Proc. Nat!. Acad. Sci. USA Vol. 87, pp. 3728-3732, May 1990 Genetics Regulation of in the generation of isoforms of the mouse Ly-5 (CD45) glycoprotein (gene expression/trans-acting factors/RNA structure) YUMIKO SAGA*, JANET S. LEEt, CHITRA SARAIYA, AND EDWARD A. BOYSEt Immunology Program, Sloan-Kettering Institute, 1275 York Avenue, New York, NY 10021 Contributed by Edward A. Boyse, December 28, 1989

ABSTRACT Alternative splicing generates various Ly-5 40 (SV40) promoter and dihydrofolate reductase (DHFR) glycoprotein isoforms of the cell surface that typify different cDNA with a polyadenylylation signal (provided by E. Gil- cell lineages and stages of hematopoietic differentiation in the boa, Sloan-Kettering Institute). The DHFR coding sequence mouse; 4-6 are incorporated to generate a B-cell isoform was removed from pFR400 and replaced by sequence coding (B220) and excluded from a T-cell isoform (T200), the other for neomycin resistance derived from the pZip-neo SV(X) coding exons (3 and 7-33) being shared. As a first step to vector (Bgl II-EcoRI fragment) (15). The resulting vector, understanding the mechanisms regulating Ly-5 alternative pFR-NEO, has two unique enzyme sites, Cla I and HindIII, splicing, and thus determining Ly-5 isoforms, a minigene which were used for construction of Ly-5 minigenes. representing exons 3-7 was transfected into Ly-5-expressor T The Ly-5 minigene MG1, containing sequences from exons cells and B cells and into nonexpressor L cells for comparison 3-7 (11 kb), was derived from a subclone of genomic clone 6 of splicing patterns. We conclude that all the information and insertion into the blunt-ended HindIII site of pFR-NEO required for faithful splice-site selection according to cell type (1). This prototype minigene was used to make further is contained within the resulting pre-mRNA. The splicing constructs by progressive deletions in the 3' direction from pattern manifested by nonexpressor L cells may represent a 3 [HindIII site at nucleotide (nt) 1952; numbering default and nonregulated type. We postulate trans-acting fac- begins at the first nucleotide in the 11-kb fragment, starting tor(s) to account for the selection of appropriate exons, and we within intron 2]: MG2, within intron 3 (to HindIII at 4691); provide support for this interpretation from analysis of fused MG3, through intron 4 (BamHI at 7079); MG4, through intron hybrid T-B cells, which exhibited B-cell specific Ly-5 tran- 5 (Sac I at 8563); and MG5, containing only intron 5 (Kpn I scripts. Splicing patterns were well conserved despite substan- at 9376) to intron 7 (Bgl II at 10,935). MG5 was further deleted tial disruption of constructs. However, extensive deletion anal- to produce MG5-S1 through -S5. MG5-S1 contains nt 9552- yses suggested that cis sequences flanking and within 6 9768 (Nco I-Spn I) and 10,149-10,565 (Bal I-Sph I); MG5-S2 affect the exclusion of that exon in T cells. contains nt 9552-10,737 (Nco I-Nco I); MG5-S3 contains nt 9552-10,012 (Nco I-Xba I) and 10,149-10,565 (Bal I-Sph I); The Ly-5 (CD45) gene of the mouse encodes a set of MG5-S4 contains nt 9376 (Kpn I) to -9800 (deleted by transmembrane glycoprotein isoforms expressed only on exonuclease digestion) and 10,149-10,935 (Bal I-Bgl II); and hematopoietic cells (1, 2). The Ly-5 and human CD45 ho- MG5-S5 was derived from MG5 by deletion of exon 6 mologous genes each span -=120 kilobases (kb), comprising sequences only (from Pst I to EcoRI) (see Fig. 6). 34 and 33 exons, respectively (1, 3). In mice, exons la Preparation of Cytoplasmic RNA. Harvested cells (2 X 107) (lacking in humans) and lb are mutually exclusive. Ly-5 were washed with cold phosphate-buffered saline and lysed exons 4, 5, and 6 are termed optional because on the basis of in 500 ,ul of 10 mM Tris, pH 7.5/10 mM NaCl/3 mM alternative splicing they may be omitted altogether, as in the MgCl2/0.5% Nonidet P-40. After centrifugation at 2000 rpm T-cell isoform T200 (Mr 200,000), or all included, as in the in a Sorvall RT-6000 for 5 min at 4°C, the supernatants were B-cell isoform B220 (Mr 220,000), or used singly or in any transferred to 1.5-ml tubes and treated with proteinase K (200 combination of two to generate six more isoforms of inter- ,ug/ml) in 150 mM NaCl/1% SDS and extracted with phenol, mediate molecular weight (4-6). phenol/chloroform, and chloroform. Then, RNAs were pre- The biochemistry of alternative splicing, a well-known cipitated with ethanol, washed, and resuspended in sterile, device for generating multiple isoforms from a single gene, is double-distilled H20. obscure (7, 8). Little is known ofhow splice sites are selected, Polymerase Chain Reaction (PCR; Ref. 16). Oligonucleotide although differential trans-acting factors (9, 10), a role for primers were synthesized using an automated DNA synthe- exon sequences (10-12), and lariat branch points (13) have sizer (DuPont) and purified by Sephadex G-50 column chro- been invoked. To investigate this question in the case of matography. The 3'-end primers (antisense) were Ex-7, GCT- Ly-5, we constructed a minigene containing the three op- TGCAAGGCCCAGAGTGGATGGTGTAAG (nt 47-17 of tional exons, from which we obtained derivatives featuring exon 7); IVS-7a, GTGGTAGAGGTAGGCCTGCATGCCT- various deletions, and studied the splicing modes expressed GAGGG (nt 42-12 of intron 7); IVS-7b, CCTGAGGGTAA- by transfected B cells, T cells, and nonexpressor L cells. Our GATTGTCACCTATGG (nt 20 to -6 of intron 7). The 5'-end data confirm and extend previous findings from studies of primers (sense) were Ex-2, GCACAGCTGATCTCCA- alternative splicing for the human homolog CD45 (10, 14). GATATGACCATGGG (nt 21-51 of exon 2); Ex-3, GGCAAACACCTACACCCAGTGATG (nt 1-24 of exon 3); MATERIALS AND METHODS Vector and Miniigene Construction. The vector pFR-NEO Abbreviations: DHFR, dihydrofolate reductase; PCR, polymerase was constructed from pFR400, which contains a simian virus chain reaction; nt, nucleotide(s). *Current address: Department ofCell Biology, Tsukuba Life Science Center, Riken, Tsukuba, Ibaraki 305, Japan. The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tCurrent address: University of Arizona Health Sciences Center, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Tucson, AZ 85724. 3728 Downloaded by guest on September 23, 2021 Genetics: Saga et al. Proc. Natl. Acad. Sci. USA 87 (1990) 3729 Ex-4, AACTGAGCACAACAGAGAATGCCCTTCTTC (nt Accordingly, we constructed a minigene, MG1, represent- 1-30 of exon 4); Ex-5, GTGTGTTATCCACGCTGCTGCCT- ing only the elements deemed necessary to optional usage of CACCTGT (nt 1-30 of exon 5); Ex-6, GTGTGCCAGGG- exons 4-6 (i.e., comprising exons 3-7, Fig. 1), to produce GAGAGGACTGTACCGGGGA (nt 1-30 of exon 6). uniform primary transcripts. IfMG1 were capable ofdirecting Step 1: Conversion ofRNA to cDNA. Cytoplasmic RNA faithful splicing patterns, we would infer that other genomic (10-20 ug) was mixed with 500 ng of 3'-end primer, heated at elements are not necessary to isoform determination per se. 680C for 3 min, and cooled on ice. The reaction mixture (25 MG1 was transfected into T cells and B cells, which exhibit pl) was adjusted to 10 mM Tris, pH 8.0/50 mM KCl/2.5 mM splicing modes representing primarily isoform T200 (using MgCl2/0.6 mM each dNTP and incubated with 20 units of none of the three optional exons 4-6), and B220 (using all avian myeloblastosis virus reverse transcriptase (Molecular three), respectively. After selection with G418, stable trans- Genetic Resources, Tampa, FL) at 550C for 90 min. RNase A fectants were examined by the PCR. Cytoplasmic RNAs were (2.5 ,ug) and RNase H (2 units) were then added and the hybridized with 3' primer Ex-7 or IVS-7 to prime cDNA mixture was incubated at 370C for 30 min, extracted with synthesis by reverse transcriptase, and single-stranded cDNA phenol/chloroform, and precipitated with an equal volume of provided template for PCR with both 5' and 3' primers. PCR 4 M ammonium acetate and 2.5 volumes of ethanol. The products were examined by agarose gel electrophoresis. En- pellet was resuspended in 30 ,ul of double-distilled H20 and dogenous transcripts were distinguished from transcripts of used for PCR. the exogenous minigene as illustrated in Fig. 2. Primers Ex-2 Step 2: PCR. Samples prepared by step 1 were amplified in and Ex-7 together detect only endogenous transcripts because reaction mixtures (50,l) of 10mM Tris (pH 8.0), 50mM KCl, all minigene constructs lack exon 2. Primers IVS-7 and Ex-3 2.5 mM MgCl2, each (3' and 5' end) primer at 1 ,uM, each together identify minigene transcripts. dNTP at 200,uM, gelatin at 200,g/ml, and 1 unit of Thermus Alternative Splicing Was Reproduced in Both T and B Cells aquaticus (Taq) DNA polymerase. The samples were over- relating to laid with 50 ,1 of mineral oil to prevent condensation and Transfected with Minigene MG1. PCR products subjected to 18-21 cycles of amplification using a pro- endogenous splicing in control (nontransfected) T and B cells grammed thermal cycler (Perkin-Elmer/Cetus). Each cycle (primers Ex-7 and Ex-2) are illustrated in Fig. 3 Left. The consisted of denaturation at 94°C for 1.5 min, annealing at three optional exons (nos. 4-6) are so similar in size that only 55°C for 2.5 min, and polymerization at 72°C for 3 min. After four bands are apparent, representing usage of none (T200), amplification, DNA was extracted with phenol/chloroform any one, any two, and all three (B220) of these exons. T cells and analyzed by electrophoresis in a 3% agarose (2% (leukemias ASLi and EL4) yielded only the first (T200) band. NuSieve and 1% SeaKem agarose; FMC) gel in a Tris/borate However, we occasionally detected single optional exon buffer system (16). transcripts in T cells (Y.S., unpublished data; and see below). . Cell lines used as recipients were two T-cell B-cell tumor lines A20 and 70Z-3 yielded the fourth (B220) leukemia lines (ASL1, EL4) and three B-cell leukemia lines B-cell-typical band, but A20 cells yielded the other bands (A20, 70Z-3, 300-19), all of which express Ly-5, and L cells also. [These data, reproduced with cloned A20 and 70Z-3 (fibroblast line), which do not express Ly-5. DNAs (50,g) cells, accord with other reports of considerable qualitative were mixed with 5 x 106 cells in either minimum essential and quantitative variation in isoform expression among B-cell medium (T cells) or Hanks' balanced salts solution (B cells) lines (ref. 20 and Y.S., unpublished data).] and electroporated at 25°C with a Cell-Porator (BRL) at 750 PCR products relating to splicing of exogenous minigene V/cm, 1600 ,uF for T cells or 500 V/cm, 1980 ,uF for B cells. MG1 in transfected cells (primers IVS-7 and Ex-3) are L cells were transfected by the calcium phosphate method illustrated in Fig. 3 Right, showing faithful reproduction of (17). After transfection, stable transfectants were selected by the T splicing pattern in T cells and of B splicing patterns in incubation in medium containing G418 (1 mg/ml). pertinent B cells. These oligonucleotides were unable to Cell Fusion. EL4 (T cells) and 70Z-3 (B cells) were first prime PCR amplification in untransfected cells, as expected. transfected with different plasmids carrying resistance genes Thus the genomic segment from exon 3 through exon 7 for hygromycin and neomycin, respectively. Cells were har- includes all cis information required for selection of splice vested and washed twice with RPMI 1640 and then mixed in sites according to cell type. equal volumes (2 x 107 cells in 1 ml each) and centrifuged. T-Cell Splicing Pattern Is the Default Type. Fig. 3 Right Pellets were resuspended very slowly (1 min) in 0.2 ml of50% shows PCR products from cytoplasmic RNA of MG1- (vol/vol) PEG 4000, mixed gently by pipeting (1 min), and transfected nonexpressor L cells selected with G418. Only rested at 37°C for 1 min. Then 5 ml of complete medium the band representing T200 (no optional exon) is apparent. (RPMI 1640 with 10% fetal bovine serum and antibiotics) was Evidently the programs of nonexpressor cells permit expres- added very slowly (5 min), and the cells were centrifuged and finally resuspended in complete medium containing both hygromycin (300 ,g/ml) and G418 (1 mg/ml). RESULTS Minigene Construction and Strategy for Analysis of Splicing Regulation. Alternative splicing might be explained in two ways. (i) Different primary transcripts might govern splicing -10kb modes as a function of their structure or of their specific cDNA CLONES interactions with trans-acting factors. In fact, Ly-5 primary pLy-5-T4 transcripts differ at sites of transcriptional initiation and/or termination; e.g., two alternative and mutually exclusive first exons of Ly-5, la and lb, and two polyadenylylation signals mLC. I Fl_ allow four versions of the ; also, multiple initiation sites for transcription in each exon may underlie FIG. 1. Exon-intron organization ofthe 5'-proximal region ofthe further heterogeneity of primary transcripts. (ii) Splicing Ly-5 gene and exon usage of two distinct cDNA clones. pLy-5-T4 modes might be determined by the specificity of trans-acting was derived from a T-cell clone and contains no alternative exon (18). factors and entirely independent of primary transcript vari- In contrast, mLC.1 derived from 70Z-3 B-cell leukemia incorporates ation. all exons 4-6 (19). UT, untranslated. Downloaded by guest on September 23, 2021 3730 Genetics: Saga et al. Proc. Natl. Acad. Sci. USA 87 (1990) Endogenous mRNA /I Fused cells m 11 2131 4 1 5 1 6 1 7 81 9 5iIL _- poly-A - CmCt 4 ----- Ex-7 primer LiO a 0 UNr- Ex-2 primer

622 3 7 527 Exogenous mRNA 404 I._-.i,_. -1 MM 309 3 7 314|56 1 7 H NEO poly-A 242 4 _ IVS-7 primer 160 3 7 v R Ex-3 primer FIG. 2. Strategy to distinguish between RNA from the endoge- nous genes and exogenous transfected minigenes. Different primers were used to distinguish the origins of RNAs. The Ex-2 primer was used to detect endogenous Ly-5 RNA and IVS-7a was used to detect exogenous RNA. NEO, neomycin-resistance gene.

sion ofLy-5 but lack the machinery for incorporating optional FIG. 4. Splicing pattern of B cells is dominant. Hygromycin- and exons. neomycin-resistant EL4 (T-cell) and 70Z-3 (B-cell) lines, respec- Positive Trans-Acting Factor(s) Are Required for Incorpo- tively, were established. Cells were fused by use of PEG and split ration of Optional Exons in B Cells. Given the evidence that into four groups. Stable hybrids were selected from each group in contrasting modes of splicing of uniform MG1 primary tran- medium containing both hygromycin and G418. Cytoplasmic RNA scripts are determined by the several different programs of was prepared from each group (G1-G4) and subjected to PCR. Ly-5 expressor cells, it seemed likely that such cells elabo- rate differential trans-acting factors that regulate the selec- from a point 1 kb downstream from exon 3, retaining exon 3 tion of splice sites in a positive or negative manner. We (common donor exon) and exon 7 (common acceptor exon); therefore examined the splicing mode ofhybrid cells made by MG5, which lacks exon 3, was also tested. Each minigene fusing T cells with B cells. construct was transfected into T cells, B cells, and L (non- EL4 T cells expressing a hygromycin-resistance gene and expressor) cells. 70Z-3 B cells expressing a neomycin-resistance gene were In transfected B cells, MG2, lacking 3.4 kb of intron 3, fused by using PEG. T-B hybrids were selected in medium failed to generate the PCR band representing the B-cell containing both drugs. As Fig. 4 illustrates for PCR products isoform B220 (all three optional exons) (Fig. 5). A segment of cytoplasmic RNA of four such stable hybrid cell lines, the reaching to 110 bp upstream of exon is missing in MG2 and B-cell splicing mode prevailed; i.e., usage of optional exons may have prevented appropriate splicing ofexon 3 to exon 4. was dominant over nonusage. This result implies positive We then determined whether splicing between exons 4 and 5 regulation of isoform phenotypes by differential trans-acting had also been affected, using the Ex-4 primer in place of the factors and accords with the conclusion (above) that the T200 Ex-3 primer for PCR testing. The pertinent PCR band was phenotype of T cells, like that of transfected nonexpressor L absent (data not shown), which implies that exon 4-5 splic- cells, is the default (nonregulated) phenotype. ing, as well as exon 3-4 splicing, had been blocked. This Sequences Flanking and/or Within Optional Exons Are result may signify atypical regulation in this system, because Involved in the Determination of Splicing Modes That Accord exclusion of sequences upstream of a 5' donor site evidently with Cell Lineage. To map cis-acting elements involved in does not affect splicing of downstream exons (21). selection of splicing modes, minigenes MG2 to MG4 were In MG2-transfected L cells, no optional exon was repre- derived, featuring progressive deletion in the 3' direction sented; only the smallest PCR band, representing T200, was

3 4 5 6 7

Endogenous Products -- - MG1 ---U----t-

FIG. 3. Faithful reproduction ofendogenous splicing patterns by transfected T and B cells. (Left) .X" I- r - = Y) 4 Endogenous forms of Ly-5 tran- ea U)Jtj u N c< w < F-

3 4 5 6 7 3 5 6 7 MG2 -1 --t * MG3 | I--I--I-

m 4 _U M M -i- m _) _j N LUI 2

3 7 622 622 3 7 527 527 404 404 309622~~~~-IW 309 Aw. "- 242 242 3 7 3 7 160 160 -Em-_

3 6 7 6 7

MG4 ~--~F < MG5 Q- 5-1

M L- 4, I a, IQ c-U -4 c-U)w-4 _i _ 0c)_- E LL -J < 1< Oj

1353 6 7 622 872 527 603 404 3 6 7 309 -i r-.Je,... 242 310 6 7 3 7 1CIO m

FIG. 5. Analysis of MG1 deletion constructs. PCR products show splicing patterns of RNAs derived from minigene constructs MG2-MG5 transfected into T cells, B cells, and L cells. Primers used were Ex-3 (Ex-6 for MG-5) and IVS-7a.

generated. In transfected ASLi and EL4 T cells, however, depend on competition between exon 3 and exon 6 for both the T200 (default) band and the single optional exon acceptance by exon 7 but depends on an element in and/or products were found. This result is in accord with previous flanking exon 6 that governs its usage by B cells and exclusion findings of single exons in T cells (Y.S., unpublished data). from T cells and nonexpressor cells. MG3 lacks exon 4. Thus the largest PCR band expected is Elements Needed for Exon 6 Exclusion Are Located in Both 426 bp (exons 5-7), which was observed in MG3-transfected Intron 6 and Exon 6. To define cis-acting regulatory elements B cells (A20 and 70Z) but not in T cells or L cells. MG3- further, we constructed derivatives of MG5 (S1 to S5) with transfected T and L cells yielded a PCR band corresponding deletions 5' and/or 3' of exon 6. With MG5-S1 transfection, to usage of a single optional exon, shown to be exon 5 by splicing of exon 6 to exon 7 occurred not only in B cells but generation from primer Ex-5, in accord with the known also in T cells (Fig. 6). Thus the splicing machinery of T cells phenotype of T cells that includes minor representation of an can recognize exon 6 in the context of exon 7 but normally is isoform using exon 5 (Y.S., unpublished data). Expression of restrained from doing so. Perhaps secondary structural con- exon 5 is apparently favored by the exon 4 deletion, possibly formation or association of a masking factor with the se- because an altered secondary structure engendered by the quences 5' and/or 3' of exon 6 missing from MG5-S1 inter- absence of intron or exon segments affected the pattern of feres with this recognition. The splicing pattern in MG5- splicing. S2-transfected cells might indicate that a sequence within Even though MG5 lacks exon 3, which carries the donor intron 6 was important, but comparison with the results from site for all optional exons, and exon 7, similar data were MG5-S3- and MG5-S4-transfected cells indicates that simul- obtained with both MG4 and MG5. Exon 6 of MG-4 was duly taneous deletion of sequences on both sides of exon 6 is incorporated in B cells but spliced out in T and L cells, and probably required to alter splicing control. As Fig. 6 also intron 6 of MG5 was removed from RNA of B cells but shows, restraint of exon 6-7 splicing, the normal condition of retained by RNA of T and L cells (faint bands observed in T cells, depends not only on the presence of sequences ASL1 and L cells). Thus splicing of exon 6 evidently does not flanking exon 6, more narrowly defined by MG5-S3, but also Downloaded by guest on September 23, 2021 3732 Genetics: Saga et al. Proc. Natl. Acad. Sci. USA 87 (1990) splicing between effect splicing between exons 6 and 7 in T cells (Fig. 6, Ex-6 and Ex-7 compare MG5-S1 and -S3 to MG5-S2 and -S4). The influence 6 7 NEO T cell B cell of intron sequences controlling alternative splicing contrasts with the of Tsai et al. who concluded that MG5 a -+ experiments (14), 230 723 394 only sequences within exon 6 were necessary for its exclu- sion in T cells. Together, these observations imply the MG5-S1 ml( Ir + + existence ofa T-cell factor that normally masks these missing 54 20 320 22 sequences or that splicing in T cells is normally inhibited for MG5-S2 - + reasons of secondary structural conformation. Somatic cell 196 hybrids of B and T cells displayed the B220 isoform pheno- of B all three rather MG5-S3 N= + + type cells, representing optional exons, 263 than that of T cells, generally lacking all three. Inhibition by RNA conformation is thus more consistent with the finding MG5-S4 - + that minigene-transfected nonexpressor cells exhibit a (de- 25 fault) T-cell phenotype and with the action of positive trans-

MG5-S5 H-fl U ,I + + acting factors, postulated above, required for the inclusion 723 394 splicing mode of B cells. However, a computer search 40 11 revealed no promising sequences that would generate stable secondary structures from 400 bp upstream to 400 bp down- MG5 -S1 -S2 -S3 -S4 -S;5 stream of exon 6. Alternatively, a ubiquitous masking factor preventing exon 6 recognition could be invoked, the positive BI M M T B T B T B T B T B T B M trans-acting agent then appearing as a releasing factor. It follows that the production of differentially spliced products 622 622 be explained primarily by the regulated concentration 527 might 404 527 of trans-acting factors specific for each exon. 309 _ 30W In conclusion, we have developed a system to identify 242 factors regulating the alternative splicing of optional exons in 160/ the generation of Ly-5 isoforms. Our findings suggest a complex series of events in which RNA structure and trans- acting factors are critical. We thank Dr. R. Krug for advice and for reading the manuscript. FIG. 6. Schematic representation of MG5 deleetion clones and This work was supported by National Institutes of Health Grants splicing patterns observed in T cells and B cells. EL 4wasusedasthe CA39827 (E.A.B.) and GM 40612 (Y.S.). E.A.B. is an American T-cell recipient. As B-cell recipients, A20 was used for MGS, Cancer Society Research Professor. MG5-S1, and MG5-S3 and 300-19 was used for other MG5 con- structs. Primers used were Ex-6 and IVS-7b. The encdogenous pattern 1. Saga, Y., Tung, J.-S., Shen, F.-W., Pancoast, T. C. &i Boyse, of isoform expression of 300-19 is the same as tha t of 70Z-3 cells. E. A. (1988) Mol. Cell. Biol. 8, 4889-4895. Numbers below each construct indicate the number of nucleotides in 2. Tung, J. S., Scheid, M. P., Peirotti, M. A., Hammerling, U. & each intron or exon fragment. Ex, exon; M, marks orsi Boyse, E. A. (1981) Immunogenetics 14, 101-106. 3. Hall, L. R., Streuli, M., Schlossman, S. F. & Saito, H. (1988) on a sequence within exon 6 itself (MG5-'S5). Thus, we J. Immunol. 141, 2781-2787. conclude that cis sequences preventing splicinig in T cellse sarare 4. I.Ralph,S. (1987)S. J.,EMBOThomas,J. 6,M.1251-1257.L., Morton, C. C. & Trowbridge, widely spread over exon 6 and flanking regic ns. 5. Barclay, A. N., Jackson, D. I., Willis, A. C. & Williams, A. F. (1987) EMBO J. 6, 1259-1264. DISCUSSION 6. Saga, Y., Tung, J. S., Shen, F. W. & Boyse, E. A. (1987) Proc. These studies confirm that all genomic informsation necessary Nati. Acad. Sci. USA 84, 5364-5368. for independent inclusion or Breitbart, exclusion of ea(ch of the three 7. Annu. Rev.R.Biochem.E., Andreadis,56, 467-495.A. & Nadal-Ginard, B. (1987) optional Ly-5 exons (nos. 4-6), leading by allternative splic- 8. Leff, S. E., Evans, R. M. & Rosenfeld, M. G. (1987) Cell 48, ing to the generation of eight discrete isoformis, is contained 517-524. within the region including exons 3-7 (whatever theoretical 9. Breitbart, R. E. & Nadal-Ginard, B. (1987) Cell 49, 793-803. subsidiary influences may come from the re st of the Ly-5 10. Streuli, M. & Saito, H. (1989) EMBO J. 8, 787-7%. gene). Because presumably uniform transcripAs were gener- 11. Mardon, H. J., Sebastio, G. & Baralle, F. (1987) Nucleic Acids Res. 15, 7725-7733. ated in transfected cells, differentially progra mined isoform, 12. Hampson, R. K., Follette, L. L. & Rottman, F. M. (1989) Mol. expression can be adequately explained by rejgulatedmmlated controlsontrol Cell. Biol. 9, 1604-1610. of splicing modes rather than by diversity olf primary tran- 13. Smith, C. W. J. & Nadal-Ginard, B. (1989) Cell 56, 749-758. scripts. Related studies on the human CD455 equivalent of 14. Tsai, A. Y. M., Streuli, M. & Saito, H. (1988) Mol. Cell. Biol. Ly-5 (10, 14) are generally consistent with thie present stud- 8, 4550-4555. ies. Disparities between the results with siimilar minigene 15. Cepko, C. L., Roberts, B. E. & Mulligan, R. C. (1984) Cell 37, constructs of human CD45 and the results lpresented here 1.1053-1062.16. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, may be explained by the initial construction of the minigenes. R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science In our experiments, all exons and wet re conserved in 239, 487-497. order, as in the endogenous gene, but in the human construct, 17. Graham, F. L. & van der Eb, A. J. (1973) Virology 52,456-467. mini-LCA21, donor and acceptor exons were replaced with 18. Saga, Y., Tung, J. S., Shen, F. W. & Boyse, E. A. (1986) Proc. other exons, nos. 2 and 8. NatI. Acad. Sci. USA 83, 6940-6944. Data obtained with the series ofminigene de indicate 19. Thomas, M. L., Reynolds, P. J., Chain, A., Ben-Neriah, Y. & ~letions Trowbridge, I. S. (1987) Proc. Natl. Acad. Sci. USA 84, that at least one optional exon, no. 6, can be identified and 5360-5363. incorporated by T cells if a sequence flanking (or(owidnthifdwithin) thathand 20. Chang, H.-L., Zaroukian, M. H. & Esselman, W. J. (1989) J. exon is missing. Our studies demonstrate thatt simultaneous Immunol. 143, 315-321. deletion of both 5' and 3' intron sequences vvas required to 21. Ruskin, B. & Green, M. R. (1985) Cell 43, 131-142. Downloaded by guest on September 23, 2021