Regulation of Glucose Uptake and Enteroendocrine Function by the Intestinal Epithelial

Page 1 of 45 Diabetes

Siegfried Ussar1,2,3*, MaxFelix Haering1,4*, Shiho Fujisaka1, Dominik Lutter3,5, Kevin Y. Lee1,

Ning Li6, Georg K. Gerber6, Lynn Bry6, C. Ronald Kahn1

1Section on Integrative Physiology and Metabolism, Joslin Diabetes Center, Harvard Medical School, Boston, MA,2JRG Adipocytes and Metabolism, Institute for Diabetes and Obesity, Helmholtz Diabetes Center at Helmholtz Center Munich, Neuherberg, Germany, 3German Center for Diabetes Research (DZD), 85764 Neuherberg, Germany 4Division of Clinical Chemistry and Pathobiochemistry, Department of Internal Medicine IV, University Hospital Tübingen, Tübingen, Germany,5Institute for Diabetes and Obesity, Helmholtz Diabetes Center at Helmholtz Center Munich, Neuherberg, Germany 6Center for Clinical and Translational Metagenomics, Department of Pathology, Brigham & Women's Hospital Harvard Medical School, Boston, MA, 02115

Running Title: Insulin Receptor and Intestinal Epithelium

Keywords: Insulin action, SGLT1, GLUT2, glucose uptake, Glucosedependent insulinotropic polypeptide (GIP); intestinal gene expression; gut microbiome

* contributed equally to this work

To whom correspondence should be addressed: C. Ronald Kahn, MD Section on Integrative Physiology and Metabolism Joslin Diabetes Center One Joslin Place Boston, MA 02215 Phone: (617) 3092635 Fax: (617) 3092593 Email: [email protected]

Diabetes Publish Ahead of Print, published online January 17, 2017 Diabetes Page 2 of 45

Abstract Insulin and IGF1 receptors (IR and IGF1R) are major regulators of metabolism and cell growth throughout the body, however, their roles in the intestine remain controversial. Here we show that genetic ablation of the IR or IGF1R in intestinal epithelial cells of mice does not impair intestinal growth or development or the composition of the gut microbiome. However, loss of IR alters intestinal epithelial gene expression, especially in pathways related to glucose uptake and metabolism. More importantly, loss of IR reduces intestinal glucose uptake. As a result, mice lacking the IR in intestinal epithelium retain normal glucose tolerance during aging as compared to controls, which show an agedependent decline in glucose tolerance. Loss of the insulin receptor also results in a reduction of GIP expression from Kcells and decreased GIP release in vivo following glucose ingestion, but has no effect on GLP1 expression or secretion. Thus, the

IR in the intestinal epithelium plays important roles in intestinal gene expression, glucose uptake and GIP production, which may contribute to pathophysiological changes in diabetes, metabolic syndrome and other insulin resistant states.

Page 3 of 45 Diabetes

Introduction

The intestinal mucosa consists of a single layer of rapidly proliferating, specialized

epithelial cell types (1; 2). The uptake of various classes of nutrients and other substances

through enterocytes depends on a multitude of receptors and transporters (3), determining their

preferential site of absorption. Glucose is predominantly absorbed in the proximal small

intestine, whereas lipids are absorbed throughout the small intestine (4; 5). The large intestine,

on the other hand, is the major site of water absorption and the primary site for microbially

mediated hindgut fermentation and production of short chain fatty acids (6).

Uptake of glucose in the small intestine is facilitated via the sodiumglucose linked

transporter 1 (SGLT1), which is constitutively localized to the luminal membrane of the

enterocytes (4; 7; 8). SGLT1dependent glucose uptake is also important in enteroendocrine

cells, where glucose or its metabolites stimulate the expression and secretion of glucose

dependent insulinotropic polypeptide (GIP) and glucagonlike peptide 1 (GLP1) (9; 10). Export

of glucose from the basolateral side of enterocytes into the circulation, on the other hand, is

mediated primarily via GLUT2 (11).

A major function of insulin in peripheral tissues is to stimulate glucose uptake via

translocation of GLUT4 transporters to the plasma membrane (12). However, the role of insulin

action in intestinal glucose absorption is unclear. Studies in diabetic patients and in vitro have

shown conflicting results, with insulin signaling implicated in both increased and decreased

glucose uptake from the intestinal lumen (1317). Several studies in rodents have suggested an

additional role of the insulin receptor and the closelyrelated IGF1 receptor in promoting gut

maturation and development (1923). However, previous studies in mice with an IR knockout in

the intestinal epithelium did not identify any major role of the IR on glucose or lipid metabolism

Diabetes Page 4 of 45

(24) nor were any changes in proliferation or intestinal length detected upon tamoxifen induced deletion of the IGF1R (25). In these studies, however, glucose uptake and effects of aging were not directly assessed, and the IGF1R deletion was done in young adult mice after intestinal development is complete. Thus, the exact roles of early deletion of the IR and IGF1R in these important intestinal functions still remain unclear.

To investigate the roles of the insulin receptor and IGF1 receptor in intestinal epithelial function in greater detail, we therefore established mice with a specific deletion of the IR or the

IGF1R in intestinal epithelial cells using villincre and followed them throughout life and in response to high fat diet challenge. We find that developmental deletion of the IGF1R did not result in any physiological abnormalities or retardation in intestinal growth and development. In contrast, developmental deletion of the insulin receptor results in altered gene expression, reduced glucose absorption and a decrease in GIP expression and glucosedependent release from enteroendocrine Kcells. In this manner, the intestinal insulin receptor plays a specific role in fine tuning glucose homeostasis by regulating glucose uptake and glucose dependent incretin release.

Page 5 of 45 Diabetes

Research Design and Methods Animals and diets

IR and IGF1R fl/fl mice on a C57BL/6 genetic background were bred with villincre

mice to obtain IR fl/fl villincre+ (VILIRKO), IGF1R villin cre+ (VILIGFRKO) and the

respective fl/fl littermate controls. Mice were allowed adlibitum access to water and chow diet

containing 22% calories from fat (9F 5020; PharmaServ) or high fat diet containing 60% calories

from fat (D12492; Open Source Diets). All mice were housed in a facility with a 12hlight/dark

cycle in a temperaturecontrolled room. Animal care and study protocols were approved by the

Animal Care Committee of Joslin Diabetes Center and were in accordance with the National

Institutes of Health guidelines.

Metabolic analysis

Twelve weekold male VILIRKO and controls were individually housed and evaluated

for ambulatory activity using an OPTOM3 sensor system (CLAMS; Columbus Instruments).

Indirect calorimetry was measured on the same mice using an opencircuit Oxymax system

(Columbus Instruments). After a 48h acclimation period, exhaust air was sampled for 60s every

12min in each cage consecutively for 72h with ad libitum access to food to determine O2

consumption and CO2 production.

Intraperitoneal glucose tolerance tests (2g/kg body weight), oral glucose tolerance tests (2g/kg

body weight) and insulin tolerance (1.25unit/kg body weight) tests were performed in

unrestrained conscious male mice after a 16 and 4h fast, for glucose and insulin tolerance tests

respectively. Oral glucose tolerance tests were performed by gavaging glucose directly into the

stomach.

Diabetes Page 6 of 45

Gene Expression

Total RNA was extracted using a RNeasy Mini kit (QIAGEN), and 1µg RNA was used

for reverse transcription (Applied Biosystems). SYBR green based qPCR was performed in a

CFX realtime PCR system (BioRad) using 300nM gene specific primers with an initial

denaturation at 95°C for 10min, followed by 40 PCR cycles, each consisting of 95°C for 15s and

60°C for 1min. mRNA expression was calculated relative to TATA binding protein (TBP).

Primer sequences are presented in Supplemental Table 1.

Microarray processing and data analysis

Total RNA extracted from jejunal epithelial cells from six months old CD fed control and

VILIRKO mice was analyzed using Affymetrix mouse gene2.0 chips. Affymetrix CEL files were preprocessed using Bioconductor's R package affy (26). Expression values were calculated using the RMA algorithm. Gene names and gene symbols for each probeset were derived from the Bioconductor mogene20sttranscriptcluster.db package version 8.4.0. Gene expression was filtered to remove the lowest 10 percent of all absolute expression values. Transcripts with a variance lower than 0.05 were also removed. Nonproteincoding genes were excluded using biomaRt (27). Differential expression was estimated using oneway ANOVA with an alpha of p<0.05 and a minimum of 1.5fold change of expression. KEGG enrichment analysis was done

using a hypergeometric distribution test. Filtering of gene expression and statistics were done

using MATLAB 2016b.

Western Blot

Intestinal epithelial cells were isolated by one hour incubation of the small intestine in

chelating solution as previously described (28). Isolated intestinal epithelial cells were

Page 7 of 45 Diabetes

maintained in DMEM in suspension for 30 minutes in a cell culture incubator prior to

stimulation. Stimulations were stopped with icecold DMEM and immediate centrifugation at

4°C. Proteins were extracted from cells in lysis buffer (25mM TrisHCl pH7.4, 150mM NaCl,

1% NP40, 1mM EDTA, 5% glycerol, 0.1% SDS) containing protease and phosphatase

inhibitors. 30g of protein were subjected to SDSPAGE and transferred to PVDF membranes.

The following antibodies were used: IRbeta subunit, ERK, phosphoERK, AKT, phospho

AKT, IGF1Rbeta subunit, phosphorIR/IGF1R (all from Cell Signaling Technologies, 1:1000),

SGLT1 (Abcam, 1:500).

Immunofluorescence

Immunofluorescence was performed on formalin fixed sections using the following

antibodies: ECadherin (Life Technologies, 1:500), KI67 (Cell Signaling Technologies, 1:200),

SGLT1 (Abcam, 1:50), GLP1 (Phoenix Pharmaceuticals, 1:500), GIP (Phoenix

Pharmaceuticals, 1:500) and detected with Alexa 594 or Alexa 488 conjugated secondary

antibodies (Invitrogen, 1:500).

Glucose uptake assay

For ex vivo glucose uptake jejunal epithelial cells were isolated on ice and incubated for

30 minutes in 37°C in 2.8mM glucose DMEM, penicillin and streptomycin, and then

resuspended in Krebs ringer buffer containing 2mM pyruvate and incubated for 30min in 37°C.

[3H] 2deoxyDglucose (Perkin Elmer) was then added for 10min in 37°C (on ice for control) in

the presence of absence of insulin. Radioactivity was assayed in samples and normalized to

protein concentration. Results are shown as fold change between control and VILIRKO cells.

Diabetes Page 8 of 45

For the in vivo glucose uptake assay, mice were fasted for 16 hours and gavaged with

2g/kg body weight glucose + 2.3µl/g body weight [14C] 3OMethylDglucose, (50

µCi/1.85MBq; Perkin Elmer). A parallel group of mice was gavaged with 1g/kg phloridzin diluted in saline 15 minutes prior to glucose gavage and radioactivity was assayed in blood.

Background counts, assessed in samples without radioactivity were subtracted from each sample.

Microbiome analysis

A multiplexed amplicon library covering the 16S rDNA gene V4 region was generated from mouse stool sample DNA. Bacterial genomic DNA was extracted using MO BIO Power

Fecal DNA Isolation Kit (MO BIO Laboratories) with modification of library preparation following the protocol of Kozich, et al. (29). Aggregated libraries were sequenced with paired end 300bp reads on Illumina MiSeq platform at Molecular Biology Core Facilities at Dana

Farber. Raw sequencing reads were processed using the mothur software package (30) and custom Python scripts, which performs denoising, quality filtering, alignment against the ARB

Silva reference database of 16S rDNA gene sequences, and clustering into Operational

Taxonomic Units (OTUs) at 97% identity. A measure of overall microbial community diversity, the Shannon entropy (31), was calculated for the samples. To statistically test for differences in relative abundances of microbial taxa (phylum/genera) between cohorts, the DESeq2 (32; 33) software package was employed.

Other Assays and Statistics

ELISA assays for insulin and incretin serum levels were done by the Joslin DRC

Specialized Assay Core. Bomb calorimetry of fecal calorie content was performed by the

Central Analytical Laboratory at the University of Arkansas. All differences, except the

Page 9 of 45 Diabetes

Affymetrix chip analysis, for which the statistical analysis is described above, were analyzed by

ANOVA or Student’s ttest and were considered significant if p<0.05.

Diabetes Page 10 of 45

Results

Intestinal epithelial insulin/ IGF signaling is dispensable for intestinal growth and development

To determine the roles of intestinal epithelial insulin and IGF1 receptors in intestinal development, growth and metabolic function we created mice with an intestinal epithelial specific deletion of the insulin or IGF1 receptor using Cre recombinase under the control of the murine villin promoter (hereafter referred to as VILIRKO and VILIGFRKO mice, respectively).

Villincre induces specific recombination in all epithelial cell types of the small and large intestine (34). To assess efficiency of the knockout, IR mRNA was assessed in isolated epithelial cells from the duodenum, jejunum and ileum of control (floxed/floxed litter mates) and

VILIRKO mice (Figure 1A left panel). Consistent with previous studies (3537), IR was expressed at the highest level in the duodenum followed by the jejunum, with 50% lower levels in the ileum. The colon had similar levels to the duodenum. VILIRKO mice had >90% reductions in IR mRNA in all segments of the small intestine and colon (Figure 1A). This virtually complete loss of IR expression was confirmed at the protein level by Western blot analysis (Figure 1B). In control mice, mRNA expression of the IGF1R was highest in the colon

(Supplemental Figure 1A), and both jejunum and colon showed >90% reduction in

VILIGFRKO mice compared to controls (Supplemental Figure 1B).

To investigate the effects of loss of the IR on insulin signaling in the intestine, epithelial cells were isolated from the jejunum of control and VILIRKO mice, stimulated for 10 minutes with insulin or IGF1 (100 nM) and analyzed for activation of the IR/IGF1R and ERK (Figure

1C and D). Consistent with Figure 1B, there was a marked reduction in IR protein in the

VILIRKO epithelial cells. In controls, in vitro stimulation with insulin and led to a robust

Page 11 of 45 Diabetes

increase in phosphorylation of the IR, and this was completely lost in cells obtained from

VILIRKO mice, indicating that preparation did not impair cell viability and cells were still

responsive to insulin/IGF1 (Figure 1C). This was paralleled by decreases in both basal and

stimulated ERK phosphorylation. Stimulation of cells with 100 nM IGF1 also showed a reduced

phosphorylation of ERK, despite somewhat increased phosphorylation of the IGF1R, suggesting

that the loss of IR probably also affected postreceptor signaling.

VILIRKO mice showed comparable weight gain over 18 weeks to controls on a standard

chow diet (CD; 22% of kcal from fat) and had comparable liver, subcutaneous fat and

perigonadal fat pad weights (Supplemental Figure 1C). Control and VILIRKO mice gained

significantly more and equivalent weights on high fat diet (HFD; 60% of kcal from fat) (Figure

1E) and had comparable increases in liver and adipose tissue weight (Supplemental Figure 1C).

There was also no difference in food intake or fecal caloric content between control and

VILIRKO mice (Figure 1F and Supplemental Figure 1D). Similarly, VILIGFRKO mice

showed no difference in body weight or weight gain, and no change in liver weight during the 3

month study period (Supplemental Figures 1F and G).

Histological examination of the jejunum of control and VILIRKO mice revealed normal

intestinal structure with no difference in length of the crypt–villus axis (Figures 1G and H).

Small and large intestinal lengths were also normal in both VILIRKO (Figures 1I and J) and

VILIGFRKO mice (Supplemental Figure 1G). Immunofluorescence staining for Ki67 in

jejunal sections of VILIRKO mice indicated no differences in proliferation (Figure 1K), as

previously described (24). Thus, neither the insulin receptor nor the IGF1 receptor is essential

for normal growth and development of the intestinal epithelium.

Diabetes Page 12 of 45

Loss of intestinal epithelial insulin receptor improves age dependent glucose intolerance and glucose transporter activity

Previous studies using a variety of approaches have shown inconsistent effects of insulin on glucose uptake from the intestine (1317), (24). In VILIRKO mice, oral glucose tolerance tests (OGTT) at 8 weeks were not different from controls (Figure 2A). However, as mice matured, there was a natural decline in glucose tolerance in control mice, whereas VILIRKO mice maintained good glucose tolerance, such that by 12 weeks of age VILIRKO mice exhibited slightly better glucose tolerance than controls (Figure 2A). This effect further increased by 20 weeks of age with VILIRKO mice demonstrating significantly lower glucose levels during an

OGTT resulting in a 20% reduction in the area under the glucose curve (AUC, p =0.02) (Figure

2A). The effect of the improved glucose tolerance was even greater when mice were challenged with a HFD with a 34% reduction in AUC in VILIRKO mice compared to controls (p =0.009)

(Figure 2A). In contrast, OGTT in 19 weekold VILIGFRKO mice showed no difference between groups (Figure 2B), indicating this effect was insulin receptor specific. Likewise, no differences were observed in random fed blood glucose levels or intraperitoneal glucose tolerance tests between 18 weekold VILIRKO and control mice (Supplemental Figures 2A and B), indicating that the improved glucose handling in these mice was due to an effect of insulin receptor action on glucose uptake from the intestine. Serum insulin levels in VILIRKO mice on chow and high fat diet were not significantly different from controls (Supplemental

Figure 2C) nor was there any difference in insulin tolerance between VILIRKO and

VILIGFRKO mice and their respective controls (Supplemental Figures 2D and E). Assessment

of body composition using DEXA scans and other metabolic parameters, like O2 consumption,

CO2 production, respiratory exchange ratio, as well as mean activity, measured in CLAMS

Page 13 of 45 Diabetes

metabolic cages, also did not reveal significant difference in metabolic rates, bone mineral

density, lean and fat mass between VILIRKO and control mice (Supplemental Figure 3).

The primary transporters involved in glucose uptake from the intestinal lumen into the

epithelial cell are SGLT1 and, upon high luminal glucose concentrations, GLUT2 (38; 39). To

assess transporter activity in vivo, we performed an oral glucose uptake assay in 8 weekold mice

using the nonmetabolizable glucose analogue [14C] 3OmethylDglucose (3OMG). 3OMG

was used instead of [3H] 2deoxyDglucose, since 3OMG cannot be phosphorylated and

retained within cells, allowing quantification of tracer uptake into blood. To assess the amount

of SGLT1mediated glucose uptake, separate cohorts of control and VILIRKO mice were

gavaged with the SGLT1/SGLT2 inhibitor phloridzin (phloridzin dehydrate; 1g/kg body weight)

prior to the oral glucose administration. At this young age, there were no differences in blood

glucose levels between the VILIRKO and control mice during the OGTT (Figure 2C, solid line

with filled circles and dashed line with solid squares). In control mice, blood levels of 3OMG

peaked at 30 minutes, and this was reduced by ~80% in the phloridzinpretreated mice (Figure

2D, solid line with filled squares and dashed line with empty squares), consistent with SGLT1

being the major intestinal glucose transporter. In the VILIRKO mice, there was a ~50% decrease

in total 3OMG uptake, with a proportional decrease following phloridzin pretreatment (Figure

2D, solid line with open symbol and dashed line with open symbol). Following phloridzin

pretreatment no statistically significant differences between control and VILIRKO mice could be

observed. Together these data indicate that SGLT1 is most likely the primary transporter

responsible for the change in glucose uptake from the intestine of VILIRKO mice, however,

with a possibility of degradation of phloridzin to phloretin, we cannot exclude a role of GLUT2

in the observed phenotype.

Diabetes Page 14 of 45

Insulin receptor regulates glucose transporter activity but not expression

Glucose uptake into isolated jejunal epithelial cells in vitro was assessed using [3H] 2 deoxyDglucose (2DOG), which after transport into cells is phosphorylated and retained.

Compared to controls, 2DOG uptake was >40% decreased in VILIRKO mice. Treatment of these cells with 100 nM insulin for 10 minutes did not increase glucose uptake in either control or VILIRKO cells (Figure 3A). Taken together these results indicate that the intestinal epithelial cell is insulin responsive in terms of signaling and that the IR plays a role in SGLT1/GLUT2 mediated glucose uptake. Gene expression analysis of isolated cells from the duodenum, jejunum and ileum showed that SGLT1 and GLUT2 mRNAs were highest in duodenum and jejunum, but with no significant differences in expression of either transporter between

VILIRKO and control mice (Figure 3B). Likewise, there was no significant difference in

SGLT1 expression at the protein level (Figure 3C), and no differences in localization of SGLT1 by immunofluorescence staining on jejunal sections (Figure 3D).

To identify additional genes dysregulated in VIRLIKO mice that might play a role in the altered glucose uptake we measured gene expression profiles using microarrays. We found 132 significantly regulated protein coding genes (Supplemental Figure 4A and B; ANOVA p <

0.05 and fold change > 1.5). Unsupervised KEGG pathway enrichment analysis revealed 26 significantly enriched pathways (Figure 3E and Supplemental Table 2). Seven of these pathways were consistently upregulated whereas 9 pathways were consistently downregulated.

The remaining 10 pathways showed significant gene regulation in both directions. To determine differences potentially associated with reduced glucose transport, we used the STRING database to identify genes/proteins directly interacting with SGLT1 (Supplemental Table 3;

Page 15 of 45 Diabetes

Supplemental Figure 4C). We found 10 genes predicted or validated to interact with SGLT1 of

which 5 could be detected in the microarray dataset. KEGG enrichment of these 11 proteins (10

interactors and SGLT1) revealed “carbohydrate digestion and absorption” as the most relevant

pathway. Subsequently we identified all genes mapping to “carbohydrate digestion and

metabolism” and inspected their differential expression (Supplemental Figure 4D). None of the

14 detected pathway members were statistically significantly regulated. However, among the

nine upregulated genes, hexokinase 2 (Hk2) was upregulated, whereas the predominant isoform

of glucose6phosphatase (G6pc) was downregulated, suggesting a diversion of glucose

utilization into the intestinal epithelium of VILIRKO mice, which could contribute to the

decreased release of glucose into the circulation. Exactly how altered glucose metabolism and/or

reduced glucose transport in intestine of VILIRKO mice are related to the reduction in glucose

transporter activity will require further investigation.

The loss of insulin action and the decrease of glucose uptake in the VILIRKO mice could

alter the intestinal milieu resulting in changes of the composition of the gut microbial

community, and this, in turn, could further indirectly impact on host metabolism. We therefore

performed an analysis of the gut microbiome community composition by sequencing of the V4

region of the 16S rRNA gene in fecal samples of VILIRKO and control mice. This did not reveal

significant differences in phylogenetic diversity (Shannon Entropy) nor any significant changes

in the relative abundances of individual phyla (Supplemental Figures 5A and B). There were

also no significant differences between individual taxa.

Intestinal epithelial insulin receptor regulates GIP expression and secretion

Diabetes Page 16 of 45

Incretins, like GIP and GLP1, are important modulators of insulin secretion from the pancreatic βcell. Incretins are released upon stimulation by glucose and other nutrients in the intestinal lumen. qPCR analysis showed that GIP mRNA was decreased by >40% in the duodenum (p =0.04) and jejunum (p =0.007) of the VILIRKO mouse, while proglucagon mRNA

(GCG), the precursor for GLP1, tended to be increased. mRNAs for peptide YY (PYY) and the enteroendocrine marker chromograninA were unchanged in the VILIRKO mice (Figure 4A).

None of these genes, including the insulin receptor and GIP, were changed in expression in

VILIGFRKO mice (Supplemental Figure 6), so this effect was insulin receptor specific. The decreased expression of GIP correlated with a 16% (p<0.05) decrease in GIP immunoreactive K cells in VILIRKO mice compared to control (Figure 4B); this occurred with no difference in expression of chromograninA (CHGA; Figure 4A). There was also no change in the number of

Lcells (GLP1 positive) (Figure 4C). Consistent with the decreases in GIP positive cells and

GIP mRNA, VILIRKO mice had a ~30% decrease in peak serum GIP levels following acute oral glucose challenge compared to controls (Figure 4D). Serum levels of other incretins, like GLP1 and PYY, showed no difference between VILIRKO and control mice (Figure 4D).

Page 17 of 45 Diabetes

Discussion Insulin and IGF1 signaling play pivotal roles in metabolic homeostasis, embryonic

development and growth. Since both IR and IGF1R have broad expression patterns, the specific

functions of the insulin and IGF1 receptors have been studied in a multitude of cell types and

organs. However, the role of these receptors in one of the largest organs of the body, the

intestine, has received relatively little attention.

Here we have investigated the role of the insulin and IGF1 receptors on development

and function of the intestine by generating mice with an intestinal epithelial deletion of the

insulin receptor (VILIRKO) and the IGF1 receptor (VILIGFRKO). Expression analyses of both

receptors reveal highest expression of the insulin receptor in the epithelium of the proximal small

intestine with lower levels in the ileum, while levels in the colon were comparable to those in the

duodenum. Conversely, IGF1R expression is highest expressed in the colon with lower

expression in the proximal small intestine, suggesting nonredundant functions of these receptors

in the intestine.

In contrast to what would have been anticipated from some previous studies (25; 40; 41),

but in line with data on the intestinal insulin receptor by Andres and colleagues (24), loss of

neither the insulin receptor nor IGF1 receptor impairs gut development or growth. However, as

we did not study insulin receptor/ IGF1R double knockout mice we cannot exclude potential

compensation during development or in very specific cellular functions. This lack of effect on

growth suggests that concerns about oral insulin analogues having potential mitogenic and

tumorigenic properties in the intestine are an unlikely safety concerns and that supplementation

of infant formula with either IGF1 or insulin to improve gut maturation as previously suggested

(42) is also unlikely to provide major benefits.

Diabetes Page 18 of 45

Loss of the intestinal epithelial insulin receptor, however, does have some important, but unexpected, effects on glucose uptake from the intestinal lumen and release of the incretin GIP.

Previous studies have provided conflicting results on the role of insulin action on glucose absorption. Some have reported insulin inhibition of glucose transport (43), whereas others have reported increased glucose entry into the enterocytes via a mechanism involving an increase in the numbers of glucose transporters (17). Unlike muscle and adipose tissue, where insulin stimulated glucose uptake occurs through insulin induced translocation of Glut4 from intracellular vesicles to the plasma membrane, intestinal glucose absorption is mediated primarily by SGLT1, which is constitutively localized to the apical brush border membrane.

GLUT2, the other glucose transporter expressed in intestinal epithelial cells, primarily mediates release of glucose into the circulation and has an additional role in glucose uptake at high luminal glucose concentrations (8; 9). However, recent data using conditional deletion of

GLUT2 in the intestinal epithelium revealed effects of GLUT 2 in reducing glucose uptake into the blood stream and reducing body weight gain with only minor alterations in glucose tolerance

(44). GIP levels were not assessed in this study, but the authors did find altered GLP1 positive

Lcell number without alterations in GLP1 circulating levels.

In VILIRKO mice, there is no change in the expression of GLUT 2 or expression and localization of SGLT1 associated with the loss of insulin signaling, but there is a decrease glucose transporter activity as measured in vivo and in vitro. Since attempts to assess alterations in GLUT2 protein either by western blotting or immunofluorescent staining were inconclusive, the individual contribution of SGLT1 and GLUT2 to the observed phenotype remain to be determined, however studies with the SGLT1 inhibitor phloridzin suggests that SGLT1 accounts for the majority of glucose uptake abnormality observed in the gut of VIKIRKO mice.

Page 19 of 45 Diabetes

Interestingly, the effect of insulin receptor deletion to reduce glucose absorption can be detected

as early as 8 weeks of age, even though at that age no difference in oral glucose tolerance tests is

observed. However, as a consequence of reduced reduced intestinal glucose uptake, VILIRKO

mice are protected from age and HFDinduced glucose intolerance with no change in whole

body insulin sensitivity. Since Villin1cre is also expressed in the epithelium of the proximal

renal tubule, deleting the insulin receptor in these cells could impact on glucose reabsorption.

However, we did not detect any histological abnormalities in the kidneys nor did Andres and

colleagues in their study (24). Despite the reduced glucose absorption, we do not observe

increased fecal caloric content in VILIRKO mice nor any significant change in the community of

gut microbiota.

We did, however, find that VILIRKO mice showed a selective reduction in GIP

expression by both qPCR and Affymetrix analysis, and a reduced number of GIP positive cells.

A similar reduction of GIP in intestinal epithelial insulin receptor knockouts was also observed

in a previous study, albeit the observed GIP reduction in that study did not reach statistical

significance (24). The reduced number of GIPpositive cells appears to be due to a reduction in

the number of Kcells and/or a reduction in GIP expression in the Kcells. The fact that

chromogranin A (CHGA) expression was unaltered in all small intestinal segments suggests no

change in total enteroendocrine cell number, but a 20% reduction of GIPpositive cells. Garcia

Martinez et al. have shown that insulin can stimulate the expression of GIP in a glucose

dependent manner via regulation of FoxO1 and LEF1/βCatenin (45). The reduced expression of

GIP, combined with the dependency of GIP secretion on SGLT1 activity (9; 46), leads to

diminished secretion of GIP during acute glucose challenge. Previous studies have shown that K

cell activation in response to an oral glucose challenge is strongly reduced in type 2 diabetic rats

Diabetes Page 20 of 45

(47). However, in this study, Kcells that were still responding to luminal glucose showed normal expression of GIP, whereas GLP1 expression was reduced in Lcells from diabetic versus prediabetic rats, resulting in overall reduced GIP and even more pronounced GLP1 expression. These data suggest that the insulin receptor knockout in the intestinal epithelium resembles the Kcell phenotype observed in diabetic rats. However, elements of the diabetic phenotype, independent of the insulin receptor in intestinal epithelial cells, seem to regulate

GLP1 expression in Lcells.

Aside from its pharmacological role as an incretin, GIP also has effects on calcium homeostasis and bone remodeling, as well as lipid metabolism through activation of lipoprotein lipase in adipocytes (46; 48; 49). The latter results in some protection of GIPdeficient mice from

HFD induced obesity (50). Consistent with this, the VILIRKO mice with reduced GIP release showed a slight, but not statistically significant, reduction of abdominal and visceral fat. They, however, had no change in bone mineral density as assessed using DEXA scans. Thus, the reduced GIP levels may play a role in insulin release, but appears to be sufficient to mediate these other functions of this GI hormone.

In summary, loss of the insulin and IGF1 receptor in the intestinal epithelium has no influence on the development and proliferation of the intestinal epithelium, but loss of the insulin receptor does reduce intestinal glucose uptake through a decrease glucose transporter activity, and this leads to beneficial metabolic effects such as improved oral glucose tolerance with aging.

Insulin action in the gut also controls Kcell number, and loss of the insulin receptor results in decreased numbers of Kcells and decreased levels of GIP. Thus, manipulating insulin receptor activity in the intestine could potentially provide longterm beneficial metabolic effects in aging and diabetes.

Page 21 of 45 Diabetes

Acknowledgements

Author contributions: S.U. and M.F.H. wrote the manuscript and researched data. S.F.

and K.Y.L. researched data and reviewed and edited the manuscript. N.L., G.K.G. and L.B.

conducted the microbiome analyses. C.R.K. helped design experiments and edited the

manuscript.

The authors wish to thank the Joslin DRC Bioinformatics Core (NIH P30DK036836) for

help with data analysis and the Brigham and Women’s Hospital/Harvard Digestive Diseases

Center for Clinical and Translational Metagenomics for help with microbiome analyses (NIH

P30DK034854). This work was supported by grants from the NIH: DK31036 to CRK; and

DK36836 to the Joslin DRC. The authors also thank the Mary K. Iacocca Professorship (CRK)

for their support. S.U. is supported by iMed, the Helmholtz Initiative on Personalized Medicine.

S.F. was supported by the Sunstar Foundation postdoctoral fellowship.

C.R.K. is the guarantor of this work and, as such, had full access to all the data in the

study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Data deposition

16S rRNA datasets have been deposited in the European Nucleotide Archive.

Diabetes Page 22 of 45

References

1. Louvard D, Kedinger M, Hauri HP: The differentiating intestinal epithelial cell: establishment and maintenance of functions through interactions between cellular structures. Annu Rev Cell Biol 1992;8:157195 2. Perdue MH, McKay DM: Integrative immunophysiology in the intestinal mucosa. Am J Physiol 1994;267:G151165 3. Depoortere I: Taste receptors of the gut: emerging roles in health and disease. Gut 2014;63:179190 4. Raja M, Puntheeranurak T, Hinterdorfer P, Kinne R: SLC5 and SLC2 transporters in epithelia cellular role and molecular mechanisms. Curr Top Membr 2012;70:2976 5. Iqbal J, Hussain MM: Intestinal lipid absorption. Am J Physiol Endocrinol Metab 2009;296:E11831194 6. Macfarlane GT, Macfarlane S: Human colonic microbiota: ecology, physiology and metabolic potential of intestinal bacteria. Scand J Gastroenterol Suppl 1997;222:39 7. Takata K, Kasahara T, Kasahara M, Ezaki O, Hirano H: Immunohistochemical localization of Na(+)dependent glucose transporter in rat jejunum. Cell Tissue Res 1992;267:39 8. Gorboulev V, Schurmann A, Vallon V, Kipp H, Jaschke A, Klessen D, Friedrich A, Scherneck S, Rieg T, Cunard R, VeyhlWichmann M, Srinivasan A, Balen D, Breljak D, Rexhepaj R, Parker HE, Gribble FM, Reimann F, Lang F, Wiese S, Sabolic I, Sendtner M, Koepsell H: Na(+)Dglucose cotransporter SGLT1 is pivotal for intestinal glucose absorption and glucose dependent incretin secretion. Diabetes 2012;61:187196 9. Roder PV, Geillinger KE, Zietek TS, Thorens B, Koepsell H, Daniel H: The role of SGLT1 and GLUT2 in intestinal glucose transport and sensing. PLOS One 2014;9:e89977 10. Drucker DJ: The biology of incretin hormones. Cell Metab 2006;3:153165 11. Hediger MA, Rhoads DB: Molecular physiology of sodiumglucose cotransporters. Physiol Rev 1994;74:9931026 12. Boucher J, Kleinridders A, Kahn CR: Insulin receptor signaling in normal and insulin resistant states. Cold Spring Harb Perspect Biol 2014;6 13. Manome S, Kuriaki K: Effect of insulin, phlorizin and some metabolic inhibitors on the glucose absorption from the intestine. Arch Int Pharmacodyn Ther 1961;130:187194 14. Aulsebrook KA: Intestinal transport of glucose and sodium: changes in alloxan diabetes and effects of insulin. Experientia 1965;21:346347 15. Gottesburen H, Schmitt E, Menge H, Bloch R, LorenzMeyer H, Riecken EO: [The effect of insulin on the intestinal absorption in man. I. Absorption of glucose, water and electrolytes in diabetics and healthy controls]. Res Exp Med (Berl) 1973;160:326330 16. Costrini NV, Ganeshappa KP, Wu W, Whalen GE, Soergel KH: Effect of insulin, glucose, and controlled diabetes mellitus on human jejunal function. Am J Physiol 1977;233:E181187

Page 23 of 45 Diabetes

17. Serhan MF, Kreydiyyeh SI: Insulin downregulates the Na+/K+ ATPase in enterocytes but increases intestinal glucose absorption. Gen Comp Endocrinol 2010;167:228233 18. Loirdighi N, Menard D, Levy E: Insulin decreases chylomicron production in human fetal small intestine. Biochim Biophys Acta 1992;1175:100106 19. Arsenault P, Menard D: Insulin influences the maturation and proliferation of suckling mouse intestinal mucosa in serumfree organ culture. Biol Neonate 1984;46:229236 20. Howarth GS: Insulinlike growth factorI and the gastrointestinal system: therapeutic indications and safety implications. J Nutr 2003;133:21092112 21. Dupont J, Holzenberger M: Biology of insulinlike growth factors in development. Birth Defects Res C Embryo Today 2003;69:257271 22. Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A: Mice carrying null mutations of the genes encoding insulinlike growth factor I (Igf1) and type 1 IGF receptor (Igf1r). Cell 1993;75:5972 23. Rubin R, Baserga R: Insulinlike growth factorI receptor. Its role in cell proliferation, apoptosis, and tumorigenicity. Lab Invest 1995;73:311331 24. Andres SF, Santoro MA, Mah AT, Keku JA, Bortvedt AE, Blue RE, Lund PK: Deletion of intestinal epithelial insulin receptor attenuates highfat dietinduced elevations in cholesterol and stem, enteroendocrine, and Paneth cell mRNAs. Am J Physiol Gastrointest Liver Physiol 2015;308:G100111 25. Rowland KJ, Trivedi S, Lee D, Wan K, Kulkarni RN, Holzenberger M, Brubaker PL: Loss of glucagonlike peptide2induced proliferation following intestinal epithelial insulinlike growth factor1receptor deletion. Gastroenterology 2011;141:21662175 e2167 26. Gautier L, Cope L, Bolstad BM, Irizarry RA: affyanalysis of Affymetrix GeneChip data at the probe level. Bioinformatics 2004;20:307315 27. Durinck S, Spellman PT, Birney E, Huber W: Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat Protoc 2009;4:11841191 28. O'Shea CBJA: Culture of Epithelial Cells, Chapter 10. Isolation and Culture of Intestinal Epithelial Cells. 2002 29. Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD: Development of a dual index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology 2013;79:5112 5120 30. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF: Introducing mothur: opensource, platformindependent, communitysupported software for describing and comparing microbial communities. Applied and environmental microbiology 2009;75:75377541 31. Weaver W, Shannon C: The Mathematical Theory of Communication. 1963; 32. McMurdie P, Holmes S: phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PloS one 2013;8:e61217

Diabetes Page 24 of 45

33. McMurdie P, Holmes S: Waste not, want not: why rarefying microbiome data is inadmissible. PLoS Comput Biol 2014;10:e1003531 34. el Marjou F, Janssen KP, Chang BH, Li M, Hindie V, Chan L, Louvard D, Chambon P, Metzger D, Robine S: Tissuespecific and inducible Cremediated recombination in the gut epithelium. Genesis 2004;39:186193 35. Freier S, Eran M, Reinus C, Ariel I, Faber J, Wilschanski M, Braverman D: Relative expression and localization of the insulinlike growth factor system components in the fetal, child and adult intestine. J Pediatr Gastroenterol Nutr 2005;40:202209 36. GalloPayet N, Hugon JS: Insulin receptors in isolated adult mouse intestinal cells: studies in vivo and in organ culture. Endocrinology 1984;114:18851892 37. Watanabe M, Hayasaki H, Tamayama T, Shimada M: Histologic distribution of insulin and glucagon receptors. Braz J Med Biol Res 1998;31:243256 38. Wright EM, Turk E, Hager K, LescaleMatys L, Hirayama B, Supplisson S, Loo DD: The Na+/glucose cotransporter (SGLT1). Acta Physiol Scand Suppl 1992;607:201207 39. ShiraziBeechey SP, Moran AW, Batchelor DJ, Daly K, AlRammahi M: Glucose sensing and signalling; regulation of intestinal glucose transport. Proc Nutr Soc 2011;70:185193 40. Qiu W, Leibowitz B, Zhang L, Yu J: Growth factors protect intestinal stem cells from radiationinduced apoptosis by suppressing PUMA through the PI3K/AKT/p53 axis. Oncogene 2010;29:16221632 41. Suman S, Kallakury BV, Fornace AJ, Jr., Datta K: Protracted Upregulation of Leptin and IGF1 is Associated with Activation of PI3K/Akt and JAK2 Pathway in Mouse Intestine after Ionizing Radiation Exposure. Int J Biol Sci 2015;11:274283 42. Shamir R, Shehadeh N: Insulin in human milk and the use of hormones in infant formulas. Nestle Nutr Inst Workshop Ser 2013;77:5764 43. Pennington AM, Corpe CP, Kellett GL: Rapid regulation of rat jejunal glucose transport by insulin in a luminally and vascularly perfused preparation. J Physiol 1994;478 ( Pt 2):187193 44. Schmitt CC, Aranias T, Viel T, Chateau D, Le Gall M, WaligoraDupriet AJ, Melchior C, Rouxel O, Kapel N, Gourcerol G, Tavitian B, Lehuen A, BrotLaroche E, Leturque A, Serradas P, Grosfeld A: Intestinal invalidation of the glucose transporter GLUT2 delays tissue distribution of glucose and reveals an unexpected role in gut homeostasis. Molecular Metabolism in press; 45. GarciaMartinez JM, ChocarroCalvo A, De la Vieja A, GarciaJimenez C: Insulin drives glucosedependent insulinotropic peptide expression via glucosedependent regulation of FoxO1 and LEF1/betacatenin. Biochim Biophys Acta 2014;1839:11411150 46. Yabe D, Seino Y: Incretin actions beyond the pancreas: lessons from knockout mice. Curr Opin Pharmacol 2013;13:946953 47. Lee J, Cummings BP, Martin E, Sharp JW, Graham JL, Stanhope KL, Havel PJ, Raybould HE: Glucose sensing by gut endocrine cells and activation of the vagal afferent pathway is impaired in a rodent model of type 2 diabetes mellitus. Am J Physiol Regul Integr Comp Physiol 2012;302:R657666

Page 25 of 45 Diabetes

48. Tsukiyama K, Yamada Y, Yamada C, Harada N, Kawasaki Y, Ogura M, Bessho K, Li M, Amizuka N, Sato M, Udagawa N, Takahashi N, Tanaka K, Oiso Y, Seino Y: Gastric inhibitory polypeptide as an endogenous factor promoting new bone formation after food ingestion. Mol Endocrinol 2006;20:16441651 49. Furusawa Y, Obata Y, Hase K: Commensal microbiota regulates T cell fate decision in the gut. Semin Immunopathol 2015;37:1725 50. Miyawaki K, Yamada Y, Ban N, Ihara Y, Tsukiyama K, Zhou H, Fujimoto S, Oku A, Tsuda K, Toyokuni S, Hiai H, Mizunoya W, Fushiki T, Holst JJ, Makino M, Tashita A, Kobara Y, Tsubamoto Y, Jinnouchi T, Jomori T, Seino Y: Inhibition of gastric inhibitory polypeptide signaling prevents obesity. Nat Med 2002;8:738742

Diabetes Page 26 of 45

Figure Legends

Figure 1: Intestinal epithelial insulin signaling is dispensable for normal growth and intestinal development

(A) Expression levels of insulin receptor in the intestine of VILIRKO and control mice. IR mRNA was measured by quantitative realtime PCR (qPCR) of RNA from isolated epithelial cells of the duodenum, jejunum, ileum and colon of 18 weekold male VILIRKO and control

(fl/fl) mice on chow diet. In all panels, data are shown as mean ±SEM (n=57). *** p<0.0001

(TwoWay ANOVA, Tukey’s posthoc test). (B) Western blot for IR βsubunit from isolated intestinal epithelial cells from duodenum, jejunum and ileum of 18 weekold male VILIRKO and control (fl/fl) mice on chow diet. ERK protein levels were used as loading control. (C) Western blot analysis of IR βsubunit, IGF1R, pIRIGF1R, ERK and pERK from isolated jejunal epithelial cells of 12 weekold male VILIRKO and fl/fl mice on chow diet. Cells were either untreated, stimulated with 100 nM insulin or 100 nM IGF1 for 10 minutes. (D) Quantification

of pERK/ERK ratio from blots shown in C. * p<0.05 (TwoWay ANOVA, Tukey’s posthoc

test). (E) Body weights from male VILIRKO and fl/fl mice fed either chow or high fat diet

(HFD) for the indicated times (n=57). (F) Fecal calorie content was measured by bomb

calorimetry from feces, and average food intake per day measured over 5 days from 12 weekold

male CD fed VILIRKO and fl/fl mice (n=56). (G) Hematoxylin and eosin staining of

duodenum, jejunum and ileum from 18 weekold male VILIRKO and fl/fl mice on chow diet.

(H) Cryptvillus length was measured with ImageJ software on images from histological sections

of the jejunum from 18 weekold male VILIRKO and fl/fl mice on chow diet. Length was

measured for at least 30 cryptvilli in each section (n=5). (I) Small intestinal and (J) colon length

Page 27 of 45 Diabetes

from 18 weekold male VILIRKO and fl/fl mice on chow diet (n=45). (K) Representative

staining for Ki67 (green), Ecadherin (red), and DAPI (blue) of the jejunum from 18 weekold

male VILIRKO and fl/fl mice on chow diet.

Figure 2: Loss of intestinal epithelial insulin receptor improves glucose intolerance and

decreases glucose uptake in intestinal epithelial cells

(A) Oral glucose tolerance tests (OGTT) of 8, 12 and 20 weekold male VILIRKO and fl/fl mice

on chow diet and 17 weekold male VILIRKO and fl/fl mice on high fat diet. Data are shown as

mean ±SEM. [n ≥5 animals/group; repeated measures two way ANOVA with Sidak’s multiple

comparison test (12 and 17 weeks) and uncorrected Fisher’s LSD for 20 weeks; * p< 0.05]. (B)

OGTT of 8 weekold male VILIGFRKO and fl/fl mice on chow diet (n=45). (C) Blood glucose

and (D) [14C] 3OmethylDglucose levels during an in vivo oral glucose uptake assay in 8

weekold male VILIRKO and fl/fl mice on chow diet. Indicated mice were gavaged with 100

mg/kg phloridzin 15 min before administration of the glucose load (n =35). Repeated measures

two way ANOVA with Dunnett’s multiple comparison test; * = p< 0.05.

Figure 3: Intestinal epithelial insulin receptor regulates SGLT1 activity without affecting

transporter expression

(A) Ex vivo glucose uptake assay from isolated jejunal epithelial cells with [3H] 2deoxyD

glucose. Uptake was measured with basal glucose and after stimulation with 100 nM insulin for

10 minutes as described in Methods. Data are shown as mean fold change ±SEM, n = 5

animals/group. * = p< 0.05, twoway ANOVA with Sidak’s multiple comparison tests. (B) TBP

normalized mRNA expression of GLUT2 and SGLT1 measured from isolated epithelial cells of

Diabetes Page 28 of 45

the duodenum, jejunum and ileum of 18 weekold male VILIRKO and fl/fl mice on chow diet.

Data are shown as mean ±SEM (n = 5). (C) Western blot for SGLT1 from duodenum of 18 weekold male VILIRKO and fl/fl mice on chow diet. Akt was used as loading control. (D)

Immunofluorescence for SGLT1 (red) and DAPI (blue) of jejunum from 18 weekold male

VILIRKO and fl/fl mice on chow diet. (E) KEGG pathway enrichment analysis, ordered according to mean log2FC expression. Log2FC of significantly regulated pathway members is shown in the dot plot. Each row shows the log2FC expression of the respective genes that were used for enrichment analysis. The bar plot shows the –log10 pvalues for the enriched KEGG pathways. Enrichment was calculated using hypergeometric distribution test.

Figure 4: Intestinal epithelial insulin receptor regulates GIP expression and secretion

(A) Expression of GIP, GCG (proglucagon/Glp1), PYY and CHGA (chromograninA) mRNA from isolated epithelial cells of the duodenum, jejunum and ileum of 18 weekold male

VILIRKO and fl/fl mice on chow diet. Data are shown as mean ±SEM, n = 5 (unpaired Student’s ttest). Immunofluorescence staining (B) for GIP (green) and (C) GLP1 (green) of jejunal sections from 18 weekold male VILIRKO and fl/fl mice on chow diet. (C) Quantification of

GIP and GLP1 positive cells from at least 40 villi on sections of the jejunum. Data are shown as mean ±SEM of positive cells/20 villi in VILIRKO and fl/fl mice on chow diet. (* = p< 0.05, unpaired Student’s ttest). (D) Serum levels of GIP, GLP1 and PYY measured during an OGTT.

Data are shown as mean ±SEM, n ≥5 animals/group. Repeated measures two way ANOVA with

Sidak’s multiple comparison test, * = p< 0.05.

Page 29 of 45 Diabetes

Supplemental Material Supplemental Figure 1

IGF1R qPCR from whole intestinal segments, normalized to TBP (n=3) * = p<0.05 (OneWay

ANOVA, Tukey’s posthoc test). (B) Expression of IGF1R in isolated epithelial cells of the

jejunum and colon of 12 weekold male VILIGFRKO and control (fl/fl) mice on chow diet, n=5

for jejunum, n=4 for colon. (C) Liver, subcutaneous fat pad and perigonadal fat pad weights of

18 weekold male VILIRKO and fl/fl mice on chow diet and HFD. (D) Food intake of 12 week

old male VILIRKO and fl/fl mice on chow diet, n ≥5. (E) Body weight of 12 weekold male

VILIGFRKO and fl/fl mice on chow diet, n ≥5. (F) Liver weight of 12 weekold male

VILIGFRKO and fl/fl mice on chow diet, n ≥5. (G) Small intestinal length from 12 weekold

male VILIGFRKO and fl/fl mice on chow diet. All data shown as mean ±SEM, n ≥5.

Supplemental Figure 2

(A) Random fed blood glucose levels of 18 weekold male VILIRKO and fl/fl mice on chow diet

and HFD, n ≥5. (B) Intraperitoneal glucose tolerance tests (IPGTT) of 18weekold male

VILIRKO and fl/fl mice on chow diet, n ≥5. (C) Insulin levels of 18weekold male VILIRKO

and fl/fl mice on chow diet and HFD, n ≥5. Insulin tolerance tests of 12 weekold male

VILIRKO (D) and VILIGFRKO (E) and fl/fl mice on chow diet. All data are shown as mean

±SEM, n ≥5.

Supplemental Figure 3

CLAMS and Dexa analysis of 14weekold male VILIRKO and fl/fl mice on chow diet. Data are

shown as mean ±SEM, n = 6.

Diabetes Page 30 of 45

Supplemental Figure 4

(A) Heatmap of genes significantly differentially regulated in VILIRKO vs. fl/fl mice (p<0.05,

FC > 1.5). Rows show zscores of RMA normalized expression values. (B) Volcano plot for all protein coding genes after filtering for low expressed genes with low variance. (C) Protein protein interaction (PPI) networks. Each edge refers to a validated or predicted PPI. Data taken from STRING DB. (D) Relative expression (log FC) of all expressed genes mapped to the

KEGG pathway: Carbohydrate digestion and absorption.

Supplemental Figure 5

A-B: Phylotyping and community structure analyses of the gut microbiota based on sequencing of the V4 region of the 16S rRNA gene from stool of VILIRKO and fl/fl mice, n ≥7.

Supplemental Figure 6

Expression level of GIP, GCG, PYY CHGA, and IR mRNA measured by quantitative realtime

PCR (qPCR) of RNA from isolated epithelial cells of the jejunum of 12 weekold male

VILIGFRKO and control (fl/fl) mice on chow diet. Data are shown as mean ±SEM, n =5.

Page 31 of 45 Diabetes Figure 1 **** A 8 15 Colon B Duodenum Jejunum Ileum **** **** 6 **** fl/fl VILIRKO fl/fl VILIRKO fl/fl VILIRKO 10 IR 4 **** 5 ERK 2 [TBP normalised] rel. IR expression 0 0

fl/fl KO fl/fl KO fl/fl KO fl/fl KO LIR LIR LIR LIR VI VI VI VI Duodenum Jejunum Ileum 1.0 * D unstimulated unstimulated 100nM insulin 100nM IGF-1 0.8 100nM Insulin C 100nm IGF-1 0.6 fl/fl VILIRKO fl/fl VILIRKO fl/fl VILIRKO pIR/IGF1R 0.4 pERK/ERK

IRß [arbitrary units] 0.2 IGF1Rß 0.0 pERK fl/fl fl/fl fl/fl

ERK VILIRKO VILIRKO VILIRKO E G Duodenum Jejunum Ileum 50 40 30 fl/fl CD 20

VILIRKO CD fl/ fl fl/fl HFD body weight [g] 10 VILIRKO HFD 0 4 6 8 12 15 18 weeks F fecal calorie content food intake 4600 5.0

4400 4.5

4200 4.0 VILIRKO gram/day

calories/gram4000 3.5 100um 3800 3.0 fl/fl fl/fl fl/ fl VILIRKO K VILIRKO VILIRKO H 400 I 40 J 10 8 300 30 6 200 20 E-Cadherin

4 / 100 10

2 Dapi / colon length [cm] Villus length [µm] 0 small int. length [cm] 0 0 KI67 fl/fl KO fl/fl KO fl/fl KO R 50um LIR LIR LI VI VI VI Diabetes Page 32 of 45 Figure 2 A 500 8 weeks 500 12 weeks VILIRKO ** 400 fl/fl 400 300 300 200 200 Glucose[mg/dl] 100 Glucose[mg/dl] 100 0 0 0 30 60 90 120 0 30 60 90 120 Minutes Minutes

20 weeks HFD 17 weeks 400 600 * * * 500 300 * 400 * 200 300 200

100 Glucose[mg/dl] Glucose[mg/dl] 100 0 0 0 30 60 90 120 0 30 60 90 120 Minutes Minutes B C 400 500 fl/fl VILIGFRKO 300 400 300 200 200 100 Glucose[mg/dl] Glucose[mg/dl] 100 0 0 0 30 60 90 120 0 15 30 45 60 Minutes Minutes D 3-OMG uptake 1.0 * fl/lf fl/fl phloridzin 0.8 VILIRKO VILIRKO phloridzin 0.6 0.4 0.2

% input0.0 [BG subtracted] 0 15 30 45 60 Minutes PageFigure 33 of 345 Diabetes Duodenum Jenunum Ileum A fl/fl B 1.5 VILIRKO 100 ** ** 80 1.0 60

40 0.5

[TBP normalised] 20 rel. Glut2 expression rel. glucose uptake [control normalised] 0.0 0 5mM glucose 5mM glucose fl/fl fl/fl fl/fl +100nM Insulin VILIRKO VILIRKO VILIRKO fl/fl VILIRKO Duodenum Jenunum Ileum C 600 SGLT1

400 Akt

D fl/fl VILIRKO 200 [TBP normalised] rel. Sglt1 expression 0 fl/fl fl/fl fl/fl Dapi / VILIRKO VILIRKO VILIRKO SGLT1 50um

E Influenza A Hippo signaling pathway -multiple species Protein processing in endoplasmic reticulum Estrogen signaling pathway Antigen processing and presentation Toxoplasmosis Malaria MAPK signaling pathway Longevity regulating pathway - multiple species Olfactory transduction Chemokine signaling pathway Legionellosis Endocytosis Hippo signaling pathway FoxO signaling pathway NOD-like receptor signaling pathway Central carbon metabolism in cancer Platinum drug resistance Fatty acid metabolism Glutathione metabolism Chemical carcinogenesis Drug metabolism - cytochrome P450 Metabolism of xenobiotics by cytochrome P450 Sphingolipid metabolism Aldosterone-regulated sodium reabsorption AMPK signaling pathway

-2 -1 0 1 2 012345 log2 fold -log10 (pValue)

-2 -1.5 -1 0 1 21.5 Figure 4 Diabetes Page 34 of 45 A Duodenum Jejunum Ileum Duodenum Jejunum Ileum 30 4

* * 3 20 2 10 1 [TBP normalised] [TBP normalised] rel. GIP expression rel. PYY expression 0 0 fl/fl fl/fl fl/fl fl/fl fl/fl fl/fl

VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO

Duodenum Jejunum Ileum Duodenum Jejunum Ileum 6 4

3 4 2 2 1 [TBP normalised] [TBP normalised] rel. GCG expression rel. CHGA expression 0 0 fl/fl fl/fl fl/fl fl/fl fl/fl fl/fl

VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO

fl/fl VILIRKO * 15 B

Dapi 10

5 E-Cadh. GIP

GIP positive cells x 20 villi 0

fl/fl

VILIRKO C 15 Dapi 10

E-Cadh. 5

GLP1 50 um

Glp-1 positive cells x 20 villi 0

fl/fl

VILIRKO D GIP Glp-1 PYY 1500 50 400 * fl/fl VILIRKO 40 300 1000 30 200

pg/ml 20 500 100 10

0 0 0 0 2040600 2040600 204060 Minutes Minutes Minutes Page 35 of 45 Diabetes Figure S1

A 0.8 *

0.6

0.4

0.2 [TBP normalised]

rel. IGF1R expressoin 0.0

Ileum Jejunum Duodenum

Ascending colon Descending colon B Jejunum Colon 0.20 0.8

0.15 0.6

0.10 0.4

0.05 0.2 [TBP normalised] [TBP normalised] rel. IGF1R expression rel. IGF1R expression 0.00 0.0

fl/fl fl/fl

VILIGFRKO VILIGFRKO C Chow HFD Chow HFD Chow HFD 1.5 2.5 3 2.0 1.0 2 1.5 1.0 0.5 1 Liver weight [g] SCF weight [g] 0.5 PGF weight [g] 0.0 0.0 0

fl/fl fl/fl fl/fl fl/fl fl/fl fl/fl

VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO VILIRKO D 5 E 25 4 20 3 15 2 10 Body weight [g] 1 fl/fl 5

Food Intake(g/day) VILIRKO 0 0 1 2 3 4 5 fl/fl Day

G VILIGFRKO F 1.5 50 40 1.0 30 20 0.5 Liver weight [g] 10 0.0 0 sm. intestine length [cm] fl/fl fl/fl

VILIGFRKO VILIGFRKO Diabetes Page 36 of 45

Figure S2

IPGTT 18 Weeks A Chow HFD B 400 250 fl/fl VILIRKO 200 300

150 200 100 Glucose [mg/dl] 100

Glucose [mg/dl] 50

0 0 0 30 60 90 120 fl/fl KO fl/fl KO Minutes LIR LIR VI VI C 18 Weeks [CD] 18 Weeks [HFD] 3000 3000

2000 2000

Insulin [pg/ml] 1000 Insulin [pg/ml] 1000

0 0 fl/fl fl/fl

VILIRKO VILIRKO

D ITT 12 Weeks E ITT 12 Weeks 250 fl/fl 300 fl/fl VILIRKO 200 VILIGFRKO 200 150

100

Glucose [mg/dl] 100 50 Glucose [mg/dl]

0 0 0 30 60 90 120 0 30 60 90 Minutes Minutes Page 37 of 45 Diabetes Figure S3 BMD BMC Total lean 0.06 0.5 25 fl/fl VILIRKO 0.4 20 0.04 0.3 15

0.2 10 0.02 0.1 5

0.00 0.0 0

fl/fl KO fl/fl KO fl/fl KO LIR LIR LIR VI VI VI

Total fat VO2 Mean VCO2 Mean 20 8000 6000

15 6000 4000 10 4000 2000 5 2000

0 0 0

fl/fl KO Light Dark Light Dark LIR VI RER Mean Activity Mean Drink Mean/day 1.0 250 4

0.8 200 3 0.6 150

ml 2 0.4 100 1 0.2 50

0.0 0 0

Light Dark Light Dark Light Dark Figure S4 Diabetes Page 38 of 45

4 A fl/fl VILIRKO B Zfy2 Gdf15 3.5 Defb23 Cts8 Tgfb3 Olfr656 3 Rassf4 Gpr162 Casp4 Cxcl10 2.5 Aard Cd93 Hic1 2 Ppt1 Impa2 Olfr116 4933406M09Rik -log10 pValue 1.5 Gypc Taar3 Fhl3 Tead1 1 Ifit1bl1 Olfr978 Hspa12a Cd14 0.5 Haus8 Olfr8 Gtf2a1l 0 Olfr1504 Mug1 -5 -4 -3 -2 -1 0 1 2 3 4 5 Olfr1141 log2 fold Gbp4 Klrb1a Slc6a18 Txk Prkch C Tas1r2 Ptprc Foxl1 Gars Heatr9 Hsp90aa1 Tas1r3 Serpina3k Hspa1a Clrn2 Lilr4b Hspa1b Cxcr6 Sit1 Asb2 Jrk Noto Olfr347 Purg Slc15a1 Fbxo21 Slc5a1 Slc2a2 Gm13124 Itih5 Rps20 Pcdh19 1700009N14Rik Keg1 Gm4858 Vps33b Hspa4 Olfr331 Kdsr Mroh7 Insr Slc2a5 Apol10a Cpne2 Hsd17b6 Lect2 Gpx3 Egfr Sec14l2 Gstk1 Igf1r Gstt1 Adora2b Podn Mcoln3 D KEGG: Carbohydrate digestion and absorption Gip Pde8a Lmx1a Tac1 Pik3cd Tbc1d31 Gnpda1 Olfr743 Fxyd2 Isoc1 Mgst2 Apol11b Hk2 Afp Stk38 Scd1 Slc2a2 Ext1 Fam132a Abt1 Atp1a2 Zfp280c Gsta4 Creg1 G6pc2 Cd59a Thap2 Pik3r3 Gm5549 Tnfrsf23 Pisd Akt3 Insr Slc25a37 Naip2 Slc2a5 Naip5 Gm7102 Mmp15 Slc5a1 Homer2 Igf2 D130043K22Rik Slc37a4 Flywch1 Fam151a Rnf208 Mgam Olfr679 Enpp7 Pfkm G6pc Fbxw16 Bok Neto1 Lct Cntnap5c Olfr472 Vmn2r109 Tmcc3 -0.5 -0.4 -0.3 -0.2 -0.1 0 0.1 0.2 0.3 0.4 0.5 Gm7694 log2 fold Scnn1a Clps Fgfr3 Grk5 Bmp8b Cox6b2 Cttnbp2 Rtn4r Olfr458 -2 -1 0 1 2 Capn13 z-Score Page 39 of 45 Diabetes Figure S5 0.6 fl/fl A B VILIRKO 5 4 0.4 3

2 1

Shannon Entropy 0.2 0 fl/fl

VILIRKO

0.0

Bacteria;Firmicutes Bacteria;unclassifiedArchaea;unclassifiedBacteria;Tenericutes Bacteria;BacteroidetesBacteria;Proteobacteria Bacteria;Actinobacteria Bacteria;VerrucomicrobiaBacteria;Deferribacteres Diabetes Page 40 of 45

Figure S6

15 1.5 5

4 10 1.0 3 2 5 0.5

[TBP normalised] 1 [TBP normalised] [TBP normalised] rel. IR expression rel. GIP expression rel. GCG expression 0 0.0 0

fl/fl fl/fl fl/fl

VILIGFRKO VILIGFRKO VILIGFRKO 1.5 4

3 1.0 2

0.5 1 [TBP normalised] [TBP normalised] rel. CHGA expression rel. PYY expression 0.0 0 fl/fl fl/fl

VILIGFRKO VILIGFRKO Page 41 of 45 Diabetes

Supplemental Table 1: qPCR Primer sequences

Gene symblos primer sequence CHGA FWD TTTTTGCCCTTCCTGTGAAC CHGA REV ACAGCGAGTCGGAGATGACT GCG FWD GCCCTTCAAGACACAGAGGA GCG REV TGTGAGTGGCGTTTGTCTTC GIP FWD GACTTCGTGAACTGGCTGCT GIP REV TTGTCCTCCTTTCCCTGAGA GLUT2 FWD GACATCGGTGTGATCAATGC GLUT2 REV ATCCAGTGGAACACCCAAAA IGF1R FWD AGGAGAAGCCCATGTGTGAG IGF1R REV GTGTTGTCGTCCGGTGTGT IR FWD CCACCAATACGTCATTCACAAC IR REV GGGCAGATGTCACAGAATCAA PYY FWD GCTTCTCCCACCTTCCATCT PYY REV CGAGCAGGATTAGCAGCATT SGLT1 FWD GGTACCGTTGGAGGCTTCTT SGLT1 REV CCACAAAGTGACCACTTCCA TBP fwd ACCCTTCACCAATGACTCCTATG TBP REV TGACTGCAGCAAATCGCTTGG SFB FWD GACGCTGAGGCATGAGAGCAT SFB REV GACGGCACGGATTGTTATTCA eubacteria FWD ACTCCTACGGGAGGCAGCAGT eubacteria REV ATTACCGCGGCTGCTGGC Diabetes Page 42 of 45

string_interactions_Sglt1 #node1 node2 node1_string_internal_id node2_string_internal_id node1_external_id Slc2a2 Slc5a1 2097454 2094098 10090.ENSMUSP00000029240 Tas1r3 Tas1r2 2098026 2097875 10090.ENSMUSP00000030949 Slc2a5 Slc2a2 2097978 2097454 10090.ENSMUSP00000030826 Slc2a5 Slc5a1 2097978 2094098 10090.ENSMUSP00000030826 Slc15a1 Slc5a1 2107818 2094098 10090.ENSMUSP00000085728 Tas1r3 Slc5a1 2098026 2094098 10090.ENSMUSP00000030949 Slc2a2 Igf1r 2097454 2093723 10090.ENSMUSP00000029240 Insr Slc2a2 2108203 2097454 10090.ENSMUSP00000088837 Egfr Slc5a1 2094834 2094098 10090.ENSMUSP00000020329 Tas1r2 Slc5a1 2097875 2094098 10090.ENSMUSP00000030510 Foxl1 Slc5a1 2115662 2094098 10090.ENSMUSP00000137732 Slc5a1 Igf1r 2094098 2093723 10090.ENSMUSP00000011178 Hspa4 Slc5a1 2094928 2094098 10090.ENSMUSP00000020630 Insr Slc5a1 2108203 2094098 10090.ENSMUSP00000088837 Insr Slc2a5 2108203 2097978 10090.ENSMUSP00000088837 Tas1r3 Slc2a2 2098026 2097454 10090.ENSMUSP00000030949 Slc2a5 Igf1r 2097978 2093723 10090.ENSMUSP00000030826 Hspa4 Egfr 2094928 2094834 10090.ENSMUSP00000020630 Slc15a1 Slc2a2 2107818 2097454 10090.ENSMUSP00000085728 Slc15a1 Slc2a5 2107818 2097978 10090.ENSMUSP00000085728 Tas1r2 Slc2a2 2097875 2097454 10090.ENSMUSP00000030510 Egfr Igf1r 2094834 2093723 10090.ENSMUSP00000020329 Insr Egfr 2108203 2094834 10090.ENSMUSP00000088837 Slc15a1 Tas1r3 2107818 2098026 10090.ENSMUSP00000085728

Page 1 Page 43 of 45 Diabetes

string_interactions_Sglt1 node2_external_id neighborhood_on_chromosome gene_fusion phylogenetic_cooccurrence 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000030510 0 0 0 10090.ENSMUSP00000029240 0 0 0.527 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000005671 0 0 0 10090.ENSMUSP00000029240 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000005671 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000011178 0 0 0 10090.ENSMUSP00000030826 0 0 0 10090.ENSMUSP00000029240 0 0 0 10090.ENSMUSP00000005671 0 0 0 10090.ENSMUSP00000020329 0 0 0 10090.ENSMUSP00000029240 0 0 0 10090.ENSMUSP00000030826 0 0 0 10090.ENSMUSP00000029240 0 0 0 10090.ENSMUSP00000005671 0 0 0 10090.ENSMUSP00000020329 0 0 0 10090.ENSMUSP00000030949 0 0 0

Page 2 Diabetes Page 44 of 45

string_interactions_Sglt1 homology coexpression experimentally_determined_interaction database_annotated 0 0 0 0.9 0.8 0 0.165 0.9 0.891 0 0 0.9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.165 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.063 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.606 0 0 0 0 0 0 0 0 0 0 0 0 0 0.625 0 0.299 0 0.625 0 0.299 0 0 0 0 0

Page 3 Page 45 of 45 Diabetes

string_interactions_Sglt1 automated_textmining combined_score 0.906 0.99 0.994 0.93 0.935 0.915 0.883 0.883 0.778 0.778 0.766 0.766 0.755 0.755 0.747 0.747 0.706 0.744 0.74 0.74 0.736 0.736 0.711 0.712 0.698 0.705 0.701 0.701 0.65 0.651 0.65 0.65 0.648 0.648 0.091 0.626 0.615 0.615 0.597 0.597 0.553 0.553 0.836 0.517 0.826 0.514 0.417 0.416

Page 4