Effect of Recombinant Vascular Endothelial Growth Factor and Translationally Controlled Tumor Protein on 2‑Hydroxyethyl Methacrylate‑Treated Pulp Cells

6100 MOLECULAR MEDICINE REPORTS 17: 6100-6108, 2018

Effect of recombinant vascular endothelial growth factor and translationally controlled tumor protein on 2‑hydroxyethyl methacrylate‑treated pulp cells

CHUNYANUT WONGKHUM1, WILAIWAN CHOTIGEAT1 and UREPORN KEDJARUNE‑LEGGAT2

Departments of 1Molecular Biotechnology and Bioinformatics, Faculty of Science and 2Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand

Received September 13, 2017; Accepted February 6, 2018

DOI: 10.3892/mmr.2018.8593

Abstract. Vascular endothelial growth factor (VEGF)-A is promoted pulp cell growth and the survival of HEMA‑treated a potential signaling protein that may promote angiogenesis. cells without synergistic effects. TCTP was required in lower VEGF also helps cells survive in stressfull or hazardous concentrations for these effects. VEGF and TCTP enhanced conditions. The present study aimed to compare the effect of cell differentiation and mineralization. VEGF with translationally controlled tumor protein (TCTP), an anti‑apoptotic protein in human dental pulp cells (HDPCs), Introduction following exposure to 2‑hydroxyethyl methacrylate (HEMA), which is a major residual monomer from resin restorative Growth factor typically acts as signaling molecules between dental materials. Cell viability, alkaline phosphatase (ALP) cells and is an important component required for tissue engi- activity, mineralization and gene expressions for odontogenic neering. There have been many attempts at developing dental and osteogenic differentiation markers of HDPCs were inves- biomaterial or scaffold supplemented with a single or combina- tigated, following exposure to HEMA and in combination with tion of active molecules to induce dentine or pulp regeneration. TCTP and VEGF. The results revealed that TCTP at 1 ng/ml One growth factor that was widely selected for this purpose is and VEGF at 10 ng/ml significantly promoted the proliferation vascular endothelial growth factor (VEGF). of HDPCs (P<0.05). TCTP (1 ng/ml) and VEGF (10 ng/ml) VEGF-A is one of the four subtypes of VEGF maintained the cell viability of 4 mM HEMA‑treated cells (‑A, ‑B, ‑C, and ‑D) that are expressed in dental pulp with at the same percentage as the control. However, cells treated autocrine and paracrine effects in blood vessels and immune with HEMA+TCTP+VEGF had a lower cell viability than cells (1). It is a potential signaling protein that can promote the groups treated with HEMA and TCTP or VEGF alone. angiogenesis and activate dentin regeneration (2). VEGF TCTP and VEGF promoted cell proliferation, ALP activity has been used in growth factor delivery‑based tissue engi- and mineralization, and upregulated of DSPP, DMP‑1, BMP‑2, neering (3), including pulp tissue regeneration for regenerative and ALP mRNA expression compared with the control. endodontics (4). Moreover, VEGF has been shown to induce Furthermore, the HEMA+TCTP and HEMA+VEGF groups proliferation and differentiation of human pulp cells into had significantly higher percentages of calcium deposition odontoblasts (5). Another interesting property of VEGF is than HEMA‑treated cells (P<0.001). HEMA was cytotoxic helping cells survive from stress or hazardous conditions. to HDPCs, reduced ALP activity and caused the significant There have been some studies reporting that VEGF played a downregulation of odontogenic and osteogenic gene expres- role in survival of serum‑starved endothelial cells (6,7), as well sions (P<0.05). It was concluded that VEGF and TCTP as survival of these cells in hypoxic conditions (8). A previous study has also revealed that VEGF expression was upregulated in mouse odontoblast‑like cells (MDPC‑23) exposed to 2‑hydroxyethyl methacrylate (HEMA) (9). HEMA is a major monomer released from incomplete Correspondence to: Dr Ureporn Kedjarune‑Leggat, Department of polymerization of resin‑based dental restorative materials. It is Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla cytotoxic to cells and can damage DNA (10), leading to prolif- University, 15 Karnjanavanich Road, Hat Yai, Songkhla 90112, Thailand eration impairment (11) and delayed cell differentiation (12). E‑mail: [email protected] Translationally controlled tumor protein (TCTP) is a conserved protein found in many eukaryotic cells ranging Key words: vascular endothelial growth factor, translationally from plant to animal kingdoms (13). TCTP has many controlled tumor protein, 2‑hydroxyethyl methacrylate, pulp cells, functions, including proliferation, maturation, and antiapop- cytotoxicity tosis (14). TCTP from Penaeus merguiensis (Pmer‑TCTP) has been shown to have an antiapoptotic property against HEMA‑treated dental pulp cells (15). A new formula of resin WONGKHUM et al: VEGF AND TCTP ON HEMA-TREATED PULP CELLS 6101 modified glass ionomer cement supplemented with TCTP can solution (5 mg/ml in PBS) were added to each well and incu- reduce cell death from residual HEMA release (16). The aim of bated in the dark for 4 h at 37˚C. The medium and MTT were this study was to compare cell proliferation, anticytotoxicity, then removed and 200 µl of DMSO and 25 µl of Sorensen's differentiation and mineralization of VEGF-A with TCTP on glycine buffer (0.1 M glycine plus 0.1 M NaCl equilibrated to HEMA‑treated human dental pulp cells (HDPCs). This will pH 10.5 with 0.1 M NaOH) were added. The optical density assist the further development of a restorative material that (OD) of formazan production was measured at 570 nm. The may have less toxicity and be able to regenerate pulpal dentine OD values adjusted for a blank (medium only) of the experi- complex. mental groups were divided by the control (cell cultured in normal medium without TCTP and VEGF) and expressed as Materials and methods percentages of the control, which represented the percentages of viable cells. Expression and purification of recombinant TCTP and recombinant VEGF. Expression of Pmer‑TCTP gene was Cytotoxicity of HEMA. MTT assay was used to evaluate the performed in the bacteria Escherichia coli (E. coli) strain cytotoxicity of HEMA at two concentrations, which were BL21. The protein was purified according to methods previ- 4 mM and 6 mM. HDPCs were seeded at 8x103 cells/well in a ously described (14). Briefly, E. coli strain BL21 harboring 96‑well plate at a humidified atmosphere of 5% CO2 at 37˚C. pGEX‑Pmer‑TCTP was inoculated and induced by 1 mM After 24 h, the media was replaced with HEMA mixed in IPTG (isopropyl β‑D‑thiogalactopyronositol) for stimulating culture medium and left for 24 h. Then the media was refreshed protein expression. After induction for 3 h, the bacterial with normal media and incubated for 48 h before MTT assay cells were harvested by centrifugation and the soluble gluta- was performed as described previously (n=5 in each group). thione S‑transferase (GST)‑TCTP protein was purified by The results from HEMA cytotoxicity testing led to the using Glutathione Sepharose 4 Fast Flow (GE Healthcare selection of 4 mM HEMA as a cytotoxic reagent. In addition, Bio‑Science, Piscataway, NJ, USA) and thrombin was used the result from effective concentrations of TCTP and VEGF for splitting of GST‑tagged protein. The purified Pmer‑TCTP suggested the use of TCTP at 1 and 10 ng/ml of VEGF for protein with molecular mass about 19.2 kDa (168 amino further investigation. acid residues) was determined by SDS‑PAGE and protein concentration was analyzed by a BCA protein assay kit The recovery effect of TCTP and VEGF on HEMA‑treated (Pierce; Thermo Fisher Scientific, Inc., Waltham, MA, USA). HDPCs. There were five groups of HDPCs according to Recombinant human VEGF was purchased from Gibco® different medium conditions: HEMA, HEMA+TCTP, (Gibco; Thermo Fisher Scientific, Inc.).This protein has about HEMA+VEGF, HEMA+TCTP+VEGF, and control group 40 kDa (homodimer) with 165 amino acid residues/subunit. (culture medium only). HDPCs were seeded at 8x103 cells/well

on a 96‑well plate at a humidified atmosphere of 5% CO2 at Cell culture. HDPCs were cultured from pulp tissue of sound 37˚C and fed with normal medium. After 24 h, the culture third molar teeth of adults aged 18‑25 years at the Dental medium was replaced with media supplemented with Hospital, Faculty of Dentistry, Prince of Songkla University, substances as described above for 24 h. After that, the fresh with consent forms approved by the Research Ethics media was replaced and incubated for 48 h. The viable cells Committee (Number EC5703‑09‑P‑LR), Faculty of Dentistry, were determined by the MTT assay (n=5 in each group). Prince of Songkla University. Primary culture of pulp cells was performed using an enzymatic method. Briefly, the pulp Alkaline phosphatase (ALP) activity assay. ALP activity assay tissue was cut into small pieces before digested in 3 mg/ml of was used to determine odontoblast‑like differentiation. The collagenase type I and 4 mg/ml of dispase for 1 h at 37˚C. After experiment was divided to six groups according to substances centrifugation, cells were cultured in α‑MEM, supplemented added to the medium: HEMA, HEMA+TCTP, HEMA+VEGF, with 10% fetal calf serum (FCS), 100 µM L‑ascorbic acid TCTP, VEGF and cells cultured in normal medium as a control 2‑phosphate, 100 µM L‑glutamate, 100 U/ml penicillin, and group. HDPCs were seeded at 1x104 cells/well on a 24‑well

100 µg/ml streptomycin and incubated at 37˚C with 5% CO2. plate and fed with normal culture medium using 15% FCS at a Pulp cell passages between three and five were used for this humidified atmosphere of 5% CO2 at 37˚C (n=3 in each group). study. The medium was changed every 2 days and the ALP activity of cells was determined after being cultured for 3, 7 and 14 days. Finding effective concentrations of TCTP and VEGF The ALP activity was measured by using p‑nitrophenol phos- on HDPCs. The effect of TCTP and VEGF at various phate as a substrate. Cells were washed twice with PBS pH 7.4 concentrations on HDPCs was examined by the and lysed in 20 µl/well of lysis buffer (100 mM MgCl2·6H2O, 3‑(4, 5‑dimethylthiazol‑2‑yl)‑2,5‑diphenyltetrazolium 1 M Tris‑HCl pH 7.4, 0.1% Triton‑X 100, pH 10) on ice and bromide (MTT) assay. TCTP and VEGF were diluted with centrifuged at 14,000 g at 4˚C for 10 min. The supernatant cell culture medium at various concentrations varying from was collected for total protein and ALP activity determina- 1 ng/ml to 15 µg/ml (n=5 in each group). HDPCs at a density of tions. The total protein was determined by using BCA kit. For 5x103 cells/well were cultured in 96‑well plates in a humidified ALP activity assay, 5 µl of the supernatant of each sample was atmosphere of 5% CO2 at 37˚C for 24 h and then the culture incubated in 50 µl of ALP substrate solution containing 0.2 M medium supplemented with TCTP and VEGF were replaced. 2‑amino‑2‑methyl‑1‑propanol (AMP), 4 mM MgCl2 and 50 µl After 24 and 72 h, the medium was removed, 200 µl of fresh of 4 mg/ml p‑nitrophenol phosphate at 37˚C for 30 min. Then, medium containing 10 mM HEPES (pH 7.4) and 50 µl MTT the reaction was stopped with 100 µl of 0.1 M NaOH. The 6102 MOLECULAR MEDICINE REPORTS 17: 6100-6108, 2018

Table I. qPCR F and R primer sequences.

Gene Primer sequence (5'‑ 3') GenBank accession no.

DSPP F: GGGATGTTGGCGATGCA NM_014208.3 R: CCAGCTACTTGAGGTCCATCTTC DMP1 F: GCAGAGTGATGACCCAGAG NM_004407.3 R: GCTCGCTTCTGTCATCTTCC ALP F: CCACAAGCCCGTGACAGA NM_001127501.3 R: GCGGCAGACTTTGGTTTC BMP‑2 F: GCTTCCGCCTGTTTGTGTTTG NM_007553.2 R: AGAGACATGTGAGGATTAGCAGGT GAPDH F: GCACCGTCAAGGCTGAGAAC NM_002046 R: ATGGTGGTGAAGACGCCAGT

F, forward; R, reverse; DSPP, dentin sialophosphoprotein; DMP1, dentin matrix protein 1; ALP, alkaline phosphatase; BMP‑2, bone morphogenetic protein‑2.

absorbance was measured at 405 nm. ALP activity was calcu- sialophosphoprotein (DSPP), dentin matrix protein 1 (DMP‑1), lated as nanomolar of p‑nitrophenol per µg of total protein and ALP and bone morphogenetic protein‑2 (BMP‑2) expressions adjusted to the increased percentage compared to the control were examined and gene glyceraldehyde‑3‑phosphate dehy- (medium only). drogenase (GAPDH) was selected to be an internal control. The primers (5'‑ and 3'‑) were designed and shown in Table I. Alizarin red S (ARS) staining assay. Alizarin red S (ARS) There were six groups in the experiment: HEMA 4 mM alone staining assay was used to evaluate calcium deposition. There and with (1 ng/ml TCTP, 10 ng/ml VEGF) with pulp cells, were six groups according to different substances added in 1 ng/ml TCTP, 10 ng/ml VEGF with pulp cells and cells the inductive medium, which were HEMA, HEMA+TCTP, cultured in normal medium was set as the control. The experi- HEMA+VEGF, TCTP, VEGF and the last group was cells ments were repeated three times. HDPCs at 1.5x106 cells cultured in an inductive medium only as a positive control group. were seeded on six‑well plate with 2,000 µl/well of normal HDPCs at 1.5x105 cells/well were seeded on a 12‑well plate and medium. After 24 h, the mixed‑medium with selected supple- fed with 500 µl/well of inductive medium, which was composed ments was replaced and then changed every 2 days. After 1, 3 of 1 M β‑glycerophosphate, 10 mg/ml ascorbic acid, 100 U/ml and 7 days the medium was removed and cells were washed penicillin, 100 mg/ml streptomycin and 100 mg/ml antibi- with PBS pH 7.4. The total RNA of cells was extracted and otic‑antimycotic, in α‑MEM with 20% fetal calf serum (n=3 in purified by RNeasy® Plus Micro kits (Qiagen, Inc., Valencia, each group) at 37˚C in a humidified atmosphere containing 5% CA, USA) and converted to cDNA with SuperScript™ III RT

CO2. After the first 24 h, the medium was refreshed and then (Invitrogen; Thermo Fisher Scientific). The thermal profile the medium was replaced every 2 days. After 7, 14 and 21 days, for RT‑PCR, under denaturing conditions was 65˚C for 5 min the medium was removed and cells were washed with PBS followed by cDNA synthesis at 50˚C for 30 min. The reac- pH 7.4 and fixed in 10% (v/v) formaldehyde (Sigma-Aldrich; tion was terminated at 85˚C for 5 min. Then the remaining Merck KGaA, Darmstadt, Germany ) at room temperature for RNA was removed by adding 1 µl of RNase H at 37˚C for 15 min and washed twice with 1 ml/well of ultrapure water at 20 min and 3 µl of each cDNA product was fractionated by room temperature for 5 min. Then Alizarin Red solution was 1.2% agarose gel electrophoresis and visualized by ethidium added 1 ml/well and incubated on shaker for 30 min. After bromide staining by ultraviolet (UV) transillumination. removal of ARS, the plate was washed four times with ultra- SYBR Green PCR master mix (Roche Diagnostics GmbH, pure water, while shaking for 5 min, and then Store plates at Mannheim, Germany) was used for qPCR analysis. The ‑20˚C prior to dye extraction. The monolayers were incubated qPCR mix consisted of 1 µl of cDNA, 2 µl of forward and by 200 µl cetylpyridinium chloride (CPC) buffer for 2 h on a reverse primer, 10 µl of SYBR Green and 5 µl of nuclease‑free shaker. After that, it was centrifuged at 20,000 g for 15 min water, and the negative control was distilled water instead of and 100 µl of the supernatant was then transferred to a 1.5 ml cDNA sample. The reaction was performed manually in trip- tube. It was diluted (10 µl of sample and 90 µl of CPC) to a licates in each sample, at a final volume of 20 µl. The thermal 96‑well plate and the OD values corrected for a blank (CPC profile for amplification of the investigated gene was followed only). The absorbance of the sample was measured in an by 40 cycles of denaturation at 95˚C for 15 sec, annealing ELISA reader at 550 nm. at 60˚C for 30 sec and then elongation at 72˚C for 30 sec. After the end of the last cycle, the final quantification was Gene expression. Quantitative real‑time reverse transcription reported as an amount after normalization to reference gene polymerase chain reaction (qRT‑PCR) was used to investigate GAPDH. Relative values were analyzed using comparative the effect of each sample on pulp cells differentiation. Dentin cycle threshold (CT) method (∆∆CT method). WONGKHUM et al: VEGF AND TCTP ON HEMA-TREATED PULP CELLS 6103

Figure 1. Effect of TCTP and VEGF on HDPCs viability investigated by MTT assay. Cells were treated with various concentrations of TCTP and VEGF at (A) 24 and (B) 72 h. Data were presented as the mean ± standard deviation (n=5). *P<0.05. aP<0.05 vs. TCTP control and bP<0.05 vs. VEGF control. TCTP, translationally controlled tumor protein; VEGF, vascular endothelial growth factor; HDPCs, human dental pulp cells.

Statistical analysis. The results of MTT were analyzed using cell viability (P<0.05). Cells cultured in medium supplemented the one way analysis of variance (ANOVA) and Tukey's with VEGF did not have a higher percentage of viable cells than post hoc‑test to investigate the differences among the the control after culturing for 24 h. However, after 72 h, it was experimental groups. Unpaired t‑test was used to compare the found that at low concentration, especially at 1 ng/ml of TCTP difference of means between two groups of TCTP and VEGF. and 10 ng/ml of VEGF, had significantly higher cell viability Kruskal‑Wallis and Dunnett multiple comparison were used than the control and compared within groups (P<0.05). High to analyze the results of ALP assay, ARS assay and qRT‑PCR. concentration of VEGF at 15 µg/ml significantly reduced cell P<0.05 was considered as statistically significant. viability (Fig. 1B). The results led to the determination to use 1 ng/ml of TCTP and 10 ng/ml of VEGF in culture medium for Results further studies.

Effective concentration of TCTP and VEGF on HDPCs. HDPCs The recovery effect of TCTP and VEGF on HEMA‑treated were treated with various concentrations from 1 to 15 µg/ml of HDPCs. HEMA‑treated pulp cells at concentration of 4 mM TCTP and VEGF in order to find the effective concentrations and 6 mM demonstrated its high level of cytotoxicity, because that are not cytotoxic to cells and can also promote cell growth. the percentages of viable cells were all less than 10% (Fig. 2A). After culturing for 24 h, most of the various concentrations of The result from Fig. 2B showed that HDPCs cultured in 4 mM TCTP can promote cell growth because the percentage of viable of HEMA with either 1 ng/ml TCTP or 10 ng/ml VEGF and cells was over 100% compared to the control (Fig. 1A), espe- both of combinations TCTP and VEGF had percentages of cially at 1 ng/ml of TCTP, which gave the highest percentages of cell viability that were not statistically different from the 6104 MOLECULAR MEDICINE REPORTS 17: 6100-6108, 2018

Figure 2. MTT assay of HDPCs. (A) Cytotoxicity test of 4 mM and 6 mM HEMA on HDPCs. (B) The recovery effect of TCTP and VEGF on HEMA‑treated HDPCs. (C) The morphological features of HDPCs in each group taken by inverted microscope, scale bar represented 500 µm. Data were presented as the mean ± standard deviation (n=5). *P<0.05 vs. control group. HDPCs, human dental pulp cells; HEMA, 2‑hydroxyethyl methacrylate. TCTP, translationally controlled tumor protein; VEGF, vascular endothelial growth factor.

control group, while cell viability in HEMA‑treated cells was deposition in TCTP and VEGF groups were higher than the significantly lower than other groups (P<0.05) (Fig. 2B). The others (P<0.001). However, calcium in group HEMA+VEGF morphological features of HDPCs were shown in Fig. 2C. was significantly higher than HEMA+TCTP and HEMA The results suggested that TCTP and VEGF had an ability alone (P<0.01). In addition, after culture for 14 days, cells to recover the viability of HEMA‑treated pulp cells. It was in groups HEMA+TCTP, HEMA+VEGF, TCTP, and VEGF noted that HEMA‑treated cells supplemented with TCTP+ had increased calcium deposition compared to the control. In VEGF did not increase the percentages of cell viability, when particular, the HEMA+TCTP group had the highest calcium compared to either TCTP or VEGF. deposition (P<0.001). At this period, the level of calcium deposition in cells treated with TCTP and VEGF was reduced ALP activity. The result of ALP activity was revealed in from 7 days. After culture for 21 days, HDPCs cultured in an Fig. 3. HEMA significantly reduced ALP activity compared inductive medium with added TCTP had increased calcium to the control and TCTP or VEGF groups in all three periods deposition and became the highest compared to other groups. (day 3 P<0.01), (day 7 and day 14 P<0.001). HEMA+TCTP and It was noted that HDPCs cultured in inductive medium only HEMA+VEGF groups had slightly higher ALP activity than (control) had increased calcium deposition by time and reached HEMA within each time period. its highest after 21 days. Cells treated with HEMA+TCTP had reached its highest calcium deposition after 14 days and then Mineralization effect of TCTP and VEGF on HEMA‑treated reduced, but were still the same level as control after 21 days. HDPCs. The Alizarin red S (ARS) assay was used to deter- Furthermore, the groups of HEMA+TCTP and HEMA+VEGF mine calcium deposition and the results have been shown had higher calcium deposition than the HEMA group at all in Fig. 4. After culture for 7 days, the levels of calcium three time periods. WONGKHUM et al: VEGF AND TCTP ON HEMA-TREATED PULP CELLS 6105

Figure 3. ALP activity assay. Data were presented as the mean ± standard deviation (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. the control group within each time period; #P<0.05 and ##P<0.01 vs. the corresponding 3 day group. ALP, alkaline phosphatase.

Figure 4. Cell mineralization measured by ARS assay. Data were presented as the mean ± standard deviation (n=3). **P<0.01 and ***P<0.001 vs. the control group within each time period; ##P<0.01, ###P<0.001 vs. the corresponding 7 day group. ARS, Alizarin red S.

Differentiation‑related gene expression of HDPCs by At day 3, cells treated with HEMA+TCTP (P<0.001) and qRT‑PCR. The result of qRT‑PCR was shown in Fig. 5. The HEMA+VEGF (P<0.01) had significantly higher upregulation response of DSPP gene was reported as an average of fold than other groups. However, downregulation was found in all expression (Fig. 5A). At day 1, the expression of DSPP gene groups on day 7. in cells treated with HEMA was lower than control, while The high level of BMP‑2 gene expression was observed in upregulation was found in cells treated with TCTP and VEGF. cells treated with HEMA+TCTP on day 1 (P<0.01) and on day 6106 MOLECULAR MEDICINE REPORTS 17: 6100-6108, 2018

Figure 5. The results of RT‑qPCR. (A) The fold change of DSPP expression, (B) BMP‑2 expression, (C) ALP expression, and (D) DMP‑1 expression. Gene expression was described as fold changes relative to the control group at the same time‑point. Data were presented as the mean ± standard deviation (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. the control group within each time period; #P<0.05, ##P<0.01 and ###P<0.001 vs. the corresponding 1 day group. DSPP, dentin sialophosphoprotein. BMP‑2, bone morphogenetic protein‑2; ALP, alkaline phosphatase; DMP‑1, dentin matrix protein 1.

3 (P<0.001) and HEMA+VEGF on day 1 and day 3 (P<0.001) were confirmed by the results of this study. The VEGF used (Fig. 5B). In addition, the expression of BMP‑2 gene upregu- in this study is in a homodimer form, which has 165 amino lated significantly highest in group HEMA+VEGF on day 1 acid residues per monomer. Pmer‑TCTP is composed of 168 and day 3 (P<0.001). BMP‑2 gene was down regulated in all amino acid residues and the molecular mass is not much groups on day 7. different from this VEGF monomer. The effective concentra- On day 1, the expression of ALP gene, in control group, tion of VEGF that can promote cell growth after 72 h and also HEMA+TCTP and TCTP was higher than other groups used to promote survival of HEMA‑treated HDPCs was 10 ng, (Fig. 5C). Moreover, the upregulation of ALP expression in which was the working concentration that induced stem cells TCTP and VEGF groups increased immediately on day 3, and to differentiate (3). The concentration that promoted growth of ALP expression in VEGF groups was significantly higher HDPCs of TCTP was lower (1 ng/ml) than VEGF (10 ng/ml), (P<0.01) compared to others which corresponded with the which may suggest that TCTP has a higher potential than result of ALP activity in Fig. 3. ALP gene expression down VEGF in promoting HDPCs growth. regulated in all groups on day 7. Both TCTP and VEGF can survive HEMA‑treated pulp DMP‑1 expression was reduced by time in all groups cells. But they did not have a synergistic effect, as pulp cells (Fig. 5D). DMP‑1 expression in the control group, treated with HEMA+TCTP+VEGF did not increase the HEMA+VEGF and VEGF, were higher than other groups on percentages of viable cells compared to HDPCs exposed to day 1. The expression of DMP‑1 gene upregulated significantly either HEMA+TCTP or HEMA+VEGF. This result may highest in VEGF group on day 3 (P<0.05). HDPCs treated with suggest that the mechanism whereby both VEGF and TCTP HEMA+VEGF (P<0.05), TCTP (P<0.05), and VEGF (P<0.01) survive HEMA‑treated pulp cells might relate to each other or were significantly higher compared to others on day 7. share the same carrier or pathway. However, further investigation is required. Discussion The mechanism of the added VEGF that can promote HDPCs proliferation and survive cells from HEMA expo- This study evaluated some biological properties of VEGF-A sure may involve signal transduction through receptor or VEGF, especially the anticytotoxicity, differentiation and tyrosine kinases, vascular endothelial growth factor mineralization in pulp cells compared to TCTP. Previous receptor 2 (VEGF‑R2), and lead to cell proliferation by either studies have reported that VEGF (3,5) and Pmer‑TCTP (15) activation of the mitogen‑activated protein kinases or MAPK can promote pulp cell proliferation and differentiation, which cascade via Raf stimulation or PLC (phospholipase C)‑γ. WONGKHUM et al: VEGF AND TCTP ON HEMA-TREATED PULP CELLS 6107

Activation of PI3K (phosphatidylinositol 3‑kinase) leads to Education Commission and a Postgraduate Grant, Prince of activation of PKB (protein kinase B) and the cell survival Songkla University. process (7,17). VEGF can also survive cells from hypoxic conditions via the PI3K/Akt/FoxO1 pathway (8). VEGF Availability of data and material induces expression of the anti‑apoptotic proteins Bcl‑2 in vascular endothelial cells (18) and in leukemic cells (19). The datasets generated and analyzed during the TCTP and its anti‑apoptotic effect against HEMA‑treated current study are not currently publicly available due to work in pulp cells has previously been reported (15). The mecha- progress on a suitable repository in Thailand, however they are nism whereby TCTP can survive HEMA‑treated pulp cells available from the corresponding author on reasonable request. remains unknown. It was shown that TCTP can inhibit apoptosis by maintaining mitochondria stability and inhib- Authors' contributions iting Bax function (20), as well as forming heterocomplexes with Bcl‑xL (21). However, TCTP also inhibits apoptosis by The current study was conceived by UK. CW performed the stabilizing anti‑apoptotic Bcl‑2 family proteins, MCL1 and experiments, analyzed and interpreted the data in conjunction by inhibiting p53‑dependent apoptosis by down regulating with WC and UK. CW and UK were the major contributors in this protein (14). writing the draft manuscript. All authors read and approved The results of ALP activity assay and cell mineralization the final manuscript. by the ARS assay confirmed the results of other studies, which showed that TCTP (16) and VEGF (2) can enhance differentia- Ethics approval and consent to participate tion and mineralization of pulp cells. This was also consistent with qRT‑PCR results that both TCTP and VEGF had up The study was approved by the Human Research Ethics regulated ALP expression on day 3 compared to the control. Committee, Faculty of Dentistry, Prince of Songkla University TCTP may promote cell mineralization longer than VEGF, (approval number EC5703‑09‑P‑LR) and by the Dental as shown in the results of calcium deposition after 21 days. Hospital, Faculty of Dentistry, Prince of Songkla University. DMP‑1 is a phosphoprotein that activates both bone and dentin This included the use of approved consent forms for the collec- mineralization by inducing the deposition of mineral particles tion of specimens. along the collagen fibrils (22). HDPCs had lower expression of DMP‑1 in longer culture time in all groups, but it was noticed Consent for publication that TCTP and VEGF groups still had higher expression than the control after culture for 3 and 7 days, respectively. Not applicable. This study revealed that HEMA at low concentration (4 mM) was cytotoxic to cells and caused down regulation Competing interests of DSPP, BMP‑2, ALP and DMP‑1 expression. TCTP and VEGF up regulated DSPP expression on day 1 and BMP‑2 The authors declare that they have no competing interests. expression on day 1 and day 3, which supports that both proteins can promote pulp cells differentiation, especially in References TCTP/VEGF supplemented in HEMA‑treated pulp cells. A 1. Virtej A, Løes S, Iden O, Bletsa A and Berggreen E: Vascular recent study revealed that VEGF may have synergist effect endothelial growth factors signalling in normal human dental to BMPs, including on cell survival and mineralization (23). pulp: A study of gene and protein expression. Eur J Oral Sci 121: Further investigation may be required concerning the potential 92‑100, 2013. 2. Zhang J, Liu X, Yu W, Zhang Y, Shi C, Ni S, Liu Q, Li X, Sun Y, connection of the two mechanisms protecting cell death and Zheng C and Sun H: Effects of human vascular endothelial differentiation, since both VEGF and TCTP had anticytotox- growth factor on reparative dentin formation. Mol Med Rep 13: icity and promoted cell differentiation. 705‑712, 2016. 3. Yadlapati M, Biguetti C, Cavalla F, Nieves F, Bessey C, Bohluli P, In conclusion both TCTP and VEGF promoted pulp cells Garlet GP, Letra A, Fakhouri WD and Silva RM: Characterization proliferation and survived HEMA‑treated cells, but TCTP of a vascular endothelial growth factor‑loaded bioresorbable was required a lower concentration for these functions. They delivery system for pulp regeneration. J Endod 43: 77‑83, 2017. 4. Li X, Ma C, Xie X, Sun H and Liu X: Pulp regeneration in a did not have a synergistic effect; however both of them can full‑length human tooth root using a hierarchical nanofibrous enhance cell differentiation and mineralization. microsphere system. Acta Biomater 35: 57‑67, 2016. 5. Matsushita K, Motani R, Sakuta T, Yamaguchi N, Koga T, Matsuo K, Nagaoka S, Abeyama K, Maruyama I and Torii M: Acknowledgements The role of vascular endothelial growth factor in human dental pulp cells: Induction of chemotaxis, proliferation and differen- The authors would like to thank Professor Peter Leggat (James tiation and activation of the AP‑1‑dependent signaling pathway. J Dental Res 79: 1596‑1603, 2000. Cook University, Australia) for his advice and proof reading of 6. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V the manuscript. and Ferrara N: Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'‑kinase/Akt signal transduction pathway. Requirement for Funding Flk‑1/KDR activation. J Biol Chem 273: 30336‑30343, 1998. 7. Latham AM, Odell AF, Mughal NA, Issitt T, Ulyatt C, Walker JH, This study was supported by the Higher Education Research Homer‑Vanniasinkam S and Ponnambalam S: A biphasic endothelial stress‑survival mechanism regulates the cellular response to Promotion and National Research University Project of vascular endothelial growth factor A. Exp Cell Res 318: 2297‑2311, Thailand (grant no. DEN580513S), Office of the Higher 2012. 6108 MOLECULAR MEDICINE REPORTS 17: 6100-6108, 2018

8. Zhong Q, Zhou Y, Ye W, Cai T, Zhang X and Deng DY: 17. Grando Mattuella L, Westphalen Bento L, de Figueiredo JA, Hypoxia‑inducible factor 1‑alpha‑AA‑modified bone marrow Nor JE, de Araujo FB and Fossati AC: Vascular endothe- stem cells protect PC12 cells from hypoxia‑induced apoptosis, lial growth factor and its relationship with the dental pulp. partially through VEGF/PI3K/Akt/FoxO1 pathway. Stem Cells J Endod 33: 524‑530, 2007. Dev 21: 2703‑2717, 2012. 18. Gerber HP, Dixit V and Ferrara N: Vascular endothelial growth 9. Mantellini MG, Botero T, Yaman P, Dennison JB, Hanks CT and factor induces expression of the antiapoptotic proteins Bcl‑2 and Nor JE: Adhesive resin and the hydrophilic monomer HEMA A1 in vascular endothelial cells. J Biol Chem 273: 13313‑13316, induce VEGF expression on dental pulp cells and macrophages. 1998. Dent Mater 22: 434‑440, 2006. 19. Dias S, Shmelkov SV, Lam G and Rafii S: VEGF(165) promotes 10. Ginzkey C, Zinnitsch S, Steussloff G, Koehler C, Hackenberg S, survival of leukemic cells by Hsp90‑mediated induction of Hagen R, Kleinsasser NH and Froelich K: Assessment of HEMA Bcl‑2 expression and apoptosis inhibition. Blood 99: 2532‑2540, and TEGDMA induced DNA damage by multiple genotoxicological 2002. endpoints in human lymphocytes. Dent Mater 31: 865‑876, 2015. 20. Susini L, Besse S, Duflaut D, Lespagnol A, Beekman C, Fiucci G, 11. Di Nisio C, D'Aurora M, di Giacomo V, Stuppia L, Cataldi A and Atkinson AR, Busso D, Poussin P, Marine JC, et al: TCTP Gatta V: Transcriptome modifications in human gingival fibroblasts protects from apoptotic cell death by antagonizing bax function. exposed to 2‑hydroxyethyl methacrylate. Gene 582: 38‑46, 2016. Cell Death Different 15: 1211‑1220, 2008. 12. Kwon JH, Park HC, Zhu T and Yang HC: Inhibition of odonto- 21. Thebault S, Agez M, Chi X, Stojko J, Cura V, Telerman SB, genic differentiation of human dental pulp cells by dental resin Maillet L, Gautier F, Billas‑Massobrio I, Birck C, et al: TCTP monomers. Biomater Res 19: 8, 2015. contains a BH3‑like domain, which instead of inhibiting, acti- 13. Amson R, Pece S, Marine JC, Di Fiore PP and Telerman A: vates Bcl‑xL. Sci Rep 6: 19725, 2016. TPT1/ TCTP‑regulated pathways in phenotypic reprogramming. 22. Suzuki S, Haruyama N, Nishimura F and Kulkarni AB: Dentin Trends Cell Biol 23: 37‑46, 2013. sialophosphoprotein and dentin matrix protein‑1: Two highly 14. Nagano‑Ito M and Ichikawa S: Biological effects of Mammalian phosphorylated proteins in mineralized tissues. Arch Oral translationally controlled tumor protein (TCTP) on cell death, Biol 57: 1165‑1175, 2012. proliferation and tumorigenesis. Biochem Res Int 2012: 204960, 23. Li B, Wang H, Qiu G, Su X and Wu Z: Synergistic effects of 2012. vascular endothelial growth factor on bone morphogenetic 15. Wanachottrakul N, Chotigeat W and Kedjarune‑Leggat U: proteins induced bone formation in vivo: Influencing factors Translationally controlled tumor protein against apoptosis from and future research directions. Biomed Res Int 2016: 2869572, 2‑hydroxy‑ethyl methacrylate in human dental pulp cells. J Mater 2016. Sci Mater Med 22: 1479‑1487, 2011. 16. Wanachottrakul N, Chotigeat W and Kedjarune‑Leggat U: Effect of novel chitosan‑fluoroaluminosilicate resin modified glass ionomer cement supplemented with translationally controlled tumor protein on pulp cells. J Mater Sci Mater Med 25: 1077‑1085, 2014.