Master of Dental Surgery Branch – Ii Periodontics

COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTHBRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE

A Dissertation submitted in partial fulfillment of the requirements for the degree of

MASTER OF DENTAL SURGERY

BRANCH – II PERIODONTICS

THE TAMIL NADU DR. M.G.R. MEDICAL UNIVERSITY Chennai – 600 032

2015 - 2018 CERTIFICATE BY THE GUIDE

This is to certify that Dr. A. J. JAREEN, Post Graduate student (2015–2018) in the Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 has done this dissertation titled “COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE” under my direct guidance and supervision in partial fulfillment of the regulations laid down by Tamil Nadu Dr. M.G.R. Medical University, Chennai – 600 032 for M.D.S., (Branch – II) Periodontics degree examination.

Dr.JAISHREE TUKARAM KSHIRSAGAR, M.D.S.

Professor and Guide Department of Periodontics

Tamil Nadu Government Dental College and Hospital Chennai – 600 003 ENDORSEMENT BY HEAD OF THE DEPARTMENT /

HEAD OF THE INSTITUTION

This is to certify that the Dissertation entitled “COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE” is a bonafide work done by Dr. A. J. JAREEN, Post Graduate student (2015–2018) in the Department of Periodontics, under the guidance of Dr. JAISHREE TUKARAM KSHIRSAGAR, M.D.S., Professor, Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003.

Dr. K. Malathi, M.D.S., Dr.B.Saravanan, M.D.S., Ph.D., Professor & HOD Principal. Department of Periodontics.

Tamil Nadu Government Dental College and Hospital Chennai – 600 003 DECLARATION BY THE CANDIDATE

I hereby declare that this dissertation titled “COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE” is a bonafide and genuine research work carried out by me under the guidance of Dr. JAISHREE TUKARAM KSHIRSAGAR, M.D.S., Professor and Guide, Department of Periodontics, Tamil Nadu

Government Dental College and Hospital, Chennai -600003.

Signature of the candidate

Tamil Nadu Government Dental College and Hospital

Chennai – 600 003

ACKNOWLEDGEMENT

I am privileged to express my deep sense of gratitude to Dr. JAISHREE TUKARAM KSHIRSAGAR, M.D.S., Professor and Guide, Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 for her continuous motivation, encouraging in all endeavors, throughout my PG Course and for her involvement, guidance and support for this dissertation work and in bringing out this wonderful thesis.

I am immensely obliged to Dr. K. MALATHI, M.D.S., Professor and Head, Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 for her valuable support and continuous encouragement throughout the study.

I am extremely grateful to Dr. MAHEASWARI RAJENDRAN, M.D.S., Professor, Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 for her esteemed guidance and support throughout my PG course.

I sincerely thank Dr. B. SARAVANAN, M.D.S., Principal, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 for his kind permission and encouragement.

My heartfelt & sincere thanks to DR. ARVIND RAMANATHAN, BDS, MSC., PH.D in molecular biology,research scientist at Balaji Dental College and hospital who helped me in my lab processes.

I express my gratitude to Dr. A. MUTHUKUMARASWAMY, M.D.S., Associate professor, Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 for sharing his valuable clinical knowledge and continuous encouragement throughout the course.

I am grateful to Dr. P. BHUVANESHWARI, M.D.S., Associate Professor, Dr. M. JEEVA REKHA M.D.S., Associate Professor, Dr. R. KARTHIKEYAN, M.D.S., Dr. A.J. ANAND, M.D.S., Dr. P.R. GANESH, M.D.S., Dr. D. JAYANTHI, M.D.S., Dr. M. SHABBIR AHAMED, M.D.S., Assistant Professors, Tamil Nadu Government Dental College

and Hospital, Chennai – 600 003, for helping me with my dissertation and during my study period. I extend my heartfelt thanks to my friends Dr. AKSHAYA NARAYANAN, Dr. E. AMUTHAVALLI , Dr. R. JENAPRIYA, Dr. K. POORANA and Dr. M. SHYAMALA who made my P.G period peaceful and memorable.

I would also like to express my gratitude to my seniors Dr. N. LAVANYA, Dr. K. PREM KUMAR, Dr. S. R. YASHODHA; Dr. NIRMMAL MARIA T., Dr. M. K. ANJU, Dr. S. ANNAPOORANI and all my juniors who have stood by me always and have been a constant source of encouragement for me during this period.

I dedicate this work to my husband Mr. SYED MASOOD FAIZEL, who has been a constant support throughout my PG period, without whom my dreams could have not come true. I would also dedicate this work to my mom RAHILA BEGUM whose unconditional love and support made me achieve horizons .She also extended a mother-care to my kids. I extend my heartfelt thanks to my in-laws Mr.SHEIK ABDUL KADER and Mrs.PARISAL. It will not be complete if I forget my lovely daughters THASNEEM and MUHSINA who bore shortcomings of my mother hood.

A special mention of thanks to all of my study subjects for their kind cooperation throughout my study.

Last, but not the least, I thank GOD ALMIGHTY who made things possible. TRIPARTITE AGREEMENT

This agreement herein after the “Agreement” is entered into on this day ------between the Tamil Nadu Government Dental College and Hospital represented by its Principal having address at Tamil Nadu Government Dental College and Hospital, Chennai – 600 003, (hereafter referred to as, ‘the college’)

And

Dr. A. J. JAREEN, aged 36 years currently studying as Post Graduate student in Department of Periodontics, Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 (herein after referred to as the ‘PG student and Principal Investigator’),

And Mrs. Dr. JAISHREE TUKARAM KSHIRSAGAR, M.D.S., aged 48 years working as Professor in Department of Periodontics at the Tamil Nadu Government Dental College and Hospital, Chennai – 600 003 (hereafter referred to as ‘Co- investigator’),

Whereas the PG student as part of her curriculum undertakes this research on “COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE” for which purpose the Co – investigator and the college shall provide the requisite infrastructure based on availability and also provide facility to the PG student as to the extent possible as a Principal Investigator

Whereas the parties, by this agreement have mutually agreed to the various issues including in particular the copyright and confidentiality issues that arise in this regard.

Now this agreement witnessed as follows

1. The parties agree that all the Research material and ownership therein shall become the vested right of the college, including in particular all the copyright in the literature including the study, research and all other related papers. 2. To the extent that the college has the legal right to do, shall grant to licence or assign the copyright so vested with it for medical and/or commercial usage of interested persons/ entities subject to a reasonable terms/ conditions including royalty as deemed by the college. 3. The royalty so received by the college shall be shared equally by all the three parties. 4. The PG student and Co-investigator shall under no circumstances deal with the copyright, Confidential information and know how–generated during the course of research/study in any manner whatsoever, while shall sole vest with the college. 5. The PG student and Co-investigator undertake not to divulge (or) cause to be divulged any of the confidential information or, know how to anyone in any manner whatsoever and for any purpose without the express written consent of the college. 6. All expenses pertaining to the research shall be decided upon by the Principal investigator/ Co-investigator or borne sole by the PG student (Principal-investigator) 7. The college shall provide all infrastructure and access facilities within and in other institutes to the extent possible. This includes patient interactions, introductory letters, recommendation letters and such other acts required in this regard. 8. The Co-Investigator shall suitably guide the Student right from selection of the research topic and area till its completion. However the selection and conduct of research, topic and area of research by the student researcher under guidance from the Co-Investigator shall be subject to the prior approval, recommendations and comments of the Ethical Committee of the College constituted for the purpose. 9. It is agreed that as regards other aspects not covered under this agreement, but which pertain to the research undertaken by the PG student, under the guidance from the Co-Investigator, the decision of the college may be binding and final. 10. If any dispute arises as to the matters related or connected to this agreement herein, it shall be referred to arbitration in accordance with the provisions of the Arbitration and Conciliation Act, 1996.

In witness whereof the parties herein above mentioned have on this day month and year herein above mentioned set their hands to this agreement in the presence of the following two witnesses.

College represented by its Principal PG Student

Student Guide

Witness

PLAGIARISM CERTIFICATE

CERTIFICATE - II

This is to certify that this dissertation work titled

CHAIN REACTION TECHNIQUE of the candidate DR A. J. JAREEN with registration number ______for the award of MASTER OF DENTAL SURGERY in the branch of PERIODONTICS ( BRANCH

II ). I personally verified the urkund.com website for the purpose of plagiarism Check. I found that the uploaded thesis file contains from introduction to conclusion pages and result shows 4 % of plagiarism in the dissertation.

Guide & Supervisor sign with Seal ABSTRACT BACK GROUND: The etiological role of bacteria is established in periodontal disease. Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Treponema denticola are more commonly associated with destructive periodontal disease. Human saliva is a reservoir of micro-organisms derived from various niches of oral cavity. Molecular analysis of salivary sample allows evaluation of levels of microbes. Miswak is a chewing stick obtained from the roots and branches of a particular tree called the Salvadora persica. Several studies revealed that when used correctly, Miswak can have a positive impact on oral hygiene. AIM: To compare the salivary microbial levels of Porphyromonas gingivalis, Treponema denticola , Prevotella intermedia and Aggregatibacter actinomycetemcomitans between habitual Miswak stick users and regular toothbrush users using polymerase chain reaction technique and to assess the relationship between salivary bacterial levels and periodontal status. MATERIALS AND METHODS: A total of 50 subjects were included in the study. Study group consisted of 25 subjects who used only Miswak stick as their oral hygiene aid and control group consisted of 25 subjects who used tooth brush as their oral hygiene aid. Microbial levels of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans were assessed in salivary samples by quantitative PCR technique and compared between the two groups. Furthermore the clinical parameters, plaque index, sulcus bleeding index, probing pocket depth and clinical attachment level were compared between the two groups. RESULTS The mean plaque index score of Miswak users was 1.14±0.63 and tooth brush users was 0.74±0.23 (p=0.005). The mean sulcus bleeding index score for Miswak users was 1.70±1.00 and tooth brush users was 0.93±0.27 (p=0.001). The median bacterial count of P.gingivalis among Miswak users was 9812 and the Tooth brush users was 7894 and the difference was statistically significant(p=0.046). The median bacterial count of T.denticola among Miswak users was 1900 and the Tooth brush users was 3793 and the difference was statistically not significant(p=0.304). The median bacterial count of A. actinomycetemcomitans among Miswak users was 3762 and the Tooth brush users was 3498 and the difference was statistically not significant(p=0.816). The median bacterial count of P.intermedia among Miswak users was 3450 and the Tooth brush users was 4352 and the difference was statistically not significant(p=0.839). CONCLUSION Within the limits of the present study, it can be concluded that tooth brush is better than Miswak stick in maintaining oral hygiene. Tooth brush users had significantly lower counts of P.gingivalis. Miswak has some chemical constituents that inhibits T. denticola and P.intermedia. Furthermore, clinical studies comparing clinical and microbiological parameters in larger samples are required. Invitro studies to explore the phytochemical constituents of Miswak is necessary. CONTENTS

S. No. Title Page No.

1. Introduction 1

2. Aim and Objectives 4

3. Review of Literature 5

4. Materials and methods 23

5. Photographs 33

6. Statistical analysis 40

7. Results 42

8. Discussion 55

Summary and 9. 61 Conclusion

10. Bibliography 63

11. Annexure 81

LIST OF PHOTOGRAPHS

S. No. Title Page

1. Miswak tree 33

2. Miswak twig 33

3. Armamentarium for periodontal examination 34

4. Armamentarium for salivary sample collection 34

5. Salivary sample collection 35

6. Armamentarium for DNA extraction 35

7. Homogenized samples in micro centrifuge tubes 36

8. Enzymes and reagents in -20oc cooler 36

9. Dry heat incubator 37

10. Qubit fluorometer 37

11. Vortex mixer 38

12. Micro centrifuge 38

13. Rotor Gene Q Real Time PCR 39

14. Buccal and Lingual surfaces of Miswak user 1 39

15. Buccal and Lingual surfaces of Miswak user 2 39

LIST OF TABLES

S. No. Title Page No. Comparison of mean scores of clinical parameters 1. between Miswak and tooth brush users and its 46 significance

2. Independent Sample T test 46

Comparison of Q PCR data of micro organisms between 3. 47 Miswak and tooth brush users Comparison of mean and median of Q PCR data 4. 48 between Miswak and tooth brush users Comparison of mean ranks and sum of ranks between 5. 48 Miswak users and tooth brush users Comparison of Mann –Whitney U test statistics between 6. 49 the four tested micro organisms and its significance

LIST OF FIGURES

S. No. Title Page No.

Comparison of mean scores in whole mouth 1. plaque index between Miswak stick users and 50 tooth brush users Comparison of mean scores in whole mouth 2. bleeding index between Miswak stick users and 50 tooth brush users Comparison of median microbiological counts of P.gingivalis, T.denticola, A. 3. 51 actinomycetemcomitans, P. intermedia between Miswak stick users and tooth brush users Real time PCR results of microbial count of 4. 51 P.gingivalis in salivary samples

Real time PCR results of microbial count of 5. 52 T.denticola in salivary samples

Real time PCR results of microbial count of 6. 52 A.actinomycetemcomitans in salivary samples

Real time PCR results of microbial count of P. 7. 53 intermedia in salivary samples

8. Raw data for cycling A.Green 53

9. Quantitation data for Cycling A.green 54

10. Standard curve 54

LIST OF ABBREVIATIONS

Aa Aggregatibacter actinomycetemcomitans

A. actinomycetemcomitans Aggregatibacter actinomycetemcomitans

ABTS Azino-bis ethylbenzo-thiazoline sulfonic acid

BIT Benzyl iso thiocyanate

Bp base pair

CAL Clinical Attachment Level

CEJ Cemento–Enamel Junction

DNA Deoxyribo Nucleic Acid

DMBA Dimethyl benzanthracin

DPPH Diphenyl picrylhydrazyl radicals

E.faecalis Enterococcus faecalis

E.coli Escherichia coli

EDTA Ethylene diamine tetraacetic acid

GC-MS Gas chromatography mass spectrometry

HSV-1 Herpes Simplex Virus 1 mRNA Messenger Ribo Nucleic Acid

P. gingivalis Porphyromonas gingivalis

P. intermedia Prevotella intermedia

PCR Polymerase Chain Reaction

PPD Probing Pocket Depth

q PCR Quantitative Polymerase Chain Reaction

rRNA Ribosomal Ribo Nucleic Acid

RT-PCR Real Time Polymerase Chain Reaction

SD Standard Deviation

SDS Sodium Dodecyl Sulfate

T. denticola Treponema denticola

T. forsythia Tannerella forsythia

WHO World Health Organisation

Introduction

INTRODUCTION

Periodontitis is a disease of tooth supporting tissues which is inflammatory in origin. The etiological role of bacteria is established in periodontal disease conditions.

Although more than 700 species of microorganisms have been isolated from periodontal pockets, it is likely that only a small percentage of these are etiological agents (Haffajee and Socransky, 2005; Aas et al., 2005)1,2.Some species such as Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Treponema denticola, Prevotella intermedia are more commonly associated with destructive periodontal disease3,4.

Human saliva harbors as much as 108 bacteria per milliliter. It is a reservoir of microorganisms regularly derived from dental plaque biofilms adhering to the dorsum of the tongue, periodontal pockets, gingival crevices and other mucosal surfaces5. Plaque control is the primary preventive measure to prevent the onset of gingivitis and arrest its progression into periodontitis. As an adjunct to mechanical plaque control, various chemotherapeutic agents have been employed and developed to improve the efficacy of daily oral hygiene. Chemotherapeutic agents including systemic antibiotics, antiseptic mouthwashes, local drug delivery of antiseptics and antibiotics, host modulating agents have been used as an adjunct to the conventional periodontal therapy.

Herbs are nature's gift to humans. They have various bioactive components which possess enormous medicinal value with least side effects. Synthetic antimicrobial agents and antibiotics are known to cause antimicrobial resistance, emergence of previously uncommon infections probably due to the inappropriate or widespread overuse of

Introduction antimicrobials. Natural phytochemicals have proven to be good alternatives to such synthetic agents. Natural herbs have been used effectively to treat oral diseases in the past.

Chewing sticks are being used in many parts of the world as oral hygiene aid. In addition to their use in mechanical removal of plaque, it has been postulated that they have an anti-bacterial effect. Miswak is a chewing stick obtained from the roots and branches of a particular tree called the “Salvadora persica” or “Arak tree”. Salvadora persica is a plant native to Saudi Arabia, India and Egypt. Miswak stick is used in the same way as neem stick. World Health Organisation (WHO) has recommended the use of chewing sticks as an active tool for oral hygiene (WHO 1984). The consensus statement on oral hygiene(2000) states that chewing sticks can play a role in the promotion of oral hygiene and evaluation of their effectiveness requires further research (Hassan suliman halawany)6. Several studies revealed that when used correctly Miswak can have a positive impact on oral hygiene.

Miswak helps for oral hygiene maintenance through dual function. Mechanical plaque control is achieved by friction between plant fibres and tooth surfaces. Chemical plaque control is due to phytochemical constituents which includes benzyl iso thiocyanate, fluoride ions, silica, calcium, sodium bicarbonate, alkaloids, tannic acid, resins, essential oils, vitamin c etc7.

The present study was carried out to evaluate the effects of Miswak on the periodontal pathogens. Hence this study was designed to evaluate and compare the levels of periodontal pathogens in the Miswak stick users who uses only Miswak stick as oral hygiene aid with tooth brush users. The traditional culture methods to detect periodontal pathogens have inherent advantages, but have several shortcomings. The revolutionary

Introduction molecular technique; polymerase chain reaction overcomes the limitations and is a highly sensitive and specific method for analysis of saliva8.

Aim and Objectives

AIM AND OBJECTIVES

AIM:

To compare the salivary microbial levels of Porphyromonas gingivalis, Treponema denticola , Prevotella intermedia and Aggregatibacter actinomycetemcomitans between habitual Miswak stick users and regular toothbrush users using polymerase chain reaction technique and to assess the relationship between salivary bacterial count and periodontal status

OBJECTIVES:

The objective of the present study is

1. To find the salivary microbial count of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans in habitual Miswak stick users and regular toothbrush users using polymerase chain reaction technique 2. To compare the salivary microbial count of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans in habitual Miswak stick users and regular toothbrush users using polymerase chain reaction technique 3. To assess relationship of microbial count of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans and periodontal status in these individuals.

Review of Literature

REVIEW OF LITERATURE

Modern tooth brush has been evolved from chewing sticks which were used by

Greeks, Arabs and Romans since 3500 BC9. Chewing sticks are still being used in rural areas by many people for cleaning their teeth. They are known for their systemic benefits when they are chewed and sucked.

Miswak tree is not much familiar to us but has its origin from India too. It has various names in different languages such as Miswak or Siwak in Arabic, Ugaai in

Tamil and Peelu in Urdu. The botanical name of this tree is Salvodera Persica. It is also known as “Tooth brush tree”. ‘‘Miswak” means tooth-cleaning stick10. Among 180 plant species suitable for toothbrushing, Miswak harvested from Salvadora persica, is used most widely 11.

Origin and appearance

Salvadora persica has a widespread geographic distribution including India,

Nepal, Pakistan, Iran, Iraq, Malaysia, Saudi Arabia, Egypt, and Africa12.The term

Salvadora, (from Juan Salvadory Bosca, 1598–1681) was suggested by Dr. Laurent

Garcin while persica, term denotes Persia and L indicates Carl Linnaeus (1707–1778), who is the father of modern taxonomy. S. persica belongs to family Salvadoraceae ,

Class Magnoliopsida13.

Salvadora persica is an evergreen shrub or small tree, reaching a maximum height of three meters. The leaves are oval, succulent and thick with a strong smell of mustard or cress. The fresh leaves are used for salad and are used in traditional medicine for piles, rheumatism, asthma, cough, scurvy and other diseases. The flowers are small, fragrant which is used as a stimulant and purgative. They have small berries. They are

Review of Literature eaten both fresh or dried. Though Miswak is usually obtained from the roots of the tree, some sticks are made from its branches14. The root bark of the tree resembles sand in colour and the inner surfaces have even a lighter shade of brown. It has a warm, pungent taste.

Chemical composition

Miswak helps for oral hygiene maintenance through dual function.

Mechanical plaque control is achieved by friction between plant fibres and tooth surfaces. Chemical plaque control is due to its phytochemical constituents which includes

• Benzyl iso thiocyanate - a major component, has strong antibacterial effect against

periodontal pathogens

• Alkaloids (salvodarine) - bactericidal effect and gingival stimulation

• Silica - acts as abrasive material that removes deposits and stains from the tooth

surface

• Fluoride and Calcium ions– promotes re-mineralization

• Sodium bicarbonate –germicidal and mild abrasive

• Tannic acid – astringent , good anti-plaque and anti-gingivitis agent

• Resins – forms a layer over enamel protecting it from microbial action

• Essential oils – antiseptic effect and increases the flow of saliva

• Vitamin C –Repair and healing

Review of Literature

Benzyl iso thiocyanate

The root of Salvadora persica contains a steam-distillable oil which contains

90% benzyl iso thiocyanate (BIT), 10% benzyl nitrate16. BIT is a chemo-preventive agent that prevents carcinogenic and genotoxic compounds from reacting with the target sites on the treated tissue17. Dosari et al studied the effect of BIT on epithelial changes induced by trauma and dimethylbenzanthracin (DMBA) in the hamster tongue.

Results indicated that BIT retarded the neoplastic changes induced by trauma or trauma plus DMBA18. BIT has an anti-viral activity against Herpes simplex virus 1 (HSV-1) at

133.3 mg/ml concentration19 . It has a broad-spectrum bacteriocidal activity20. Al-

Bagieh et al stated that BIT inhibits the acid production and growth of Streptococcus mutans21.

Salvodarine

Salvadorine is the alkaloid present in Salvadora persica, which on hydrolytical cleavage yields trimethylamine 22. It is bactericidal and stimulates gingiva23

Miswak on oral health

Many studies revealed that Miswak had strong anti-carious properties. In a dental survey conducted in Sudan, a lower caries prevalence was seen among Miswak users than among toothbrush users (Emslie R 1966)24. Lewis WH and Elvin-Lewis

(1977) reported that tooth loss was very low in adults where Miswak is used widely.25

Miswak prevents the formation of dental plaque chemically but the primary cleaning action of Miswak is due to its mechanical action.(Akpata, E and Akinrimisi,

E 1977)26

Review of Literature

Baghdady & Ghose (1979)27 stated a lower caries prevalence among Sudanese school children, who used Miswak.

Hayes AG, Tyers MB (1983) did experiments on mice which proved that

Miswak had a moderate analgesic effect due to its interaction with the peripheral opiate system.28

Miswak is also used to clean the tongue which helps in fighting halitosis and removing the white coat that develops on the dorsum of the tongue. This is generally done by the brush end of the Miswak.(Chawla Hs 1983)29

Plaque scores were lower following the proper use of Miswak as an oral hygiene aid when compared with the use of conventional tooth brushes. (Gazi M 1988)30

Gazi et al investigated the effect of Miswak on the composition of saliva. They reported that there was a significant increase in calcium (22-fold) and chloride (6-fold), and marked decrease in phosphate.

Calcium in saliva prevented demineralization and promoted re-mineralization of tooth enamel whereas increased concentrations of chloride prevented calculus formation. (Kubota K et al 1988)31

Al- Bagieh et al32 reported that aqueous extracts of Miswak could be used to inhibit the growth of Candida albicans. Such inhibition lasted for upto 36 hours at 15% concentration and above . (Tyler VE et al 1988)33

Miswak has analgesic, astringent and anti-inflammatory properties. This makes it an effective tool against periodontal disease (Eid MA and Selim HA 1994)34

Review of Literature

It has been proved in vitro that aqueous extracts of Miswak have inhibitory effects on growth of several oral microorganisms, including the primary colonizers in the early stages of dental plaque formation (Al Laﬁ & Ababneh 199535,

AbdelRahman 200036) and pathogens associated with periodontal diseases and dental caries.

Studies have revealed that Miswak contains substances that possess antibacterial and plaque inhibiting properties against various types of cariogenic bacteria such as Streptococcus mutans and E. faecalis and periodontopathogens that are commonly found in the oral cavity (Almas K. 1999)37. Elvin-Lewis et al (1980)38 suggested that this consequence may be due to the interaction with bacteria, which prevents their adherence on the tooth surface .

It has been reported that patients using Miswak regularly had a lower incidence of toothache than toothbrush users (Wu CD et al 2001)39.

Soaking the healthy and periodontally affected root dentine in Miswak extract led to partial removal of smear layer, and occlusion of dentinal tubules was detected in dentine specimens brushed with Miswak solution.(Almas K 2001)40

Al-Otaibi M et al (2004)41 reported that the use of Miswak, in contrast to toothbrush, markedly reduced the amount of A. actinomycetemcomitans in the subgingival plaque, which showed that extracts from Salvadora persica might affect the growth and leukotoxicity of A. actinomycetemcomitans.

Strong anti-bacterial effect of Miswak against oral pathogens was demonstrated when an invitro study showed both Miswak pieces embedded in the agar plate and suspended above the agar plate at a distance of 3mm revealed a zone of inhibition

Review of Literature around the stick for Porphyromonas gingivalis, Lactobacillus acidophilus,

Aggregatibacter actinomycetemcomitans and Haemophilus influenza. This proved the volatile antibacterial agents present in Miswak (Sofrata a et al 2008)42 .

Miswak, Neem, Banyan and Mango sticks are popular oral hygiene aids that are used in India. A study was done in South India comparing these four sticks, which reported that Miswak was more superior in antimicrobial activity among these chewing sticks (Elangovan et al 2012)43

Miswak has high antioxidant activity due to the presence of antioxidant enzymes such as peroxidase, catalase, polyphenoloxidase. (Mohamed SA and Khan

JA 2013)44

In a study it was found that mints with Miswak extracts were 20 times more efficient in killing bacteria than ordinary mints, which was published by Journal of

Agriculture and Food Chemistry in 2007. It was seen that in 30 minutes, 60% of bacteria was destroyed by mints with Miswak extracts when compared to 3.4% by ordinary mints ( Husain A, Khan S 2015)45

Bacterial etiology of periodontal disease

Oral hygiene is one of the factors which has a strong impact on the microbial composition of saliva (Dahle ´n et al. 1992)46.The subgingival microflora in a healthy oral cavity consists of facultative anaerobic gram-positive species, but in gingivitis the proportion of gram-negative bacteria increases. Although more than 700 species of microorganisms have been isolated from periodontal pockets, it is likely that only a small percentage of these are aetiological agents (Haffajee and Socransky, 2005).47

Review of Literature

Studies conducted in the 1930s to 1970s were unable to identify specific bacteria as etiological agents of periodontal diseases. Non-specific theory was suggested, which hypothesized that periodontal disease is due to a consortium of microorganisms rather than the importance of any bacterial species as the sole causative agents (Theilade, 1986).48 In the late 1970s and after, more specific microorganisms were isolated as etiological agents of periodontitis (Tanner et al., 1979, Slots et al,

1986, Moore and Moore, 1994).49,50,51

Haffajee and Socransky et al., in 1994 adapted Koch’s postulates for use in the identification of periodontal pathogens.52 Based on the criteria proposed by them, the consensus report of the 1996 World Workshop in Periodontics identified three species,

A.actinomycetemcomitans, P.gingivalis and Bacteroides forsythus as causative factors for periodontitis.

It has recently been shown that putative periodontal pathogens such as A. actinomycetemcomitans, P.gingivalis, P.intermedia, Campylobacter rectus and

Peptostreptococcus micros are commonly recovered from saliva (von Troillinden et al. 1995)53.

Data from polymerase chain reaction (PCR)-based diagnostics suggesting that the use of whole saliva may be superior to pooled periodontal pocket samples for the detection of periodontal pathogens like P.gingivalis, P.intermedia, Provotella nigrescens and T.denticola (Umeda et al. 1998). Using only sequence analysis of 16S rRNA, previously characterized, as well as a number of previously uncultured and uncharacterized, bacterial species have recently been identified in saliva from healthy individuals and patients with periodontitis (Sakamoto et al. 2000)54.

Review of Literature

Porphyromonas gingivalis

P.gingivalis is one of the prime etiological agents in the pathogenesis and progression of the inflammatory events of periodontal disease.55 It is a non-motile, asacharolytic, gram-negative, obligate anaerobic rod which forms black-pigmented colonies on blood agar plates and has an absolute requirement for iron in its growth. It was formerly named as Bacteroides gingivalis prior to its reclassification as a new genus, Porphyromonas.56 This periodontopathic bacterium was found in about 85.75% of subgingival plaque samples from patients with chronic periodontitis.57

The number of P.gingivalis has been shown to increase substantially in sites with periodontitis and lesser or non-detectable in sites with plaque-associated gingivitis

(Schmidt et al., 2014).58 It usually resides in higher proportion in deep than in shallow periodontal pockets (Ali et al., 1996).59

A study by Bodet et al., (2006)60 demonstrated that P.gingivalis is associated with Treponema denticola (T. denticola) and Tannerella forsythia (T. forsythia) to form the red bacterial complex. Immunological studies also demonstrated the presence of

P.gingivalis (Moore et al., 1991 and Schmidt et al., 2014).61, 58 Serum antibody levels to P.gingivalis are higher in patients diagnosed with adult periodontitis (Mahanonda et al., 1991; Casarin et al., 2010).62, 63

Griffen et al., (1998)64 demonstrated that 79% of the periodontally diseased and 25% of the healthy subjects were positive for P.gingivalis. Interestingly, the prevalence of P.gingivalis in the periodontally healthy group varied substantially with race/ethnicity, occurring in 22% of Caucasians, 53% of African–Americans and 60% of Asian–Americans.

Review of Literature

Aggregatibacter actinomycetemcomitans

Aggregatibacter actinomycetemcomitans is a non-motile, gram-negative, capnophilic, fermentative coccobacillus. Since long time A.actinomycetemcomitans

(Aa) has been considered the primary pathogen for aggressive periodontitis, especially in its localized form. Six serotypes of Aa (a, b, c, d, e, and f) are described based on the composition of O polysaccharide of their lipopolysaccharide and there are phenotypically non serotypable strains of Aa which lack expression of serotype-specific polysaccharide antigen. A highly leukotoxic clonal type of Aa serotype b was first isolated, in the early 1980s, from an 8-year-old male child with localized aggressive periodontitis(LAP)65

Prevalence of Aa in LAP varies from 70 to 90%,66,67. However, there are studies which states there is no association between Aa and the periodontal disease. Rather prevalence of significant levels of P.gingivalis, T.denticola and P.intermedia are associated with aggressive periodontitis.

In a study done by Takeuchi for detection of microorganisms in sub gingival flora of Japanese population using polymerase chain reaction (PCR) it was found that the prevalence of Aa was less in patients with LAP whereas elevated levels of

P.gingivalis, Tannerella forsythia, T.denticola, P.intermedia and Campylobacter rectus was detected.68

Prevotella intermedia

Prevotella strains are Gram-negative, non-motile, singular cells that thrive in anaerobic growth conditions. Prevotella intermedia is a major bacterial periodontal pathogen in humans together with P.gingivalis and A.actinomycetemcomitans69.

Review of Literature

P.intermedia is often recovered from subgingival plaque in patients suffering from acute necrotising gingivitis, pregnancy gingivitis and chronic periodontitis70.

Recently, P.intermedia was reported to be found in 14% of adult population in

Finland and there was association between the carriage of this species and the number of teeth with deepened periodontal pockets71.

Triponema denticola

Treponema denticola is a Gram-negative, obligate anaerobic, motile and highly proteolytic spirochete bacterium. Triponema denticola was also reported to increase susceptibility to gingival inﬂammation72. This microorganism is frequently isolated from humans with chronic periodontitis73 and is co-isolated with P.gingivalis and Tannerella forsythia74. The consortium of these species is known as the red complex75. These epidemiological data agree with synergistic bioﬁlm formation of T. denticola with P. gingivalis in vitro. A detailed description of the role of T. denticola in the development of periodontitis was provided in a study by Ellen & Galimanas 76.

A recent report indicated that elevated levels of salivary matrix metalloproteinase and

T. denticola bioﬁlm levels displayed robust combinatorial characteristics in predicting periodontal disease severity 77.

It was reported that the levels of serum antibody to T. denticola were elevated in patients with chronic periodontitis. T. denticola was reported to induce a strong antibody response in young adult patients with localized juvenile periodontitis

(aggressive periodontitis)

Review of Literature

Microbial tests

The gold standard traditional culture methods have inherent advantages, but have shortcomings, including the need to preserve bacterial vitality, the inability to detect low numbers of microorganisms with a detection limit averaging 103 to 104 bacterial cells, labour intensiveness, need for experienced personnel, strict sampling, transport conditions and a prolonged period of time before results (Armitage 1996)78

The microbiological tests such as dark field microscopy are not able to detect the non-motile periodontal pathogen, and immunodiagnostic methods like immunofluorescence assay, flow cytometry, etc and enzymatic assays lead to false positive results and cross-reactions79. Polymerase chain reaction (PCR) overcomes the above limitations and is capable of detecting even one copy of the searched Deoxyribo

Nucleic Acid (DNA) targets from clinical microbiologic samples.80

History of Polymerase Chain Reaction

The field of human genetics started on when DNA was first isolated by Johann

Friedrich Miescher in 1869 and the double helix structure of DNA was first described by Watson and Crick in 1953.81 In 1975, Southern blotting technology was used for genetic analysis. Its adaptation Restriction fragment length polymorphism was developed in 1980 by Ray White (Tilstone et al., 2006).82

One of the most important revolutionary techniques in molecular biology, the

PCR was introduced by Kary Mullis et al in 1983 and he won the Noble prize in

Chemistry in 1993 for its discovery. They developed it as a rapid and two times sensitive procedure than standard Southern blotting for the detection of the sickle cell mutation which is the first application of PCR in the field of medicine.83

Review of Literature

This molecular technique, invented three decades ago, now has revolutionized various fields. In dentistry, as early as 1992, PCR was used to identify DNA from human tooth pulp tissue for use in forensic dentistry.

In periodontics, Watanabe and Frommel (1993) utilized PCR for the identification of periodontal pathogen P. gingivalis in oral plaque samples.84

Various derivatives of conventional PCR including nested PCR, multiplex-

PCR, reverse transcriptase PCR , allele-specific PCR and quantitative PCR (qPCR) or real-time PCR subsequently evolved playing significant role in the field of

Periodontology (Leys et al., 1994, Riggio et al., 1996, Saygun et al., 2002, Kobayashi et al., 2000, Lyons et al., 2000).85,86,87,88. In 2005, open-ended PCRs were used for genome mapping of the entire bacterial spectrum in the plaque sample (Kumar et al.,

2005).89

Principles of Polymerase Chain Reaction

PCR, an in vitro technique, allow amplification and study of the genes and their

RNA transcripts obtained from various tissue sources including peripheral blood, skin, saliva, gingival crevicular fluid, semen and hair (Jordan et al 2001, Jervoe-Storm et al 2005).90,91

Each assay requires the presence of template DNA, primers, nucleotides, and

DNA polymerase. Template DNA is the identified target sequence that needs to be amplified and it ranges from 100 to 1000 base pairs in length. Primers are short, single- stranded sequences of nucleic acid (oligonucleotides) selected to specifically anneal to a particular nucleic acid target (Tille 2013).92 Primer pairs containing forward and reverse primer, each 16 to 20 base pairs in length are used (Turgeon 2011).93DNA

Review of Literature polymerase is the DNA replicating enzyme that links individual nucleotides together to form the PCR product and thus to amplify target sequences of DNA.

Nucleic acid is first extracted from the clinical sample by heat, enzymatic or chemical methods. Once it is extracted, target nucleic acid is added to the reaction mix containing primers, components to optimize polymerase activity (i.e., buffer, cation

[MgCl2], salts and deoxynucleotides) and enzymes in a test tube or 96-well plate and then placed in a thermal cycler that allows repeated cycles of DNA amplification to occur. Automated programmable thermal cyclers carry the PCR mixture through each reaction step at the precise temperature and for an optimal duration.

The process is repeated 30 times in general. At the finish of 30 cycles, the reaction mixture contains about 230 molecules of the desired product (Turgeon 2011).93

Once amplification reactions have occurred, a variety of manual and automated methods are there to detect the amplified product (Tille 2013).92

Real-time PCR

In principle, real-time amplification is accomplished in the same manner as previously described for conventional PCR-based assays in which denaturation of double stranded nucleic acid followed by primer annealing and extension (elongation) are performed in one cycle. However, it is the detection process that differentiates real- time PCR from conventional PCR assays.

In real-time PCR assays, accumulation of amplicon is monitored as it is generated. SYBER Green I chemistry is based on the binding of SYBER Green I to a site referred to as the DNA minor groove which is present in all double-stranded DNA molecules. Once bound, fluorescence of this dye increases more than 100 fold.

Therefore, as the amount of double-stranded amplicon increases, the fluorescent signal

Review of Literature or output increases proportionally and can be measured by the instrument during elongation stage of amplification.

Principle of PCR:

Applications of PCR in Dentistry

PCR plays an important role in various fields of dentistry. The subgingival plaque, saliva, mouth wash, blood, gingival tissue and buccal mucosa scraping are used in the PCR to identify microorganisms, mRNA gene expression of various inflammatory mediators and genetic polymorphisms in dentistry.94,95,96,97,98

Review of Literature

The knowledge of the ecology of the oral cavity has been well understood using

PCR studies (Bizzarro et al., 2013).99 Real-time PCR is precise and sensitive method and it serves as a useful tool for studies on aetiology of periodontal diseases (Jervoe

Storm et al., 2005).90 Epidemiological studies based on the microbiology of dental diseases, their relation to systemic diseases and genetic polymorphisms can be established.

Dental caries pathogens can be identified by PCR and it also explains the progress of dental caries (Okada et al., 2002).100 The microorganisms responsible for endodontic infections can be identified (Bogen and Slots, 1999; Kim et al.,

2002).101,102

Genetic markers for oral cancers are identified by the PCR technique and they are used in diagnosing and predicting the outcome and response to treatment

(Murdoch-Kinch, 1999).103

Identification of microbial pathogens

Subgingival plaque is frequently used in detecting and quantifying bacterial species for the microbiological diagnosis of periodontal diseases. Paper points, scalers and dental floss have been used to sample the subgingival plaque. Moreover the technique used can affect the outcome of microbiological analysis.

In recent times, salivary analysis has been proposed as a useful future diagnostic method for periodontitis because it offers simple quantitative sampling and the possibility to assess various bacteria.

Putative perio-pathogens including P. gingivalis, A. actinomycetemcomitans, P. intermedia, T. forsythia, T. denticola, Prevotella nigrescens, Parvimonas micra,

Review of Literature

Eubacteria, Campylobacter rectus, Capnocytophaga sputigena, Capnocytophaga ochracea, and Capnocytophaga gingivalis have been detected in subgingival plaque samples.104,105,90,87,106,107

It has recently been shown that putative periodontal pathogens such as

Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Campylobacter rectus and Peptostreptococcus micros are commonly recovered from saliva (von Troillinden et al. 1995,)106. There are datas suggesting that the use of whole saliva may be superior than pooled periodontal pocket samples for detecting periodontal pathogens like P. gingivalis, P. intermedia, Prevotella nigrescens and Treponema denticola (Umeda et al. 1998)107

A PCR assay for the identification of P. gingivalis, A. actinomycetemcomitans,

P. intermedia, T. forsythia and T. denticola has been described.38, 60 The PCR technique is a more accurate, sensitive, and rapid technique in the detection, identification and quantification of periodontal bacteria. 108,109,110

Lyons et al., (2000) using real-time PCR were able to determine both the amount of P. gingivalis and the total number of bacterial cells present in plaque samples.87 Using the TaqMan system high levels of P. gingivalis were observed in several of the samples from subjects with periodontitis and none of those from healthy subjects. Real-time quantitative PCR provides a sensitive and reliable method for quantitating P. gingivalis within a complex sample.

Jervoe Storm et al., (2005) conducted a study to compare real-time PCR with conventional anaerobic bacterial cultivation and concluded that real-time PCR is a precise and sensitive tool for identification of aetiology of periodontal diseases.90

Review of Literature

Masunaga et al. (2010) used qPCR to compare the levels of P. gingivalis, T. forsythia, and T. denticola, and total bacteria detected by different sampling methods.

The numbers of total bacteria in samples of gingival crevicular fluid, saliva, and mouthwash were 105 to 106, 108, and 107, respectively, per milliliter. The number of P. gingivalis increased with worsening clinical status.111

Paster et al., demonstrated that about 40% bacterial species present to be novel species or phylotypes on the basis of 16S cloning and sequencing of human subgingival flora.112 Ghayoumi et al., (2002) using PCR identification method determined the presence of Dialister pneumosintes from periodontal pockets and implicated it as

“candidate pathogen”.113

Kumar et al., (2005) using open-ended PCR/sequencing techniques detected gram positive organisms Peptostreptococcus and Filifactor, genera Megasphaera and

Desulfobulbus, species or phylotypes of Atopobium, Campylobacter, Catonella,

Dialister, Deferribacteres, Eubacterium, Streptococcus, Selenomonas, Treponema, and

Tannerella which were elevated in periodontal disease.114

Since the bacterial pathogens are not solely responsible for the development of periodontitis, PCR is used for research purposes to determine the prevalence of various viruses - Herpes Simplex Virus, Human Papilloma Virus, Human Immuno deficiency

Virus, Human Cytomegalovirus, and Epstein-Barr Virus Type I and II in the gingival crevicular fluid in various forms of periodontal disease.115,116,88

PCR is also used to study the association of the systemic diseases such as coronary heart disease, chronic kidney disease, pregnancy complications, diabetes, respiratory disease and osteoporosis with periodontitis by identifying the periodontal pathogen levels in various tissue samples such as subgingival plaque, thrombi, coronary

Review of Literature artherosclerotic plaque, carotid endarterectomy, placenta, aortic valves, and maxillary sinus tissue/wash samples.

Figuero E et al., (2011) conducted study to detect periodontal bacteria P. gingivalis,A. actinomycetemcomitans, T. forsythia, E. corrodens, Fusobacterium nucleatum, and Campylobacter rectus in atheromatous plaque by nested PCR. 96

Mahendra et al., (2013) using PCR detected the presence of specific periodontopathogenic bacteria and confirmed that detection of red complex bacteria correlated with the severity of periodontal destruction.117

The microbial levels can be assessed following various treatment modalities and thus, can be an indicator for efficacy of treatment in chronic and aggressive periodontitis.118,, 119, 120, 121, 122

Milne et al., (2015) conducted a study to evaluate periodontopathogen levels following the use of an Er:YAG laser in the treatment of chronic periodontitis using multiplex qPCR. They found that T. denticola and T. forsythia were significantly reduced post-treatment for both Er:YAG laser and scaling and root planing.121

Diagnostic tests such as the MicroDent® Test, ParoCheck® kits, MyPerioPath®

Test and oralDNA® using multiplex PCR scheme are commercially available to assess the microbiota in subgingival plaque samples and they provide crucial information for a prevention strategy for healthy patients and treatment plans for “at risk” patients.123

Materials and methods

MATERIALS AND METHODS

Study population:

The study population was selected from the out-patient section of the

Department of Periodontics, Tamil Nadu Government Dental College and Hospital,

Chennai – 600003

Subjects:

A total of 50 subjects were included in the study. They were selected by convenience sampling. They were organized into two groups of 25 each ( A & B ) based on their oral hygiene practice as below :

Group A ( study group ) : Subjects who use Miswak stick at least once daily or more

often for the past one year.

Group B ( Control group ) : Subjects who use regular manual toothbrush and paste

atleast once daily or more often for the past one year

Study design:

The study is of cross sectional type. The study was carried out in 50 subjects

divided into 2 groups with 25 subjects in each group.

Ethical clearance was obtained from institutional ethical committee and ethical

principles were meticulously followed throughout the study.

After explaining the study protocol, informed consent was obtained from all the

selected subjects.

A thorough medical and dental history of the subjects was taken.

Materials and methods

All the subjects underwent full –mouth periodontal examination. Subjects from both

the sex were included.

Eligibility criteria:

Inclusion Criteria are as follows:-

 Subjects in the age group 20-60 years.

 Systemically healthy subjects.

 Subjects who use Miswak stick atleast once daily or more often for past one

year under Miswak group( study group ).

 Subjects who use toothbrush with paste atleast once daily or more often for

past one year under toothbrush group ( Control group ).

 Subjects with PPD equal to or lesser than 6 mm.

 Presence of at least 16 remaining teeth with a minimum of four teeth in each

quadrant.

Exclusion Criteria are as follows:-

 Subjects suffering from any known systemic diseases or are immuno-

compromised.

 Subjects who had received any surgical or non-surgical therapy six months

prior to the start of the study.

 Subjects who had received any antibiotic therapy in the last six months.

 Subjects who use tooth paste which contains herbal extracts/medication (tooth

brush group)

 Subjects who are using mouth rinses for past six months.

 Subjects with habit of betel-nut, pan masala, tobacco chewing, smoking and

alcohol consumption were excluded

Materials and methods

 Pregnant & lactating females were not included in the study

Study protocol:

1. Institutional ethical committee approval

2. Complete medical and dental history obtained.

3. Informed Consent obtained

4. Complete intra oral evaluation

5. Periodontal Examination using clinical parameters namely Sulcus Bleeding

Index, Plaque Index, Probing Pocket Depth and Clinical Attachment Level.

6. Salivary sampling done for microbial analysis

7. Microbiological evaluation .

Armamentarium:

For clinical examination and indices evaluation :

 Mouth mirror

 William’s periodontal probe

 Curved explorer

 Dental tweezers

 Kidney tray

 Cotton roll

 Sterile disposable gloves.

 Disposable facemask

 Disposable headcap

 Patient apron

Materials and methods

For salivary sample collection:

 Mouth mirror

 Probe

 Kidney tray

 Disposable syringe

 Nitrile gloves

 Microcentrifuge tube

CLINICAL PARAMETERS:

Plaque index (Silness and Loe, 1964)124

Teeth examined – All teeth

Surfaces examined – 4 sites for each tooth (disto-facial, facial, mesio-facial, lingual/palatal)

Criteria for Scoring

Score 0 – No plaque in the gingival area.

Score 1 – A film of plaque adhering to the free gingival margin and adjacent area of the

tooth. The plaque may only be recognized by running a probe across the tooth

surface.

Score 2 – Moderate accumulation of soft deposits within the gingival pocket, on the

gingival margin and/or adjacent tooth surface, which can be seen by the naked

eye.

– Abundance of soft matter within the gingival pocket and/or on the gingival

Score 3 margin and adjacent tooth surface.

Materials and methods

Calculation:

Plaque index for a tooth = Total score from 4 areas of each tooth/ 4

Plaque index for the individual = Total Plaque index of each tooth / Number of teeth examined

Interpretation of Plaque index score:

0 – Excellent oral hygiene

0.1 to 0.9 – Good oral hygiene

1.0 to 1.9 – Fair oral hygiene

2.0 to 3.0 - Poor oral hygiene

Sulcus Bleeding index (Muhlemann and Son, 1971)125

Sulcus Bleeding Index is performed through gentle probing of the orifice of the gingival crevice. Bleeding after probing to the base of the probable pocket is recorded.

Criteria for Scoring:

Score 0 – Gingiva of normal texture and colour, no bleeding on probing;

Score 1 – Gingiva apparently normal, bleeding on probing;

Score 2 _ Bleeding on probing, change in colour, no oedema;

Score 3 _ Bleeding on probing, change in colour, slight oedema

Score 4- either:

a) Bleeding on probing, change in colour, obvious oedema

b) Bleeding on probing, obvious edema

Materials and methods

Score 5 - Bleeding on probing and spontaneous bleeding, change in colour, marked oedema

Calculation:

Sulcus Bleeding index for a tooth = Total score from 4 areas of each tooth/ 4

Sulcus Bleeding index for the individual = Total Sulcus Bleeding index of each tooth

/ Number of teeth examined

Probing Pocket Depth126

Probing Pocket Depth was measured in millimeter (mm) from the gingival margin to the base of the pocket using William’s Periodontal Probe. The probe was passed within the gingival sulcus along the circumference of the tooth.

Three measurements were made on the buccal aspect and three on lingual aspect of each tooth – total of six sites per tooth (mesiobuccal, midbuccal, distobuccal, mesiolingual, midlingual, distolingual).

Clinical Attachment Level126

Clinical attachment level was measured from the cemento–enamel junction

(CEJ) to the base of the pocket using William’s periodontal probe.

 When the gingival margin was located on the anatomic crown, the level of the

attachment was determined by subtracting from the probing pocket depth, the

distance from the gingival margin to the CEJ. If both were the same, the loss

of attachment was calculated to be zero.

 When the gingival margin coincided with the CEJ, the loss of attachment was

calculated as equaling the probing pocket depth.

Materials and methods

 When the gingival margin was located apical to the CEJ, the loss of attachment

was greater than the probing pocket depth and therefore the distance between

the CEJ and the gingival margin were added to the PPD.

Three measurements were made on the buccal aspect and three on the lingual aspect of each tooth – total of six sites per tooth (mesiobuccal, midbuccal, distobuccal, mesiolingual, midlingual, and distolingual).

Sampling for Quantitative PCR Microbial Analysis:

Patients were asked to report in the morning in empty stomach. 2 ml of unstimulated saliva was collected using a sterile disposable syringe without needle in sterile microcentrifuge tube and kept over dry ice and transported to the microbiological laboratory for analysis.Microbial levels of P.gingivalis, T.denticola,

P.intermedia and A.actinomycetamcomitans, was assessed by quantitative PCR technique at Enable Biolabs, Oorappaakkam ,Chennai.

Microbial analysis of salivary samples:

DNA extraction

Salivary samples collected in DNA extraction buffer containing 100mM of

Tris (pH8), 25mM EDTA and 2% SDS were digested with 10mg/ml of lysozyme

(Cat#L6876, Sigma-Aldrich, USA) at 37°C for 30 minutes. Following cell lysis 20mg

/ ml of Proteinase K (Cat#P8038-50MG, Sigma-Aldrich, USA) was added and the lysates were incubated at 57°C for 2 hours to digest all protein components present in the lysate. Subsequently, the lysates were transferred to DNA extraction columns as per recommendation of the manufacturer after addition of binding buffer (Cat# 51104,

Qiagen). The total amount of DNA present in each of the sample was quantified with

Qubit fluorometer (Life Technologies, USA).

Materials and methods

Amplification and quantitation of P. gingivalis, T. denticola, P. intermedia and

A.actinomycetamcomitans

In order to identify the quantitative presence of P. gingivalis, T. denticola, P. intermedia and A. actinomycetamcomitans in the saliva samples of patients who were either using regular brushing technique or Miswak sticks routinely to maintain oral hygiene were selected. 2.5ng of total DNA was subjected to quantitative PCR with species specific primers. The following set of primers that are present within the 16S rRNA gene were used for each of the species:

P.gingivalis:

Forward: TGTAGATGACTGATGGTGAAAACC,

Reverse: ACGTCATCCCCACCTTCCTC

T.denticola:

Forward: TGTAGATGACTGATGGTGAAAACC,

Reverse: ACGTCATCCCCACCTTCCTC

P.intermedia:

Forward: CCACATATGGCATCTGACGTGGAC,

Reverse: CCCGCTTTACTCCCCAACAA

A.actinomycetamcomitans:

Forward: ATTGGGGTTTAGCCCTGGTG,

Reverse: ACGTCATCCCCACCTTCCTC

Materials and methods

10µM of each of the above primers were added to HRM Eva-green RT-Master Mix

(Cat# 206542, Qiagen, Germany) in 20µl reaction, and samples were analyzed in

Rotor Gene Q real time PCR equipment (Qiagen, Germany). The following amplification condition was used: after an initial denaturation at 95°C for 10 min, samples were amplified for 25 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 30 s.

The following six standards were used to identify the copy number of amplicons in each of the sample – 106, 105, 104, 103, 102 and 101.

Q PCR components:

Composition Volume

(in µl)

HRM master mix 10.0

10µM Forward primer 1.4

10µM Reverse primer 1.4

DNA template 2.0

Nuclease Free Water (NFW) 3.2

Total 20.0

The concentration of DNA template was 2.5ng/20μl reaction.

Data analysis:

The quantification of each of the four bacteria under study was calculated with in-system software in reference to standards, and presence of bacteria was expressed as copy numbers.

Materials and methods

Establishment of standards for quantitative real time PCR:

In order to quantitatively determine the copy numbers of each of the bacteria

(relative to each other and among the samples), a standard curve has been established.

Briefly, serial dilutions of 139bp PCR product amplified from E.coli bacterial species

DNA was made and the quantity of each standard was expressed as copy number starting from 1 x 106 to 1 x 101. The performance of the standard curve was confirmed in independent reactions with HRM Eva-green RT-Master Mix (Cat# 206542, Qiagen,

Germany) in 20µl reaction in Qiagen 5-plex rotor gene real time PCR system. The samples were amplified for 25 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 30 s.

Photographs

Photograph 1 : Miswak Tree

Photograph 2: Miswak Twig

Photographs

Photograph 3: Armamentarium for periodontal examination

Photograph 4: Armamentarium for salivary sample collection

Photographs

Photograph 5 : Salivary sample collection

Photograph 6 : Armamentarium for DNA extraction

Photographs

Photograph 7 : Samples being homogenized in microfuge tubes

Photograph 8 : Enzymes and reagents in -20°C cooler

Photograph 6: Dry heat incubator

Photographs

Photograph 9 : Dry heat incubator

Photograph 10 : Qubit fluorometer

Photographs

Photograph 11 : Vortex mixer

Photograph 12 : Micro centrifuge

Photographs

Photograph 13 : Rotor Gene Q Real Time PCR

Photograph 14 : Buccal and Lingual surfaces of Miswak user 1

Photograph 15 : Buccal and Lingual surfaces of Miswak user 2

Statistical Analysis

STATISTICAL ANALYSIS

The statistical analysis was done using the computer software program SPSS version 20.0 (Statistical package for social science version 20). Data is expressed as mean ± standard deviation for the clinical parameters evaluated. As the frequency distribution of data regarding microbiological parameters is skewed, median is the preferred mode of central tendency than mean.

Clinical parameters were analysed using independent sample t test.

Microbiological data were analysed using Mann-Whitney test. In the above statistical tool, the probability value p ≤ 0.05 was considered as significant.

P value:

Two hypotheses were set in the beginning. The first is the null hypothesis, which assumes that the mean of two paired samples are equal. The second hypothesis is an alternative hypothesis, which assumes that the means of two paired samples are not equal. The level of significance was set at 5%. The p value or calculated probability was the estimated probability of rejecting the null hypothesis of a study question when that hypothesis was true. The smaller the p-value, the more significant the result was said to be. Differences between the two populations were considered significant when p ≤ 0.05.

Statistical Analysis

STATISTICAL FORMULAE USED FOR DATA ANALYSIS

Independent sample t test formula:

Mann Whitney U Test:

Results

RESULTS

The present clinical study was designed to assess and compare the salivary microbial levels of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans in habitual Miswak stick users and regular toothbrush users and also to assess relationship of microbial levels of

Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and

Aggregatibacter actinomycetemcomitans and periodontal status in these individuals.

Fifty subjects in the age group between 20 to 60 years were included in the study. The observations and results of clinical parameters and microbial parameters of the 50 subjects are summarized in the tables and figures.

Table–I : Comparison of mean scores in whole mouth plaque index, whole mouth bleeding index, whole mouth probing pocket depth, whole mouth clinical attachment level between Miswak users and tooth brush users and their significance.

Table–II : Independent sample t test was used to statistically analyse the comparison of PI, SBI, PPD, CAL between Miswak and tooth brush users

Table–III : Comparison of q PCR data of Porphyromonas gingivalis, Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans between

Miswak users and tooth brush users

Table-IV : Comparison of mean and median scores of, Porphyromonas gingivalis,

Treponema denticola, Prevotella intermedia and Aggregatibacter actinomycetemcomitans between Miswak users and tooth brush users

Results

Table-V : Mann-Whitney test which was used to statistically analyse the comparison of microbiological levels of Porphyromonas gingivalis, Treponema denticola,

Prevotella intermedia and Aggregatibacter actinomycetemcomitans between Miswak users and tooth brush users

Table VI : Shows the statistical significance obtained in Mann- Whitney test

Clinical parameters:

1. Plaque index:

Whole mouth: The mean plaque index score of Miswak users was 1.14±0.63 and tooth brush users was 0.74±0.23 and the mean difference was statistically significant(p=0.005)

2. Sulcus bleeding index:

Whole mouth: The mean sulcus bleeding index score for Miswak users was

1.70±1.00,and tooth brush users was 0.93±0.27 and the mean difference was statistically significant (p=0.001)

3. Probing pocket depth:

Whole mouth: The mean probing pocket depth for Miswak users was 3.31±0.93 and tooth brush users was 3.16±0.74 and the mean difference was statistically not significant (p=0.551)

Results

4. Clinical attachment level:

Whole mouth: The mean clinical attachment level for Miswak users was 3.62±0.73 and tooth brush users was 3.43±0.76 and the mean difference was statistically not significant (p=0.397)

5. Microbial parameters:

The quantitative presence of P. gingivalis, T. denticola, P. intermedia and

A.actinomycetamcomitans in the salivary samples were identified by subjecting the salivary samples to quantitative PCR with species specific primers.

As the frequency distribution of the data was skewed median was chosen as the central tendency measure instead of mean.

Comparison of levels of P. gingivalis between Miswak users and tooth brush users

The median bacterial count of P.gingivalis among Miswak users was 9812 and the tooth brush users was 7894 and the difference was statistically significant(p=0.046)

Comparison of levels of T. denticola between Miswak users and tooth brush users

The median bacterial count of T.denticola among Miswak users was 1900 and the Tooth brush users was 3793 and the difference was statistically not significant(p=0.304)

Comparison of levels of Aa between Miswak users and tooth brush users

The median bacterial count of Aa among Miswak users was 3762 and the tooth brush users was 3498 and the difference was statistically not significant(p=0.816)

Results

Comparison of levels of P. intermedia between Miswak users and tooth brush users

The median bacterial count of P. intermedia among Miswak users was 3450 and tooth brush users was 4352 and the difference was statistically not significant(p=0.839)

Table – I: Comparision of mean scores of clinical parameters between Miswak Users and Toothbrush Users

Miswak Users ( n=25 ) Toothbrush Users ( n=25 ) Clinical Paramaters P Value Mean SD Mean SD

Plaque Index 1.14 0.63 0.74 0.23 0.005

Bleeding Index 1.70 1.00 0.93 0.27 0.001

Probing Pocket Depth 3.31 0.93 3.16 0.74 0.551

Clinical Attachment 3.62 0.73 3.43 0.76 0.397 loss

Table – II : Independent Samples Test for clinical parameters

Levene's Test for Equality of

Parameters Variances t-test for Equality of Means 95% Confidence Sig. (2- Mean Std. Error Interval of the F Sig. t df tailed) Difference Difference Difference

PI Equal variances 19.082 .000 2.978 48 .005 .40000 .13431 .12996 .67004 assumed

Equal variances 2.978 30.101 .006 .40000 .13431 .12574 .67426 not assumed

BI Equal variances 99.907 .000 3.707 48 .001 .77600 .20931 .35516 1.19684 assumed

Equal variances 3.707 27.539 .001 .77600 .20931 .34693 1.20507 not assumed

PPD Equal variances 1.628 .208 -.601 48 .551 -.14320 .23820 -.62214 .33574 assumed

Equal variances -.601 45.643 .551 -.14320 .23820 -.62278 .33638 not assumed

CAL Equal variances .077 .783 -.855 48 .397 -.18000 .21054 -.60332 .24332 assumed

Equal variances -.855 47.907 .397 -.18000 .21054 -.60334 .24334 not assumed

Table –III :Comparison of Q PCR data of micro organisms between Miswak and tooth brush users

P.Gingivalis T.Denticola A.a P.Intermedia S No Tooth Tooth Tooth Tooth Miswak Miswak Miswak Miswak Brush Brush Brush Brush 1 16021 9214 3793 0 9384 19102 3475 5574 2 9540 59114 84 3948 7529 8465 6759 8934 3 18099 25839 7717 478 5329 4957 0 6797 4 1222 62764 8993 1928 239 3762 487 4578 5 4568 9812 64253 0 7243 12576 4521 3269 6 8743 238 5668 34784 1938 0 9102 9836 7 2387 20225 467 325 9348 946 2534 4560 8 98 36627 0 2894 0 9835 4352 762 9 12398 234 19485 298 429 8734 23 459 10 32189 2084 0 47891 5949 5342 8976 1432 11 2937 12617 35 4982 38249 3320 730 2390 12 7894 3469 509 980 874 0 324 5329 13 43 14872 34758 0 2433 1672 4723 3450 14 9872 3579 9841 8764 3498 3327 5649 0 15 6724 8921 209 7653 485 2736 4891 0 16 5623 12321 1243 8234 3560 1002 345 1200 17 8234 5623 4564 2312 6000 123 90 234 18 9324 9234 2145 1900 10000 6500 5003 5678 19 5123 10232 49 100 120 7600 6704 6700 20 9569 8798 6002 2367 200 500 30 345 21 6321 9236 2103 180 1234 7600 8002 7654 22 8243 11002 1467 5000 90 80 367 216 23 5324 7602 4500 80 2000 6890 9001 8102 24 7012 13212 5000 70 6500 342 234 435 25 8132 10231 10000 1230 10000 7001 9035 9101

Table – IV: Comparison of mean and median of q PCR data between Miswak and tooth brush users

Toothbrush Users ( n=25 ) Micro Miswak Users ( n=25 ) Organisms Mean SD Median Mean SD Median P.Gingivallis 14684.00 15976.70 9812.00 8225.60 6606.23 7894.00

T.Denticola 5455.90 11286.90 1900.00 7715.40 14034.50 3793.00

Aa 4896.50 4674.84 3762.00 5305.20 7711.97 3498.00

P.Intermedia 3881.40 3319.93 3450.00 3814.12 3411.03 4352.00

Table V: Comparison of mean ranks and sum of ranks between Miswak users and tooth brush users

Miswak Users ( n=25 ) Toothbrush Users ( n=25 ) Micro Organisms Sum of Mean Ranks Sum of Ranks Mean Ranks

P.Gingivallis 29.62 740.50 21.38 534.50

T.Denticola 23.38 584.50 27.62 690.50

Aa 25.98 649.50 25.02 625.50

P.Intermedia 25.92 648.00 25.08 627.00

TableVI: Comparison of Mann –Whitney U test statistics between the four tested micro organisms and its significance

Tests P.Gingivallis T.Denticola Aa P.Intermedia

Mann-Whitney U 209.5 259.5 300.5 302

Wilcoxon W 534.5 584.5 625.5 627

Z -1.999 -1.029 -0.233 -0.204

Asymp. Sig. (2-tailed) 0.046 0.304 0.816 0.839

Figure 1: Comparison of mean scores in whole mouth plaque index between Miswak stick users and tooth brush users.

1.2

0.8

Mean PI 0.6 Miswak Users Scores Tooth Brush 0.4

0.2

0 PI

Figure 2: Comparison of mean scores in whole mouth bleeding index between Miswak stick users and tooth brush users.

1.8 1.6 1.4 1.2 1 Mean BI Miswak Users Scores 0.8 Tooth Brush 0.6 0.4 0.2 0 BI

Figure 3: Comparison of median scores of micro biological counts of P.Gingivallis, T.Denticola, Aa,P.Intermedia between Miswak stick users and tooth brush users.

12000

10000

8000

6000 Miswak Tooth Brush 4000

2000

0 P gingivalis T denticola Aa P intermedia

Figure 4: Real time PCR results of microbial count of P.Gingivallis in salivary samples

Figure 5: Real time PCR results of microbial count of T.Denticola in salivary samples

Figure 6: Real time PCR results of microbial count of Aa in salivary samples

Figure 7: Real time PCR results of microbial count of P.Intermedia in salivary samples

Figure 8: Raw Data For Cycling A.Green

Figure 9 : Quantitation data for Cycling A.Green

Figure 10 : Standard Curve

Discussion

DISCUSSION

The present study assessed and compared the levels of four bacterial species which are periodontal pathogens namely P. gingivalis, T. denticola , A. actinomycetemcomitans and P. intermedia in salivary samples of habitual Miswak stick users and toothbrush users. The high light of our present study is the people included in the Miswak group were the subjects who uses only Miswak stick as their oral hygiene aid which is a very rare sample nowadays. The bacterial species were identified and quantified by using polymerase chain reaction technique. Our results based on q PCR data showed that P. gingivalis and A. actinomycetemcomitans were higher in Miswak users than in tooth brush users group. T. denticola and P. intermedia were higher in toothbrush users than in Miswak users group. We had statistically significant results with respect to P. gingivalis. Results of this study implies that some chemical constituent of Miswak has inhibitory effect on both T. denticola and P. intermedia.

Miswak is a traditional oral hygiene aid that is used commonly by natives of several African and Middle Eastern countries. Many epidemiological studies have proved beneficial effects of Miswak use on the prevalence of dental caries and periodontal diseases (Younes & Al-Angbawi 1982, AlKhateeb et al. 1991, Darout et al. 2000a)127,128,129. Some Invitro studies have proved that Miswak contains substances that have antibacterial effects (Al Laﬁ & Ababneh (1995), Abd El Rahman 2000, Wu et al. 2000)130,131,132,.

In the present study ,subjects with generalised probing pocket depth equal to or greater than 6mm were not included to standardise the periodontal status between

Miswak and tooth brush users. A high percentage of the subjects had demonstrable salivary levels of all the four bacterial species evaluated in our study. This is similar to

Discussion the previous reports showing regular detection of various bacterial species in saliva

(Könönen et al. 1994, Danser et al. 1994, Umeda et al. 1998)133,134,135.

In the present study, it was found that all the tested periopathogens were high even in apparently healthy mouth which implies that mere presence of periopathogens is not sufficient to produce periodontitis. Host related factors are essential for periodontal destruction to occur

Miswak has some unique aspects which has to be adapted prior to use for the best results. The functional end of a slender bark piece is striped off ,then chewed.

Chewing separates fibers and gives a brush like appearance that aids in cleaning the teeth and massaging the gums. The suggested length for a stick is about 15 cm so that it can be grasped easily along with ease to carry around, whereas, the diameter is preferred to be less than 1 cm136.

Two methods are documented to hold the Miswak. They are three finger grip technique and five finger grip technique. The aim of these techniques is to make all the surfaces of the teeth accessible. It also ensures convenient cleaning and controlled movements of the stick in the oral cavity. While cleaning the tooth surfaces, the fibers of Miswak should be held at right angles to the tooth surface and gradually moved in vertical strokes, directed away from the gingiva on both the buccal and lingual surfaces

(Almas K 1995) 136 .

Miswak should be fresh so that it is supple, easily chewed, and also rich in active constituents. Fresh Miswak is light brown in colour while dry Miswak is dark brown

(Abo Al-Samh D. and Al-Bagieh N; 1996) 137. Dry Miswak can damage the gums and other oral tissues. Dry Miswak should be soaked in fresh water before use. However

Discussion soaking for long periods causes loss of active constituents and reduces the therapeutic properties. Miswak should be kept in a moist place when not in use.

In the present study it was found that plaque index and bleeding index was slightly higher in Miswak users than in tooth brush users. Both Miswak and toothbrush have bristles and are used for mechanical removal of plaque from the tooth surfaces.

But the bristles of the Miswak lie in the same long axis as its handle. The angulation of bristles in the toothbrush enables it to adapt more easily to the distal and lingual tooth surfaces (Al-Lafi T 1988) 138. In our study it was found that plaque index and bleeding index was slightly higher in Miswak users than in tooth brush users. Photographs 14 and 15 shows the oral hygiene level of two Miswak users who use only Miswak stick as their oral hygiene aid. Photograph 14 shows that the buccal surfaces of teeth are meticulously clean whereas the lingual surfaces are with more calculus. Photograph 15 shows that both buccal and lingual surfaces are clean .This difference can be attributed to two reasons. One is the difference in the type of the stick; former used a fresh and supple stick while the later used a dry and old stick. The other reason may be the difference in the manual dexterity.

Mechanical removal of plaque is similar with the toothbrush and the chewing stick, through vertical and horizontal brushing. However, techniques are less important when compared to people's attitudes, knowledge and manual dexterity.

Miswak is organic and biodegradable whereas plastic tooth brushes causes tonnes of landfills every year. Tooth brush is generally used along with tooth paste for brushing. After brushing, the paste is spitted out considering the systemic toxicity of

Discussion the ingredients, but the juice of the Miswak stick is sucked during brushing and also habitually. This has systemic effects.

In a study, comparing the efficacy of Miswak and toothbrush , they found that with the use of Miswak there was a significant reduction of dental plaque and gingivitis.

There was also a comparable or superior oral hygiene effect in Miswak users.(

Danielsons B; 1989) 139 . It was also reported that the habitual Miswak users had lower gingival bleeding (Gazi M et al;1990) 140

A study was conducted among 213 males, with age range of 20 to 65 years, to evaluate the periodontal status of Miswak and toothbrush users. They stated that periodontal status of Miswak users in Sudanese population is better than that of toothbrush (Darout IA et al; 2000)141 . In a single-blind cross-over clinical study, after professional instruction of the proper usage of Miswak and toothbrush, Miswak was found to be more effective than use of tooth brush for reducing plaque and gingivitis in a sample of male Saudi Arabians (Al-Otaibi M; 2003) 142

In the present study, a co-relation between the PPD and P.gingivalis count has been identified. Mean PPD of Miswak users was slightly higher than the tooth brush users. There is a statistically significant increase in P.gingivalis count in Miswak users compared to tooth brush users. However this co-relation should be confirmed in a larger size samples. It was found that clinical attachment loss though statistically not significant, was more in Miswak users which may be attributed to the usage of dry stick and improper technique. A study reported that about 22% of the Saudi school children with gingival recession used Miswak (Younes SA and El Engebawi MF; 1983)

143. This group had minimal calculus deposits which may be due to the use of Miswak.

It is reported that Miswak users had considerably more sites of gingival recession than

Discussion the toothbrush users. In addition, the severity of the recession was more pronounced in the Miswak users than in the toothbrush users (Eid MA et al; 1991) 144. However, the gingival recession stated in Miswak users may be due to poor techniques.

The results of our study should be interpreted with some caution, considering the limited number of participants in the study. An increased number of individuals might have revealed more significant differences than were found among these 25 subjects. Darout et al 2000145 interpreted the reduction of some bacterial species by the presence of several anionic components of Miswak, which had potent promoter effects on hydrogen peroxide antimicrobial system and salivary peroxidase thiocyanate system.

Sofrata et al 2008146 reported that Miswak embedded in agar or suspended above the agar plate had strong antibacterial effects against all tested bacterias. The antibacterial effect of suspended Miswak pieces suggests the presence of volatile antibacterial compounds

Saleh A Mohamed and Jalaluddin A Khan 2013147 stated that Furan derivatives, identified by GC-MS analysis, from Miswak could exhibit high antioxidant activity by scavenging DPPH radicals, ABTS radicals and reducing molybdenum (VI) to molybdenum (V). The antioxidant capacity of Miswak was due to the presence of antioxidant enzymes, catalase, peroxidase, and polyphenoloxidase. The combined actions of antioxidant compounds and antioxidant enzymes make Miswak a good chewing stick for cleaning teeth, and an oral hygiene aid .

Limitation of our present study is the sample size. Increasing the sample size may give statistically significant results. Adding another group which uses both

Discussion

Miswak and tooth brush as their oral hygiene aid could have given an idea if Miswak could be an adjuvant to tooth brush. In vitro studies to extract the phytochemicals of

Miswak should be done for betterment of our knowledge

Summary and Conclusion

SUMMARY AND CONCLUSION

Comparison of salivary microbial levels of Porphyromonas gingivalis,

Treponema denticola , Prevotella intermedia and Aggregatibacter actinomycetemcomitans between habitual Miswak stick users and regular toothbrush users have been carried out with 25 subjects in each group. The clinical parameters such as plaque index, sulcus bleeding index, probing pocket depth, clinical attachment level and the estimation of microbiological parameter P. gingivalis, T.denticola,

P.intermedia, A actinomycetemcomitans level, by q PCR were evaluated and the following inferences were drawn:

1. Oral hygiene was better in the tooth brush users than Miswak users

2. Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans

were found in higher levels in the Miswak users.

3. Treponema denticola and Prevotella intermedia were found in higher levels

in tooth brush users

4 Miswak has some chemical constituent which inhibits the growth of

T.denticola and P.intermedia

Within the limits of present study, it can be concluded that tooth brush is better than Miswak stick in maintaining oral hygiene. Tooth brush users had significantly lower counts of P.Gingivalis. Miswak has some chemical constituent that inhibits Treponema denticola and Prevotella intermedia. Lower counts of

Treponema denticola and Prevotella intermedia in Miswak users who uses only

Miswak stick as their oral hygiene aid strongly recommends invitro studies to explore the phytochemical constituents of Miswak. Disadvantage of gingival recession in

Summary and Conclusion

Miswak stick usage can be overcome by using paste or mouthrinse formulations with extracts of Miswak, at the same time without compromising its antibacterial properties. Furthermore, clinical studies with larger sample size comparing clinical, microbiological parameters are required.

Bibliography

REFERENCES

1. Aas AJ, Paster BJ, Stokes LN, Olsen I, Dewhirst FE. Defining the normal beneficial

flora of the oral cavity. J Clin Microbiol 2005;43:5721-5732.

2. Haffajee AD, Socransky SS. Microbiology of periodontal diseases:introduction.

Periodontol 2000, 2005;38:9-12.

3 Newman,M.G;Socransky,S.S.;Savitt,E.;Propas,D.;Crawford,A.A.Studies of

microbiology of periodontitis. J.Periodontol.,47:373-379, 1976.

4 Gazi MI , Cox SW, Clark DT, Eley BM (1997). Characterization of protease

activities in Capnocytophaga spp., Porphyromonas gingivalis, Prevotella spp.,

Treponema denticola and Actinobacillus actinomycetemcomitans. Oral Microbiol

Immunol 12:240-248.

5 Van der Velden, U., van Winkelhoff, A. J., Abbas, F. & de Graaff, J. (1986) The

habitat of periodontopathic microorganisms. Journal of Clinical Periodontology 13,

243– 248.

6 Hassan suliman halawany.A review on miswak(salvadora persica)and its effect on

various aspects of oral health.The Saudi dental journal 2012;24 63-69.

7 Miswak (chewing Stick): A Cultural And Scientific Heritage, Saudi dental journal

1999,vol 11,no 2,80-88

8 Könönen, E., Asikainen, S., Saarela, M., Karjalainen, J. & Jousimies-Somer, H.

Bibliography

(1994) The oral gram-negative anaerobic microﬂora in young children: longitudinal

changes from edentulous to dentate mouth. Oral Microbiology and Immunology 9,

136–141

9 Almas K and Al - Lafi T. The natural toothbrush. World Health Forum 1995;

16:206-10.

10 Wu, C., Darout, I., Skaug, N., 2001. Chewing sticks: timeless natural toothbrushes

for oral cleansing. J. Periodontal. Res. 36 (5), 275– 284.

11 Hattab, F., 1997. Meswak: the natural toothbrush. J. Clin. Dent. 8 (5), 125–129.

12 Elvin-Lewis, M., 1982. The therapeutic potential of plants used in dental folk

medicine. Odontostomatol. Trop. 5 (3), 107–117.

13 Farooqi MIH and Srivastava JG. The toothbrush tree (Salvadora persica). Quart. J.

Crude Drug Res. 1968;8:1297-99.

14 Gerrit Bos. The Miswak, an aspect of dental care in Islam. Medical History 1993;

37:68-79.

15 Miswak (chewing Stick): A Cultural And Scientific Heritage, Saudi dental journal

1999,vol 11,no 2,80-88

16 Mohammad A and Turner JE. In vitro evaluation of Saudi Arabian toothbrush tree

(Salvadora persica). Odontostomatol Trop 1983; 3:145-148.

17 Ezmirly ST and El-Nasr MS. Isolation of gluco- tropaeolin from Salvadora persica.

J Chem Soc Pak 1981; 3: 9-12.

Bibliography

18 Wattenberg LW. Inhibition of carcinogenic effects of polycyclic hydrocarbons by

benzylisothiocyanate and related compounds. J Natl Cancer Inst. 1977;58:395-8.

19 Al-Bagieh NH and Weinberg ED. Benzylisothiocyanate: a possible agent for

controlling dental caries. Microbios. 1988; 39: 143-151.

20 Brown JM and Jacobs JW. An investigation into antibacterial activity in chewing

sticks against oral streptococci. Odontostomatol Trop. 1979; 2 :25-30.

21 AI-LafiT and Ababneh H. The effect of the extract of the Miswak ( chewing sticks

) used in Jordan and the Middle East on oral bacteria. Int Dent J. 1995;45:218-22.

22 Dorland W. A. Newman. Dorland's Illustrated Medical Dictionary. 27th ed.

Philadelphia: W. B. Saunders Co., 1988

23 Almas K. Miswak (chewing stick) and its role in oral health. Postgraduate Dentist

1993; 3: 214-18.

24 Emslie, R., 1966. A dental health survey in the Republic of the Sudan. Br. Dent. J.

120 (4), 167–178.

25 Lewis WH and Elvin-Lewis MPF. Oral Hygiene, Medical Botany, John Wiley &

Sons, New York, 1977:226-270.

26 Akpata, E., Akinrimisi, E., 1977. Antibacterial activity of extracts from some

African chewing sticks. Oral Surg. Oral Med. Oral Pathol. 44 (5), 717–722.

27 Baghdady, V. S. & Ghose, L. J. (1979) Comparison of the severity of caries attack

in permanent ﬁrst molars in Iraqi and Sudanese schoolchildren. Community

Dentistry and Oral Epidemiology 7, 346–348.

28 Hayes AG, Tyers MB. Determination of receptors that mediate opiate side effects

in the mouse. Br J Pharmacol 1983;79:731-6.

Bibliography

29 Chawla Hs. A new natural source for topical fluoride. J Indian Dent Assoc 1983;

55: 419-422

30 Gazi M. Photographic plaque assessment of the antiplaque properties of

Sanguinarine and chlor- hexidine. J Clin Periodontol 1988; 15:106-9.

31 Kubota K, Tanaka T, Murata Y and Hirasawa M. Effect of tannic acid on adherence

of Candida to denture base. J of Dental Research 1988; 67: abstract 183. 17

32 Al-Bagieh NH and Weinberg ED. Benzylisothiocyanate: a possible agent for

controlling dental caries. Microbios. 1988; 39: 143-151.

33 Tyler VE, Bradly LR Robebers JE. "Pharma- cognosy" 9th Ed. Lea & Febiger 1988;

80-106.

34 Eid MA, Selim HA. A retrospective study on the relationship between miswak

chewing stick and periodontal health. Egypt Dent J 1994;40:589-92.

35 AI-LafiT and Ababneh H. The effect of the extract of the Miswak ( chewing sticks

) used in Jordan and the Middle East on oral bacteria. Int Dent J. 1995;45:218-22.

36 Abdel Rahman, H. F. (2000) In vitro antibacterial effects and preliminary chemical

composition of different Salvadora persica crude extracts – with speciﬁc reference

to miswak and oral microbes. Master Thesis. Bergen: University of Bergen

37 Almas, K., 1999. The antimicrobial effects of extracts of Azadirachta indica

(Neem) and Salvadora persica (Arak) chewing sticks. Indian J. Dent. Res. 10 (1),

23–26.

38 Elvin-Lewis, M., 1980. Plants used for teeth cleaning throughout the world. J. Prev.

Dent. 6, 61–70

Bibliography

39 Wu, C., Darout, I., Skaug, N., 2001. Chewing sticks: timeless natural toothbrushes

for oral cleansing. J. Periodontal. Res. 36 (5), 275– 284.

40 Almas K. The effects of extracts of chewing sticks (Salvadora persica) on healthy

and periodontally involved human dentine: A SEM study. Indian J Dent Res

2001;12:127-32.

41 Al-Otaibi M, Al-Harthy M, Gustafsson A, Johansson A, Claesson R, Angmar-

Mansson B. Subgingival plaque microbiota in Saudi Arabians after use of miswak

chewing stick and toothbrush. J Clin Periodontol 2004;31:1048-53

42 Sofrata, A., Claesson, R., Lingstrom, P., Gustafsson, A., 2008. Strong antibacterial

effect of miswak against oral microorganisms associ-ated with periodontitis and

caries. J. Periodontol. 79 (8), 1474– 1479.

43 Elangovan A, Muranga J, Joseph E. Comparative evaluation of the antimicrobial

efficacy of four chewing sticks commonly used in South India: An in vitro study.

Indian J Dent Res 2012;23:840.

44 Mohamed SA, Khan JA. Antioxidant capacity of chewing stick miswak Salvadora

persica. BMC Complement Altern Med 2013;13:40.

45 Husain A, Khan S. Miswak: The miracle twig. Arch Med Health Sci 2015;3:152-4.

46 Dahle ´n, G., Manji, F., Baelum, V. & Fejerskov, O. (1992) Putative

periodontopathogens in diseased and nondiseased persons exhibiting poor oral

hygiene. Journal of Clinical Periodontology 19, 35–42.

47 Haffajee AD, Socransky SS. Microbiology of periodontal diseases:introduction.

Periodontol 2000, 2005;38:9-12.

Bibliography

48 Theilade E. The non-specific theory in microbial etiology of inflammatory

periodontal diseases. J Clin Periodontol 1986;13:905–11.

49 Tanner ACR, Haffer C, Bratthall GT, Visconti RA, Socransky SS. A study of the

bacteria associated with advancing periodontitis in man. J Clin Periodontol

1979;6:278–307.

50 Slots J, Bragd L, Wikstrom M, Dahlen G. The occurrence of Actinobacillus

actinomycetemcomitans, Bacteroides gingivalis and Bacteroides intermedius in

destructive periodontal disease in adults. J Clin Periodontol 1986;13:570–7.

51 Moore WEC, Moore LVH. The bacteria of periodontal diseases. Periodontol 2000,

1994;5:66–77.

52 Haffajee AD, Socransky SS. Microbial etiological agents of destructive periodontal

diseases. Periodontology 2000, 1994;5:78–111.

53 von Troil-Linden, B., Torkko, H., Alauusua, S., Jousimies-Somer, H. & Asikainen,

S. (1995) Salivary levels of suspected periodontal pathogens in relation to

periodontal status and treatment. Journal of Dental Research 74, 1789–1793.

54 Sakamoto, M., Umeda, M., Ishikawa, I. & Benno, Y. (2000) Comparison of the oral

bacterial ﬂora in saliva from a health subject and two periodontitis patients by

sequence analysis of 16S rDNA Libraries. Microbiology and Immunology 44, 643–

652.

55 Hajishengallis G, Lamont RJ. Beyond the red complex and into more complexity:

the polymicrobial synergy and dysbiosis (PSD) model of periodontal disease

etiology. Mol. Oral Microbiol 2012. 27, 409–419.

Bibliography

56 Nisengard RJ and Newman MG (1994). Oral Microbiol Immunol Philadelphia:

W.B. Saunders Company.

57 Datta HK, Ng WF, Walker JA, Tuck SP, Varanasi SS. The cell biology of bone

metabolism. J Clin Pathol. 2008;61:577-87.

58 Sencimen M, Saygun I, Gulses A, Bal V, Acikel CH, Kubar A. Evaluation of

periodontal pathogens of the mandibular third molar pericoronitis by using real time

PCR. Int Dent J 2014;64:200-5.

59 Ali RW, Velcescu C, Jivanescu MC, Lofthus B and Skaung N. Prevalence of six

putative periodontal pathogen in subgingival plaque samples from Romanian adult

periodontitis patients. J Clin Periodontol 1996;23:133-9.

60 Bodet C, Chandad F, Grenier D. Pathogenic potential of Porphyromonas gingivalis,

Treponema denticola and Tannerella forsythia, the red bacterial complex

associated with periodontitis. Pathol Biol 2006;55:154-62.

61 Moore WE, Moore LH, Ranney RR, Smibert RM, Burmeister JA, Schenkein HA.

The microflora of periodontal sites showing active destructive progression. J Clin

Periodontol 1991;18:729-39.

62 Mahanonda R, Seymour GJ, Powell LW, Good MF and Halliday JW (1991). Effect

of initial treatment of chronic inflammatory periodontal disease on the frequency

of peripheral blood T-lymphocytes specific to periodontopathic bacteria. Oral

Microbiol Immunol 1991;6:221-227.

63 Casarin RCV, Del Peloso Ribeiro E, Mariano FS, Nociti FH Jr, Casati MZ and

Goncalves RB. Levels of Aggregatibacter actinomycetemcomitans,

Porphyromonas gingivalis, inflammatory cytokines and species-specific

Bibliography

immunoglobulin G in generalized aggressive and chronic periodontitis. J Periodont

Res 2010;45:635-42.

64 Griffen AL, Becker MR, Lyons SR, Moeschberger ML, Leys EJ. Prevalence of

Porphyromonas gingivalis and periodontal health status. Journal of Clinical

Microbiology 1998;36:3239–42.

65 Kononen E, Müller HP. Microbiology of aggressive periodontitis. Periodontology

2000 2014;65:46-78.

66 Asikainen S, Jousimies-Somer H, Kanervo A, Saxén L. Actinobacillus

actinomycetemcomitans and clinical periodontal status in Finnish juvenile

periodontitis patients. J Periodontol 1986;57:91-3.

67 Elamin A, Albandar JM, Poulsen K, Ali RW, Bakken V. Prevalence of

aggregatibacter actinomycetemcomitans in Sudanese patients with aggressive

periodontitis: A case-control study. J Periodontal Res 2011;46:285-91.

68 Takeuchi Y, Umeda M, Ishizuka M, Huang Y, Ishikawa I. Prevalence of

periodontopathic bacteria in aggressive periodontitis patients in a Japanese

population. J Periodontol 2003;74:1460-9.

69 Darby I, Curtis M (2001) Microbiology of periodontal disease in children and

young adults. Periodontol 2000 26: 33–53.

70 Loesche WJ, Syed SA, Laughon BE, Stoll J (1982) The bacteriology of acute

necrotizing ulcerative gingivitis. J Periodontol 53: 223–230.

71 Kononen E, Paju S, Pussinen PJ, Hyvonen M, Di Tella P, et al. (2007)

Population-based study of salivary carriage of periodontal pathogens in adults. J

Clin Microbiol 45: 2446–2451.

Bibliography

72 Riviere GR, DeRouen TA. Association of oral spirochetes from periodontally

healthy sites with development of gingivitis. J Periodontol 1998: 69: 496–501.

73 Riviere GR, DeRouen TA, Kay SL, Avera SP, Stouffer VK, Hawkins NR.

Association of oral spirochetes from sites of periodontal health with development

of periodontitis. J Periodontol 1997: 68: 1210–1214.

74 Kasuga Y, Ishihara K, Okuda K. Signiﬁcance of detection of Porphyromonas

gingivalis, Bacteroides forsythus and Treponema denticola in periodontal pockets.

Bull Tokyo Dent Coll 2000: 41: 109–117.

75 Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RLJ. Microbial complexes

in subgingival plaque. J Clin Periodontol 1998: 25: 134–144

76 Ellen RP, Galimanas VB. Spirochetes at the forefront of periodontal infections.

Periodontol 2000 2005: 38: 13–32..

77 Ramseier CA, Kinney JS, Herr AE, Braun T, Sugai JV, Shelburne CA, Rayburn

LA, Tran HM, Singh AK, Giannobile WV. Identiﬁcation of pathogen and host-

response markers correlated with periodontal disease. J Periodontol 2009: 80: 436–

446.

78 Armitage GC. Periodontal diseases: Diagnosis. Ann Periodontol 1996;1:37-215.

79 Sanz M, Newman MG, Quirynen M. Advanced diagnostic techniques. In: Newman

MG, Takei HH, Klokkevold PR and Carranza FA, editors. Carranza's Clinical

Periodontology, 11th ed. New Delhi: Elsevier; 2012. p. 1353-9.

80 Sanz M, Lau L, Herrera D, Morillo JM, Silva A. Methods of detection of

Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Tannerella

Bibliography

forsythensis in periodontal microbiology, with special emphasis on advanced

molecular techniques: A review. J Clin Periodontol 2004;31:1034-47.

81 Dahm R. Friedrich Miescher and the discovery of DNA. Dev Biol. 2005;278:274-

88.

82 Tilstone WJ, Savage KA, Clark LA. Forensic science: An encyclopedia of history,

methods, and techniques, 6th ed. California: ABC-CLIO Publishers; 2006. p. 48.

83 Mullis KB. The unusual origin of the polymerase chain reaction. Sci Am

1990;262:56-61, 64-5.

84 Watanabe K, Frommel TO. Detection of Porphyromonas gingivalis in oral plaque

samples by use of the polymerase chain reaction. J Dent Res 1993;72:1040-4.

85 Kobayashi T, Sugita N, van der Pol WL, Nunokawa Y, Westerdaal NA, Yamamoto

K, et al. The Fcgamma receptor genotype as a risk factor for generalized early-onset

periodontitis in Japanese patients. J Periodontol 2000;71:1425-32.

86 Leys EJ, Griffen AL, Strong SJ, Fuerst PA. Detection and strain identification of

Actinobacillus actinomycetemcomitans by nested PCR. J Clin Microbiol

1994;32:1288-94.

87 Lyons SR, Griffen AL, Leys EJ. Quantitative real-time PCR for Porphyromonas

gingivalis and total bacteria. J Clin Microbiol 2000;38:2362-5.

88 Saygun I, Sahin S, Ozdemir A, Kurtis B, Yapar M, Kubar A, et al. Detection of

human viruses in patients with chronic periodontitis and the relationship between

viruses and clinical parameters. J Periodontol 2002;73:1437-43.

Bibliography

89 Kumar PS, Griffen AL, Moeschberger ML, Leys EJ. Identification of candidate

periodontal pathogens and beneficial species by quantitative 16S clonal analysis. J

Clin Microbiol 2005;43:3944-55.

90 Jervoe-Storm P-M, Koltzscher M, Falk W, Dorfler A, Jepsen S. Comparison of

culture and real-time PCR for detection and quantification of five putative

periodontopathogenic bacteria in subgingival plaque samples. J Clin Periodontol

2005;32:778-83.

91 Jordan RCK, Daniels TE, Greenspan JS, Regezi JA. Advanced diagnostic methods

in oral and maxillofacial pathology. Part I: molecular methods. Oral Maxillofac

Pathol 2001;92:650-69.

92 Tille PM. Bailey and Scott's diagnostic microbiology, 13th ed. Missouri: Mosby

Elsevier Publishers; 2013. p.112-22.

93 Turgeon ML. Linne's & Ringsrud's Clinical laboratory science: The Basics and

routine techniques, 6th ed. Missouri: Mosby Elsevier Publishers; 2011. p. 146-7.

94 Boutaga K, Savelkoul PH, Winkel EG, van Winkelhoff AJ. Comparison of

subgingival bacterial sampling with oral lavage for detection and quantification of

periodontal pathogens by real-time polymerase chain reaction. J Periodontol

2007;78:79-86.

95 Garlet GP, Cardoso CR, Silva TA, Ferreira BR, Avila-Campos MJ, Cunha FQ, et

al. Cytokine pattern determines the progression of experimental periodontal disease

induced by Actinobacillus actinomycetemcomitans through the modulation of

MMPs, RANKL, and their physiological inhibitors. Oral Microbiol Immunol

2006;21:12-20.

Bibliography

96 Figuero E, Lindah C, Marin MJ, Renvert S, Herrara D, Ohllsson O, et al.

Quantification of periodontal pathogens in vascular, blood, and subgingival

samples from patients with peripheral arterial disease or abdominal aortic

aneurysms. J Periodontol 2014;85:1182-93.

97 Garcia-Delaney C, Sanchez-Garces MA, Figueiredo R, Sanchez-Torres A, Gay-

Escoda C. Clinical significance of interleukin-1 genotype in smoking patients as a

predictor of peri-implantitis: A case-control study. Med Oral Patol Oral Cir Bucal

2015;20:e737-43.

98 Kumar V, Abbas AK, Fausto N, Astra JC. Robbins and Cotran Pathologic basis of

disease, 8th ed. Philadelphia: Saunders Elsevier Publishers; 2010. p. 173.

99 Bizzarro S, Loos BG, Laine ML, Crielaard W, Zaura E. Subgingival microbiome

in smokers and non-smokers in periodontitis: an exploratory study using traditional

targeted techniques and a next-generation sequencing. J Clin Periodontol

2013;40:483-92.

100 Okada M, Soda Y, Hayashi F, Doi T, Suzuki J, Miura K, et al. PCR detection of

Streptococcus mutans and S. sobrinus in dental plaque samples from Japanese pre-

school children. J Med Microbiol 2002;51:443-7.

101 Takamatsu N, Yano K, He T, Umeda M, Ishikawa I. Effect of initial periodontal

therapy on the frequency of detection Bacteroides forsythus, Porphyromonas

gingivalis, and Actinobacillus actinomycetemcomitans. J Periodontol 1999;70:574–

80.

102 Kim Y, Flynn TR, Donoff RB, Wong DTW, Tood R. The gene: the polymerase

chain reaction and its clinical application. J Oral Maxillofac Surg 2002;60:808-15.

Bibliography

103 Murdoch-Kinch CA. Oral medicine: advances in diagnostic procedures. J Calif

Dent Assoc 1999;27:773-84.

104 Bringuier A, Khelaifia S, Richet H, Aboudharam G, Drancourt M. Real-time PCR

quantification of Methanobrevibacter oralis in periodontitis. J Clin Microbiol

2013;51:993-4.

105 Hayashi F, Okada M, Zhong X, Miura K. PCR detection of Capnocytophaga

species in dental plaque samples from children aged 2 to 12 years. Microbiol

Immunol 2001;45:17–22.

106 von Troil-Linden, B., Torkko, H., Alauusua, S., Jousimies-Somer, H. & Asikainen,

S. (1995) Salivary levels of suspected periodontal pathogens in relation to

periodontal status and treatment. Journal of Dental Research 74, 1789–1793.

107 Umeda, M., Contreras, A., Chen, C., Bakker, I. & Slots, J. (1998) The utility of

whole saliva to detect the oral presence of periodontopathic bacteria. Journal of

Periodontology 69, 828–833.

108 Eick S, Pfister W. Comparison of microbial cultivation and a commercial PCR

based method for detection of periodontopathogenic species in subgingival plaque

samples. Journal of Clinical Periodontology 2002; 29:638–44.

109 Morillo JM, Lau L, Sanz M, Herrera D, Silva A. Quantitative real time PCR based

on single copy gene sequence for detection of Actinobacillus

actinomycetemcomitans and Porphyromonas gingivalis. J Periodontal Res

2003;38:518-24.

Bibliography

110 Riggio MP, Macfarlane TW, Mackenzie D, Lennon A, Smith AJ, Kinane D.

Comparison of polymerase chain reaction and culture methods for detection of

Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in

subgingival plaque samples. J Periodontal Res 1996;31:496-501.

111 Masunaga H, Tsutae W, Oh H, Shinozuka N, Kishimoto N, Ogata Y. Use of

quantitative PCR to evaluate methods of bacteria sampling in periodontal patients.

Journal of Oral Science 2010;52:615-21.

112 Arora N, Mishra A, Chugh S. Microbial role in periodontitis: Have we reached the

top? Some unsung bacteria other than red complex. J Indian Soc Periodontol

2014;18:9-13.

113 Ghayoumi N, Chen C, Slots J. Dialister pneumosintes, a new putative periodontal

pathogen. J Periodontal Res 2002;37:75-8.

114 Kumar PS, Griffen AL, Moeschberger ML, Leys EJ. Identification of candidate

periodontal pathogens and beneficial species by quantitative 16S clonal analysis. J

Clin Microbiol 2005;43:3944-55.

115 Parra B, Slots J. Detection of human viruses in periodontal pockets using

polymerase chain reaction. Oral Microbiol Immunol 1996;11:289-93.

116 Pucar A, Milasin J, Lekovic V, Vukadinovic M, Ristic M, Putnik S, et al.

Correlation between atherosclerosis and periodontal putative pathogenic bacterial

infections in coronary and internal mammary arteries. J Periodontol 2007;78:677-

82.

Bibliography

117 Mahendra J, Mahendra L, Kurian VM, Jaishankar K, Mythilli R. 16S rRNA-based

detection of oral pathogens in coronary atherosclerotic plaque. Indian J Dent Res

2010;21:248-52.

118 Aimetti M, Romano F, Guzzi N, Carnevale G. Full-mouth disinfection and systemic

antimicrobial therapy in generalized aggressive periodontitis: a randomized,

placebo-controlled trial. J Clin Periodontol 2012;39:284-94.

119 Ardila CM, Martelo-Cadavid JF, Boderth-Acosta G, Ariza-Garces AA, Guzman

IC. Adjunctive moxifloxacin in the treatment of generalized aggressive

periodontitis patients: clinical and microbiological results of a randomized, triple-

blind and placebo-controlled clinical trial. J Clin Periodontol 2015;42:160-8.

120 Hakki SS, Bozkurt SB. Effects of different setting of diode laser on the mRNA

expression of growth factors and type I collagen of human gingival fibroblasts.

Lasers Med Sci 2012;27:325-31.

121 Milne TJ, Coates DE, Leichter JW, Soo L, Williams SM, Seymour GJ, et al.

Periodontopathogen levels following the use of an Er:YAG laser in the treatment

of chronic periodontitis. Aust Dent J 2015. DOI: 10.1111/adj.12306. [Epub ahead

of print]

122 Rodrigues AS, Lourencao DS, Lima Neto LG, Pannuti CM, Hirata RDC, Hirata

MH, et al. Clinical and microbiologic evaluation, by real-time polymerase chain

reaction, of non-surgical treatment of aggressive periodontitis associated with

amoxicillin and metronidazole. J Periodontol 2012;83:744-52.

123 Do T, Devine D, Marsh PD. Oral biofilms: molecular analysis, challenges, and

future prospects in dental diagnostics. Clin Cosmet Investig Dent 2013;5:11-

Bibliography

124 Loe H. The Gingival Index, the Plaque Index and the Retention Index systems. J

Periodontal, Nov-Dec, 1967, Vol 38, No. 6, Pages 610-616.

125 Benamghar L, Penaud J, Kaminsky P, Abt F, and Martin J. Comparison of gingival

index and sulcus bleeding index as indicators of periodontal status. Bull World

Health Organ 1982;60:147-51.

126 Grant IB, Stern J, Listergarten MA. Periodontics 6th edition.

127 Younes, S. A. & El-Angbawi, M. F. (1982) Dental caries prevalence in intermediate

Saudi schoolchildren in Riyad. Community Dental Oral Epidemiology 10, 74–76.

128 Al-Khateeb, T. L., O’Mullane, D. M., Whelton, H. & Sulaiman, M. I. (1991)

Periodontal treatment needs among Saudi Arabian adults and their relationship to

the use of Miswak. Community Dental Health 8, 323–328.

129 Darout, I. A., Albandar, J. M. & Skaug, N. (2000a) Periodontal status of adult

Sudanese habitual users of miswak chewing sticks or toothbrushes. Acta

Odontologica Scandinavica 58, 25–30.

130 Al Lafi, T. & Ababneh, H. (1995) The effect of the extract of miswak (chewing

sticks) used in Jordan and the Middle East on oral bacteria. International Dental

Journal 45, 218–222.

131 AbdElRahman, H. F. (2000) In vitro antibacterial effects and preliminary chemical

composition of different Salvadora persica crude extracts – with speciﬁc reference

to miswak and oral microbes. Master Thesis. Bergen: University of Bergen.

132 Wu, C. D., Darout, I. A. & Skaug, N. (2001) Chewing sticks: timeless natural

toothbrushes for oral cleansing. Journal of Periodontal Research 36, 275–284.

133 Könönen, E., Asikainen, S., Saarela, M., Karjalainen, J. & Jousimies-Somer, H.

Bibliography

(1994) The oral gram-negative anaerobic microﬂora in young children: longitudinal

changes from edentulous to dentate mouth. Oral Microbiology and Immunology 9,

136–141

134 Danser, M. M., van Winkelhoff, A. J., de Graaff, J., Loos, B. G. & van der Velden,

U. (1994) Short-term effect of full-mouth extraction on periodontal pathogens

colonizing the oral mucous membranes. Journal of Clinical Periodontology 21,

484– 489.

135 Umeda, M., Contreras, A., Chen, C., Bakker, I. & Slots, J. (1998) The utility of

wholesaliva to detect the oral presence of periodontopathic bacteria. Journal of

Periodontology 69, 828–833.

136 Almas K, Al-Lafi TR. The natural toothbrush. World Health Forum 1995;16:206-

10.

137 Abo Al-Samh D. and Al-Bagieh N. A study of antibacterial activity of the miswak

extract in vitro. Biomedical Letters. 1996; 53: 225-238.

138 Al-Lafi T. Effectiveness of Miswak as a tool for oral hygiene. M Sc. Thesis 1988.

University of London.

139 Danielsons B, Baelum V, Manji F and Fejerskov O. Chewing stick, toothpaste and

plaque removal. Acta Odontol Scand 1989; 47:121-25.

140 Gazi M, Saini T, Ashri N, Lambourne A. Meswak chewing stick versus

conventional toothbrush as an oral hygiene aid. Clin Prev Dent 1990;12:19-23

141 Darout IA, Albandar JM, Skaug N. Periodontal status of adult Sudanese habitual

users of miswak chewing sticks or toothbrushes. Acta Odontol Scand 2000;58:25-

30.

Bibliography

142 Al-Otaibi M, Al-Harthy M, Soder B, Gustafsson A, AngmarMansson B.

Comparative effect of chewing sticks and toothbrushing on plaque removal and

gingival health. Oral Health Prev Dent 2003;1:301-7.

143 Younes SA and El Engebawi MF. Gingival recession in mandibular central

incisor region of Saudi schoolchildren aged 10-15 years. Community Dent Oral

Epidemiol 1983; 4:246-49.

144 Eid MA, Selim HA and Al-Shammery AR. The relationship between chewing

sticks (Miswak) and periodontal health. III. Relationship to gingival recession.

Quint Int 1991; 22:61-4.

145 Darout IA, Christy AA, Skaug N, Egeberg KP. Identification and quantification of

some potentially antimicrobial anionic component in Miswak extract. Indian J

Pharmacol 2000;32:11-4.

146 Sofrata AH1, Claesson RL, Lingström PK, Gustafsson AK. Strong antibacterial

effect of miswak against oral microorganisms associated with periodontitis and

caries. J Periodontol. 2008 Aug;79(8):1474-9.

147 Mohamed and Khan Antioxidant capacity of chewing stick miswak Salvadora

persica BMC Complementary and Alternative Medicine 2013, 13

TAMIL NADU GOVERNMENT DENTAL COLLEGE AND HOSPITAL

DEPARTMENT OF PERIODONTICS

COMPARISON OF MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS,TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTERACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND REGULAR TOOTH BRUSH USERS USING POLYMERASE CHAIN REACTION TECHNIQUE

PROFORMA

Date : OP No.: S. No.:

Name : Age : Sex:

Occupation : Income:

Address : Phone Number:

CHIEF COMPLAINTS AND DURATION:

HISTORY OF PRESENT ILLNESS:

PAST MEDICAL HISTORY:

PAST DENTAL HISTORY:

FAMILY HISTORY:

PERSONAL HISTORY:

a) Oral Hygiene Practices :

b) Habits :

c) Menstrual History :

d) Menopause :

e) H/o. Stress Factor :

GENERAL EXAMINATION

a) Extra-Oral Examination

b) Examination of Lymphnodes

INTRA-ORAL EXAMINATION WITH CLINICAL FINDINGS:

Buccal mucosa:

Vestibule:

Hard palate:

Soft palate:

Tonsils:

Tongue:

Floor of the mouth:

Teeth:

Decayed

Missed

Filled teeth

Gingiva

Plaque index

18 17 16 15 14 13 12 11 21 22 23 24 25 26 27 28 48 47 46 45 44 43 42 41 31 32 33 34 35 36 37 38

Inference:

Bleeding Index

18 17 16 15 14 13 12 11 21 22 23 24 25 26 27 28 48 47 46 45 44 43 42 41 31 32 33 34 35 36 37 38

Inference:

Probing depth and attachment loss in millimetre

Maxillary:

CAL PPD 18 17 16 15 14 13 12 11 21 22 23 24 25 26 27 28 PPD CAL

Mandibular:

CAL PPD 48 47 46 45 44 43 42 41 31 32 33 34 35 36 37 38 PPD CAL Inference:

PROVISIONAL DIAGNOSIS

PROGNOSIS

TREATMENT PLAN

FITNESS FOR TREATMENT

TREATMENT DONE

DATE : PROCEDURE : SIGNATURE :

SIGNATURE OF THE PROFESSOR

ஆராசி பறிய தகவ பவ

ஆராசி ேமெகாபவ: மவ. அ.ஜா.ஜ

வழி நடபவ: மவ. ெஜய காரா ஷசாஹ M. D. S.

ஆராசி நிவனதி ெபய: தமிநா அர ப மவ க ம மவமைன, ெசைன.

ஆராசிய தைல: ப.சி.ஆ பைத பயபதி மிவா ம பசி உபேயாகிேபா உமிந உள பாைபேராேமானா ஜிஜவாலி, ேபானமா ெடேகாலா, ேவாெடலா இடமயா ம அேகேபட ஆேனாைமசிடகாமிட யகள எணைகைய ஒப பாத

ஆராசிய ேநாக: ப.சி.ஆ பைத பயபதி மிவா ம பசி உபேயாகிேபா உமிந உள பாைபேராேமானா ஜிெஜவாலி,ேபானமா ெடேகாலா, ேவாெடலா இடமயா ம அேகேபட ஆேனாைமசிடகாமிட யகள அள மதிப ஆவைன ேமெகாத

ெசைற: கீகட ஆக/பேசாதைனக உககாக ெசயப

 பேசாதைன: வா பேசாதைன:உற, ெவளற  2 மிலியளஉமிந ேசககப  யய மதிப ேமெகாளப

பேகபதினா வைள நைமக: உகள நாபட ப ஈ ேநா சிகிைச அளகப.

பேகபதினா வரய பகவைளக: வா ஆவ ேபா ஏப வலி ம அெசௗகய.

இரகசிய கா: உகைள பறிய றிக பற அறியா வண ஆராசி வைர இரகசியமாக பாகாகப. அைத ெவளய ேநரகள எத தன அைடயாளக ெவளபட வா கிைடயா. தனாவ பேக: இத ஆராசிய ப ெபவ தகள தனபட ம இத ஆராசிய இ நக எேபா ேவமானா வலகிெகாளலா. தகள இத தி உகேகா அல ஆராசியாளேகா எத வத பாதிைப ஏபதா எபைத ெதயபகிேறா.

ேநாயாளய ெபய ைகெயாப/ைகேரைக

ஆராசி ெதாடைடய தகவக ம. அ.ஜா.ஜ நிைல ப மவ மாணவ, ப ம ப றதிவய ைற தமிநா அர ப மவ க ம மவமைன, ெசைன ைகேபசி : 9566831179

பேகபாள உைம ெதாடைடய தகவக: ம.B.சரவண, M.D.S., Ph.D., தைலவ, நிவன ெநறிைறக தமிநா அர ப மவ க ம மவமைன, ெசைன.

Participant Information Sheet

Investigator:Dr. A.J.JAREEN Guide:Dr. JAISHREE TUKARAM KSHIRSAGAR M.D.S

Title of the study : COMPARISON OF SALIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA, PREVOTELLA INTERMEDIA AND AGGREGATIBACTER ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS BY POLYMERASE CHAIN REACTION TECHNIQUE

Name of the research institution: Tamil Nadu Government Dental College & Hospital, Chennai. The investigator, Dr.A.J.Jareen under the guidance of Dr.JaishreeTukkaram kshirsagar M.D.S is conducting a study as titled above with aim to compare the salivary levels of Porphyromonasgingivalis, Treponemadenticola, Prevotellaintermedia and Aggregatibacteractinomycetemcomitans in habitual miswak stick users and regular tooth brush users using polymerase chain reaction technique

1. Procedure: The following examination/investigation will be done for you.

 Intra oral examination,  Extra-oral examination.  Sample of saliva will be collected  icrobiological evaluation will be performed

2. Risk of participation: Patient may experience pain, discomfort during oral examination.

3. Benefits of participation Treatment for your diseased status will be given for improving periodontal status.

4. Confidentiality: The identity of the patients participating in the research will be kept confidential throughoutthe study. In the event of any publication or presentation resulting from the research, no personallyidentifiable information will be shared.

5. Participant’s rights: Taking part in the study is voluntary. You are free to decide whether to participate in thestudy or to withdraw at any time; your decision will not result in any loss of benefits to which you areotherwise entitled. The results of this study will be intimated to you at the end of the study period orduring the study if anything is found abnormal which may aid in the management or treatment.

6. Compensation: Nil

7. Contacts: For queries related to the study: Primary Investigator: Dr.A.J.Jareen Contact Details: Post Graduate student, Department of Periodontics Tamilnadu Govt. Dental College & Hospital, Chennai -600003 Phone number: 9566831179

Contact details regarding rights of the participant: Dr. B. Saravanan, M.D.S., Ph.D., The Chairperson, Institutional Ethical committee Tamilnadu Govt. Dental College & Hospital, Chennai

ப.சி.ஆ பைத பயபதி மிவா ம பசி உபேயாகிேபா உமிந உள பாைபேராேமானா ஜிஜவாலி,ேபானமா ெடேகாலா, ேவாெடலா இடமயா ம அேகேபட ஆேனாைமசிடகாமிட யகள எணைகைய ஒப பாத:

Informed Consent Form

COMPARISON OF SALAIVARY MICROBIAL LEVELS OF PORPHYROMONAS GINGIVALIS, TREPONEMA DENTICOLA,PREVOTELLA INTERMEDIA AND AGGREGATIBACTOR ACTINOMYCETEMCOMITANS IN HABITUAL MISWAK STICK USERS AND TOOTH BRUSH USERS USING POLYMERASE CHAIN REACTION TECHNIQUE

Participant ID No:

“I have read the foregoing information, or it has been read to me. I have had the opportunity to ask questions about it and any questions I have asked have been answered to my satisfaction. I consent voluntarily to participate as a participant in this study and understand that I have the right to withdraw from the study at any time without in any way it affecting my further medical care.”

Date Name of the participant Signature/thumb impression of the participant

[The literate witness selected by the participant must sign the informed consent form. The witness should not have any relationship with the research team; If the participant doesn’t want to disclose his / her participation details to others, in view of respecting the wishes of the participant, he / she can be allowed to waive from the witness procedure (This is applicable to literate participant ONLY). This should be documented by the study staff by getting signature from the prospective participant]

______

“I have witnessed the accurate reading of the consent form to the potential participant and the individual has had opportunity to ask questions. I confirm that the individual has given consent freely”

Date Name of the witness Signature of the witness

Date Name of the interviewer Signature of the interviewer