DOCSLIB.ORG

Regulation of Alternative Splicing in the Generation of Isoforms

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation of Alternative Splicing in the Generation of Isoforms Proc. Nat!. Acad. Sci. USA Vol. 87, pp. 3728-3732, May 1990 Genetics Regulation of alternative splicing in the generation of isoforms of the mouse Ly-5 (CD45) glycoprotein (gene expression/trans-acting factors/RNA structure) YUMIKO SAGA*, JANET S. LEEt, CHITRA SARAIYA, AND EDWARD A. BOYSEt Immunology Program, Sloan-Kettering Institute, 1275 York Avenue, New York, NY 10021 Contributed by Edward A. Boyse, December 28, 1989 ABSTRACT Alternative splicing generates various Ly-5 40 (SV40) promoter and dihydrofolate reductase (DHFR) glycoprotein isoforms of the cell surface that typify different cDNA with a polyadenylylation signal (provided by E. Gil- cell lineages and stages of hematopoietic differentiation in the boa, Sloan-Kettering Institute). The DHFR coding sequence mouse; exons 4-6 are incorporated to generate a B-cell isoform was removed from pFR400 and replaced by sequence coding (B220) and excluded from a T-cell isoform (T200), the other for neomycin resistance derived from the pZip-neo SV(X) coding exons (3 and 7-33) being shared. As a first step to vector (Bgl II-EcoRI fragment) (15). The resulting vector, understanding the mechanisms regulating Ly-5 alternative pFR-NEO, has two unique enzyme sites, Cla I and HindIII, splicing, and thus determining Ly-5 isoforms, a minigene which were used for construction of Ly-5 minigenes. representing exons 3-7 was transfected into Ly-5-expressor T The Ly-5 minigene MG1, containing sequences from exons cells and B cells and into nonexpressor L cells for comparison 3-7 (11 kb), was derived from a subclone of genomic clone 6 of splicing patterns. We conclude that all the information and insertion into the blunt-ended HindIII site of pFR-NEO required for faithful splice-site selection according to cell type (1). This prototype minigene was used to make further is contained within the resulting pre-mRNA. The splicing constructs by progressive deletions in the 3' direction from pattern manifested by nonexpressor L cells may represent a intron 3 [HindIII site at nucleotide (nt) 1952; numbering default and nonregulated type. We postulate trans-acting fac- begins at the first nucleotide in the 11-kb fragment, starting tor(s) to account for the selection of appropriate exons, and we within intron 2]: MG2, within intron 3 (to HindIII at 4691); provide support for this interpretation from analysis of fused MG3, through intron 4 (BamHI at 7079); MG4, through intron hybrid T-B cells, which exhibited B-cell specific Ly-5 tran- 5 (Sac I at 8563); and MG5, containing only intron 5 (Kpn I scripts. Splicing patterns were well conserved despite substan- at 9376) to intron 7 (Bgl II at 10,935). MG5 was further deleted tial disruption of constructs. However, extensive deletion anal- to produce MG5-S1 through -S5. MG5-S1 contains nt 9552- yses suggested that cis sequences flanking and within exon 6 9768 (Nco I-Spn I) and 10,149-10,565 (Bal I-Sph I); MG5-S2 affect the exclusion of that exon in T cells. contains nt 9552-10,737 (Nco I-Nco I); MG5-S3 contains nt 9552-10,012 (Nco I-Xba I) and 10,149-10,565 (Bal I-Sph I); The Ly-5 (CD45) gene of the mouse encodes a set of MG5-S4 contains nt 9376 (Kpn I) to -9800 (deleted by transmembrane glycoprotein isoforms expressed only on exonuclease digestion) and 10,149-10,935 (Bal I-Bgl II); and hematopoietic cells (1, 2). The Ly-5 and human CD45 ho- MG5-S5 was derived from MG5 by deletion of exon 6 mologous genes each span -=120 kilobases (kb), comprising sequences only (from Pst I to EcoRI) (see Fig. 6). 34 and 33 exons, respectively (1, 3). In mice, exons la Preparation of Cytoplasmic RNA. Harvested cells (2 X 107) (lacking in humans) and lb are mutually exclusive. Ly-5 were washed with cold phosphate-buffered saline and lysed exons 4, 5, and 6 are termed optional because on the basis of in 500 ,ul of 10 mM Tris, pH 7.5/10 mM NaCl/3 mM alternative splicing they may be omitted altogether, as in the MgCl2/0.5% Nonidet P-40. After centrifugation at 2000 rpm T-cell isoform T200 (Mr 200,000), or all included, as in the in a Sorvall RT-6000 for 5 min at 4°C, the supernatants were B-cell isoform B220 (Mr 220,000), or used singly or in any transferred to 1.5-ml tubes and treated with proteinase K (200 combination of two to generate six more isoforms of inter- ,ug/ml) in 150 mM NaCl/1% SDS and extracted with phenol, mediate molecular weight (4-6). phenol/chloroform, and chloroform. Then, RNAs were pre- The biochemistry of alternative splicing, a well-known cipitated with ethanol, washed, and resuspended in sterile, device for generating multiple isoforms from a single gene, is double-distilled H20. obscure (7, 8). Little is known ofhow splice sites are selected, Polymerase Chain Reaction (PCR; Ref. 16). Oligonucleotide although differential trans-acting factors (9, 10), a role for primers were synthesized using an automated DNA synthe- exon sequences (10-12), and lariat branch points (13) have sizer (DuPont) and purified by Sephadex G-50 column chro- been invoked. To investigate this question in the case of matography. The 3'-end primers (antisense) were Ex-7, GCT- Ly-5, we constructed a minigene containing the three op- TGCAAGGCCCAGAGTGGATGGTGTAAG (nt 47-17 of tional exons, from which we obtained derivatives featuring exon 7); IVS-7a, GTGGTAGAGGTAGGCCTGCATGCCT- various deletions, and studied the splicing modes expressed GAGGG (nt 42-12 of intron 7); IVS-7b, CCTGAGGGTAA- by transfected B cells, T cells, and nonexpressor L cells. Our GATTGTCACCTATGG (nt 20 to -6 of intron 7). The 5'-end data confirm and extend previous findings from studies of primers (sense) were Ex-2, GCACAGCTGATCTCCA- alternative splicing for the human homolog CD45 (10, 14). GATATGACCATGGG (nt 21-51 of exon 2); Ex-3, GGCAAACACCTACACCCAGTGATG (nt 1-24 of exon 3); MATERIALS AND METHODS Vector and Miniigene Construction. The vector pFR-NEO Abbreviations: DHFR, dihydrofolate reductase; PCR, polymerase was constructed from pFR400, which contains a simian virus chain reaction; nt, nucleotide(s). *Current address: Department ofCell Biology, Tsukuba Life Science Center, Riken, Tsukuba, Ibaraki 305, Japan. The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tCurrent address: University of Arizona Health Sciences Center, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Tucson, AZ 85724. 3728 Downloaded by guest on September 23, 2021 Genetics: Saga et al. Proc. Natl. Acad. Sci. USA 87 (1990) 3729 Ex-4, AACTGAGCACAACAGAGAATGCCCTTCTTC (nt Accordingly, we constructed a minigene, MG1, represent- 1-30 of exon 4); Ex-5, GTGTGTTATCCACGCTGCTGCCT- ing only the elements deemed necessary to optional usage of CACCTGT (nt 1-30 of exon 5); Ex-6, GTGTGCCAGGG- exons 4-6 (i.e., comprising exons 3-7, Fig. 1), to produce GAGAGGACTGTACCGGGGA (nt 1-30 of exon 6). uniform primary transcripts. IfMG1 were capable ofdirecting Step 1: Conversion ofRNA to cDNA. Cytoplasmic RNA faithful splicing patterns, we would infer that other genomic (10-20 ug) was mixed with 500 ng of 3'-end primer, heated at elements are not necessary to isoform determination per se. 680C for 3 min, and cooled on ice. The reaction mixture (25 MG1 was transfected into T cells and B cells, which exhibit pl) was adjusted to 10 mM Tris, pH 8.0/50 mM KCl/2.5 mM splicing modes representing primarily isoform T200 (using MgCl2/0.6 mM each dNTP and incubated with 20 units of none of the three optional exons 4-6), and B220 (using all avian myeloblastosis virus reverse transcriptase (Molecular three), respectively. After selection with G418, stable trans- Genetic Resources, Tampa, FL) at 550C for 90 min. RNase A fectants were examined by the PCR. Cytoplasmic RNAs were (2.5 ,ug) and RNase H (2 units) were then added and the hybridized with 3' primer Ex-7 or IVS-7 to prime cDNA mixture was incubated at 370C for 30 min, extracted with synthesis by reverse transcriptase, and single-stranded cDNA phenol/chloroform, and precipitated with an equal volume of provided template for PCR with both 5' and 3' primers. PCR 4 M ammonium acetate and 2.5 volumes of ethanol. The products were examined by agarose gel electrophoresis. En- pellet was resuspended in 30 ,ul of double-distilled H20 and dogenous transcripts were distinguished from transcripts of used for PCR. the exogenous minigene as illustrated in Fig. 2. Primers Ex-2 Step 2: PCR. Samples prepared by step 1 were amplified in and Ex-7 together detect only endogenous transcripts because reaction mixtures (50,l) of 10mM Tris (pH 8.0), 50mM KCl, all minigene constructs lack exon 2. Primers IVS-7 and Ex-3 2.5 mM MgCl2, each (3' and 5' end) primer at 1 ,uM, each together identify minigene transcripts. dNTP at 200,uM, gelatin at 200,g/ml, and 1 unit of Thermus Alternative Splicing Was Reproduced in Both T and B Cells aquaticus (Taq) DNA polymerase. The samples were over- relating to laid with 50 ,1 of mineral oil to prevent condensation and Transfected with Minigene MG1. PCR products subjected to 18-21 cycles of amplification using a pro- endogenous splicing in control (nontransfected) T and B cells grammed thermal cycler (Perkin-Elmer/Cetus). Each cycle (primers Ex-7 and Ex-2) are illustrated in Fig. 3 Left. The consisted of denaturation at 94°C for 1.5 min, annealing at three optional exons (nos.
Load more

Recommended publications
  • EYS Mutations and Implementation of Minigene Assay for Variant
    www.nature.com/scientificreports OPEN EYS mutations and implementation of minigene assay for variant classifcation in EYS‑associated retinitis pigmentosa in northern Sweden Ida Maria Westin1, Frida Jonsson1, Lennart Österman1, Monica Holmberg1, Marie Burstedt2 & Irina Golovleva1* Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations. The ortholog of Drosophila eyes shut/spacemaker, EYS on chromosome 6q12 is a major genetic cause of recessive RP worldwide, with prevalence of 5 to 30%. In this study, by using targeted NGS, MLPA and Sanger sequencing we uncovered the EYS gene as one of the most common genetic cause of autosomal recessive RP in northern Sweden accounting for at least 16%. The most frequent pathogenic variant was c.8648_8655del that in some patients was identifed in cis with c.1155T>A, indicating Finnish ancestry. We also showed that two novel EYS variants, c.2992_2992+6delinsTG and c.3877+1G>A caused exon skipping in human embryonic kidney cells, HEK293T and in retinal pigment epithelium cells, ARPE‑19 demonstrating that in vitro minigene assay is a straightforward tool for the analysis of intronic variants. We conclude, that whenever it is possible, functional testing is of great value for classifcation of intronic EYS variants and the following molecular testing of family members, their genetic counselling, and inclusion of RP patients to future treatment studies. Retinitis pigmentosa (RP, MIM 268000) is a clinically and genetically heterogeneous group of inherited retinal degenerations (IRDs) causing primarily deterioration of the rod photoreceptors with subsequent worsening of the cones. It is classifed into two forms: syndromic (afecting other organs) and non-syndromic (not afect- ing other organs).
    [Show full text]
  • Cellular Minigene Models for the Study of Allelic Expression of the Tau Gene and Its Role in Progressive Supranuclear Palsy
    CELLULAR MINIGENE MODELS FOR THE STUDY OF ALLELIC EXPRESSION OF THE TAU GENE AND ITS ROLE IN PROGRESSIVE SUPRANUCLEAR PALSY Victoria Anne Kay Thesis submitted in the fulfilment of the degree of Doctor of Philosophy Reta Lila Weston Institute of Neurological Studies Institute of Neurology University College London March 2013 Declaration I, Victoria Kay, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Progressive supranuclear palsy (PSP) belongs to a group of neurodegenerative disorders that are characterised by hallmark pathology consisting of intra-neuronal aggregates of the microtubule-associated protein, tau. In PSP, these aggregates are almost exclusively composed of one of the two major tau protein isoform groups normally expressed at similar levels in the healthy brain, indicating a role for altered isoform regulation in PSP aetiology. Although no causal mutations have been identified, common variation within the gene encoding tau, MAPT, has been highly associated with PSP risk. The A-allele of the rs242557 single nucleotide polymorphism has been repeatedly shown to significantly increase the risk of developing PSP. Its location within a distal region of the MAPT promoter region is significant, with independent studies – including this one – demonstrating that the rs242557-A allele alters the function of a transcription regulatory domain. As transcription and alternative splicing processes have been shown to be co-regulated in some genes, it was hypothesised that the rs242557-A allele could directly affect MAPT alternative splicing through its differential effect on transcription.
    [Show full text]
  • Splicing Inhibition of U2AF Leads to Alternative Exon Skipping
    Splicing inhibition of U2AF65 leads to alternative exon skipping Sunghee Choa, Heegyum Moona, Tiing Jen Loha, Ha Na Janga, Yongchao Liua, Jianhua Zhoub, Takbum Ohnc, Xuexiu Zhenga, and Haihong Shena,1 aSchool of Life Sciences, Gwangju Institute of Science and Technology, Gwangju 500-712, Korea; bJiangSu Key Laboratory of Neuroregeneration, Nantong University, Nantong 226001, China; and cDepartment of Cellular & Molecular Medicine, College of Medicine, Chosun University, Gwangju 501-759, Korea Edited by Michael R. Green, University of Massachusetts Medical School, Worcester, MA, and approved June 11, 2015 (received for review January 11, 2015) U2 snRNP auxiliary factor 65 kDa (U2AF65) is a general splicing factor mutations in SMN2 pre-mRNA cause predominantly skipping of that contacts polypyrimidine (Py) tract and promotes prespliceo- exon 7, which produces SMNΔ7, a truncated and less stable pro- some assembly. In this report, we show that U2AF65 stimulates al- tein with reduced self-oligomerization activity. Alternative exon 7 ternative exon skipping in spinal muscular atrophy (SMA)-related splicing of SMN pre-mRNA was modulated by orchestrated RNA– survival motor neuron (SMN) pre-mRNA. A stronger 5′ splice-site protein and protein–protein interactions, secondary structures of mutation of alternative exon abolishes the stimulatory effects of RNA, and RNA sequences (25–27). Among the mutations on U2AF65. U2AF65 overexpression promotes its own binding only on SMN2 pre-mRNA, the most functionally understood one is the the weaker, not the stronger, Py tract. We further demonstrate C-to-U point mutation on exon 7, which plays an important role in that U2AF65 inhibits splicing of flanking introns of alternative exon alternative splicing of exon 7 (25–27).
    [Show full text]
  • An Inhibitory Intron to a Stimulatory Intron by Alteration of the Splice Donor Sequence
    Nucleic Acids Research, 1993, Vol. 21, No. 25 5901-5908 Stimulation of gene expression by introns: conversion of an inhibitory intron to a stimulatory intron by alteration of the splice donor sequence Martin Korb+, Yunbo Ke and Lee F.Johnson* Departments of Molecular Genetics and Biochemistry, The Ohio State University, Columbus, OH 43210, USA Received September 16, 1993; Revised and Accepted November 18, 1993 GenBank accession no. L11364 ABSTRACT Efficient expression of many mammalian genes Introns have been shown to be directly responsible for a variety depends on the presence of at least one intron. We of qualitative changes in gene expression. For example, previously showed that addition of almost any of the alternative splicing of introns from primary transcripts can give introns from the mouse thymidylate synthase (TS) gene rise to multiple mRNA (and protein) species from a single gene to an intronless TS minigene led to a large increase In (reviewed in 3). expression. However, addition of intron 4 led to a Introns can also have quantitative effects on gene expression. reduction In minigene expression. The goal of the Some introns contain promoter or enhancer elements and present study was to determine why TS intron 4 was stimulate expression by increasing the rate of gene transcription unable to stimulate expression. Insertion of intron 4 (4-12). Regulating the efficiency of intron splicing also appears into an intron-dependent derivative of the ribosomal to play an important role in the autogenous regulation of yeast protein L32 gene did not lead to a significant increase ribosomal protein genes (13), and in the growth-regulated in expression, suggesting that its inability to stimulate expression of several mammalian genes for S-phase proteins expression was due to sequences within the intron.
    [Show full text]
  • Independence Between Pre-Mrna Splicing and De Novo DNA Methylation in an Isogenic Minigene Resource
    bioRxiv preprint doi: https://doi.org/10.1101/124073; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Independence between pre-mRNA splicing and de novo DNA methylation in an isogenic minigene resource Kyster K. Nanan1, Cody Ocheltree1, David Sturgill1, Mariana D. Mandler1, Maria Prigge1, Garima Varma1,2 and Shalini Oberdoerffer1,* 1 Laboratory of Receptor Biology and Gene Expression, National Cancer Institute, National Institutes of Health, Bethesda, MD, 20892, U.S.A. 2 Current address, Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA, 19107, U.S.A. * To whom correspondence should be addressed. Tel: 001-240-760-6682; Fax: 301-496-4951; Email: [email protected]. ABSTRACT Actively transcribed genes adopt a unique chromatin environment with characteristic patterns of enrichment. Within gene bodies, H3K36me3 and cytosine DNA methylation are elevated at exons of spliced genes and have been implicated in the regulation of pre-mRNA splicing. H3K36me3 is further responsive to splicing, wherein splicing inhibition led to a redistribution and general reduction over gene bodies. In contrast, little is known of the mechanisms supporting elevated DNA methylation at actively spliced genic locations. Recent evidence associating the de novo DNA methyltransferase Dnmt3b with H3K36me3-rich chromatin raises the possibility that genic DNA methylation is influenced by splicing-associated H3K36me3. Here, we report the generation of an isogenic resource to test the direct impact of splicing on chromatin. A panel of minigenes of varying splicing potential were integrated into a single FRT site for inducible expression.
    [Show full text]
  • Splicing Inhibition of U2AF Leads to Alternative Exon Skipping
    Splicing inhibition of U2AF65 leads to alternative exon skipping Sunghee Choa, Heegyum Moona, Tiing Jen Loha, Ha Na Janga, Yongchao Liua, Jianhua Zhoub, Takbum Ohnc, Xuexiu Zhenga, and Haihong Shena,1 aSchool of Life Sciences, Gwangju Institute of Science and Technology, Gwangju 500-712, Korea; bJiangSu Key Laboratory of Neuroregeneration, Nantong University, Nantong 226001, China; and cDepartment of Cellular & Molecular Medicine, College of Medicine, Chosun University, Gwangju 501-759, Korea Edited by Michael R. Green, University of Massachusetts Medical School, Worcester, MA, and approved June 11, 2015 (received for review January 11, 2015) U2 snRNP auxiliary factor 65 kDa (U2AF65) is a general splicing factor mutations in SMN2 pre-mRNA cause predominantly skipping of that contacts polypyrimidine (Py) tract and promotes prespliceo- exon 7, which produces SMNΔ7, a truncated and less stable pro- some assembly. In this report, we show that U2AF65 stimulates al- tein with reduced self-oligomerization activity. Alternative exon 7 ternative exon skipping in spinal muscular atrophy (SMA)-related splicing of SMN pre-mRNA was modulated by orchestrated RNA– survival motor neuron (SMN) pre-mRNA. A stronger 5′ splice-site protein and protein–protein interactions, secondary structures of mutation of alternative exon abolishes the stimulatory effects of RNA, and RNA sequences (25–27). Among the mutations on U2AF65. U2AF65 overexpression promotes its own binding only on SMN2 pre-mRNA, the most functionally understood one is the the weaker, not the stronger, Py tract. We further demonstrate C-to-U point mutation on exon 7, which plays an important role in that U2AF65 inhibits splicing of flanking introns of alternative exon alternative splicing of exon 7 (25–27).
    [Show full text]
  • Use of Minigene Systems to Dissect Alternative Splicing Elements
    Methods 37 (2005) 331–340 www.elsevier.com/locate/ymeth Use of minigene systems to dissect alternative splicing elements Thomas A. Cooper * Departments of Pathology and Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA Accepted 5 July 2005 Abstract Pre-mRNA splicing is an essential step for gene expression in higher eukaryotes. The splicing efficiency of individual exons is deter- mined by multiple features involving gene architecture, a variety of cis-acting elements within the exons and flanking introns, and interactions with components of the basal splicing machinery (called the spliceosome) and auxiliary regulatory factors which transiently co-assemble with the spliceosome. Both alternative and constitutive exons are recognized by multiple weak protein:RNA interactions and different exons differ in the interactions which are determinative for exon usage. Alternative exons are often regulated according to cell-specific patterns and regulation is mediated by specific sets of cis-acting elements and trans-acting factors. Transient expression of minigenes is a commonly used in vivo assay to identify the intrinsic features of a gene that control exon usage, identify specific cis-acting elements that control usage of constitutive and alternative exons, identify cis-acting elements that control cell-specific usage of alternative exons, and once regulatory elements have been identified, to identify the trans-acting factors that bind to these elements and modulate splicing. This chapter describes approaches and strategies for using minigenes to define the cis-acting elements that determine splice site usage and to identify and characterize the trans-acting factors that bind to these elements and regulate alternative splicing.
    [Show full text]
  • Cell-Based Splicing of Minigenes
    Chapter 18 Cell-Based Splicing of Minigenes Sarah A. Smith and Kristen W. Lynch Abstract Cell-based splicing of minigenes is used extensively in the analysis of alternative splicing events. In particular, such assays are critical for identifying or confi rming the in vivo relevance of cis - and trans -acting factors in the regulation of particular splicing patterns. Here we provide detailed information on the methods specifi c to the cell-based analysis of minigene splicing. In addition, we discuss some of the theoretical considerations that must be given to the design of the minigene and subsequent experimental conditions. Key words Minigene , RNA isolation , RT-PCR , Transfection , Stable cell lines , Alternative splicing , Exon , Intron 1 Introduction The use of minigenes has long been a central tool in the character- ization of splicing regulation and mechanisms. As the name implies, a “minigene” is a simplifi ed version of an endogenous pre-mRNA. Most pre-mRNAs are vastly too long for ready manipulation, and mutation of endogenous genes in living cells is both ineffi cient and potential toxic. Therefore, use of a simplifi ed model of a pre- mRNA, or “minigene,” opens the door to lines of investigation not other- wise feasible. Indeed, the vast majority of known sequence elements that control pre-mRNA splicing were identifi ed and/or character- ized through minigene studies (e.g., [ 1 – 3 ]). Minigenes are also widely used to report on splicing patterns in cell-based screens for trans-acting proteins and regulatory pathways (e.g., [ 4 – 6 ]). At the point at which one has identifi ed a splicing event of interest—perhaps a change in the alternative splicing pattern of a particular gene in normal and diseased cells—the next step in understanding how the splicing pattern is regulated is most typi- cally the development and characterization of a minigene.
    [Show full text]
  • Identification of Pathogenic Gene Mutations in LMNA and MYBPC3 That Alter RNA Splicing
    Identification of pathogenic gene mutations in LMNA and MYBPC3 that alter RNA splicing Kaoru Itoa,1, Parth N. Patela, Joshua M. Gorhama, Barbara McDonougha,b, Steven R. DePalmaa,b, Emily E. Adlera, Lien Lama, Calum A. MacRaec, Syed M. Mohiuddind, Diane Fatkine,f,g, Christine E. Seidmana,b,c,2, and J. G. Seidmana,2,3 aDepartment of Genetics, Harvard Medical School, Boston, MA 02115; bHoward Hughes Medical Institute, Harvard Medical School, Boston, MA 02115; cCardiovascular Division, Brigham and Women’s Hospital, Boston, MA 02115; dDepartment of Internal Medicine, Creighton University Medical Center, Omaha, NE 68131; eFaculty of Medicine, University of New South Wales, Kensington, NSW 2052, Australia; fVictor Chang Cardiac Research Institute, Darlinghurst, NSW 2010, Australia; and gCardiology Department, St Vincent’s Hospital, Darlinghurst, NSW 2010, Australia Contributed by J. G. Seidman, June 9, 2017 (sent for review May 16, 2017; reviewed by Gerald Dorn and Jil C. Tardiff) Genetic variants that cause haploinsufficiency account for many cost and time constraints limit their application to clinical gene- autosomal dominant (AD) disorders. Gene-based diagnosis classifies based diagnosis (6, 7). variants that alter canonical splice signals as pathogenic, but due to imperfect understanding of RNA splice signals other variants that Results maycreateoreliminatesplicesites are often clinically classified as LMNA and MYBPC3 Variants That Affect RNA Splicing. LoF variants in variants of unknown significance (VUS). To improve recognition of LMNA and MYBPC3 are prevalent causes of dilated cardiomyop- pathogenic splice-altering variants in AD disorders, we used compu- athy (DCM) with associated conduction defects (8) and hypertro- tational tools to prioritize VUS and developed a cell-based minigene phic cardiomyopathy (HCM) (9, 10), respectively.
    [Show full text]
  • Splicing: Going in Circles
    RESEARCH HIGHLIGHTS Nature Reviews Molecular Cell Biology | Published online 6 Dec 2017; doi:10.1038/nrm.2017.128 SPLICING V. Summersby/Macmillan V. Publishers Limited Going in circles Circular RNAs (circRNAs) are covalently closed RNAs that can specifically control gene expression. CircRNAs are produced at low levels from many failure to protein-coding genes by pre-mRNA ‘back-splicing’ of exons, but the terminate mechanisms that modulate their production are poorly understood. Liang et al. now show that steady-state circRNA levels increase when co-transcriptional transcription mRNA processing is diminished. can result The authors introduced into fruit fly DL1 cells a three-exon minigene derived in circRNA from the laccase2 gene, which is known to produce circRNA. Depletion of production several spliceosome proteins largely eliminated the expression of the minigene linear mRNA. By contrast, expression of the minigene circRNA in these cells was from only slightly decreased or even increased. Importantly, the splicing patterns of downstream the endogenous laccase2 gene and of two other circRNA-producing genes genes were similarly affected. Furthermore, the depletion of 25 other core spliceosome proteins resulted in increase in circRNA expression from various endogenous genes. These data suggested that the relative efficiency of back-splicing compared with canonical splicing increases when the quantity of spliceosome proteins is limited. Next, the authors examined the effect of mRNA 3ʹ-end processing on circRNA production. Depletion of the cleavage and polyadenylation factors Cpsf73 (cleavage and polyadenylation specificity factor 73) and Symplekin greatly increased the expression of the minigene circRNA. Gene expression analyses revealed that depleting these factors reduced transcription termination of an upstream gene, which resulted in readthrough transcription into the minigene and back-splicing.
    [Show full text]
  • Hybrid Minigene Splicing Assay Verifies the Pathogenicity of a Novel
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Xiamen University Institutional Repository Injury 50 (2019) 2215–2219 Contents lists available at ScienceDirect Injury journal homepage: www.elsevier.com/locate/injury Hybrid minigene splicing assay verifies the pathogenicity of a novel splice site variant in the COL1A1 gene of a chinese patient with osteogenesis imperfecta type I Yuxiang Lin 1, Xiaoli Li 1, Xinghua Huang, Dezhu Zheng, Yichu Liu, Fenghua Lan, ∗ Zhihong Wang Research Center for Molecular Diagnosis of Genetic Diseases, Dongfang Hospital, Xiamen University Medical College, Fuzhou, China a r t i c l e i n f o a b s t r a c t Article history: Background: Osteogenesis imperfecta (OI) is a rare genetic bone disease associated with brittle bones and Accepted 14 October 2019 fractures. Among all known types, OI type I is the most common type and characterized by increased bone fragility, low bone mass, distinctly blue-gray sclera, and susceptibility to conductive hearing loss Keywords: beginning in adolescence. Mutations in genes encoding type I collagen ( COL1A1 and COL1A2 ) contribute Bioinformatics to the main pathogenic mechanism of OI. Osteogenesis imperfecta type I Methods: Subtle mutation of the COL1A1 gene in the proband was detected by targeted next-generation Hybrid minigene splicing assay sequencing (NGS) and confirmed by Sanger sequencing. We then assessed the effect of the mutation on Next-generation sequencing the splicing of the COL1A1 gene by bioinformatics prediction and hybrid minigene splicing assay (HMSA). Results: A novel splice site mutation c.1821 + 1 G > C was discovered in the proband by NGS and further confirmed by Sanger sequencing, which was also simultaneously identified from the proband’s mother and elder sister.
    [Show full text]
  • Using Positional Distribution to Identify Splicing Elements and Predict Pre-Mrna Processing Defects in Human Genes
    Using positional distribution to identify splicing elements and predict pre-mRNA processing defects in human genes Kian Huat Lima, Luciana Ferrarisa, Madeleine E. Fillouxa, Benjamin J. Raphaelb,c, and William G. Fairbrothera,c,d,1 aDepartment of Molecular and Cellular Biology and Biochemistry, Brown University, 70 Ship Street, Providence, RI 02903; bDepartment of Computer Science, Brown University, Providence, RI 02912; cCenter for Computational Molecular Biology, 151 Waterman Street, Providence, RI 02912; and dCenter for Genomics and Proteomics, Brown University, 70 Ship Street, Providence, RI 02903 Edited by Phillip A. Sharp, MIT, Cambridge, MA, and approved May 13, 2011 (received for review February 11, 2011) We present an intuitive strategy for predicting the effect of molecular intervention. As physical methods for the detection of sequence variation on splicing. In contrast to transcriptional ele- alternative splicing require large panels of genotyped accessible ments, splicing elements appear to be strongly position dependent. tissue, these studies will probably continue to be limited to sam- We demonstrated that exonic binding of the normally intronic spli- ples harvested from human blood. An alternate approach is the cing factor, U2AF65, inhibits splicing. Reasoning that the positional prediction of causative variations from single-nucleo polymorph- distribution of a splicing element is a signature of its function, we ism (SNPs) that fall within splicing elements. The key to this developed a method for organizing all possible sequence motifs approach is being able to identify what the splicing elements into clusters based on the genomic profile of their positional dis- are and whether a variation is disruptive. tribution around splice sites.
    [Show full text]