DOCSLIB.ORG

ELAVL1 Regulates Alternative Splicing of Eif4e Transporter to Promote Postnatal Angiogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ELAVL1 Regulates Alternative Splicing of Eif4e Transporter to Promote Postnatal Angiogenesis ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis Sung-Hee Changa,1, Olivier Elementob, Jiasheng Zhangc, Zhen W. Zhuangc, Michael Simonsc, and Timothy Hlaa,1 aCenter for Vascular Biology, Department of Pathology and Laboratory Medicine, and bInstitute for Computational Biomedicine, Department of Physiology and Biophysics, Weill Cornell Medical College, Cornell University, New York, NY 10065; and cYale Cardiovascular Research Center, Yale University School of Medicine, New Haven, CT 06520 Edited by Napoleone Ferrara, University of California, San Diego, La Jolla, CA, and approved October 28, 2014 (received for review June 27, 2014) Posttranscriptional RNA regulation is important in determining the angiogenic factor induced by hypoxia-inducible factor 1α (HIF-1α) plasticity of cellular phenotypes. However, mechanisms of how RNA (20). We and others recently showed that macrophage ELAVL1 is binding proteins (RBPs) influence cellular behavior are poorly under- important in the angiogenic gene expression program (9, 21). stood. We show here that the RBP embryonic lethal abnormal vision In this report, we investigated how posttranscriptional gene like 1 (ELAVL1, also know as HuR) regulates the alternative splicing of regulations via ELAVL1 control postnatal angiogenesis. This eukaryotic translation initiation factor 4E nuclear import factor 1 work shows that ELAVL1 regulates alternative splicing of the (Eif4enif1), which encodes an eukaryotic translation initiation factor eukaryotic translation initiation factor 4E nuclear import factor 1 4E transporter (4E-T) protein and suppresses the expression of capped (Eif4enif1), which encodes an eIF4E transporter (4E-T) protein. mRNAs. In the absence of ELAVL1, skipping of exon 11 of Eif4enif1 The 4E-T is required for cytoplasmic RNA processing body (PB) forms the stable, short isoform, 4E-Ts. This alternative splicing event formation and functions in mRNA translational suppression and results in the formation of RNA processing bodies (PBs), enhanced mRNA degradation (22, 23). We hypothesize that ELAVL1- turnover of angiogenic mRNAs, and suppressed sprouting behavior regulated alternative splicing of Eif4enif1 controls mRNA turn- of vascular endothelial cells. Further, endothelial-specific Elavl1 knock- over, which regulates postnatal pathological angiogenesis. out mice exhibited reduced revascularization after hind limb ischemia and tumor angiogenesis in oncogene-induced mammary cancer, Results and Discussion resulting in attenuated blood flow and tumor growth, respectively. ELAVL1 Regulates Alternative Splicing of Eif4enif1. To examine the ELAVL1-regulated alternative splicing of Eif4enif1 leading to en- mechanisms by which ELAVL1 regulates angiogenesis, we con- hanced formation of PB and mRNA turnover constitutes a novel post- ducted exon-microarray analysis using mouse lung endothelial transcriptional mechanism critical for pathological angiogenesis. cells (MLECs) isolated from endothelial cell-specific Elavl1 knockout mice (Elavl1 ECKO) (Fig. S1) as well as bone-marrow– angiogenesis | RNA binding protein | eIF4e transporter | derived macrophages (BMDMs) isolated from myeloid-specific alternative splicing | tumor angiogenesis Elavl1 knockout mice (Elavl1 MøKO) (9) and compared them with the wild-type (WT, Elavl1f/f) counterparts. Alternative ngiogenesis, also known as new vessel formation, is a funda- splicing (AS) analysis by GeneSpring (Agilent Technologies) and Amental process in embryonic development, tissue growth, and AltAnalyze (24) identified four genes (Eif4enif1, Dlst, Usp1, and recovery from tissue injury (1). In addition, dysregulated angiogen- BC005537) to be alternatively spliced in an ELAVL1-dependent esis is important in many conditions such as cancer growth, metas- manner in both cell types (Fig. 1 and Figs. S2 and S3). Among tasis, age-related macular degeneration, and chronic inflammatory these, the coding exon 11 of Eif4enif1 gene is spliced out in the disease (2). Both developmental and postnatal angiogenesis are absence of ELAVL1. This 72-nt exon encodes a 24-amino-acid initiated by paracrine factors acting on endothelial cells to induce domain, which is positioned between the two nuclear export the formation of angiogenic sprouts, their fusion to form the pri- signal motifs of the eukaryotic initiation factor 4E transporter mary vascular plexus and maturation processes that stabilize the newly formed blood vessels (3). However, gene expression programs Significance in endothelial cells that drive the angiogenic process are poorly understood. Hypoxia- and flow-regulated transcriptional events have Angiogenesis, or new blood vessel formation, is critical not only been characterized as major mechanisms that regulate gene ex- for normal processes such as embryonic development but also for pression during angiogenesis (4, 5). Recently, posttranscriptional progression of diseases such as tumor growth, metastasis, and gene regulation by RNA binding proteins (RBPs) and miRNAs is chronic inflammatory disease. This work elucidated a molecular recognized to play important roles in the regulation of fundamental mechanism that is important in postnatal angiogenesis in tumor biological processes (6, 7). Indeed, miRNAs were shown to regulate growth and ischemia–reperfusion injury in the hind limb. of angiogenesis and expression of key regulators (8–12). Specifically, we identified a posttranscriptional gene regulatory ELAVL1 (also known as Hu antigen R, HuR) is an AU-rich mechanism that controls the activity of a potent suppressor of element (ARE) and U-rich element (URE) RBP that stabilizes gene expression, named eIF4e transporter (4E-T). Alternative mRNAs and promotes gene expression (13). Although this RBP is splicing of 4E-T controls the level of the active form of 4E-T, which located primarily in the nucleus, it is translocated into the cytoplasm suppresses gene expression in endothelial cells. This mechanism after cellular activation to promote gene expression. ELAVL1 binds may be targeted to control angiogenesis-dependent diseases. to the 3′ UTRs of many mRNAs, often at or near miRNA bind- MEDICAL SCIENCES Author contributions: S.-H.C. and T.H. designed research; S.-H.C., J.Z., and Z.W.Z. per- ing sites (14, 15). Indeed, ELAVL1 functions in part to modulate formed research; S.-H.C., O.E., J.Z., Z.W.Z., M.S., and T.H. analyzed data; O.E. performed miRNA-dependent gene regulation (9, 16). Mice deficient for bioinformatic analysis; and S.-H.C., M.S., and T.H. wrote the paper. Elavl1 are embryonic lethal due to defects in placental development The authors declare no conflict of interest. (17). Inducible postnatal deletion of Elavl1 leads to stem/progenitor This article is a PNAS Direct Submission. cell apoptosis leading to intestinal and hematopoietic failure 1To whom correspondence may be addressed. Email: [email protected] or and death within 10 d (18), and zebrafish elavl1 is important for [email protected]. regulation of gata1 expression and embryonic erythropoiesis (19). This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. ELAVL1 stabilizes the mRNA for VEGF-A, which encodes a key 1073/pnas.1412172111/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1412172111 PNAS | December 23, 2014 | vol. 111 | no. 51 | 18309–18314 Downloaded by guest on October 1, 2021 (4E-T) protein (25). In contrast, the three other ELAVL1- were shown to be involved in posttranscriptional gene regulation regulated, alternatively spliced genes contain affected exons in in germ cells (27). However, the role of 4E-T in angiogenesis has the 5′ UTR (Usp1)or3′ UTR (Dlst and BC005537). not been determined. RT-PCR analysis indicated that Eif4enif1 We further studied ELAVL1 regulation of alternative splicing exon 11 is skipped in cells that lack ELAVL1, resulting in the re- of Eif4enif1, which encodes an important factor that is critical for duced expression of Eif4enif1-L (4E-TL) isoform and increased cytoplasmic RNA PB formation, suppression of mRNA trans- expression of Eif4enif1-S (4E-Ts) isoform (Fig. 1B). ELAVL1- lation, and mRNA degradation (22, 23). Loss-of-function muta- dependent alternative splicing of Eif4enif1 was observed in primary tions of EIF4ENIF1 gene are associated with primary ovarian BMDMs, MLECs, immortalized mouse embryonic endothelial cells Elavl1 insufficiency (26) and both mouse and Drosophila homologs of 4E-T (IMECs) transfected with siRNA targeting ,andIMECstably expressing the shRNA for Elavl1 (shElavl1), indicating that this event is not cell-type specific. Eif4enif1 genomic sequence shows that intron 10 contains 18 U-rich sites including a long, U-rich poly- pyrimidine tract (∼71 bp) immediately preceding the 3′-splice ac- ceptor site (Fig. S4). Because ELAVL1 interaction with binding sites located close to 3′-splice junctions have been observed in the pho- toactivatable ribonucleoside enhanced crosslinking and immuno- precipitation analysis of human cells (14, 15), and because it was shown to regulate splicing of the FAS primary transcript in HeLa cells (28), our data suggest that nuclear function of ELAVL1 may involve the regulation of splicing of Eif4enif1 primary transcript. This event results in the predominant expression of the 4E-TL isoform. Eif4enif1 mRNA expression was similar between WT and Elavl1 ECKO MLECs. When MLECs were treated with acti- nomycin D, Eif4enif1 mRNA decayed with a half-life of ∼2h, which was similar between WT and Elavl1 ECKO cells (Fig. 1C), suggesting
Load more

Recommended publications
  • IP6K1 Upregulates the Formation of Processing Bodies by Promoting Proteome Remodeling on the Mrna Cap
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. IP6K1 upregulates the formation of processing bodies by promoting proteome remodeling on the mRNA cap Akruti Shah1,2 and Rashna Bhandari1* 1Laboratory of Cell Signalling, Centre for DNA Fingerprinting and Diagnostics (CDFD), Inner Ring Road, Uppal, Hyderabad 500039, India. 2Graduate studies, Manipal Academy of Higher Education, Manipal 576104, India. *Correspondence to Rashna Bhandari; Email: [email protected] Running title: IP6K1 promotes mRNA turnover to induce P-bodies ORCID IDs Akruti Shah - 0000-0001-9557-4952 Rashna Bhandari - 0000-0003-3101-0204 This PDF file includes: Main Text Figures 1 to 6 Keywords mRNA decay/mRNA metabolism/P-bodies/translation suppression 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Inositol hexakisphosphate kinases (IP6Ks) are ubiquitously expressed small molecule kinases that catalyze the conversion of the inositol phosphate IP6 to 5-IP7. IP6Ks have been reported to influence cellular functions by protein-protein interactions independent of their enzymatic activity.
    [Show full text]
  • Differential Analysis of Gene Expression and Alternative Splicing
    i bioRxiv preprint doi: https://doi.org/10.1101/2020.08.23.234237; this version posted August 24, 2020. The copyright holder for this preprint i (which was not certified by peer review)“main” is the author/funder, — 2020/8/23 who has — granted 9:38 — bioRxiv page a1 license — #1 to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. i i EmpiReS: Differential Analysis of Gene Expression and Alternative Splicing Gergely Csaba∗, Evi Berchtold*,y, Armin Hadziahmetovic, Markus Gruber, Constantin Ammar and Ralf Zimmer Department of Informatics, Ludwig-Maximilians-Universitat¨ Munchen,¨ 80333, Munich, Germany ABSTRACT to translation. Different transcripts of the same gene are often expressed at the same time, possibly at different abundance, While absolute quantification is challenging in high- yielding a defined mixture of isoforms. Changes to this throughput measurements, changes of features composition are further referred to as differential alternative between conditions can often be determined with splicing (DAS). Various diseases can be linked to DAS high precision. Therefore, analysis of fold changes events (3). Most hallmarks of cancer like tumor progression is the standard method, but often, a doubly and immune escape (4, 5) can be attributed to changes in differential analysis of changes of changes is the transcript composition (6). DAS plays a prominent role required. Differential alternative splicing is an in various types of muscular dystrophy (MD) (7), splicing example of a doubly differential analysis, i.e. fold intervention by targeted exon removal is a therapeutic option changes between conditions for different isoforms in Duchenne MD (8).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DCP1 decapping enzyme homolog A (S. cerevisiae) Gene Symbol Dcp1a Organism Mouse Gene Summary Description Not Available Gene Aliases 1110066A22Rik, 4930568L04Rik, AU019772, D14Ertd817e, Mitc1, SMIF RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.28733 Ensembl Gene ID ENSMUSG00000021962 Entrez Gene ID 75901 Assay Information Unique Assay ID qMmuCID0013841 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000022535 Amplicon Context Sequence TAATCTGGGAAGCACCGAGACTCTAGAAGAGACACCCTCTGGGTCACAGGATAA GTCTGCTCCGTCTGGTCATAAACATCTGACAGTAGAAGAGTTATTTGGAACCTCC TTGCCAAAGGAA Amplicon Length (bp) 91 Chromosome Location 14:30513043-30518984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 22.41 cDNA Tm (Celsius) 81 gDNA Cq 24.87 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Dcp1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 4005-4009, May 1991 Genetics Exon amplification: A strategy to isolate mammalian genes based on RNA splicing (gene cloning/polymerase chain reaction) ALAN J. BUCKLER*, DAVID D. CHANG, SHARON L. GRAw, J. DAVID BROOK, DANIEL A. HABER, PHILLIP A. SHARP, AND DAVID E. HOUSMAN Center for Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Phillip A. Sharp, January 25, 1991 ABSTRACT We have developed a method, exon amplifi- (7, 8). Thus, this method may be generally applicable for the cation, for fast and efficient isolation of coding sequences from selection of exon sequences from any gene. The method is complex mammalian genomic DNA. This method is based on also both rapid and easily adapted to large scale experiments. the selection of RNA sequences, exons, which are flanked by A series of cloned genomic DNA fragments can be screened functional 5' and 3' splice sites. Fragments of cloned genomic within 1-2 weeks. The sensitivity of this method is high. DNA are inserted into an intron, which is flanked by 5' and 3' Genomic DNA segments of 20 kilobases (kb) or more can be splice sites of the human immunodeficiency virus 1 tat gene successfully screened in a single transfection by using a set contained within the plasmid pSPL1. COS-7 cells are trans- of pooled subclones. This method thus allows the rapid fected with these constructs, and the resulting RNA transcripts identification of exons in mammalian genomic DNA and are processed in vivo. Splice sites of exons contained within the should facilitate the isolation of a wide spectrum of genes of inserted genomic fragment are paired with splice sites of the significance in physiology and development.
    [Show full text]
  • Mrna Turnover Philip Mitchell* and David Tollervey†
    320 mRNA turnover Philip Mitchell* and David Tollervey† Nuclear RNA-binding proteins can record pre-mRNA are cotransported to the cytoplasm with the mRNP. These processing events in the structure of messenger proteins may preserve a record of the nuclear history of the ribonucleoprotein particles (mRNPs). During initial rounds of pre-mRNA in the cytoplasmic mRNP structure. This infor- translation, the mature mRNP structure is established and is mation can strongly influence the cytoplasmic fate of the monitored by mRNA surveillance systems. Competition for the mRNA and is used by mRNA surveillance systems that act cap structure links translation and subsequent mRNA as a checkpoint of mRNP integrity, particularly in the identi- degradation, which may also involve multiple deadenylases. fication of premature translation termination codons (PTCs). Addresses Cotransport of nuclear mRNA-binding proteins with mRNA Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, from the nucleus to the cytoplasm (nucleocytoplasmic shut- Kings’ Buildings, Edinburgh EH9 3JR, UK tling) was first observed for the heterogeneous nuclear *e-mail: [email protected] ribonucleoprotein (hnRNP) proteins. Some hnRNP proteins †e-mail: [email protected] are stripped from the mRNA at export [1], but hnRNP A1, Current Opinion in Cell Biology 2001, 13:320–325 A2, E, I and K are all exported (see [2]). Although roles for 0955-0674/01/$ — see front matter these hnRNP proteins in transport and translation have been © 2001 Elsevier Science Ltd. All rights reserved. reported [3•,4•], their affects on mRNA stability have been little studied. More is known about hnRNP D/AUF1 and Abbreviations AREs AU-rich sequence elements another nuclear RNA-binding protein, HuR, which act CBC cap-binding complex antagonistically to modulate the stability of a range of DAN deadenylating nuclease mRNAs containing AU-rich sequence elements (AREs) DSEs downstream sequence elements (reviewed in [2]).
    [Show full text]
  • RNA Components of the Spliceosome Regulate Tissue- and Cancer-Specific Alternative Splicing
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research RNA components of the spliceosome regulate tissue- and cancer-specific alternative splicing Heidi Dvinge,1,2,4 Jamie Guenthoer,3 Peggy L. Porter,3 and Robert K. Bradley1,2 1Computational Biology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 3Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA Alternative splicing of pre-mRNAs plays a pivotal role during the establishment and maintenance of human cell types. Characterizing the trans-acting regulatory proteins that control alternative splicing has therefore been the focus of much research. Recent work has established that even core protein components of the spliceosome, which are required for splicing to proceed, can nonetheless contribute to splicing regulation by modulating splice site choice. We here show that the RNA components of the spliceosome likewise influence alternative splicing decisions. Although these small nuclear RNAs (snRNAs), termed U1, U2, U4, U5, and U6 snRNA, are present in equal stoichiometry within the spliceosome, we found that their relative levels vary by an order of magnitude during development, across tissues, and across cancer samples. Physiologically relevant perturbation of individual snRNAs drove widespread gene-specific differences in alternative splic- ing but not transcriptome-wide splicing failure. Genes that were particularly sensitive to variations in snRNA abundance in a breast cancer cell line model were likewise preferentially misspliced within a clinically diverse cohort of invasive breast ductal carcinomas.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • RNA Editing at Baseline and Following Endoplasmic Reticulum Stress
    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress By Allison Leigh Richards A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Human Genetics) in The University of Michigan 2015 Doctoral Committee: Professor Vivian G. Cheung, Chair Assistant Professor Santhi K. Ganesh Professor David Ginsburg Professor Daniel J. Klionsky Dedication To my father, mother, and Matt without whom I would never have made it ii Acknowledgements Thank you first and foremost to my dissertation mentor, Dr. Vivian Cheung. I have learned so much from you over the past several years including presentation skills such as never sighing and never saying “as you can see…” You have taught me how to think outside the box and how to create and explain my story to others. I would not be where I am today without your help and guidance. Thank you to the members of my dissertation committee (Drs. Santhi Ganesh, David Ginsburg and Daniel Klionsky) for all of your advice and support. I would also like to thank the entire Human Genetics Program, and especially JoAnn Sekiguchi and Karen Grahl, for welcoming me to the University of Michigan and making my transition so much easier. Thank you to Michael Boehnke and the Genome Science Training Program for supporting my work. A very special thank you to all of the members of the Cheung lab, past and present. Thank you to Xiaorong Wang for all of your help from the bench to advice on my career. Thank you to Zhengwei Zhu who has helped me immensely throughout my thesis even through my panic.
    [Show full text]
  • Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 10, pp. 4853-4857, October 1978 Biochemistry Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries* (split gene/mRNA splicing/eukaryotic gene structure) R. BREATHNACH, C. BENOIST, K. O'HARE, F. GANNON, AND P. CHAMBON Laboratoire de Genetique Mol6culaire des Eucaryotes du Centre National de la Recherche Scientifique, Unite 44 de l'Institut National de la Sant6 et de la Recherche MWdicale, Institut de Chimie Biologique, Facult6 de Melecine, Strasbourg 67085, France Communicated by A. Frey-Wyssling, July 31, 1978 ABSTRACT Selected regions of cloned EcoRI fragments the 5' end of ov-mRNA and have revealed some interesting of the chicken ovalbumin gene have been sequenced. The po- features in the DNA sequences at exon-intron boundaries. sitions where the sequences coding for ovalbumin mRNA (ov- mRNA) are interrupted in the genome have been determined, and a previously unreported interruption in the DNA sequences MATERIALS AND METHODS coding for the 5' nontranslated region of the messenger has been discovered. Because directly repeated sequences are found at Plasmid pCR1 ov 2.1 containing the ov-ds-cDNA insert was exon-intron boundaries, the nucleotide sequence alone cannot prepared as described (9). EcoRI fragments "b," "c," and "d" define unique excision-ligation points for the processing of a previously cloned in X vectors (3) were transferred to the plas- possible ov-mRNA precursor. However, the sequences in these mid pBR 322. An EcoRI/HindIII of the EcoRI boundary regions share common features; this leads to the fragment proposal that there are, in fact, unique excision-ligation points fragment "a" containing the entirety of exon 7 (Fig.
    [Show full text]
  • Splicing Graphs and RNA-Seq Data
    Splicing graphs and RNA-seq data Herv´ePag`es Daniel Bindreither Marc Carlson Martin Morgan Last modified: January 2019; Compiled: May 19, 2021 Contents 1 Introduction 1 2 Splicing graphs 2 2.1 Definitions and example . .2 2.2 Details about nodes and edges . .2 2.3 Uninformative nodes . .5 3 Computing splicing graphs from annotations 6 3.1 Choosing and loading a gene model . .6 3.2 Generating a SplicingGraphs object . .6 3.3 Basic manipulation of a SplicingGraphs object . .8 3.4 Extracting and plotting graphs from a SplicingGraphs object . 12 4 Splicing graph bubbles 15 4.1 Some definitions . 15 4.2 Computing the bubbles of a splicing graph . 17 4.3 AScodes ............................................... 18 4.4 Tabulating all the AS codes for Human chromosome 14 . 19 5 Counting reads 20 5.1 Assigning reads to the edges of a SplicingGraphs object . 22 5.2 How does read assignment work? . 23 5.3 Counting and summarizing the assigned reads . 25 6 Session Information 26 1 Introduction The SplicingGraphs package allows the user to create and manipulate splicing graphs [1] based on annotations for a given organism. Annotations must describe a gene model, that is, they need to contain the following information: The exact exon/intron structure (i.e., genomic coordinates) for the known transcripts. The grouping of transcripts by gene. Annotations need to be provided as a TxDb or GRangesList object, which is how a gene model is typically represented in Bioconductor. 1 The SplicingGraphs package defines the SplicingGraphs container for storing the splicing graphs together with the gene model that they are based on.
    [Show full text]
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role
    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.
    [Show full text]