachycladus subsp. pernambu- genus Pilosocereus s.s.) emerge as a strongly sup- coensis (P. glaucochrous, P. pentaedrophorus)) clade, ported clade (PP = 1, BS = 99), including most of the the support values connecting these taxa to other species endemic to Brazil and those distributed in clades are not high and it is possible that they are Central and North America (Fig. 1, Table 1). Species indeed related to this clade. We cannot identify in this clade present characters common to all Piloso- potential synapomorphies or morphological connec- cereus as currently taxonomically defined (e.g. lack tions among species in the other strongly supported of a cephalium, mostly naked pericarpel and typical clades (P. aurisetus (Werderm.) Byles & G.D.Rowley flower morphology; Zappi, 1994; Hunt et al., 2006), subsp. aurilanatus (F.Ritter) Zappi, P. fulvilanatus and the basi- or mesotonic branching as opposed to (Buining & Brederoo) F.Ritter subsp. rosae the subapical candelabriform branching found in (P.J.Braun) Zappi); (P. azulensis N.P.Taylor & Zappi, subgenus Gounellea. Basitonic or mesotonic branch- P. floccosus (Backeb. & Voll) Byles & G.D.Rowley ing is also found commonly in other genera of Cere- subsp. quadricostatus (F.Ritter) Zappi); and (P. chry- inae and therefore may also represent a sostele (Vaupel) Byles & G.D.Rowley, P. flavipulvina- plesiomorphic character state. An option to resolve tus (Buining & Brederoo) F.Ritter). Further research Pilosocereus as a monophyletic taxon is to restrict its examining macro- and micromorphology in detail is circumscription to include only this clade, but a thor- needed to help identify potential synapomorphies for ough search expanding the set of characters cur- these groups. rently used and including micromorphological data The infrageneric division into five informal taxo- might prove useful in the detection of generic nomic groups (Zappi, 1994; Hunt et al., 2006) is synapomorphies to define the group better. apparently not supported in the phylogenetic trees

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 3410 A. CALVENTE ETET AL. AL.

obtained here, but poor resolution at deeper nodes of Ancestral state reconstruction indicates that key the Pilosocereus subgenus Pilosocereus s.s. clade does morphological characters used for definition of infor- not allow us to suggest alternative groupings for the mal taxonomic groups in Pilosocereus subgenus Pilo- genus at this point. The taxonomy of Pilosocereus is socereus do not carry significant phylogenetic signal. difficult and recent evolutionary work indicates that Instead, characters of habit, pattern of flowering are- some species as traditionally morphologically defined oles and shape of floral tube have shown an evident are polyphyletic and include species complexes, as is plasticity in the group and may putatively be easily the case for P. machrisii (E.Y.Dawson) Backeb., influenced by selective pressures rather than linked which has the widest distribution within the ‘P. to phylogenetic relationship. Additional characters aurisetus complex’ (Perez et al., 2016). Similar com- analysed (branching, number of ribs, distance of are- plexity may be affecting the informal groups and an oles, wood, differentiation of central spine, shape of integrative revision is necessary in order to propose flower bud, flower and fruit size and fruit pulp col- a new infrageneric classification for the genus. our) are also highly homoplasious. Poor resolution at We experienced difficulty in obtaining adequate deeper nodes may also contribute to the lack of a phylogenetic resolution when working with Pilosocer- defined pattern of evolution observed for the anal- eus and after a thorough search for adequate markers ysed characters in some cases. Previous studies with (Bonatelli et al., 2013) we chose a combination of the genus already identified morphological conver- more quickly evolving regions to obtain the present gence as a problem when trying to determine key phylogenetic trees. The same was observed for other taxonomic characters for infrageneric and even speci- South American taxon-rich and taxonomically com- fic delimitation of taxa in the group (Zappi, 1994; plex genera of Cactaceae such as Rhipsalis Gaertn. Hunt et al., 2006). It is possible that recent diversifi- and Opuntia Mill. Phenomena such as unusually cation combined with a high potential for morpholog- rapid radiations, recent divergence with incomplete ical plasticity and even some hybridization and lineage sorting and reticulate evolution have been introgression events have so far prevented the fixa- evoked to explain low phylogenetic resolution (Cal- tion of distinct sets of morphological characters in vente et al., 2011; Korotkova et al., 2011; Majure the different taxa. et al., 2012). Although they represent a limited sam- Pilosocereus is an interesting model to discuss the pling for Pilosocereus as a whole, phylogeographical biogeography of dry seasonal forests of South Amer- studies in the P. aurisetus species complex point to a ica mainly due to its extra-Amazonian occurrence. recent, early to mid Pleistocene divergence of main The pattern of geographical distribution seen for the lineages in this species group (Bonatelli et al., 2014; genus as a whole is similar to several other taxa in Perez et al., 2016). Hybridization followed by intro- different plant families in the Neotropics (Prado & gression, processes that have been evoked in different Gibbs, 1993; Pennington, Prado & Pendry, 2000). It work reporting on intricate relationships, and para- takes advantage of its adaptations to be distributed phyly of species have not been investigated deeply in across deciduous and semi-deciduous forests from the genus, although four cases of hybrids between the northeastern Brazil, where a few Pilosocereus sympatric parental species were mentioned by Zappi spp. are among the most characteristic of the decidu- (1992). Bonatelli et al. (2014) found evidence for well ous thorn woodland Caatinga (see Rodal & Nasci- established geographical structuring and absence of mento, 2006), down to the border of Paraguayan present-day gene flow among populations of the P. Chaco along the seasonal forests of the dry diagonal aurisetus species complex. Nevertheless, Perez et al. and also forming a northern core area, from northern (2016) did not confirm such geographical structuring. Brazilian Amazon to Mexico and the southern USA. We believe that recent diversification in Pilosocereus The analysis of phylogenetic relationships obtained coupled with incomplete lineage sorting is more likely here allows the observation of clear and defined pat- the scenario explaining the low phylogenetic resolu- terns of the history of the macrogeographical distri- tion observed, although we cannot exclude events of bution of the genus. The ancestral distribution in reticulate evolution. The limited resolution of classical central and eastern Brazil resulted in the diversifica- molecular markers seen in Pilosocereus spp. has stim- tion of most lineages in the same area, whereas the ulated the development of anonymous nuclear mark- P. leucocephalus group s.s. clade was able to disperse ers from next-generation sequencing (Perez et al., through the Amazonian areas and diversify further 2016). These authors suggest that larger datasets north and reach Central and North America. might help to clarify species boundaries in an integra- Although we did not include P. lanuginosus (L.) tive mode, associated with taxon morphology. The Byles & G.D.Rowley and P. polygonus (Lam.) Byles same approach appears to be necessary for obtaining & G.D.Rowley in this study, both species belong to a fully resolved phylogenetic hypothesis for the entire the P. leucocephalus group and occur in the northern genus. core area of distribution of the genus and we believe

that, once these are included in a molecular phylo- American epiphytic cacti. International Journal of Plant genetic hypothesis for the genus, they will probably Sciences 172: 902–914. be nested in the P. leucocephalus group s.s. clade. A Cavalcanti NB, Resende GM. 2007. Efeito de diferentes fully resolved phylogenetic hypothesis for the genus substratos no desenvolvimento de mandacaru (Cereus jama- is necessary, with higher resolution in the Pilosocer- caru P. DC.), Facheiro (Pilosocereus pachycladus Ritter), eus subgenus Pilosocereus s.s. clade, as it may bring Xiquexique [Pilosocereus gounellei (A. Weber ex K. Schum.) particularly interesting conclusions about the series Byl. ex Rowl.], e Coroa-de-Frade (Melocactus bahiensis of events involving the historical occupation of genus (Britton & Rose). Revista Caatinga 20: 28–35. along the dry diagonal seasonal forests. Darriba D, Taboada GL, Doallo R, Posada D. 2012. jMo- delTest 2: more models, new heuristics and parallel com- puting. Nature Methods 9: 772. Farris JD, Kallersjo M, Kluge AG, Bult C. 1994. Testing ACKNOWLEDGEMENTS significance of incongruence. Cladistics 10: 315–319. Gibson A, Nobel P. 1986. The cactus primer. Cambridge: This work was accomplished with support from Harvard University Press. CNPq, Conselho Nacional de Desenvolvimento Guindon S, Gascuel O. 2003. A simple, fast and accurate Cient�ıfico e Tecnologico� – Brazil (485693/2011 to AC) method to estimate large phylogenies by maximum-likeli- and from FAPESP, the Sao~ Paulo Research Founda- hood. Systematic Biology 52: 696–704. tion (2008/50905-1 and 2010/02186-6 to IASB and Helsen P, Browne RA, Anderson DJ, Verdyck P, Van 2005/55200-8 to EMM). We thank Marcelo Pace, Sal- Dongen S. 2009. Galapagos’� Opuntia (prickly pear) cacti: vador Arias and Teresa Terrazas for helping with extensive morphological diversity, low genetic variability. Mexican samples; Joselio� Maria Galvao~ de Araujo, Biological Journal of the Linnean Society 96: 451–461. Fabiana Lima Bezerra and users of LABIC/UFRN Hernandez-Hern� andez� T, Brown JW, Sclumpberger for facilitating the shared use of laboratory equip- BO, Eguiarte LE, Magallon� S. 2014. Beyond aridifica- ment and two anonymous reviewers for valuable tion: multiple explanations for the elevated diversification comments on the manuscript. of cacti in the New World Succulent Biome. New Phytolo- gist 202: 1382–1397. Hernandez-Hern� andez� T, Hernandez HM, De-Nova JA, Puente R, Eguiarte LE, Magallon� S. 2011. Phylogenetic REFERENCES relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae). American Journal of Abud HF, Goncßalves NR, Reis RGE, Pereira DS, Bez- Botany 98: 44–61. erra ME. 2010. Germinacßao~ e expressao~ morfologica� de frutos, sementes e plantulas^ de Pilosocereus pachycladus Hernandez-Ledesma� P, Berendsohn WG, Borsch T, Ritter. Revista Ciencia^ Agronomica^ 41: 468–474. Mering S, Akhani H, Arias S, Castaneda-Noa~ I, Eggli Barcenas� RT, Yesson C, Hawkins JA. 2011. Molecular U, Eriksson R, Flores-Olvera H, Fuentes-Bazan� S, systematics of the Cactaceae. Cladistics 27: 470–489. Kadereit G, Klak C, Korotkova N, Nyffeler R, Ocampo Barthlott W, Hunt DR. 1993. Cactaceae. In: Kubitzki K, ed. G, Ochoterena H, Oxelman B, Rabeler RK, Sanchez A, The families and genera of vascular plants. Berlin: Schlumpberger BO, Uotila P. 2015. A taxonomic back- Springer-Verlag, 161–197. bone for the global synthesis of species diversity in the Boke N. 1941. Zonation in the shoot apices of Trichocereus angiosperm order Caryophyllales. Willdenowia 45: 281–383. spachianus and Opuntia cylindrica. American Journal of Hunt D, Taylor NP, Charles G. 2006. The new cactus lexi- Botany 28: 656–664. con. London: Dhbooks. Bonatelli IA, Zappi DC, Taylor NP, Moraes EM. 2014. Korotkova N, Borsch T, Quandt D, Taylor NP, Muller€ Interglacial microrefugia and diversification of a cactus spe- KF, Barthlott W. 2011. What does it take to resolve rela- cies complex: phylogeography and palaeodistributional tionship and to identify species with molecular markers? reconstructions for Pilosocereus aurisetus and allies. Molec- An example from the epiphytic Rhipsalideae (Cactaceae). ular Ecology 23: 3044–3063. American Journal of Botany 98: 1549–1572. Bonatelli IAS, Zappi DC, Taylor NP, Moraes ME. 2013. Locatelli E, Machado ICS, Medeiros P. 1997. Floral biol- Usefulness of cpDNA markers for phylogenetic and phylo- ogy and pollination in Pilosocereus catingicola (Cactaceae) geographic analyses of closely-related cactus species. Genet- in northeastern Brazil. Bradleya 15: 28–34. ics and Molecular Research 12: 4579–4585. Maddison WP, Maddison DR. 2015. Mesquite: a modular Braun PJ, Esteves EP. 1999. Pilosocereus chrysostele (Vau- system for evolutionary analysis. Version 3.04. Available at: pel) Byles & Rowley subsp. cearensis P.J. Braun & Esteves: http://mesquiteproject.org a new subspecies of Pilosocereus from the State of Ceara.� Majure LC, Puente R, Griffith MP, Judd WS, Soltis P, Brazil. British Cactus & Succulent Journal 17: 21–27. Soltis DE. 2012. Phylogeny of Opuntia s.s. (Cactaceae): Calvente A, Zappi DC, Forest F, Lohmann LG. 2011. clade delineation, geographic origins, and reticulate evolu- Molecular phylogeny, evolution, and biogeography of South tion. American Journal of Botany 99: 847–864.

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 3612 A. CALVENTE ETET AL. AL.

Meiado MV, Albuquerque LSC, Rocha EA, Leal IR. Shaw J, Lickey EB, Beck JT, Farmer SB, Liu WS, 2008. Efeito da luz e da temperatura na germinacßao~ de Miller J, Siripun KC, Winder CT, Schilling EE, Small sementes de Pilosocereus catingicola subsp. salvadorensis RL. 2005. The tortoise and the hare II: relative utility of 21 (Werderm.) Zappi (Cactaceae). Boletın de la Sociedad Lati- noncoding chloroplast DNA sequences for phylogenetic noamericana y del Caribe de Cactaceas y otras Suculentas analysis. American Journal of Botany 92: 142–166. 5: 9–12. Shaw J, Lickey EB, Schilling EE, Small RL. 2007. Com- Mungu�ıa-Rosas MA, Sosa VJ, Jacome-Flores ME. 2010. parison of whole chloroplast genome sequences to choose Pollination system of the Pilosocereus leucocephalus colum- noncoding regions for phylogenetic studies in angiosperms: nar cactus (tribe Cereeae) in eastern Mexico. Plant Biology the tortoise and the hare III. American Journal of Botany 12: 578–586. 94: 275–288. Nyffeler R, Eggli U. 2010. A farewell to dated ideas and Silva JGM, Silva DS, Ferreira MA, Lima GFC, Melo concepts – molecular phylogenetics and a revised supra- AAS, Diniz MCNM. 2005. Xiquexique (Pilosocereus gou- generic classification of the family Cactaceae. Schummania nellei (A. Weber ex K. Schum.) Bly. Ex Rowl.) em substi- 6: 109–149. tuicßao~ a� silagem de sorgo (Sorghum bicolor L. Moench) na Pennington RT, Prado DE, Pendry CA. 2000. Neotropical alimentacßao~ de vacas leiteiras. Revista Brasileira de Zootec- seasonally dry forests and Quaternary vegetation changes. nia 34: 1408–1417. Journal of Biogeography 27: 261–273. Simmons MP, Ochoterena H. 2000. Gaps as characters in Perez MF, Carstens BC, Rodrigues GL, Moraes EM. sequence-based phylogenetic analyses. Systematic Biology 2016. Anonymous nuclear markers reveal taxonomic incon- 49: 369–381. gruence and long-term disjunction in a cactus species com- Swofford DL. 2002. PAUP*. Phylogenetic analysis using plex with continental-island distribution in South America. parsimony (*and other methods). Version 4.0. Sunderland: Molecular Phylogenetics and Evolution 95: 11–19. Sinauer Associates. Prado DE, Gibbs PE. 1993. Patterns of species distribu- Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Univer- tions in the dry seasonal forests of South America. Annals sal primers for amplification of three non-coding regions of of the Missouri Botanical Garden 80: 902–927. chloroplast DNA. Plant Molecular Biology 17: 1105–1109. Rivera-Marchand B, Ackerman JD. 2006. Bat pollination Taylor NP, Zappi DC. 1997. Nomenclatural adjustments breakdown in the Caribbean columnar cactus Pilosocereus and novelties in Brazilian Cactaceae. Cactaceae Consensus royenii. Biotropica 38: 635–642. Initiatives 3: 7–8. Rocha EA, Machado IC, Zappi DC. 2007a. Fenologia, Taylor NP, Zappi DC. 2004. Cacti of eastern Brazil. Kew: biologia da polinizacßao~ e da reproducßao~ de Pilosocereus Royal Botanic Gardens. Byles & Rowley (Cactaceae) no Nordeste do Brasil. Boletın Zappi D, Taylor N. 2011. A new species of Pilosocereus sub- de la Sociedad Latinoamericana y del Caribe de Cactaceas genus Gounellea, P. frewenii, from SE Brazil. Bradleya 29: y Otras Suculentas 4: 5–7. 131–136. Rocha EA, Machado IS, Zappi DC. 2007b. Floral biology Zappi D, Taylor N, Santos MR, Larocca J. 2016. Cac- of Pilosocereus tuberculatus (Werderm.) Byles & Rowley: a taceae in Lista de Especies da Flora do Brasil. Rio de bat pollinated cactus endemic from the ‘Caatinga’ in north- Janeiro: Jardim Botanico^ do Rio de Janeiro. Available at: eastern Brazil. Bradleya 25: 129–160. http://floradobrasil.jbrj.gov.br/jabot/floradobrasil/FB70 Rodal MJN, Nascimento LM. 2006. The arboreal compo- Zappi DC. 1992. A fam�ılia Cactaceae nos Campos Rupestres nent of a dry forest in northeastern Brazil. Brazilian Jour- da Cadeia do Espinhacßo Minas Gerais, Brasil. Dissertacßao~ nal of Biology 66: 479–492. de mestrado, USP. Ronquist F, Teslenko M, van der Mark P, Ayres D, Dar- Zappi DC. 1994. Pilosocereus (Cactaceae). The genus in ling A, Hohna€ S, Larget B, Liu L, Suchard MA, Brazil. Succulent Plant Research 3: 1–160. Huelsenbeck JP. 2011. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542.

Appendix 1. Vouchers and GenBank Accession Numbers for Species Used in the Phylogenetic Analyses of Pilosocereus

Species: vouchers – accession numbers psbD-trnT, petL-psbE, trnL-trnT, trnS-trnG, PhyC

Arrojadoa rhodantha: M Machado 777 (HUEFS) – KX301086, KX301129, KX301167, KX301205, KX301244. Cereus jamacaru: A Calvente 461 (UFRN) – KX301076, KX301119, KX301162, KX301200, KX301238. Melocactus zehntneri: A Calvente 462 (UFRN) – KX301074, KX301117, KX301160, KX301198, KX301236. Pilosocereus albisummus: EM Moraes S141 (SORO) – KX301097, KX301140, KX301178, KX301216, KX301255. P. alensis: H Sanchez-Mejorada 4449 (MEXU) – KX301064, KX301107, KX301150, KX301188, KX301226. P. arrabidae: FF Franco S79B1 (SORO) – KX301103, KX301146, KX301184, KX301222, KX301261. P. aureispinus: EM Moraes S21 (HUFS) – KX301080, KX301123, KX301163, KX301201, KX301240. P. aurisetus subsp aurisetus: EM Moraes S30 (SORO) – KX301082, KX301125, KC779380.1, KC779380.1, KX301241. P. aurisetus subsp aurilanatus: EM Moraes S7 (HUFS) – KX301077, KX301120, KC621246.1, KC779423.1, KC779288. P. azulensis: G Olsthoorn 253 (SORO) – KX301095, KX301138, KX301176, KX301214, KX301253. P. bohlei: EM Moraes S51 (CCTS) – KX301092, KX301135, KX301173, KX301211, KX301250. P. brasiliensis: FF Franco S79E (SORO) – KX301104, KX301147, KX301185, KX301223, KX301262. P. catingicola subsp catingicola: G Olsthoorn 1026 (SORO) – KX301098, KX301141, KX301179, KX301217, KX301256. P. catingicola subsp salvadorensis: MOT Menezes 378 (EAC) – KX301099, KX301142, KX301180, KX301218, KX301257. P. chrysacanthus: S. Arias 858 (MEXU) – KX301066, KX301109, KX301152, KX301190, KX301228. P. chrysostele subsp. cearensis: MOT Menezes 161(SORO) – KX301084, KX301127, KX301165, KX301203, KX301242. P. collinsii: S. Arias 1658 (MEXU) – KX301067, KX301110, KX301153, KX301191, KX301229. P. densiareolatus: EM Moraes S43 (SORO) – KX301089, KX301132, KX301170, KX301208, KX301247. P. flavipulvinatus: MOT Menezes 259 (EAC) – KX301105, KX301148, KX301186, KX301224, KX301263. P. floccosus subsp. quadricostatus: G Olsthoorn 42 (SORO) – KX301101, KX301144, KX301182, KX301220, KX301259. P. fulvilanatus subsp. fulvilanatus: EM Moraes S42 (SORO) – KX301088, KX301131, KX301169, KX301207, KX301246. P. fulvilanatus subsp. rosae: G Olsthoorn 263 (SORO) – KX301096, KX301139, KX301177, KX301215, KX301254. P. glaucochrous: M Machado S35M2 (SORO) – KX301083, KX301126, KX301164, KX301202, –. P. gounellei: P Lavor 08 (UFRN) – KX301070, KX301113, KX301156, KX301194, KX301232. P. jauruensis: EM Moraes S25 (SORO) – KX301081, KX301124, KC779358.1, KC779358.1, KC779302. P. leucocephalus: S Arias 1654 (MEXU) – KX301069, KX301112, KX301155, KX301193, KX301231. P. machrisii: EM Moraes S17 (HUFS) – KX301078, KX301121, JN035602, KC779262.1 and JN035400, KX301239. P. magnificus: NP Taylor and DC Zappi 755 (BHCB) – KX301085, KX301128, KX301166, KX301204, KX301243. P. multicostatus: EM Moraes S39 (SORO) – KX301087, KX301130, KX301168, KX301206, KX301245. P. pachycladus subs P. pachycladus: EM Moraes S45 (SORO) – KX301090, KX301133, KX301171, KX301209, KX301248. P. pachycladus subsp. pernambucoensis: P Lavor 23 (UFRN) – KX301073, KX301116, KX301159, KX301197, KX301235. P. parvus: EM Moraes S47 (SORO) – KX301091, KX301134, KX301172, KX301210, KX301249. P. pentaedrophorus subsp. pentaedrophorus: G Olsthoorn 167 (SORO) – KX301100, KX301143, KX301181, KX301219, KX301258. P. pentaedrophorus subsp. robustus: G Olsthoorn 172 (SORO) – KX301093, KX301136, KX301174, KX301212, KX301251. P. purpusii: JJ Blancas Vazquez 119 (MEXU) – KX301065, KX301108, KX301151, KX301189, KX301227. P. pusillibaccatus: P Lavor 20 (UFRN) – KX301071, KX301114, KX301157, KX301195, KX301233. P. pusillibaccatus: P Lavor 21 (UFRN) – KX301072, KX301115, KX301158, KX301196, KX301234. P. quadricentralis: S Arias 2180 (MEXU) – KX301063, KX301106, KX301149, KX301187, KX301225. P. royenii: S Arias 1098 (MEXU) – KX301068, KX301111, KX301154, KX301192, KX301230. P. splendidus: EM Moraes S139 (SORO) – KX301094, KX301137, KX301175, KX301213, KX301252. P. ulei: FF Franco S79 (SORO) – KX301102, KX301145, KX301183, KX301221, KX301260. P. vilaboensis: EM Moraes S19 (CCTS) – KX301079, KX301122, KC621157.1, KC779340.1, KC779305.1. Stephanocereus leucostele: A. Calvente 413 (UFRN) – KX301075, KX301118, KX301161, KX301199, KX301237.

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018 3814 A. CALVENTE ETET AL. AL.

Appendix 2. Primers Used in This Study

Region Primers Source

petL-psbE petL: AGTAGAAAACCGAAATAACTAGTT A Shaw et al. (2007) psbE: TATCGAATACTGGTAATAATATCAGC psbD-trnTGGU psbD: CTCCGTARCCAGTCATCCATA Shaw et al. (2007) trnT(GGU)-R: CCCTTTTAACTCAGTGGTAG 30trnS-trnG 50trnG2S: TTTTACCACTAAACTATACCCGC Shaw et al. (2005) and Bonatelli et al. (2013) SGFwd2: CACCCATGGTTCCCATTAGA GCU 50 trnS-trnG trnS : AGATAGGGATTCGAACCCTCGGT Shaw et al. (2005) and Bonatelli et al. (2013) SGRev2: TCCGCTCATTAGCTCTCCTC trnL-trnT b: TCTACCGATTTCGCCATATC Taberlet et al. (1991) a: CATTACAAATGCGATGCTCT PHYC PhyF: AGCTGGGGCTTTCAAATCTT Helsen et al. (2009) PhyR: TCCTCCACTTGACCACCTCT

Downloaded from https://academic.oup.com/botlinnean/article-abstract/183/1/25/2857470 by Universidade Federal do Rio Grande do Norte user on 15 February 2018