BCL6 Antagonizes NOTCH2 to Maintain Survival of Human Follicular

Home , APOL6, ARID3B, BCL6, BLZF1, CBX3, HOXA13

Valls et al. Targeting BCL6 in FL

Supplemental Information for: BCL6 antagonizes NOTCH2 to maintain

survival of human follicular lymphoma cells

Ester Valls1#, Camille Lobry2,7#, Huimin Geng1,3,8, Ling Wang1, Mariano Cardenas1, Martín Rivas1, Leandro Cerchietti1, Philmo Oh2, Shao Ning Yang1, Erin Oswald1, Camille W. Graham4, Yanwen Jiang1, Katerina Hatzi1,9, Xabier Agirre1,10, Eric Perkey5,11, Zhuoning Li1, Wayne Tam6, Kamala Bhatt2, John P. Leonard1, Patrick A. Zweidler-McKay4, Ivan Maillard5, Olivier Elemento3, Weimin Ci1,12*, Iannis Aifantis2* and Ari Melnick1*

1Division of Hematology/Oncology, Department of Medicine; Weill Cornell Medical College, New York, NY, 10065, USA 2Department of Pathology and Perlmutter Cancer Center, New York University School of Medicine, New York, New York 10016, USA 3Institute for Computational Biomedicine, Weill Cornell Medical College, New York, NY, 10065, USA 4Division of Pediatrics, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA 5Life Sciences Institute, Division of Hematology-Oncology, Department of Internal Medicine; University of Michigan, Ann Arbor, MI, USA 6Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, 10065, USA 7Institut Gustave Roussy, INSERM U1170, Villejuif and Université Paris Sud, Orsay, France 8Department of laboratory Medicine, University of California San Francisco, San Francisco, CA, 94143, USA 9Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA 10Division of Hematology/Oncology, Centre for Applied Medical Research (CIMA), University of Navarra, Pamplona, Spain 11Graduate Program in Cellular and Molecular Biology 12Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, 100101, China

1 Valls et al. Targeting BCL6 in FL

Inventory of Supplemental Information Supplementary Figure S1. Related to Figure 1 Supplementary Figure S2. Related to Figure 2 Supplementary Figure S3. Related to Figure 3 Supplementary Figure S4. Related to Figure 3 Supplementary Figure S5. Related to Figure 4 Supplementary Figure S6. Related to Figure 5 Supplementary Figure S7. Related to Figure 5 Supplementary Figure S8. Related to Figure 6 Supplementary Table S1. Related to Figure 1 and Supplementary Figure S1 Supplementary Table S2. Related to Figure 1 Supplementary Table S3. Related to Figure 1 Supplementary Table S4. Related to Figure 1 Supplementary Table S5. Related to Figures 1, 2, 3, 4, 6, Supplementary Figures S1, S3, S4, S6 and S7. Supplementary Table S6. Related to Supplementary Figure S1 Supplementary Table S7. Related to Supplementary Figure S1 Supplementary Table S8. Related to Supplementary Figure S1. Supplementary Table S9. Related to Figure 1 and Supplementary Figure S1 Supplementary Table S10. Related to Figure 2

2 Valls et al. Targeting BCL6 in FL

Supplementary Figure S1 A GENE FUNCTIONS B tyrosine-specific YES1, HCK protein kinase tyrosine-specificTyrosine-specific protein protein kinase kinasecell cycle CDK8, EIF4G2, FH, HERC5, NOTCH2 cellCell cyclecycle apoptosis ID3, IFIH1, NOTCH2, SOCS2 cellular structure ARF6, ARHGAP15, BLZF1, DDX5, ERBB2IP, NOTCH2, apoptosisApoptosis morphogenesis SOCS2, UBB cellularCellular structure structure morphogenesis morphogenesis lymphoid organ AOF2, BAZ2A, CBX3, CCL3, CCR6, ECGF1, ID2, NOTCH2, lymphoidLymphoid organ organ development development development RPS19, SETMAR, SMARCE1, TSPYL1 transcription AOF2, ARID3B, BAZ2A, BLZF1, CBX3, CDK8, CTNND1, transcriptionTranscription HIPK1, ID2, ID3, MEIS2, MLLT3, NOTCH2, NR4A2, NR4A3, RPS14, SMARCE1, SUPT3H, THAP7, TRIM33, TXNIP, UBB, othersOther functions functions ZBTB3, ZNF133, ZNF140, ZNF184, ZNF304, ZNF331, ZNF335, ZNF432, ZNF473, ZNF524, ZNF573, ZNF74, ZNF79

C 3 1kb 2kb 2kb 2kb 1kb 1.30 0 3.5 1.17 0 2

1.20 0 2 1.36 0 BCL6 binding enrichment in FL FL in enrichment binding BCL6 NOTCH2 BCL6 TP53 HPRT1 COX6B

D GCB E BCL6 targets in DLBCL BCL6_targets_CHIPCHIP NEG BCL6 Proliferation_DLBCL IgG Cell_cycle_Whitfield Proliferation RBP-Jk Myc_ChIP_PET_Expr_Up Glutamine_Glucose_starve_both_down Serum_response_Fb_down MAML2 Glutamine_starve_down Tcell_cytokine_induced_proliferation Pan_B_U133plus NOTCH2 Resting_monocyte_GNF Myc_RNAi_OCILy3 0.0 0.5 1.0 1.5 2.0 IL6_Ly10_Up_group1 % enrichment vs. input Germinal_center_Bcell_DLBCL Myc_overexpression_1.5x_up F BCL6 expression BCL6

G GCB DLBCL (n=71)

low high high low -3 BCL6 expression relative expression

-2 -2 BCL6_Ave -1 -1 BCL6_1

BCL6_2

0 0 BCL6_3 +1 +1 NOTCH2_1

NOTCH2_2

+2 +2 NOTCH2_3 +3 +3

RBPJ_1 RBPJ_2 CDKN1A_1 MAML2_1 NOTCH1_1

MAML2_2 CCND1_1 NRARP_1

HEY1_1

NOTCH1_2 BCL6 targets in GCB-DLBCL expression arrays arrays expression GCB-DLBCL in targets BCL6 p<0.05 in GCB- DLBCL

3 Valls et al. Targeting BCL6 in FL

Supplementary Figure S1: BCL6 displays a specific genomic localization pattern in FL. (A) A pie chart representation of the involved gene functions of the 184 target genes. Gene function analysis was performed by David Gene Functional Annotation Tool [1, 2]. (B) NOTCH2 is highlighted on the classification of BCL6 bound-genes on involved gene functions from previous panel A. (C) BCL6 binding enrichment in FL. From left to right: NOTCH2, BCL6, TP53 (the last 2 as positive control targets), and, HPRT1 and COX6B as negative control targets. (D) QChIP was performed in primary GCB cells to validate BCL6 binding to direct target genes repressed in FL specimens. BCL6 enrichment is represented as % of input. Black bars represent BCL6 and gray bars IgG control. The graph shows the mean of three independent experiments and error bars are the standard error of the mean (SEM, for primers see Supplementary Table S5). (E) The relative enrichment of specific gene signatures on DLBCL BCL6 target gene sets summarized in a heat map. The statistical significance (BH adjusted p values) is provided in color key. (F) A heatmap representation of the relative transcript abundance of BCL6 target genes in GCB-DLBCLs that display inverse correlation (p<0.05, Spearman correlation) with BCL6 expression, from a publicly available dataset of 71 primary DLBCL expression profiles. The color key indicates the relative expression values. (G) Primary GCB-DLBCL gene expression profiles were sorted by BCL6 expression from low to high (top row of heatmap), and the relative expression values of a set of Notch complex and target genes displayed in subsequent rows, indicating their degree of inverse correlation (p values are all p<0.05, Spearman correlation, n=71) with BCL6. Details are provided in Supplementary Tables S5, S7 and S8. (See Figure 1).

4 Valls et al. Targeting BCL6 in FL

Supplementary Figure S2

A B Naïve B-cells GC B-cells 100100 100100 MW (KDa)

100 8080 8080 BCL6

100 6060 6060 ICN2 75 5.71 94.594.5 Max % of % of Max 4.354.35 95.795.2 50 4040 4040 Actin 37 Relative cellnumber Relative cell number number Relative cell 2020 2020 Naive GC B-cells

0 0 2 3 4 5 0 2 3 4 5 0 2 3 4 5 0102 310 410 5 10 0 10010 1010 1010 1010 0 10 10 PE-A10 10 FITC-A IgD CD38

Murine splenocytes 100100

8080

6060

% of Max 0.39 99.699.6 4040

Relative cell number 2020

0 0 2 3 4 5 0102 10 3 10 4 10 5 0 10 10APC-A 10 10 CD45R / B220

Supplementary Figure S2: Inverse correlation between BCL6 and NOTCH2 complex genes in primary GC B-cells. (A) Naïve B-cells (red) and GC B-cells (green) were purified as detailed in methods section. Purity was >95% and >94% purity for naïve and GC B-cells respectively based IgD and CD38 B-cell markers. The histogram in the left panel shows the relative cell number of IgD staining for Naïve B-cells; the right panel shows the same for CD38 positive GC B-cells. (B) Immunoblots were conducted using BCL6 and ICN2 antibodies in lysates from purified human Naïve B-cells and GC B- cells. Actin immunoblot is included as loading control. (D) Murine splenocytes (blue) were isolated as detailed in methods section. Purity was >95% in all experiments as verified with staining for CD45R/B220+ B-cell marker. Three independent experiments and representative cell purification is shown. (See Figure 2).

5 Valls et al. Targeting BCL6 in FL

Supplementary Figure S3 PNA A B μ μ Genotype Day Tissue Experiment 40 m 20 m

WT ICN2 -1 Serum WT

WT ICN2 0

NP65-CGG/SRBC

WT ICN2 1 ICN2 Tamoxifen

BCL6/ B220 C 40 μm 20 μm WT ICN2 7 Serum WT WT

Serum WT ICN2 14 FACS Spleen ICN2 IHC

D E 20 PNA 20 BCL6/ B220 p= 0.0001 p= 0.0001

15 15

10 10

5 5

Number of GC/ Spleen 0 Number of GC/ Spleen 0 WT ICN2 WT ICN2 n=5 n=8 n=5 n=8 H F G P < 0.0001 P = 0.0002 PNA BCL6/ B220 300 p < 0.0001 p = 0.0002 )

2 WT 1000 1000 m 750 μ ICN2

) 750 ) 2 2

m m 500 200

μ 500 μ 400 400 300 300

GC area( 200 GC area( 200 100 100 100 GC area ( Average 0 0 WT ICN2 WT ICN2 0 PNA BCL6/ B220

6 Valls et al. Targeting BCL6 in FL

Supplementary Figure S3: GC reaction is impaired in Notch2 knock-in mice. (A) Schematic representation of GC induction experiments in ICN2 inducible mice. The first row reflects the alleles present in the experiment that include ROSA26 WT (in black) and ROSA26-ICN2-IRES-YFP or ROSA26-ICN2-YFP/CγCre (in green); the second row is the day; the third is the tissue or serum

harvest and the fourth column is the assay conducted. GC immunization used was NP65-CGG for mouse strain engineered to contain an ICN2-IRES-YFP (ICN2) cassette with a loxP flanked NEO-ATG knocked in to the ROSA26 locus, crossed with a tamoxifen inducible ROSA26-Cre-ERT2 strain or in ROSA26-WT (WT) – Cre-ER T2, or Sheep Red Blood Cells (SRBC) for CγCre-WT or -ICN2 mice. (B) Representative images of spleen sections from CγCre-WT (control) and -ICN2 knock-in mice stained for GC markers PNA 14 days after immunization with SRBC. The black squares on left column (4X) highlight GCs, which are shown at 20X amplification in the right column. Scale bars are 100 μm (4X) and 20 μm (20X). (C) Same experiment performed in panel B for BCL6+/B220+ staining. (D) The number of GCs per spleen (Y-axis) from immunohistochemistry shown in panel B. PNA+ clusters are shown. The range bars represent the mean values and SEM and the p values are shown on top. (E) Same experiment performed in panel D for BCL6+/B220+ staining. (F) The surface area occupied by GCs in the spleens of immunized and induced ICN2 and control mice is shown for PNA staining, and is represented by their area in μm2 (Y-axis). The average of the means for each group is shown. Each column corresponds to an individual mouse; each point is an individual GC; p values are shown on top. SEM and p values are shown. (G) Same experiment performed in panel F for BCL6+/B220+ staining. (H) Average of GC area (μm2) of WT (black) and ICN2 (green) mice from IHC of paraffin-embedded spleen slides stained with PNA+ and BCL6+/B220+ antibodies. The mean values are 301.7 +/-35.49 vs. 68.14 +/-17.39 μm2 for PNA+ GC, and 226.1 +/-24.55 vs. 66.76 +/-16.97 μm2. Data shown for immunized CγCre-WT (n=5) and CγCre-ICN2 (n=8) mice. The statistical significance of this difference is shown based on unpaired two-tailed t test (P< 0.0001 and P= 0.0002 respectively). (See Figure 3, for primers see Supplementary Table S5).

7 Valls et al. Targeting BCL6 in FL

Supplementary Figure S4 A WT ICN2 B 5 p < 0.0001 ) + 1055 WT 55ICN2 10 10 4

3.17GC 0.49GC 1044 44 10 1.63.17%% 10 0.49% / CD95 3

0.2 % +

9 4 3 3 10103 103 2

1022 2 1 10 102 % GC (GL7 GL 7 GL

101011 10 102 2 10 1033 10104 101055 1011 10 1022 103 1044 10105 5 0 WT ICN2 n=5 n=8 C CD95 D APOPTOSIS PROLIFERATION rlfr,on' prolifera,

p < 0.0001 p < 0.0013 50 p < 0.0001 50 p < 0.0004 WT apoptosis' 20 20 40 40 ICN2 15 15 30 30 10 10 20 20 5 5 10 10 0

# TUNEL Cluster Cells Cells Cluster TUNEL # 0 # PCNA Cluster Cells Cluster PCNA # 0 # KI-67 Cluster Cells Cells Cluster # KI-67 0 Cells Cluster # Caspase WT ICN2 WT ICN2 WT ICN2 WT ICN2

105 FoB 105 FoB 105 FoB 105 FoB E 66% 70.7% 73.3% 70.4% 104 104 104 104 WT 103 103 103 103 102 MZB 102 MZB 102 MZB 102 MZB 10.1% 7.79% 10.9% 10.5% 101 101 101 101 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105

FoB FoB FoB FoB 105 105 105 105 63.8% 67% 66.1% 64.2% ICN2 104 104 104 104 103 103 103 103 MZB MZB MZB MZB 102 102 102 102 17.5% 11.6% 16.1% 17% CD23 101 101 101 101 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105

CD21

WT ICN2 ICN2*

5 5 105 10 10 Lymphoid lineage 4 F 104 104 10 3 103 103 10 2 102 102 10

CD8 CD8 1 101 101 10 0 1022 1033 1044 1055 0 102 103 104 105 0 102 103 104 105 CD4

5 105 105 10 Myeloid

4 lineage 104 104 10 3 103 103 10 2 102 102 10

CD11b CD11b 1 101 101 10 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 Gr-1 * Gated on YFP

8 Valls et al. Targeting BCL6 in FL

Supplementary Figure S4: GC reaction is impaired in Notch2 knock-in mice. (A) Flow-cytometry analysis of B220+GL7+CD95+ labeled splenic GC B-cell populations. Cells were gated for B220+, GL7 is on the Y-axis and CD95(Fas) is on the X-axis. The percentage of double positive cells corresponds to GC B-cells (black box). (B) The percentage of B220+ gated GL7+/CD95+ GC B-cells among total splenocytes is shown from the spleens of immunized WT (n=5) and ICN2 induced (n=8) mice. In the presence of ICN2, the abundance of B220+GL7+CD95+ GC B-cells was reduced three-fold as compared to WT animals (1.7% vs. 0.6% mean GC B-cells vs. total splenocytes, p=0.0003 unpaired two-tailed t test. (C) Number of proliferative clusters on GC of WT (black) and ICN2 (green) mice from IHC of paraffin-embedded spleen slides stained with PNA+ and KI-67+ antibodies. The mean values are 14.17 +/-0.54 vs. 7 +/-0.8 for PCNA+cells and 14.17.1 +/-0.47 vs. 6.5 +/-1.53 for KI-67+ cells. The statistical significance of this difference is shown based on unpaired two-tailed t test (P=0.0001 and P=0.0013 respectively). Data shown for immunized WT (n=6) and ICN2 (n=8) mice. (D) Number of apoptotic clusters on GC of WT (black) and ICN2 (green) mice from IHC of paraffin-embedded spleen slides stained with TUNEL+, CASPASE3+. The mean values are 36 +/-2.67 vs. 11.43 +/- 3.23 for TUNEL+ cells and 29.17 +/- 3.48 vs 8.28 +/- 2.44 for Caspase 3+ cells; The statistical significance of this difference is shown based on unpaired two-tailed t test (P= 0.0001 and P= 0.0004 respectively). Data shown for immunized WT (n=6) and ICN2 (n=8) mice. (E) Flow-cytometry analysis of MZB and FoB cell populations and in CγCre-WT (top), CγCre-INC2 +/- (bottom) mice splenocytes. Dot plots are shown for B220+ gated cells, CD23 (Y axis) versus CD21 (X axis). (F) Flow-cytometry analysis of T lymphoid and myeloid lineages in UBCCre (left), UBCCre INC2 +/- (middle) and UBCCre ICN2+/- gated on YFP (right) mice splenocytes. Dot plots are shown for B220+ gated cells, CD8 (Y axis) versus CD4 (X axis) for T lymphoid lineage (upper panels), and CD11b (Y axis) versus Gr-1 (X axis) for myeloid lineage (bottom panels) (see Figure 3 and Supplementary Table S5).

9 Valls et al. Targeting BCL6 in FL

Supplementary Figure S5 Reporter'assay'BCL6/BTB'with'RI/BPI'in'lymphoma'cells' A B 120 Reporter assay BCL6-BTB with RI-BPI in lymphoma cell lines 100

80 *

* siBCL6 siBCL6 siBCL6 siBCL6 siBCL6 siC siC siC siC 60 * * 40 BCL6 %b Repression to PBS to Repression %b 20

P < 0.0001

% Repression to PBS to PBS % Repression 0 Actin PBS RI-BPI PBS RI-BPI PBS RI-BPI PBS RI-BPI OCI-Ly1 SU-DHL-4 Sc-1 DoHH2 10µM 10µM 10µM 10µM OCI-Ly1 SUDHL4 DOHH2 SC-1

40 siBCL6-OCI-Ly1 30 siBCL6-SU-DHL-4 20 6 5 4 3 2

Fold change to siC siC to change Fold 1 siC (Normalized to HPRT) to HPRT) (Normalized 0 NOTCH2 MAML1 MAML2 RBPJ-k

Supplementary Figure S5: BCL6 represses NOTCH2 complex genes and Notch activity. (A) Western Blot for BCL6 after BCL6 siRNA in the 4 cell lines mentioned above. Representation of 3 independent experiments. (B) Luminiscence assay for BPI using BCL6-BTB reporter in OCI-Ly1, SU- DHL-4, Sc-1 and DoHH2 cell lines. Star means p-value < 0.0001. (C) The relative transcript abundance of NOTCH2, MAML1, MAML2 and RBPJ-k was examined by QPCR in GCB-DLBCL cell lines OCI-Ly1 (black bars) and SU-DHL-4 (gray bars) 72 h after BCL6 siRNA depletion vs. control siRNA. Values were normalized to HPRT and fold change (Y-axis) is represented over a scrambled siRNA control. (see Figure 4 and Supplementary Table S5).

10 Valls et al. Targeting BCL6 in FL

Supplementary Figure S6

SU-DHL-4 A Control DoHH2 BPI Control Sc-1 BPI Control BPI 5 2% 4.76% 3.58% 5 13.4% 31% 10 4.65% 20.7% 105 1.54% 3.56% 105 2.68% 24.3% 105 2.02% 10 105 104 104 4 104 104 104

D 103 3 3 3 3 10 103 10 10 A 10 A 2 7 10 102 102 102 102 102 0

7AAD 0 0 1.08% 14.7% 0 94.1% 0.8% 63.7% 9.31% 0 93.1% 1.3% 34.3% 21.3% 92.2% 0 60% 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105

B 150 Annexin V 2 C 150 48 h 72 h

DoHH2 NOTCH2 125 * * BCL6 125 ns ns 1.5 1.5 100100 siC -1 -1 siC 1 1 siC 7575 -1.5 -1.5 -1.5 -1.5 5050 -2 -2 -2 -2 2525 2.5 -2.5 -2.5 -2.5 00 48h 72h -3 -3 -3 150 -3 2 2 150 * * 125125 ns ns 1.5 1.5 Sc-1 -1 -1 100100 siC siC 1 1 siC 7575 -1.5 -1.5 -1.5 -1.5 5050

-2 -2 -2 -2 25 2 25 -2.5 2 00

-2.5 SU-DHL-4 1.5 48h 72h 125125 -1 -1 1 1 ns ** * * siC siC 100 siC

% Cell viability Cell viability % 100 -1.5 -1.5 -2 -2 7575 -3 -3 -2 -2 5050 -4 -4 25 -2.5 25 -2.5 3 0 0 48H 72H

-1 -1 2 1.5 OCI-Ly1 siC 125 125 * * 1 * * Fold change to siC (Normalized to HPRT) Fold change to siC (Normalized HPRT) -1.5 -1.5 -1 siC 100100 siC

-1.5 -2 -2 7575 -2 -2 5050 -2.5 -2.5 -3 2525 -2.5 -3 -3 00 1.5 E

D OCI-Ly8 1.5 125125 1.5 siC 100100 1 1 siC 1 1 siC 7575 -2 -1.5 -3 -1.5 -1.5 5050 -4 -2 -2.5 viability % Cell 2525 -5 -2 -2 0 0 siNOTCH2-1 siNOTCH2-1 siNOTCH2-1 siNOTCH2-1 siNOTCH2-1 Fold change to siC change to Fold siNOTCH2-2 siNOTCH2-2 siNOTCH2-2 siNOTCH2-2 siNOTCH2-2 (Normalized to HPRT) to HPRT) (Normalized siBCL6-1 siBCL6-2 siBCL6-1 siBCL6-2 siBCL6-1* siBCL6-2+siNOTCH2-1 siBCL6-2+siNOTCH2-1 siBCL6-2+siNOTCH2-1 siBCL6-2+siNOTCH2-1 siBCL6-2+siNOTCH2-1 siBCL6-2+siNOTCH2-2 siBCL6-2+siNOTCH2-2 siBCL6-2+siNOTCH2-2 siBCL6-2+siNOTCH2-2 siBCL6-2+siNOTCH2-2

11 Valls et al. Targeting BCL6 in FL

Supplementary Figure S6: FL cells are dependent on BCL6 in a NOTCH2-dependent manner. (A) Dot plot measuring 7AAD (Y-axis) and AnnexinV (X axis) to assess apoptosis in FL (DoHH2 and Sc-1) and DLBCL (SU-DHL-4) cell lines treated with Control Peptide (left) or BPI (right) at 48h. (B) DoHH2, Sc-1, SU-DHL-4 and OCI-Ly1 cells (top to bottom) were transfected with siControl (siC), siNOTCH2, siBCL6 or both and mRNA was extracted. BCL6 and NOTCH2 expression levels were normalized to HPRT and fold change to siC is represented in the graph. The plots are the mean of 4 experiments and the error bars are the SEM. (C) Viability was determined in DoHH2, Sc-1, SU-DHL-4 and OCI-Ly1 cell lines (top to bottom) after transduction with the indicated siRNA sequences. Cell proliferation index is shown relative to 100% value of siControl (dotted line). Average of 3 experiments and SEM are represented. (D) QPCR was used to determine the abundance of BCL6 (upper panel) and NOTCH2 (lower panel) mRNAs on OCI-Ly8 cells 48 hours after siRNA transfections. The results were normalized to HPRT and represented as fold change compared to siC. The plots are the mean of 3 experiments and the error bars are the SEM. (E) OCI-Ly8 cells were transfected with siControl (siC), two siRNA sequences targeting NOTCH2 (siNOTCH2-1, siNOTCH2-2), and two siBCL6 (siBCL6-1, left panel and siBCL6-2, right panel) or combinations of both siRNA. Results are shown at 72h. Cell proliferation was measured as detailed before. (F) A competitive proliferation assay was performed in DoHH2 and Sc-1 cells transduced with ICN2-GFP or GFP expressing retrovirus. GFP-positive percentages (Y axis) were measured by flow-cytometry every other day (X axis). Triplicate experiments were normalized to day 2 values. Averages +/- SD are shown. Statistical significance is shown (p value one-tailed t test). * p<0.05; **p<0.005 (see also Figure 5 and Supplementary Table S9, for primers see Supplementary Table S5).

12 Valls et al. Targeting BCL6 in FL

Supplementary Figure S7 A B live/CD19+/CD93- 100 p<0.0001 7 ns Control anti-Notch1 anti-Notch2 95 2.0×10 105 105 105 90 FoB 1.5×107 104 104 104 85 7 103 103 103 80 1.0×10 75 2 2 2 10 10 10 % FoB cells 6

#FoB / spleen 5.0×10 83 ± 1 85 ± 1 4.6 ± 1 60 CD23 CD23 0 MZB 0 0 40 20 2 3 4 5 2 3 4 5 0.0 0 10 10 10 10 0 10 10 10 10 0 102 103 104 105 0 C aN1 aN2 C aN1 aN2 CD21/35 8 p<0.0001 1.5×106 p<0.0001 6 1.0×106 4 5.0×105 2 % MZBs cells % MZBs #MZB / spleen

0 0.0 C aN1 aN2 C aN1 aN2

C D p<0.0001 live/CD8-/lin- Control anti-Notch1 anti-Notch2 5 105 10 5 30000 105 0.21 ± 0.02 0.90± 0.11 0.33 ± 0.04 0.25± 0.04 10 0.26± 0.03 0.99± 0.08 4 4 104 10 10 104 103 20000 3 103 102 10 103 0 ETP/ DN1 DN2 2 102 10 2 CD44 10 2 3 4 5 c-kit 10000 0 10 10 10 10 0 0

0 Ki+ thymocytes c-kit 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 CD25 MFI of Lin-/c- 0 CD25 C aN1 aN2

5 105 10 105

4 104 10 104 p<0.0001

3 103 30000 10 33 ± 4 66± 4 73 ± 4 27± 4 103 28± 1 70± 1

2 102 10 102

c-kit c-kit 20000 DN4 DN3 0 0 0 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 10000 CD25 Kit- thymocytes Kit- thymocytes

CD25 MFI of Lin-/c- 0 C aN1 aN2

13 Valls et al. Targeting BCL6 in FL

Supplementary Figure S7: Evaluation of the in vivo potency and specificity of anti-Notch2 blockade. (A) Contour plot measuring CD23 (Y-axis) and CD21/35 (X axis) to assess Follicular B cells (FoB) and pre-Marginal Zone B cells and Marginal Zone B cells (MZB) in CD19+/CD93- splenocytes treated with Control IgG1 isotype (left, n=5), anti-Notch1 (middle, n=5) or anti-Notch2 (right, n=5). (B) Analysis of data from mice represented in panel A is shown. Top panels show the percentage of FoBs (left) and number of FoBs per spleen (right) (Y-axis). Bottom panels show the same for MZB cells. The range bars represent the mean values and SEM of 5 mice (Control), 4 mice (anti-Notch1) and 5 mice (anti-Notch2) respectively, and the p values are shown on top. (C) CD8-/lin- thymocytes were stained with CD44 (Y-axis) and c-Kit (X axis) as shown in contour plots. CD44+/c-Kit+ double positive gated population was stained with CD25 to assess ETP/DN1 (left) or DN2 (right) treated with Control IgG1 isotype (left, n=5), anti-Notch1 (middle, n=4) or anti-Notch2 (right, n=5) (top panels). CD44-/c-Kit- ungated population was stained with CD25 to assess DN4 (left) or DN3 (right) and treated with Control IgG1 isotype (left), anti-Notch1 (middle) or anti-Notch2 (right) as shown in bottom panels. (D) Analysis of data from mice represented in panel C is shown. Top panel shows CD25 MFI of Lin-/c-Kit+ thymocytes. Bottom panel shows the same for CD25 MFI of Lin-/c-Kit- thymocytes. The range bars represent the mean values and SEM of mice and the p values are shown on top. Since CD25 is directly regulated by Notch1-mediated signals in early thymocytes our data are consistent with specific in vivo Notch2 blockade by anti-NRR2 antibodies without crossreactive Notch1 inhibition. (See also Figure 5).

14 Valls et al. Targeting BCL6 in FL

Supplementary Figure S8

A 13 12 3.03 2.5 2.02 1.5 1.01 Control Control 0.5 (Fold change to Control ) to Control change (Fold 0.00 Patient 16 mRNA abundance abundance 16 mRNA Patient APOL6 ATF5 CCR6 HOXA13 NOTCH2 STAT3 HPRT

Pt. 16 mRNA Pt. 16 mRNA abundance RI-BPI control) to (Fold APOL6 ATF5 CCR6 HOXA13 NOTCH2 STAT3 HPRT

C B Vehicle DoHH2 mice RI-BPI Vehicle Sc-1 mice RI-BPI 50 μm 50 μm TUNEL TUNEL Caspase 3 Caspase

Vehicle

RI-BPI

DoHH2 Sc-1 DoHH2 Sc-1

15 Valls et al. Targeting BCL6 in FL

Supplementary Figure S8: RI-BPI suppresses FL tumors in vivo and ex vivo. (A) Single cell suspensions were generated from a BCL6 positive FL biopsy specimen (patient 16). The cells were cultured and treated with 10 μM RI-BPI for 48h. QPCR was performed to determine the abundance of FL BCL6 target gene transcripts APOL6, ATF5, CCR6, HOXA13, NOTCH2, as well as for the positive control BCL6 target gene STAT3, and HPRT as housekeeping control. Results are expressed as fold induction compared to control (vehicle). (B) Representative immunohistochemistry images of 4 independent DoHH2 tumors after treatment with control or RI-BPI assayed for apoptosis by TUNEL and Caspase 3 stainings (top and bottom panels respectively). Red bar represents 50 μm. (C) Representative immunohistochemistry images of 4 independent Sc-1 tumors after treatment with control or RI-BPI assayed for apoptosis by TUNEL and Caspase 3 stainings (top and bottom panels respectively). Red bar represents 50 μm. (D) Quantification of positive cells relative to total cells in field of all tumors for TUNEL (left graph) and Caspase 3 (right graph). SEM and p-values were calculated for every treatment and cell line. (see Figure 6 and Supplementary Table S5 for primers).

16 Valls et al. Targeting BCL6 in FL

Supplementary Table S1

Supplementary Table S1: BCL6 target genes on FL patient samples ChIp-onChIP. From left to right: 1) SEQ_ID: Sequence ID name on ChIp-on-ChIP microarray; 2) Annotation: annotation number form NCBI reference sequence; 3) Gene: Gene name. See also Figure 1A and Supplementary Figure S1A.

17 Valls et al. Targeting BCL6 in FL

Supplementary Table S2

Supplementary Table S2: Gene sets that are enriched among BCL6 target genes in FL samples. The signatures presented in the table are those that have enrichment of multi-test adjusted p value<0.01 using Benjamini and Hochberg (BH) method for targets in FL list. From left to right: 1) Signature names; 2) Signature names in the original database where they were obtained[3]; 3) –logBH (multi-test adjusted p value): the statistical values (see also Figure 1C).

18 Valls et al. Targeting BCL6 in FL

Supplementary Table S3

Supplementary Table S3: Excel file containing the statistical analysis of the 184 FL targets with significant inverse correlation with BCL6. From left to right: 1) BCL6 target genes in FL: gene name; 2) Spearman p value: cut-off was set as p<0.05; 3) Rho correlation values (see Figure 1B).

19 Valls et al. Targeting BCL6 in FL

Supplementary Table S4

Supplementary Table S4: p value of NOTCH2 target genes and members of its transcriptional complex that are inversely correlated to BCL6 in primary FL specimens. Statistical significance was assessed by Spearman correlation test. Cut-off was set as p<0.05. rho value is shown in third column (see Figure 1C).

20 Valls et al. Targeting BCL6 in FL

Supplementary Table S5

RT-PCR primers AICDA-F GGAAGGGCTGCATGAAAAT AICDA-R AAAGTCCCAAAGTACGAAATGC APOL6-F ACACAGATTTGCTGCCACAG APOL6-R GCTCCACGTCTTCACACAGA ATF5-F CTATGAGGTCCTTGGGGGAG ATF5-R TCGCTCAGTCATCCAGTCAG BCL6-F GACTCTGAAGAGCCACCTG BCL6-R CTGGCTTTTGTGACGGAAAT CCND1-F CTCACACGCTTCCTCTCCA CCND1-R TCCTCCTCTTCCTCCTCCTC FH-F TTGGTGACAGCTCTCAATCCT FH-R TCGTCAAACTGCTCTGCTGT GAPDH-F CGACCACTTTGTCAAGCTCA GAPDH-R CCCTGTTGCTGTAGCCAAAT HES1-F CGGACATTCTGGAAATGACA HES1-R GTCACCTCGTTCATGCACTC HES6-F AAGCCCCTGGTGGAGAAG HES6-R ACCGTCAGCTCCAGCACTT HOXA13-F CTGGAACGGCCAAATGTACT HOXA13-R GCTCTTTCTCCCCCTCCTA HPRT-F AAAGGACCCCACGAAGTGTT HPRT-R TCAAGGGCATATCCTACAACAA MAML1-F CGAGCAGAACTCCCTGTTTC MAML1-R CTGGGTCCCAACACTGGTAG MAML2-F GCAATTGATGGGAAAGAAGC MAML2-R GCCTTGACAAATGTCGGTTT NOTCH2-F TTGTTGTTGAAAAATGGGGC NOTCH2-R CTCGATTGGCAAAATGGTCT RBPJ-F TCACTCCTGTGCCTGTGGTA RBPJ-R GCTTCTACATCCCCAAACCA RUNX1-F TCTGCAGAACTTTCCAGTCG RUNX1-R GTCGGGGAGTAGGTGAAGG mBcl6-F AGTCCCCACAGCATACAGAGAT mBcl6-R CCCATTCTCACAGCTAGAATCC mHprt-F CCAGACAAGTTTGTTGTTGGA mHprt-R GGCTTTGTATTTGGCTTTTCC mMaml1-F ACCCAACACAAAGCACCTTC mMaml1-R GAGGACAGCTGGAGTTGGAC mMaml2-F AGCCAGCTGCTCAGTATTCG mNotch2-F GAATGGGGCCAACAGAGATA mNotch2-R GGTCCATGTGGTCAGTGATG mRbpj-F TGGTTTGGGGATGTAGAAGC mRbpj-R CGTCATTTCGGACCAAAGTC qCHIP primers APOL6-F AAAGTGACAGCTGGAGCCC APOL6-R GGCCTTTGAACAGGAATTGA ATF5-F TCGGCTGAAGAAAGAAGGTG ATF5-R TTCTCACTACAGTGTCGCCG BCL6-F GCAGTGGTAAAGTCCGAAGC BCL6-R AGCAACAGCAATAATCACCTG

21 Valls et al. Targeting BCL6 in FL

FH-F ACCGGCTCCAAGAATAACCT FH-R GTGTAAGGCCTTCGGATTCA GAPDH-F ACGTAGCTCAGGCCTCAAGA GAPDH-R GCTGCGGGCTCAATTTATAG HES1-F GGCGGCAATAAAACATCCT HES1-R CCGAGCTGCAGTTTGACAT HOXA13-F AAACACCCTGCCACTGTTTC HOXA13-R TTCTGCAGTGAGACCACAGG MAML1-F CTGCCAGATTCCCCTTTTCT MAML1-R AAGAGGCGGCTATTGGTTTC MAML2-F CCCAGTGGCTGAAGAGGTAA MAML2-R CCGCTTAACCGAGTCTGATG NOTCH2-F CTGAGCCTTGAAGCAGGAG NOTCH2-R GCCTGGGCAGATCCACAT P86478-F CTCCAGCAGTCGGCTTTC P86478-R GTGAACCTGTGGACACCTCC RBPJ-F GGAGCTGGTCTAGGCAAACA RBPJ-R CCTTCCACTACTCGGCTCAG Genotyping primers ROSA26-ICN2 1338_6: CGAGACTCTAGCAATCACAAGC 1338_7: CTGCCTCCTCGGAGAGAAGC ROSA26-CreER ROSA26_F: AAAGTCGCTCTGAGTTGTTATCAG CRE_R: AGGCAAATTTTGGTGTACGG ROSA26wt_R: GGAGCGGGAGAAATGGATATG UBC-CreER UBCCRE_F: TGAAGCTCCGGTTTTGAACT CRE_R: AGGCAAATTTTGGTGTACGG

Supplementary Table S5: Primers used for RT-PCR (see Figures 2A, 2D, 2E, 4A, 4B, 6B, 6E, Supplementary S5C, S6B, S6D and S8A). Primers used for QChIP (see Figures 1F and Supplementary S1D). Primers used to genotype ROSA26-ICN2; ROSA26-CreER and UBC-CreER mice (see Figures 3, Supplementary Figures S3 and S4).

22 Valls et al. Targeting BCL6 in FL

Supplementary Table S6

Supplementary Table S6: DLBCL p-values on DLBCL signatures. (See Supplementary Figure S1E).

23 Valls et al. Targeting BCL6 in FL

Supplementary Table S7

Supplementary Table S7: BCL6 target genes in GCB-DLBCL. Spearman and rho. (See Supplementary Figure S1F).

24 Valls et al. Targeting BCL6 in FL

Supplementary Table S8

Supplementary Table S8: DLBCL p-values and rho values on GCB-DLBCL probesets for Notch2 pathway genes. (See Supplementary Figure S1G).

25 Valls et al. Targeting BCL6 in FL

Supplementary Table S9

Supplementary Table S9: Overlap BCL6 target genes on FL and DLBCL datasets. (See Figure 1B for full FL datasets and Supplementary Figure S1F for DLBCL datasets).

26 Valls et al. Targeting BCL6 in FL

Supplementary Table S10

Supplementary Table S10: p value of NOTCH2 target genes and members of its transcriptional complex that are inversely correlated to BCL6 in primary GC B-cells. Statistical significance was assessed by Spearman correlation test. Cut-off was set as p<0.1. rho value is shown in third column. GC B-cell array accession number: GSE2350[4] (see Figure 2B).

27 Valls et al. Targeting BCL6 in FL

28 Valls et al. Targeting BCL6 in FL

Supplemental Experimental Procedures

Quantitative RT-PCR. RNA was prepared using Trizol extraction (Invitrogen, Carlsbad, CA). cDNA was prepared using high-capacity cDNA reverse transcription kit (Applied Biosystems). Detection was done using Fast SyberGreen on 7900HT Fast Real-Time PCR System with 384-Well Block Module thermal cycler both from Applied Biosystems (Foster city, CA) and using the following conditions: initial step of 20 seconds (sec) at 95C followed by 40 cycles of 1 sec at 95C and 20 sec at 60C. In siRNA knockdown, RI-BPI and naïve+cytokine experiments, gene target expression levels were normalized to HPRT, values are represented as fold change relative to control using the ΔΔCt method. For the experiments comparing two different cell types (see Fig. 2A) and human FL tumors in mice xenograft (see Fig. 6E) values are expressed as efficiency-corrected ΔCt method as described previously [5]. All results are shown as the average of three independent experiments and error bars are standard error of the mean (SEM). qRT-PCR primers for specific genes were purchased from Fisher Scientific (Pittsburgh, PA) are listed in Supplementary Table S5.

Plasmids and reporter assays. The pHesAB plasmid was used for reporter assays. This is a pGL2- based reporter construct with endogenous Hes1 promoter containing two binding sites for RPB-Jk and two binding sites for Hes proteins and drives expression of luciferase. pGL2-basic construct was used as control. DoHH2 and Sc-1 cell lines were co-transfected with 500 ng of pHESAB along with 20 pmol of siRNA for BCL6 or scrambled sequence used as a control (Invitrogen, Carlsbad, CA). pRL-TK Renilla was used as internal control (Promega, Madison, WI) at a 10:1 ratio. Cells were transfected using the Amaxa 96-well plate electroporation method (Lonza, Walkerrsville, MD). 24 hours post- transfection cells were harvested and divided to prepare protein extracts or to assess for abundance of renilla-luciferase using the Dual-Luciferase Reporter Assay Kit (Promega, Madison, WI) and a Synergy4 plate reader (BioTek Instruments, Winooski, VT). The percentage of luciferase activity is shown normalized to renilla values. p21 and CSFR plasmids were used for RUNX1-BCL6 reporter assays. 100 ng of either plasmid were co-transfected in 293T cells with 50 ng of RUNX1 and/or 50 ng of BCL6. Luciferase activity was measured as above, normalized to tubulin expression by immunoblot and quantified by densitometry using ImageJ software (NIH). Values are reported as fold change to reporter basal activity.

Caspase activity. The number of apoptotic cells was determined by measuring the activity of the caspases 7 and 3 using a luminogenic substrate (Caspase-Glo 3/7, Promega) following the manufacturer’s instructions. Cells were exposed for 24 h to vehicle or RI-BPI 10 μM. Caspase activity

29 Valls et al. Targeting BCL6 in FL

was normalized to cell number by multiplexing with CellTiter blue. Results are expressed in percentage of RLU in the treated vs. control cells. Experiment was carried out in biological duplicates with experimental triplicates. Results are expressed as mean with SEM. In addition, apoptotic death was morphologically confirmed by microscopy after staining with ethidium bromide and acridine orange (not shown).

TUNEL assay. DNA fragmentation coupled to the apoptotic response was detected in morphologically identifiable nuclei and apoptotic bodies present in formalin-fixed paraffin-embedded tumors by the TUNEL assay (ApopTag, Chemicon, Temecula, CA) following the manufacturer’s instructions. Tissue slides were pre-treated with 0.5% trypsin for 15 minutes (Zymed, San Francisco, CA), to improve the exposure of DNA. Results are expressed as mean and SEM percent of positive nuclei over total nuclei.

Chromatin immunoprecipitation (QChIP and ChIP-on-Chip). ChIPs were performed as described in Ci et. al. [6] with modifications. ChIP in cell lines was performed using 2x107 cells. Protein-DNA double cross-link was performed using 2 mM EGS in PBS for 20 minutes at room temperature (RT), (Cat# 21565) Pierce (Rockfold, IL) followed by 1% formaldehyde another 10 minutes at RT in rotation (F1635) Sigma Aldrich (St. Louis, MO), cell lysates were sonicated for 30 minutes at an amplitude of 45%, Branson Digital Sonifier (Danbury, CT). Fragment size achieved was between 500-1000bp and was assessed in an agarose gel. Chromatin immunoprecitiation was performed O/N incubating cell lysates with 10 μg BCL6 (clone N3) or Actin antibodies (see Transfections section for details), an aliquot for input was saved before immunoprecipitation. DNA fragments enriched by ChIP were quantified by real-time PCR using the Fast SYBR green kit and 7900HT real-time thermal cycler (Applied Biosystems). 2-∆CT values (antibody-input) were expressed as percentage of input and were calculated by standard curve method. At least three independent experiments were performed in each condition. Results are represented as standard error of the mean (SEM). ChIP of FL patient samples was performed as detailed above with some modifications. 1x107 CD20 positive FL cells were obtained from the hematopathology department from four different patients with approval from the Weill Cornell Institutional Review Board. After validation of enrichment by QChIP, BCL6 or Actin ChIP products and their respective input genomic fragments were amplified by ligation-mediated PCR (LMPCR) enrichment of positive control genes verified in additional QChIPs. The products were co- hybridized with the respective input samples to NimbleGen promoter arrays, human genome v. 35, May 2004, NimbleGen Systems (Madison, WI). Western blot was performed to verify BCL6 expression in all four FL patient samples being all positive and responsive to RI-BPI treatment. QChIP primers for specific genes were purchased from Fisher Scientific (Pittsburgh, PA) are listed in Supplementary

30 Valls et al. Targeting BCL6 in FL

Table S5.

Data analysis of ChIP-on-Chip. ChIP-on-Chip analysis was performed as previously described[6]. Briefly, to identify target genes of BCL6 from each array, the log-ratio between the probe intensities of the ChIP product and input was computed by taking moving windows of three neighboring probes for the average log-ratio and determining the maximum value of those windows as the signal for each probeset (or gene promoter). Random permutation probe log-ratios were used as background control. The peak cutoff was established as higher than 0.993 quantile of the log-ratio values generated from randomly permutated probes, since the ratio of randomly expected "hits" to called "hits" is within a range where the false discovery rate remains less than 10%. A locus with maximum moving average above cut-offs in at least three of the four FL samples is considered a binding target. Since this high stringent-overlapping approach can miss some potential targets, Pearson correlations among probeset log-ratios between biological replicates were computed as a way to rescue promoters that did not pass the cut-off in one or two replicates (probesets with a correlation >0.9 between at least two pairs of unpassed with passed replicates were rescued and included in the final set of BCL6 targets). De novo motif analysis was performed using the FIRE motif discovery program [7] using default parameters, as previously described on the ChIP-on-Chip data [6]. CpG-islands were predicted using newcpgreport from the EMBOSS package (http://emboss.sourceforge.net/), with default parameters. For unsupervised analysis, the arrays were quantile normalized to a range of values between 0 and 1. Hierarchical clustering was performed using the Euclidean distance and ward method in the R software package.

Pathway analysis. The enrichment of BCL6 target genes associated with lymphoid-specific gene expression signatures [3] and Gene Ontology (GO) biological processes (BP) [8] was examined. The lymphoid-specific gene expression signatures [3] contain 243 signatures illuminating normal and pathological lymphoid biology curated from literature (http://lymphochip.nih.gov/signaturedb/). The BP annotations of GO[8] were downloaded from GSEA Molecular Signatures Database (MSigDB) C5 collection (http://www.broad.mit.edu/gsea/msigdb/). Fisher’s Exact test (adjusted by the number of genes on the array) was used to calculate enrichment p values and Benjamini-Hochberg (BH) correction for multiple testing was used for False Discovery Rate (FDR) control. Ingenuity Pathway Analysis software (IPA) (Redwood City, CA) was used to identify top scored networks for the BCL6 target genes. Gene function analysis was performed by DAVID Gene Functional Annotation Tool [1].

31 Valls et al. Targeting BCL6 in FL

Gene expression microarray data and RNA-seq. Publically available gene expression microarray data were obtained from 191 primary FLs [9]. Data processing and normalization were performed as previously described [9]. The expression values of multiple probesets representing the same gene were averaged in al cases but for Figure 2A, where we experienced better results showing the single probes separately. The negative correlation with BCL6 was calculated for each gene using one-tailed Spearman correlation. For RNA sequencing, total RNA was extract from cell lines using Trizol (LifeTechnologies). RNA concentration was determined using Qubit (LifeTechnologies) and integrity was verified using Agilent 2100 Bioanalyzer (Agilent Technologies). Libraries were generated using mRNA-seq sample prep kit (Illumina), through which mRNA was selected by two rounds of purification using magnetic polydT beads and then fragmented. First-strand synthesis was performed using random oligos and SuperscriptIII (Invitrogen). After second-strand synthesis, a 50-bp paired-end library was prepared following the Illumina paired-end library preparation protocol. Pair-end sequencing (PE50) was performed on Illumina HiSeq2500. Raw image data were converted into base calls and fastq files via the Illumina pipeline CASAVA version 1.8 with default parameters. All 50-bp-long paired-end reads were mapped to the reference human (hg19) or mouse (mm10) genome sequence, using TopHat2 aligner[10] with the default parameters and --library-type fr-unstranded for total RNAseq or --library-type fr-firststrand for strand-specific total RNAseq. The mRNA expression level for each gene was represented as FPKM (fragments per kilobase of transcript per million fragments mapped), called by Cufflinks[11] in the Tophat2 package.

Primary B-cell populations’ isolation, culture conditions and cytokine treatments. Tonsillar tissue was obtained as discarded material from routine tonsillectomies at the Montefiore Children’s Hospital and WCMC (with approval of Institutional Review Boards of Albert Einstein College of Medicine, Montefiore Hospital and Weill Cornell Medical College and in accordance with the Helsinki protocols). Tonsillar mononuclear cells were separated by density centrifugation with Fico/Lite LymphoH (Atlanta Biologicals, Norcross, GA). Samples were divided in two and the mononuclear cells rophatPro Separator system from Miltenyi Biotec Inc. (Auburn, CA) as follows: For naïve B cells a first staining was performed with anti-IgD-FITC and a second staining with FITC-microbeads Miltenyi Biotec (Auburn, CA), and performed a positive selection. GC B-cell isolation consisted of a first staining with anti-CD77 Beckman Coulter (Brea, CA), a second staining with anti-MARM, mouse anti- rat IgM, BD Pharmingen (Franklin Lakes, NJ) and a third staining with rat anti-mouse IgG1 microbeads, Miltenyi Biotec (Auburn, CA) followed by a positive selection. The purity of the isolated B cell populations was determined by flow cytometry LSRII system Beckton Dickinson (Franklin Lakes, NJ). Naïve B cells are IgD+CD38lo and GC B-cells are IgD-CD77+CD38hi (see Fig. S3 for purity of

32 Valls et al. Targeting BCL6 in FL

samples). Antibodies used for flow cytometry were as follows: anti-IgD-FITC, anti-CD38-APC and anti- CD77 plus MARM-FITC BD Pharmingen (Franklin Lakes, NJ). The FlowJo software from Treestar, Inc. (Ashland, OR) was used for the flow cytometry analysis. Following purification, the samples were processed for mRNA and protein extraction. Naïve B cells were co-cultured with a stromal layer of OP9. OP9 is a bone marrow-derived pre-adipocyte cell line that is capable of supporting the growth and differentiation of multiple hematopoietic cell lineages from hematopoietic progenitor cells (HPCs [12]. Co-cultures were grown in RPMI with 20% FBS, 1%PS, 2mM L-Glutamine and 10 mMHepes. Cytokine treatment was done using 30 ng/ml of IL4 and 30 ng/ml of IL21 Antigenix America (Huntington Station, NY) or vehicle for up to 4 days. Cell viability was assessed every day by Trypan blue dye-exclusion and cytokines were added to media every other day. Alternatively, resting B lymphocytes from BL57/6 mice spleens were isolated. B220+ splenocytes were obtained by negative selection with anti-CD43 and anti-Mac-1/CD11b monoclonal antibodies coupled to magnetic microbeads Miltenyi Biotec (Auburn, CA). Cell purity was >95% and was assessed by CD45R/B220+ BD Pharmingen (Franklin Lakes, NJ). Cells were subjected to the same treatments as for naïve B cells, but using mouse specific cytokines Antigenix America (Huntington Station, NY). mRNA was extracted using Trizol protocol (Invitrogen, CA).

ICN2 knock in mice and NP and SRBC immunization: ROSA26-ICN2-IRES-YFP knock-in mice were generated by insertion of a loxP flanked splice acceptor NEO-ATG cassette with two polyA sites followed by the ICN2-IRES-YFP cassette into the ROSA26 locus, allowing the ROSA26 promoter to drive the expression of the NEO-ATG cassette. Cre recombinase mediates the excision of the loxP flanked NEO-ATG and use of the splice acceptor in the ICN2-IRES-YFP cassette. The IRES-YFP bicistronic mRNA allows expression to be monitored by YFP expression. In order to express the transgene (ICN2-IRES-YFP) these mice were crossed with Tamoxifen inducible ROSA26-CreERT2 mice expressing CreERT2 from the ubiquitously expressed ROSA26 promoter [13] or with the CγCre [14] mice obtained from Jackson laboratories. It has been monitored that a single dose of tamoxifen allows for 50% allelic recombination efficiency of the ROSA26 locus. ROSA26-ICN2-YFP mice were generated by Spyros Artavanis-Tsakonas and Exelixis (South San Francisco, CA) and were kept in specific pathogen-free conditions at the New York University School of Medicine. Experiments were performed in accordance to the guidelines of the New York University Institutional Animal Care and Use Committee. For GC studies, serum of pre-immunized mice (ROSA 26 WT and ROSA26-ICN2- IRES-YFP knock in) was collected one day prior the start of the experiment (day -1). The next day, mice were injected intraperitoneally with 100 μl of 4Hydroxy-3nitrophenylacetyl hapten-chicken gamma T2 globulin (NP65-GCC) in alum (day 0). For CreER induction, Tamoxifen (Sigma Aldrich - T5648) was

33 Valls et al. Targeting BCL6 in FL

solubilized in corn oil (Sigma Aldrich - C8267) at a concentration of 20mg/mL and one day after NP immunization, a single intraperitoneal injection of 0.2mg/g body weight was administered. Alternatively, mice were immunized intraperitoneally with 500 μl 2% sheep red blood cells (SRBC) in PBS. Serum was collected at day 7 and day 14. Mice were sacrificed and spleens were harvested for IHC and Flow-cytometry analysis. Schematic representation of experiment in Figure S4A. Genotyping primers are listed in Supplementary Table S5.

Flow-cytometry and Immunohistochemistry of GC. B220+ splenocytes from WT and ICN2 mice were obtained as described above. For GC B cell population we gated on B220+ (BD Biosciences) and GL7 eFluor674 (eBioscience) and CD95(Fas) PECy7 (BD biosciences). For plasma cell population (CD38+ CD138+) we used CD38 APC (eBioscience) and CD138 PE (BD Biosciences). ICN2 expression was assessed by B220+ YFP+. Immunohistochemistry of spleens was performed on formalin-fixed paraffin-embedded sections with the following primary antibodies: PNA (Vector Laboratories, CA), BCL6 (N3, Santa Cruz Biotech, CA) and CD45R/B220 (Caltag, CA). Briefly, deparaffinized slides were antigen-retrieved in citric buffer (pH 6.4) in a steam-bath. We incubated with biotinylated PNA for 2h at RT followed by avidin-HRP for 1h and DAB for color development. Finally, slides were counter-stained with hematoxylin; all reagents were from (Vector Laboratories, CA). For BCL6/B220 staining we proceeded the same way as for PNA, but prior to primary hybridization slides were permeabilized. Primary antibody was incubated O/N in a humid chamber at 4C. The following day slides were hybridized with anti-rabbit IgG-Biotin for 2h at RT. ABC-AP staining was used as substrate for BCIP/NBT developing reagent (purple color). For the second staining with B220, slides were washed with TBST (10 mM Tris pH 7.5 + 0.01% Tween-20) and boiled for 2 minutes with the same buffer. Then we proceed with the incubation of the primary antibody as explained for PNA but without doing counter-staining with hematoxylin. BCL6 shows a purple pattern, while B220 staining is pale brown. To count the GC we used CellSens Software (Olympus America Inc.).

Anti-NRR2 specificity, flow antibodies and gating strategy. To evaluate the in vivo potency and specificity of antibody-mediated Notch2 blockade, we injected anti-NRR2 to control B6 mice and assessed the impact of anti-NRR2 administration on Notch2 vs. Notch1-regulated lymphoid populations [15-17]. B6 wildtype mice (female age and litter matched controls, 8-10 weeks) were treated for 60 hours with humanized IgG1 neutralized antibodies against Notch1 (anti-N1), Notch2 (anti-N2), or isotype control [18]. All antibodies were injected i.p. (5 mg/kg) in 200μl PBS. To look for Notch2 specific effects splenic B cells were monitored for loss of either absolute numbers and percentage of MZBs and CD21/35 expression in FoBs. Conversely, anti-NRR1 but not anti-NRR2 administration inhibited CD25

34 Valls et al. Targeting BCL6 in FL expression (a specific Notch1 target gene) in early Notch1-dependent thymocyte progenitors[19]. The following antibodies were from BioLegend: APC-Cy7 conjugated anti-CD4 (clone: RM4-4) and B220 (RA3-6B2). FitC conjugated anti-CD44 (IM7). PE conjugated anti-CD23 (B3B4). APC conjugated anti- CD117 (c-KIT, 2B8) and CD93 (AA4.1). PE-Cy7 conjugated anti-CD25 (PC61) and CD19 (6D5). BV421 conjugated anti-CD8a (53-6.7) and CD21/35. Lineage cocktail was PE conjugated CD19 (6D5), B220 (RA3-6B2), CD11c (N418), CD11b (M1/70), Gr-1 (RB6-8C5), TER-119, TCRβ (H57-597), CD3 (145- 2C11), NK1.1 (PK136), and TCRγδ (GL3). Dead cells were excluded with Zombie Aqua fixable viability dye (BioLegend). Flow cytometric analysis was performed on a 3-laser Fortessa (BD).

35 Valls et al. Targeting BCL6 in FL

Supplemental References

1. Dennis G., Jr., Sherman B.T., Hosack D.A., Yang J., Gao W., Lane H.C., et al., DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol, 2003. 4(5): p. P3. 2. Huang da W., Sherman B.T., and Lempicki R.A., Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc, 2009. 4(1): p. 44-57. 3. Shaffer A.L., Wright G., Yang L., Powell J., Ngo V., Lamy L., et al., A library of gene expression signatures to illuminate normal and pathological lymphoid biology. Immunol Rev, 2006. 210: p. 67-85. 4. Basso K., Klein U., Niu H., Stolovitzky G.A., Tu Y., Califano A., et al., Tracking CD40 signaling during germinal center development. Blood, 2004. 104(13): p. 4088-96. 5. Bookout A.L., Cummins C.L., Mangelsdorf D.J., Pesola J.M., and Kramer M.F., High-throughput real-time quantitative reverse transcription PCR. Curr Protoc Mol Biol, 2006. Chapter 15: p. Unit 15 8. 6. Ci W., Polo J.M., Cerchietti L., Shaknovich R., Wang L., Yang S.N., et al., The BCL6 transcriptional program features repression of multiple oncogenes in primary B cells and is deregulated in DLBCL. Blood, 2009. 113(22): p. 5536-48. 7. Elemento O., Slonim N., and Tavazoie S., A universal framework for regulatory element discovery across all genomes and data types. Mol Cell, 2007. 28(2): p. 337-50. 8. Ashburner M., Ball C.A., Blake J.A., Botstein D., Butler H., Cherry J.M., et al., Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nature genetics, 2000. 25(1): p. 25-9. 9. Dave S.S., Wright G., Tan B., Rosenwald A., Gascoyne R.D., Chan W.C., et al., Prediction of survival in follicular lymphoma based on molecular features of tumor-infiltrating immune cells. N Engl J Med, 2004. 351(21): p. 2159-69. 10. Kim D., Pertea G., Trapnell C., Pimentel H., Kelley R., and Salzberg S.L., TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol, 2013. 14(4): p. R36. 11. Trapnell C., Williams B.A., Pertea G., Mortazavi A., Kwan G., van Baren M.J., et al., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol, 2010. 28(5): p. 511-5. 12. Kodama H., Nose M., Niida S., and Nishikawa S., Involvement of the c-kit receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp Hematol, 1994. 22(10): p. 979-84. 13. Seibler J., Zevnik B., Kuter-Luks B., Andreas S., Kern H., Hennek T., et al., Rapid generation of inducible mouse mutants. Nucleic Acids Res, 2003. 31(4): p. e12. 14. Casola S., Cattoretti G., Uyttersprot N., Koralov S.B., Seagal J., Hao Z., et al., Tracking germinal center B cells expressing germ-line immunoglobulin gamma1 transcripts by conditional gene targeting. Proc Natl Acad Sci U S A, 2006. 103(19): p. 7396-401. 15. Saito T., Chiba S., Ichikawa M., Kunisato A., Asai T., Shimizu K., et al., Notch2 is preferentially expressed in mature B cells and indispensable for marginal zone B lineage development. Immunity, 2003. 18(5): p. 675-85. 16. Radtke F., Wilson A., Stark G., Bauer M., van Meerwijk J., MacDonald H.R., et al., Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity, 1999. 10(5): p. 547-58. 17. Tran I.T., Sandy A.R., Carulli A.J., Ebens C., Chung J., Shan G.T., et al., Blockade of individual Notch ligands and receptors controls graft-versus-host disease. The Journal of clinical investigation, 2013. 123(4): p. 1590-604. 18. Wu Y., Cain-Hom C., Choy L., Hagenbeek T.J., de Leon G.P., Chen Y., et al., Therapeutic antibody targeting of individual Notch receptors. Nature, 2010. 464(7291): p. 1052-7.

36 Valls et al. Targeting BCL6 in FL

19. Maillard I., Tu L., Sambandam A., Yashiro-Ohtani Y., Millholland J., Keeshan K., et al., The requirement for Notch signaling at the beta-selection checkpoint in vivo is absolute and independent of the pre-T cell receptor. The Journal of experimental medicine, 2006. 203(10): p. 2239-45.