DOCSLIB.ORG

Population Identification and Divergence Threshold in Psoroptidae Based on Ribosomal ITS2 and Mitochondrial COI Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Population Identification and Divergence Threshold in Psoroptidae Based on Ribosomal ITS2 and Mitochondrial COI Genes Population identification and divergence threshold in Psoroptidae based on ribosomal ITS2 and mitochondrial COI genes Cheng Juan, Liu ChengCheng, Zhao YaE, Hu Li, Yang YuanJun, Yang Fan & Shi ZhiYun Parasitology Research Founded as Zeitschrift für Parasitenkunde ISSN 0932-0113 Parasitol Res DOI 10.1007/s00436-015-4578-9 1 23 Your article is protected by copyright and all rights are held exclusively by Springer- Verlag Berlin Heidelberg. This e-offprint is for personal use only and shall not be self- archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”. 1 23 Author's personal copy Parasitol Res DOI 10.1007/s00436-015-4578-9 ORIGINAL PAPER Population identification and divergence threshold in Psoroptidae based on ribosomal ITS2 and mitochondrial COI genes Cheng Juan1 & Liu ChengCheng1 & Zhao YaE 1 & Hu Li1 & Yang YuanJun1 & Yang Fan1,2 & Shi ZhiYun1,3 Received: 3 April 2015 /Accepted: 10 June 2015 # Springer-Verlag Berlin Heidelberg 2015 Abstract Psoroptidae mites are a type of small mites with a could not. The intra- and interspecies identification thresholds wide range of hosts. The proliferation of Psoroptidae mites were≤2.12 and ≥10.93 %. Further analysis showed that host could cause symptoms such as severe itching, atopic dermati- but not geographical isolation was found in Psoroptes and tis, and hair loss in infected animals. If severely infected, death Chorioptes, whereas Otodectes mites parasitizing dogs and can also occur. The morphological classification and identifi- cats were the same species; neither host nor geographical iso- cation of Psoroptidae mites is problematic due to the overlap- lation was observed. In conclusion, rDNA ITS2 is better than ping geographical distribution. In addition, there is no diver- mtDNA COI for DNA barcoding in Psoroptidae. gence threshold for molecular classification and identification. To solve this problem, gDNA was extracted from individual Keywords Psoroptidae . Phylogenetic tree . Divergence Psoroptes and Otodectes mites (China) for amplification of threshold . Molecular identification . DNA barcode rDNA ITS2 and mtDNA COI. After that, the sequences ob- tained were aligned and analyzed with those retrieved from GenBank. Based on rDNA ITS2 sequences, Psoroptidae was Introduction divided into three genera, namely, Psoroptes, Chorioptes,and Otodectes, which was in accordance with morphological clas- Psoroptidae mites are a type of small, permanently parasitic sification. The intraspecies, interspecies, and intergenera mites. They belong to Arachnida, Acari, Acariformes, and could be differentiated effectively, with thresholds≤5.20, Sarcoptiformes. Psoroptidae mites have a wide range of hosts 6.18–14.86, and ≥15.72 %, respectively. However, based on and distribute all over the world. They are commonly found mtDNA COI sequences, Psoroptidae was divided into four on the skin, external auditory canal, eyelids, and groin of genera with Caparinia added, as Caparinia sp did not cluster livestock, wild animals, and pets (Knaus et al. 2014; Burgess with the other three genera. The intra- and interspecies could et al. 2012; Mendes-de-Almeida et al. 2011). The proliferation be differentiated effectively, but interspecies and intergenera of Psoroptidae mites could cause symptoms such as severe itching, atopic dermatitis, and hair loss in infected animals Cheng Juan and Liu ChengCheng contributed equally to this work. (Shang et al. 2014;Nongetal.2014;Blotetal.2003); death can also occur in case of severe infection. Psoroptidae mites * Zhao YaE are highly contagious. The long-term infection with mites can [email protected]; [email protected] cause the spread of the mites more easily in animals, and certain species can even infect humans. This could impair 1 Department of Immunology and Pathogen Biology, School of Basic the health of humans and animals and cause economic loss Medical Science, Xi’an Jiaotong University, No. 76 Yanta West of livestock industry (Lohse et al. 2002;Katoetal.2011). Road, Xi’an, China 710061 Psoroptidae is comprised of three genera, namely, 2 School of Basic Medicine, Xinxiang Medical University, Psoroptes, Chorioptes,andOtodectes (Xu et al. 2004). Xinxiang 453003, China Conventionally, the classification of Psoroptidae mites was 3 Department of Medical Experimental Center, General Hospital of based on their hosts, parasitic sites, and morphological char- Ningxia Medical University, Yinchuan 750004, China acteristics. However, the identification of Psoroptidae mites is Author's personal copy Parasitol Res a challenge due to their small size, phenotypic polymorphism, mites a challenge and directly impedes research on similarities between species and genera, and the universality Psoroptidae at the DNA level. Therefore, the existing and overlapping geographical distribution, hosts, and parasitic studies at the DNA level mostly used pooled mites, sites of the three genera in Psoroptidae. Hence, the status of which may not represent the genetic characteristics of previously proposed species of Psoroptidae is subject to re- individual Psoroptidae mites. Thus, cross-contamination peated revisions and ongoing debate. between species could not be avoided (Khaing et al. In the past decade, the classification of Psoroptidae at 2014); (2) The gene used for molecular identification the DNA level has progressed with the rapid develop- is usually single. Most studies involve the ITS2 gene ments in molecular biology techniques. Several species (Zahler et al. 1998; Essig et al. 1999;Ochsetal. that could not be classified based on morphology have 1999;Lohseetal.2002;Nogeetal.2005;Pegler now been categorized based on their DNA sequences. In et al. 2005; Hestvik et al. 2007; Jia et al. 2008), which Psoroptes, using ribosomal DNA internal transcribed cannot objectively reflect the evolution between species. spacers 2 (rDNA ITS2) as a molecular marker, it has The species evolution is imbalance for different genes been suggested that Psoroptes mites parasitizing domes- based on the fact that rDNA ITS2 is not as good as tic rabbit, sheep, alpaca, goat, cow, big-horn sheep, mtDNA COI in the molecular classification and identi- mule deer, elk, and white-tailed deer belong to the same fication of Sarcoptes mites confirmed by our previous species without host specificity (Pegler et al. 2005). studies (Zhao et al. 2015); (3) The mtDNA COI is the Using mitochondrial DNA cytochrome oxidase 1 most common target gene used for identification at spe- (mtDNA COI) and 18S rDNA, Wang et al. (2012)sug- cies level. As there are only two studies using mtDNA gested that Psoroptes mites parasitizing buffalo COI for molecular classification and identification of belonged to a distinct species. Essig et al. (1999)used Psoroptidae (Wang et al. 2012;Andreetal.2014), it rDNA ITS2 as a molecular marker and suggested that is difficult to evaluate the value of the mtDNA COI Chorioptes bovis and C. texanus are two distinct species gene in this regard; (4) The samples used in all reported of the Chorioptes, which was supported by Zahler et al. studies are limited to particular hosts or species in a (2001) using morphological and molecular data. genus. Overall, a divergence threshold for molecular Additionally, Hestvik et al. (2007) reported a putative classification and identification of species within the undescribed species of Chorioptes from the moose. Psoroptidae is currently lacking. Therefore, it is neces- and genetic studies by Wang et al. (2012) suggested that sary to establish such a suitable divergence threshold for host isolation is also present in Chorioptes mites para- Psoroptidae. sitizing panda, comprising a separate species. In In the present study, we conducted molecular identi- Otodectes, the solitary study retrieved using rDNA fication of Psoroptes cuniculi and Otodectes cynotis ITS2 as a molecular marker suggested that mites para- from dog and cat in Xi’an, China, based on rDNA sitizing cat, dog, arctic fox, and ferret belong to the ITS2 and the 630-bp mtDNA COI at the 5′ terminal, same species without host isolation (Lohse et al. 2002). respectively. Genomic DNA was extracted from individ- However, application of molecular techniques in the ual mites. rDNA ITS2 and mtDNA COI genes were classification and identification of Psoroptidae mites is amplified by polymerase chain reaction (PCR), cloned, directly limited by the following aspects: (1) and sequenced. These were then subjected to alignment Psoroptidae mites are tiny, with a thick chitinous body and analyzed with those from different hosts and differ- wall, which makes DNA extraction from individual ent geographical background in the Psoroptidae Table 1 Specific primers for amplification of O. cynotis and Gene Primers (5′→3′)Tm(°C) P. cu ni cu li genes Otodectes cynotis mtDNA COI F: GGTATTTGAAGAGGAATGTTGGG 56 R: GATGACCAAAAAACCAAAATAAATG rDNA ITS F: TCGTAACAAGGTTTTCG 48 R: CGTTTGGTTTCTTTTCC Psoroptes cuniculi mtDNA COI F: GGTGTGTGAAGTGGTATATTG 50 R: GCCCAAAAAACCAGAAA rDNA ITS2 F: GGCTTCGTTTGTCTGAG 52 R: GTAATCTCGCTTGATCTGA
Load more

Recommended publications
  • And Wildlife, 1928-72
    Bibliography of Research Publications of the U.S. Bureau of Sport Fisheries and Wildlife, 1928-72 UNITED STATES DEPARTMENT OF THE INTERIOR BUREAU OF SPORT FISHERIES AND WILDLIFE RESOURCE PUBLICATION 120 BIBLIOGRAPHY OF RESEARCH PUBLICATIONS OF THE U.S. BUREAU OF SPORT FISHERIES AND WILDLIFE, 1928-72 Edited by Paul H. Eschmeyer, Division of Fishery Research Van T. Harris, Division of Wildlife Research Resource Publication 120 Published by the Bureau of Sport Fisheries and Wildlife Washington, B.C. 1974 Library of Congress Cataloging in Publication Data Eschmeyer, Paul Henry, 1916 Bibliography of research publications of the U.S. Bureau of Sport Fisheries and Wildlife, 1928-72. (Bureau of Sport Fisheries and Wildlife. Kesource publication 120) Supt. of Docs. no.: 1.49.66:120 1. Fishes Bibliography. 2. Game and game-birds Bibliography. 3. Fish-culture Bibliography. 4. Fishery management Bibliogra­ phy. 5. Wildlife management Bibliography. I. Harris, Van Thomas, 1915- joint author. II. United States. Bureau of Sport Fisheries and Wildlife. III. Title. IV. Series: United States Bureau of Sport Fisheries and Wildlife. Resource publication 120. S914.A3 no. 120 [Z7996.F5] 639'.9'08s [016.639*9] 74-8411 For sale by the Superintendent of Documents, U.S. Government Printing OfTie Washington, D.C. Price $2.30 Stock Number 2410-00366 BIBLIOGRAPHY OF RESEARCH PUBLICATIONS OF THE U.S. BUREAU OF SPORT FISHERIES AND WILDLIFE, 1928-72 INTRODUCTION This bibliography comprises publications in fishery and wildlife research au­ thored or coauthored by research scientists of the Bureau of Sport Fisheries and Wildlife and certain predecessor agencies. Separate lists, arranged alphabetically by author, are given for each of 17 fishery research and 6 wildlife research labora­ tories, stations, investigations, or centers.
    [Show full text]
  • Sarcoptes Scabiei, Psoroptes Ovis
    Mounsey et al. Parasites & Vectors 2012, 5:3 http://www.parasitesandvectors.com/content/5/1/3 RESEARCH Open Access Quantitative PCR-based genome size estimation of the astigmatid mites Sarcoptes scabiei, Psoroptes ovis and Dermatophagoides pteronyssinus Kate E Mounsey1,2, Charlene Willis1, Stewart TG Burgess3, Deborah C Holt4, James McCarthy1,5 and Katja Fischer1* Abstract Background: The lack of genomic data available for mites limits our understanding of their biology. Evolving high- throughput sequencing technologies promise to deliver rapid advances in this area, however, estimates of genome size are initially required to ensure sufficient coverage. Methods: Quantitative real-time PCR was used to estimate the genome sizes of the burrowing ectoparasitic mite Sarcoptes scabiei, the non-burrowing ectoparasitic mite Psoroptes ovis, and the free-living house dust mite Dermatophagoides pteronyssinus. Additionally, the chromosome number of S. scabiei was determined by chromosomal spreads of embryonic cells derived from single eggs. Results: S. scabiei cells were shown to contain 17 or 18 small (< 2 μM) chromosomes, suggesting an XO sex- determination mechanism. The average estimated genome sizes of S. scabiei and P. ovis were 96 (± 7) Mb and 86 (± 2) Mb respectively, among the smallest arthropod genomes reported to date. The D. pteronyssinus genome was estimated to be larger than its parasitic counterparts, at 151 Mb in female mites and 218 Mb in male mites. Conclusions: This data provides a starting point for understanding the genetic organisation and evolution of these astigmatid mites, informing future sequencing projects. A comparitive genomic approach including these three closely related mites is likely to reveal key insights on mite biology, parasitic adaptations and immune evasion.
    [Show full text]
  • Genetically Modified Baculoviruses for Pest
    INSECT CONTROL BIOLOGICAL AND SYNTHETIC AGENTS This page intentionally left blank INSECT CONTROL BIOLOGICAL AND SYNTHETIC AGENTS EDITED BY LAWRENCE I. GILBERT SARJEET S. GILL Amsterdam • Boston • Heidelberg • London • New York • Oxford Paris • San Diego • San Francisco • Singapore • Sydney • Tokyo Academic Press is an imprint of Elsevier Academic Press, 32 Jamestown Road, London, NW1 7BU, UK 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 525 B Street, Suite 1800, San Diego, CA 92101-4495, USA ª 2010 Elsevier B.V. All rights reserved The chapters first appeared in Comprehensive Molecular Insect Science, edited by Lawrence I. Gilbert, Kostas Iatrou, and Sarjeet S. Gill (Elsevier, B.V. 2005). All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publishers. Permissions may be sought directly from Elsevier’s Rights Department in Oxford, UK: phone (þ44) 1865 843830, fax (þ44) 1865 853333, e-mail [email protected]. Requests may also be completed on-line via the homepage (http://www.elsevier.com/locate/permissions). Library of Congress Cataloging-in-Publication Data Insect control : biological and synthetic agents / editors-in-chief: Lawrence I. Gilbert, Sarjeet S. Gill. – 1st ed. p. cm. Includes bibliographical references and index. ISBN 978-0-12-381449-4 (alk. paper) 1. Insect pests–Control. 2. Insecticides. I. Gilbert, Lawrence I. (Lawrence Irwin), 1929- II. Gill, Sarjeet S. SB931.I42 2010 632’.7–dc22 2010010547 A catalogue record for this book is available from the British Library ISBN 978-0-12-381449-4 Cover Images: (Top Left) Important pest insect targeted by neonicotinoid insecticides: Sweet-potato whitefly, Bemisia tabaci; (Top Right) Control (bottom) and tebufenozide intoxicated by ingestion (top) larvae of the white tussock moth, from Chapter 4; (Bottom) Mode of action of Cry1A toxins, from Addendum A7.
    [Show full text]
  • Efficacy of Oral Sarolaner for the Treatment of Feline Otodectic Mange
    pathogens Article Efficacy of Oral Sarolaner for the Treatment of Feline Otodectic Mange Diefrey Ribeiro Campos *, Jéssica Karoline de Oliveira Chaves, Brena Gava Guimarães, So Yin Nak, Gabriela Pereira Salça de Almeida, Isabela Scalioni Gijsen, Juliana de Moraes Intrieri and Fabio Barbour Scott Animal Parasitology Department, Veterinary Institute, Federal Rural University of Rio de Janeiro, BR 465, Km 07, Seropédica, RJ 23897-000, Brazil; [email protected] (J.K.d.O.C.); [email protected] (B.G.G.); [email protected] (S.Y.N.); [email protected] (G.P.S.d.A.); [email protected] (I.S.G.); [email protected] (J.d.M.I.); [email protected] (F.B.S.) * Correspondence: [email protected]; Tel.: +55-(21)-995595440 Abstract: Otodectes cynotis is a mite with a cosmopolitan distribution that is the primary agent for the development of otitis externa in feline species. The aim of this study was to evaluate the efficacy of the oral administration of sarolaner for the treatment of feline otodectic mange. We used 20 adult cats of both sexes that were naturally infested with O. cynotis. The mite infestation scoring was performed by video-otoscopy before treatment. The cats were randomized according to the infestation score and divided into two groups (treated and control). The treated group underwent oral administration of sarolaner in a single dose of 2–4 mg/kg. The evaluations were performed by video-otoscopy to evaluate the reduction of infestation score 2, 4, 6, 24 and 48 h and 7, 14, 21 and 28 days after medication. At the end of the study, the cats were sedated to enable the recovery of live and dead mites to determine efficacy.
    [Show full text]
  • Worldwide Integrated Assessment of the Impacts of Systemic Pesticides
    WORLDWIDE INTEGRATED ASSESSMENT OF THE IMPACTS OF SYSTEMIC PESTICIDES ON BIODIVERSITY AND ECOSYSTEMS http://www.tfsp.info/assets/WIA_2015.pdf Report in brief The Task Force on Systemic Pesticides is an independent group of scientists from all over the globe, who came together to work on the Worldwide Integrated Assessment of the Impact of Systemic Pesticides on Biodiversity and Ecosystems. The mandate of the Task Force on Systemic Pesticides (TFSP) has been “to carry out a comprehensive, objective, scientific review and assessment of the impact of systemic pesticides on biodiversity, and on the basis of the results of this review to make any recommendations that might be needed with regard to risk management procedures, governmental approval of new pesticides, and any other relevant issues that should be brought to the attention of decision makers, policy developers and society in general” (see appendix 2). The Task Force has adopted a science-based approach and aims to promote better informed, evidence-based, decision-making. The method followed is Integrated Assessment (IA) which aims to provide policy-relevant but not policy-prescriptive information on key aspects of the issue at hand. To this end a highly multidisciplinary team of 30 scientists from all over the globe jointly made a synthesis of 1,121 published peer-reviewed studies spanning the last five years, including industry-sponsored ones. All publications of the TFSP have been subject to the standard scientific peer review procedures of the journal (http://www.springer.com/environment/journal/11356). Key findings of the Task Force have been presented in a special issue of the peer reviewed Springer journal “Environmental Science and Pollution Research” entitled “Worldwide Integrated Assessment of the Impacts of Systemic Pesticides on Biodiversity and Ecosystems” and consists of eight scientific papers, reproduced here with permission of Springer.
    [Show full text]
  • A New Picorna-Like Virus in Varroa Mites As Well As Honey Bees
    Varroa destructor virus 1: A new picorna-like virus in Varroa mites as well as honey bees Juliette R. Ongus Promotor: Prof. Dr. J. M. Vlak Persoonlijk Hoogleraar bij de Leerstoelgroep Virologie Co-promotoren: Dr. M. M. van Oers Universitair Docent bij de Leerstoelgroep Virologie Dr. D. Peters Universitair Hoofddocent bij de Leerstoelgroep Virologie Promotiecommissie: Prof. Dr. M. Dicke (Wageningen Universiteit) Dr. F. J. M. van Kuppeveld (Radboud Universiteit Nijmegen) Prof. Dr. C. W. A. Pleij (Rijks Universiteit Leiden) Prof. Dr. D. L. Cox-Foster (Pennsylvania State University, U.S.A.) Dit onderzoek is uitgevoerd binnen de onderzoekschool Production Ecology and Resource Conservation. II Varroa destructor virus 1: A new picorna-like virus in Varroa mites as well as honey bees Juliette R. Ongus Proefschrift ter verkrijging van de graad van doctor op gezag van de rector magnificus van Wageningen Universiteit Prof. dr. M. J. Kropff in het openbaar te verdedigen op woensdag 12 april 2006 des namiddags te half twee in de Aula III Ongus, J.R. (2006) Varroa destructor virus 1: A new picorna-like virus in Varroa mites as well as honey bees Thesis Wageningen University – with references – with summary in Dutch ISBN 90-8504-363-8 Subject headings: Varroa destructor , Apis mellifera , picorna-like viruses, iflaviruses, genomics, replication, detection, Varroa destructor virus-1, Deformed wing virus IV Contents Chapter 1 General introduction 1 Chapter 2 Detection and localisation of picorna-like virus particles in tissues of Varroa destructor , an
    [Show full text]
  • Scanned Document
    cc: Eric Bohnenblust Alexandra Dunn Cheryl Dunton Michael Goodis Arnold Layne Anna Lowit Autumn Metzger Jennifer Saunders OPP Docket FIFRA Scientific Advisory Panel: Robert E. Chapin, PhD Joseph Shaw, PhD Sonya K. Sobrian, PhD Clifford P. Weisel, PhD Raymond S.H. Yang, PhD FQPA Science Review Board Members: Arthur Appel, PhD Michael J. Daniels, ScD Marion Ehrich, PhD Jerome Hogsette, PhD Eric Kwok, PhD Lisa Murphy, VMD Weste Osbrink, PhD Michael K. Rust, PhD Jeffrey G Scott, PhD Keith Shockley, PhD Daniel E. Snyder, DVM, PhD Larisa Vredevoe, PhD 2 FIFRA Scientific Advisory Panel Meeting Minutes and Final Report No. 2019-02 Peer Review on EPA Office of Pesticide Programs’ Proposed Guidelines for Efficacy Testing of Topically Applied Pesticides Used Against Certain Ectoparasitic Pests on Pets June 11-14, 2019 FIFRA Scientific Advisory Panel Meeting Held at U.S. Environmental Protection Agency Conference Center Lobby Level One Potomac Yard (South Bldg.) 2777 S. Crystal Drive, Arlington, VA 22202 3 Page Blank 4 NOTICE The Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) Scientific Advisory Panel (SAP) is a federal advisory committee operating in accordance with the Federal Advisory Committee Act and established under the provisions of FIFRA as amended by the Food Quality Protection Act (FQPA) of 1996. The FIFRA SAP provides advice, information, and recommendations to the U.S. Environmental Protection Agency (EPA or Agency) Administrator on pesticides and pesticide-related issues regarding the impact of regulatory actions on health and the environment. The SAP serves as a primary scientific peer review mechanism of the EPA, Office of Pesticide Programs (OPP), and is structured to provide balanced expert assessment of pesticide and pesticide-related matters facing the Agency.
    [Show full text]
  • Scientific Publications
    2006 Proceedings of the 11th International Conference on Plant Pathogenic Bacteria, 10th - 14th July. 2006 . 2001 Mycotoxins and phycotoxins in perspective at the turne of the millenium. Proceedings of the Xth international IUPAC symposium on mycotoxins and phycotoxins, 21-25 May 2000, Guaruja (Brazil) 01/01/74 1998 The importance of trace element speciation in food issues 223p 1997 The development of an integrated storage strategy for malting barley 1p 1996 Proceedings of the 2nd international conference on insect pests in the urban environment 640p 2001 Sclerotinia 2001 - The XI International Sclerotinia Workshop, York, 8th-12th July 2001 The XI International Sclerotinia Workshop 01/01/96 Abdulmawjood A;Bülte M;Roth S;Schönenbrucher H;Cook N;D'Agostino M;Malorny B;Jordan K;Pelkonen S;Hoorfar J; 2004 Toward an international standard for PCR-based detection of fodborne Escherichia coli 0157: validation of the PCR-based method in a multicenter international trial Journal of Aoac International 87(4),856-860. Abolins S;Thind B;Jackson V;Luke B;Moore D;Wall R;Taylor MA; 2007 Control of the sheep scab mite Psoroptes ovis in vivo and in vitro using fungal pathogens Veterinary Parasitology 148(3-4),310-317. Adams SJ;Fussell RJ;Dickinson M;Wilkins S;Sharman M; 2009 Study of the depletion of lincomycin residues in honey extracted from treated honeybee (Apis mellifera L.) colonies and the effect of the shook swarm procedure Analytica Chimica Acta 637(1-2),315-320. Adams SJ;Heinrich K;Fussell RJ;Wilkins S;Thompson HM;Ashwin HM;Sharman M; 2008 Study of the distribution and depletion of chloramphenicol residues in bee products extracted from treated honeybee (Apis mellifera L.) colonies Apidologie 39(5),537-546.
    [Show full text]
  • Class: Arachnida
    Class: Arachnida Mk- vthr dqekj ijthoh foKku foHkkx fcgkj Ik’kqfpfdRlk egkfo|ky; fcgkj Ik’kq foKku fo’ofo|ky; iVuk&800014 ¼fcgkj½ Image source: Google image Phylum: Arthropoda CLASSIFICATION: Phylum: Arthropoda Classes Insecta Arachnida Pentastomida Order: Acarina Family: Linguatulidae Flies, Lice, ( Ticks , mites, ( Tongue worms) fleas, bugs etc. spider & scorpions) Phylum: Arthropoda CLASSIFICATION: Phylum: Arthropoda Classes Insecta Arachnida Pentastomida Subclasses: Apterygota (Generallyo C wingless insects) and Pterygota Subclasse: Pterygota Divisions Exoterygota Endopterygota Order: (1) Mallophaga (biting lice) Order: (1) Diptera ( true flies) (2) Siphunculata/Anoplura (sucking lice) (2) Siphonaptera ( fleas) (3) Hemiptera (bugs) (3) Coleoptera (beetles) (4) Odonata( dragon flies) (5) Orthoptera ( cockroaches, (4) Hymenoptera (bees, wasps, grasshoppers) ants) Class: Arachnida Phylum: Arthropoda Class Insecta Arachnida Pentastomida Sub-class: Acari Family: Linguatulidae (Acarina) ( Tongue worm) ORDER Parasitiformes Acariformes Sub-order Sub-order Ixodida Gamasida Actinedida Acaridida Oribatida ( metastigmata) ( Mesostignmata) (Prostigmagta) ( Astigmata) ( Cryptostigmata) TICKS Family: Trombiculidae Family: Demodicidae Genus: Trombicula Genus: Demodex Family: Dermanyssidae Genus: Demanyssus Family: Psoroptidae Family: Sarcoptidae Family: Genus: Psoroptes, Genus: Sarcoptes, Knemidocoptidae Chorioptes, Notoedres Genus: Knemidocoptes Otodectes Mites Phylum: Arthropoda Class Arachnida Sub-class: Acari (Acarina) ORDER Parasitiformes Acariformes
    [Show full text]
  • Taxa Names List 6-30-21
    Insects and Related Organisms Sorted by Taxa Updated 6/30/21 Order Family Scientific Name Common Name A ACARI Acaridae Acarus siro Linnaeus grain mite ACARI Acaridae Aleuroglyphus ovatus (Troupeau) brownlegged grain mite ACARI Acaridae Rhizoglyphus echinopus (Fumouze & Robin) bulb mite ACARI Acaridae Suidasia nesbitti Hughes scaly grain mite ACARI Acaridae Tyrolichus casei Oudemans cheese mite ACARI Acaridae Tyrophagus putrescentiae (Schrank) mold mite ACARI Analgidae Megninia cubitalis (Mégnin) Feather mite ACARI Argasidae Argas persicus (Oken) Fowl tick ACARI Argasidae Ornithodoros turicata (Dugès) relapsing Fever tick ACARI Argasidae Otobius megnini (Dugès) ear tick ACARI Carpoglyphidae Carpoglyphus lactis (Linnaeus) driedfruit mite ACARI Demodicidae Demodex bovis Stiles cattle Follicle mite ACARI Demodicidae Demodex brevis Bulanova lesser Follicle mite ACARI Demodicidae Demodex canis Leydig dog Follicle mite ACARI Demodicidae Demodex caprae Railliet goat Follicle mite ACARI Demodicidae Demodex cati Mégnin cat Follicle mite ACARI Demodicidae Demodex equi Railliet horse Follicle mite ACARI Demodicidae Demodex folliculorum (Simon) Follicle mite ACARI Demodicidae Demodex ovis Railliet sheep Follicle mite ACARI Demodicidae Demodex phylloides Csokor hog Follicle mite ACARI Dermanyssidae Dermanyssus gallinae (De Geer) chicken mite ACARI Eriophyidae Abacarus hystrix (Nalepa) grain rust mite ACARI Eriophyidae Acalitus essigi (Hassan) redberry mite ACARI Eriophyidae Acalitus gossypii (Banks) cotton blister mite ACARI Eriophyidae Acalitus vaccinii
    [Show full text]
  • Otobius Megnini (Duges, 1844) Otoacariasis in a Horse from Tlahualilo, Durango, Mexico: a Case Report
    Current Trends in Entomology and Zoological Studies Gonzalez-Alvarez VH, et al. Curr Trends Entomol Zool Stds: CTEZS-108. Case Report DOI: 10.29011/ CTEZS-108. 000008 Otobius megnini (Duges, 1844) Otoacariasis in a Horse from Tlahualilo, Durango, Mexico: A Case Report Vicente Homero Gonzalez-Alvarez1, Josue Manuel de la Cruz-Ramos1, Sergio Orlando Yong-Wong1, Quetzaly Karmy Siller- Rodriguez2, Javier A. Garza-Hernandez3, Aldo Ivan Ortega-Morales4* 1Universidad Autónoma Agraria Antonio Narro, Posgrado en Ciencias en Producción Agropecuaria, Periférico Raúl López Sánchez s/n, Col. Valle Verde, C.P. 27059, Torreón, Coahuila, México 2Universidad Juarez del Estado de Durango, Facultad de Ciencias de la Salud, Calzada Las Palmas 1 y Sixto Ugalde, Col. Revolucion, C.P. 35050, Gomez Palacio, Durango, México 3Universidad Autonoma de Ciudad Juarez, Instituto de Ciencias Biomedicas, Laboratorio de Entomologia Medica, Anillo Envolvente y Estocolmo s/n, Zona Pronaf, C.P. 32310, Cd. Juarez, Chihuahua, Mexico. 4Universidad Autónoma Agraria Antonio Narro, Departmento de Parasitologia Periférico Raul Lopez Sanchez s/n, Col. Valle Verde, C.P. 27059, Torreon, Coahuila, México *Corresponding author: Aldo Ivan Ortega-Morales, Departmento de Parasitologia, Universidad Autonoma Agraria Antonio Narro, Periferico Raul Lopez Sanchez s/n, Col. Valle Verde, C.P. 27059, Torreon, Coahuila, Mexico. Email: [email protected] Citation: Gonzalez-Alvarez VH, de la Cruz-Ramos JM, Yong-Wong SO, Siller-Rodriguez QK, Garza-Hernandez JA, et al. (2018) Otobius megnini (Duges, 1844) Otoacariasis in a Horse from Tlahualilo, Durango, Mexico: A Case Report. Curr Trends Entomol Zool Stds: CTEZS-108. DOI: 10.29011/ CTEZS-108. 000008 Received Date: 17 April, 2018; Accepted Date: 11 June, 2018; Published Date: 20 June, 2018 Abstract This study reports the infestation of a horse by the tick Otobius megnini.
    [Show full text]
  • External Parasite and Vector Control Guidelines AAEP External Parasite and Vector Control Guidelines
    American Association of Equine Practitioners External Parasite and Vector Control Guidelines AAEP External Parasite and Vector Control Guidelines Developed by the AAEP External Parasite Control Task Force Dennis French, DVM, Dipl. ABVP (chair) Tom Craig, DVM, PhD Jerome Hogsette, Jr. PhD Angela Pelzel-McCluskey, DVM Linda Mittel, DVM, MSPH Kenton Morgan, DVM, Dipl. ACT David Pugh, DVM, MS, MAg, Dipl. ACT, ACVN, ACVM Wendy Vaala, DVM, Dipl. ACVIM Published by The American Association of Equine Practitioners 4033 Iron Works Parkway Lexington, KY 40511 First Edition, 2016 © American Association of Equine Practitioners AAEP External Parasite and Vector Control Guidelines TABLE OF CONTENTS Introduction ....................................................................................................Page 2 Ticks ...............................................................................................................Page 3 Flies ..............................................................................................................Page 11 Mites .............................................................................................................Page 29 Lice ...............................................................................................................Page 34 Mosquitoes ...................................................................................................Page 42 External Parasite and Vector Control Guidelines 1 INTRODUCTION Commonly used strategies for external It is important to keep in mind that
    [Show full text]