Population Identification and Divergence Threshold in Psoroptidae Based on Ribosomal ITS2 and Mitochondrial COI Genes

Population identification and divergence threshold in Psoroptidae based on ribosomal ITS2 and mitochondrial COI genes

Cheng Juan, Liu ChengCheng, Zhao YaE, Hu Li, Yang YuanJun, Yang Fan & Shi ZhiYun

Parasitology Research Founded as Zeitschrift für Parasitenkunde

ISSN 0932-0113

Parasitol Res DOI 10.1007/s00436-015-4578-9

1 23 Your article is protected by copyright and all rights are held exclusively by Springer- Verlag Berlin Heidelberg. This e-offprint is for personal use only and shall not be self- archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23 Author's personal copy

Parasitol Res DOI 10.1007/s00436-015-4578-9

ORIGINAL PAPER

Population identification and divergence threshold in Psoroptidae based on ribosomal ITS2 and mitochondrial COI genes

Cheng Juan1 & Liu ChengCheng1 & Zhao YaE 1 & Hu Li1 & Yang YuanJun1 & Yang Fan1,2 & Shi ZhiYun1,3

Received: 3 April 2015 /Accepted: 10 June 2015 # Springer-Verlag Berlin Heidelberg 2015

Abstract Psoroptidae mites are a type of small mites with a could not. The intra- and interspecies identification thresholds wide range of hosts. The proliferation of Psoroptidae mites were≤2.12 and ≥10.93 %. Further analysis showed that host could cause symptoms such as severe itching, atopic dermati- but not geographical isolation was found in Psoroptes and tis, and hair loss in infected animals. If severely infected, death Chorioptes, whereas Otodectes mites parasitizing dogs and can also occur. The morphological classification and identifi- cats were the same species; neither host nor geographical iso- cation of Psoroptidae mites is problematic due to the overlap- lation was observed. In conclusion, rDNA ITS2 is better than ping geographical distribution. In addition, there is no diver- mtDNA COI for DNA barcoding in Psoroptidae. gence threshold for molecular classification and identification. To solve this problem, gDNA was extracted from individual Keywords Psoroptidae . Phylogenetic tree . Divergence Psoroptes and Otodectes mites (China) for amplification of threshold . Molecular identification . DNA barcode rDNA ITS2 and mtDNA COI. After that, the sequences obtained were aligned and analyzed with those retrieved from GenBank. Based on rDNA ITS2 sequences, Psoroptidae was Introduction divided into three genera, namely, Psoroptes, Chorioptes,and Otodectes, which was in accordance with morphological clas- Psoroptidae mites are a type of small, permanently parasitic sification. The intraspecies, interspecies, and intergenera mites. They belong to Arachnida, Acari, Acariformes, and could be differentiated effectively, with thresholds≤5.20, Sarcoptiformes. Psoroptidae mites have a wide range of hosts 6.18–14.86, and ≥15.72 %, respectively. However, based on and distribute all over the world. They are commonly found mtDNA COI sequences, Psoroptidae was divided into four on the skin, external auditory canal, eyelids, and groin of genera with Caparinia added, as Caparinia sp did not cluster livestock, wild animals, and pets (Knaus et al. 2014; Burgess with the other three genera. The intra- and interspecies could et al. 2012; Mendes-de-Almeida et al. 2011). The proliferation be differentiated effectively, but interspecies and intergenera of Psoroptidae mites could cause symptoms such as severe itching, atopic dermatitis, and hair loss in infected animals Cheng Juan and Liu ChengCheng contributed equally to this work. (Shang et al. 2014;Nongetal.2014;Blotetal.2003); death can also occur in case of severe infection. Psoroptidae mites * Zhao YaE are highly contagious. The long-term infection with mites can [email protected]; [email protected] cause the spread of the mites more easily in animals, and certain species can even infect humans. This could impair 1 Department of Immunology and Pathogen Biology, School of Basic the health of humans and animals and cause economic loss Medical Science, Xi’an Jiaotong University, No. 76 Yanta West of livestock industry (Lohse et al. 2002;Katoetal.2011). Road, Xi’an, China 710061 Psoroptidae is comprised of three genera, namely, 2 School of Basic Medicine, Xinxiang Medical University, Psoroptes, Chorioptes,andOtodectes (Xu et al. 2004). Xinxiang 453003, China Conventionally, the classification of Psoroptidae mites was 3 Department of Medical Experimental Center, General Hospital of based on their hosts, parasitic sites, and morphological char- Ningxia Medical University, Yinchuan 750004, China acteristics. However, the identification of Psoroptidae mites is Author's personal copy

Parasitol Res a challenge due to their small size, phenotypic polymorphism, mites a challenge and directly impedes research on similarities between species and genera, and the universality Psoroptidae at the DNA level. Therefore, the existing and overlapping geographical distribution, hosts, and parasitic studies at the DNA level mostly used pooled mites, sites of the three genera in Psoroptidae. Hence, the status of which may not represent the genetic characteristics of previously proposed species of Psoroptidae is subject to re- individual Psoroptidae mites. Thus, cross-contamination peated revisions and ongoing debate. between species could not be avoided (Khaing et al. In the past decade, the classification of Psoroptidae at 2014); (2) The gene used for molecular identification the DNA level has progressed with the rapid develop- is usually single. Most studies involve the ITS2 gene ments in molecular biology techniques. Several species (Zahler et al. 1998; Essig et al. 1999;Ochsetal. that could not be classified based on morphology have 1999;Lohseetal.2002;Nogeetal.2005;Pegler now been categorized based on their DNA sequences. In et al. 2005; Hestvik et al. 2007; Jia et al. 2008), which Psoroptes, using ribosomal DNA internal transcribed cannot objectively reflect the evolution between species. spacers 2 (rDNA ITS2) as a molecular marker, it has The species evolution is imbalance for different genes been suggested that Psoroptes mites parasitizing domes- based on the fact that rDNA ITS2 is not as good as tic rabbit, sheep, alpaca, goat, cow, big-horn sheep, mtDNA COI in the molecular classification and identi- mule deer, elk, and white-tailed deer belong to the same fication of Sarcoptes mites confirmed by our previous species without host specificity (Pegler et al. 2005). studies (Zhao et al. 2015); (3) The mtDNA COI is the Using mitochondrial DNA cytochrome oxidase 1 most common target gene used for identification at spe- (mtDNA COI) and 18S rDNA, Wang et al. (2012)sug- cies level. As there are only two studies using mtDNA gested that Psoroptes mites parasitizing buffalo COI for molecular classification and identification of belonged to a distinct species. Essig et al. (1999)used Psoroptidae (Wang et al. 2012;Andreetal.2014), it rDNA ITS2 as a molecular marker and suggested that is difficult to evaluate the value of the mtDNA COI Chorioptes bovis and C. texanus are two distinct species gene in this regard; (4) The samples used in all reported of the Chorioptes, which was supported by Zahler et al. studies are limited to particular hosts or species in a (2001) using morphological and molecular data. genus. Overall, a divergence threshold for molecular Additionally, Hestvik et al. (2007) reported a putative classification and identification of species within the undescribed species of Chorioptes from the moose. Psoroptidae is currently lacking. Therefore, it is neces- and genetic studies by Wang et al. (2012) suggested that sary to establish such a suitable divergence threshold for host isolation is also present in Chorioptes mites para- Psoroptidae. sitizing panda, comprising a separate species. In In the present study, we conducted molecular identi- Otodectes, the solitary study retrieved using rDNA fication of Psoroptes cuniculi and Otodectes cynotis ITS2 as a molecular marker suggested that mites para- from dog and cat in Xi’an, China, based on rDNA sitizing cat, dog, arctic fox, and ferret belong to the ITS2 and the 630-bp mtDNA COI at the 5′ terminal, same species without host isolation (Lohse et al. 2002). respectively. Genomic DNA was extracted from individ- However, application of molecular techniques in the ual mites. rDNA ITS2 and mtDNA COI genes were classification and identification of Psoroptidae mites is amplified by polymerase chain reaction (PCR), cloned, directly limited by the following aspects: (1) and sequenced. These were then subjected to alignment Psoroptidae mites are tiny, with a thick chitinous body and analyzed with those from different hosts and differ- wall, which makes DNA extraction from individual ent geographical background in the Psoroptidae

Table 1 Specific primers for amplification of O. cynotis and Gene Primers (5′→3′)Tm(°C) P. cu ni cu li genes Otodectes cynotis mtDNA COI F: GGTATTTGAAGAGGAATGTTGGG 56 R: GATGACCAAAAAACCAAAATAAATG rDNA ITS F: TCGTAACAAGGTTTTCG 48 R: CGTTTGGTTTCTTTTCC Psoroptes cuniculi mtDNA COI F: GGTGTGTGAAGTGGTATATTG 50 R: GCCCAAAAAACCAGAAA rDNA ITS2 F: GGCTTCGTTTGTCTGAG 52 R: GTAATCTCGCTTGATCTGA

F forward, R reverse a Tm melting temperature Author's personal copy

Parasitol Res

Table 2 Information of rDNA ITS2 and mtDNA COI sequences of Psoroptidae

Gene Isolate GenBank no. Countrya Host Isolate GenBank no. Country Host

ITS2 Pso.sp1 AF123080 CH Oryctolagus cuniculus Cho.sp4 EF433564 SE Moose (Alces alces) Pso.sp2 AF123079 CH Ovis aries Cho.sp5 EF433565 SE Moose (Alces alces) Pso.ovis1 EF429267 USA Cattle Cho.sp6 EF433566 SE Moose (Alces alces) Pso.ovis2 EF429259 DE Sheep Cho.sp7 EF433567 SE Moose (Alces alces) Pso.ovis3 EF429271 DE Sheep Cho.sp8 EF433568 SE Moose (Alces alces) Pso.cervinus1 EF429254 BE Cattle Cho.sp9 EF433569 SE Moose (Alces alces) Pso.cuniculi1 EF025930 CN Rabbit Cho.sp10 EF433570 SE Moose (Alces alces) Pso.cuniculi2 EF429255 DE Goat Cho.sp11 EF433571 SE Moose (Alces alces) Pso.cuniculi3 AB105020 JP Rabbit Cho.sp12 EF433572 SE Moose (Alces alces) Pso.cuniculi4 EF429256 GB Rabbit Cho.sp13 EF433573 SE Moose (Alces alces) Pso.cuniculi5 EF429266 IT Rabbit Cho.sp14 EF433574 SE Moose (Alces alces) Pso.cuniculi6 EF429262 DE Rabbit Cho.sp15 EF433575 SE Moose (Alces alces) Pso.cuniculi7 EF429261 ZA Rabbit Cho.sp16 EF053123 CN Panda Pso.cuniculi8 EF429265 BE Rabbit Cho.texanus1 EF191358 CN Cattle Pso.cuniculi9 EF429257 MZ Rabbit Cho.texanus2 EF191359 IL Cattle Pso.cuniculi10 EF429258 IT Goat Cho.texanus3 EF191360 IL Cattle Pso.cuniculi11 EF429260 NZ Goat Cho.texanus4 EF191361 DE Cattle Pso.cuniculi12 EF429253 DE Rabbit Cho.texanus5 EF053119 CN Simmental cow Pso.cuniculi13 AB105019 JP Rabbit Cho.texanus6 EF053122 CN Montbeliarde cow Pso.cuniculi14 EF429264 ZA Goat Cho.texanus7 EF191368 DE Cattle Pso.cuniculi15 EF429263 ZA Rabbit Cho.texanus8 EF053120 CN Holstein cow Pso.cuniculi16 AB105021 JP Rabbit Cho.texanus9 EF053121 CN Cattle Pso.cuniculi17 EF429268 DE Rabbit Cho.texanus10 EF191364 DE Cattle Pso.cuniculi18 EF429269 IT Rabbit Cho.texanus11 EF191365 IL Cattle Pso.cuniculi19 EF429270 GB Rabbit Cho.texanus12 EF191366 DE Cattle Pso.cuniculi20 KP676689b CN Rabbit Cho.texanus13 EF191356 CN Cattle Pso.cuniculi21 KP676690b CN Rabbit Cho.texanus14 EF191357 CN Cattle Pso.cuniculi22 KP676691b CN Rabbit Cho.texanus15 EF191367 DE Cattle Pso.cuniculi23 KP676692b CN Rabbit Cho.texanus16 EF191362 USA Cattle Pso.cuniculi24 KP676693b CN Rabbit Cho.texanus17 EF191363 USA Cattle Pso.natalensis1 EF025929 CN Buffalo Cho.texanus18 EF191369 IL Cattle Cho.bovis1 EF191372 DE Horse Oto.cynotis1 AF367701 DE Dog Cho.bovis2 EF191373 DE Llama Oto.cynotis2 AF367699 DE Cat Cho.bovis3 EF191374 IS Sheep Oto.cynotis3 AF367702 DE Cat Cho.bovis4 EF191370 NL Cattle Oto.cynotis4 AF367700 DE Cat Cho.bovis5 EF191371 DE Horse Oto.cynotis5 AF367703 DE Cat Cho.bovis6 EF191375 DE Horse Oto.cynotis6 KP676676b CN Dog Cho.sp1 AF123081 CH Ovis aries Oto.cynotis7 KP676677b CN Dog Cho.sp2 AF123084 CH Camelus bactrianus Oto.cynotis8 HQ728005b CN Cat Cho.sp3 AF123082 CH Bos taurus Oto.cynotis9 GU324587b CN Cat Oto.cynotis10 KP676675b CN Cat COI Pso. cuniculi1 KJ957822 CN Rabbit Cho.bovis1 KF891935 IS Ovis aries Pso. cuniculi2 NC_024675 CN Rabbit Oto.cynotis1 KP676683b CN Dog Pso. cuniculi3 FJ907499 CN Rabbit Oto.cynotis2 KP676684b CN Dog Pso. cuniculi4 KP676694b CN Rabbit Oto. cynotis3 KP676685b CN Dog Pso.cuniculi5 KP676695b CN Rabbit Oto. cynotis4 KP676686b CN Dog Pso.cuniculi6 KP676696b CN Rabbit Oto. cynotis5 KP676687b CN Dog Pso.cuniculi7 KP676697b CN Rabbit Oto. cynotis6 KP676688b CN Dog Pso.natalensis1 GQ221770 CN Buffalo Oto.cynotis7 KP676678b CN Cat Author's personal copy

Parasitol Res

Table 2 (continued)

Gene Isolate GenBank no. Countrya Host Isolate GenBank no. Country Host

Cho.texanus1 FJ907500 CN Simmental cow Oto.cynotis8 KP676679b CN Cat Cho.texanus2 FJ907503 CN Montbeliarde cow Oto.cynotis9 KP676680b CN Cat Cho. texanus3 FJ907502 CN Holstein Oto.cynotis10 KP676681b CN Cat Cho.texanus4 FJ907501 CN Cattle Oto.cynotis11 KP676682b CN Cat Cho.sp1 KF891936 SE Alces alces Oto.cynotis12 KF891933 USA Felis catus Cho.sp2 FJ907504 CN Panda Cap.sp1 KF891934 KR Atelerix albiventris

Pso Psoroptes, Cho Chorioptes, Oto Otodectes, Cap Caparinia a Country names were abbreviated according to the international standard b In this study available in Genbank. The aim of the present study was DNA ladder (TaKaRa, Japan) was used for standard to confirm the DNA barcode and divergence threshold molecular weights. After recovery and purification using for Psoroptidae. a DNA extraction kit (OMEGA, USA), PCR products were combined with pMD18T-Vector (TaKaRa, Japan) andtransferredintoDH-5α Escherichia coli competent Materials and methods cells. Clones were selected on Luria Bertani (LB) agar plates containing 25 μg/mL of ampicillin. Positive Mite isolation clones were detected by PCR and sent to Suzhou GENEWIZ Biotechnology Co. Ltd., China, for sequenc- For O. cynotis, ear canal secretions from cat and dog ing. After successful sequencing, similarities between were collected using cotton buds. The secretions were sequences obtained in this study and those available in spread on glass slides with glycerin and observed under Genbank were compared using the NCBI BLAST pro- a microscope at×40 magnification. Subsequently, indi- gram. Sequences generated in this study have been sub- vidual mites were transferred to another glass slide with mitted to GenBank (HQ728005, GU324587, KP676675– distilled water using a self-made pick needle. Glass KP676697) (Table 2). slides were gently swayed to wash the mites. Morphology of the mites was observed under a micro- Sequence retrieval scope, and photographic images were captured. For P. cuniculi, ear scabs of infected rabbits were picked The following search terms were used for rDNA ITS2 using tweezers. Observation and isolation methods were in GenBank: Psoroptidae and (ITS2 or internal tran- as described above for O. cynotis. scribed spacers 2), and 81 sequences were retrieved; the search terms used for mtDNA COI were: DNA extraction, gene amplification, cloning, Psoroptidae and (cytochrome oxidase subunit I or cyto- and sequencing chrome c oxidase subunit I or COI or CO1), and 35 sequences were retrieved. Using the multiple sequence Extraction of genomic DNA from individual mites was per- alignment model in ClustalX (Version 1.8), we aligned formed as previously described (Zhao et al. 2012). Primers for the rDNA ITS2 and mtDNA COI sequences in rDNA ITS or rDNA ITS2 and mtDNA COI were designed by Psoroptidae, respectively. The length and number of se- aligning corresponding sequences retrieved from GenBank quences to be included in the analysis were determined. and synthesized by Beijing AuGCT Biotechnology Co. Ltd., China (Table 1). Reaction volume for PCR was 20.0 μL, and reaction parameters were as follows: initial denaturation Phylogenetic analysis at 98 °C for 5 min, followed by 40 cycles of denatur- ationat98°Cfor5s,annealingatTmfor5s,exten- Neighbor-joining (NJ) phylogenetic trees in Psoroptidae sion at 72 °C for 20 s, and final extension at 72 °C for based on rDNA ITS2 and mtDNA COI were recon- 1 min. After electrophorectic separation using 2 % aga- structed using the K2P model of the MEGA 5.0 soft- rose gel, the PCR products were observed and ware. The reliability of each node was confirmed by photographed under a UV radiation detector. A 100-bp 1000 bootstraps. Author's personal copy

Parasitol Res

Fig. 1 Variable sites detected in rDNA ITS2 gene of Psoroptidae

Sequence analysis and threshold determination and the intra- and interspecific genetic distances (sequence divergences) were calculated, respectively. The relationship Using the MEGA (Version 5.0) software, the variable sites of between sequence divergences and different host species and the rDNA ITS2 and mtDNA COI sequences were detected, geographical locations were analyzed and the molecular Author's personal copy

Parasitol Res

Fig. 2 Variable sites detected in the 630-bp mtDNA COI sequences at the 5′ terminal of Psoroptidae Author's personal copy

Parasitol Res identification thresholds for intra-/interspecies and intergenera Psoroptes was comprised of two species. Psoroptes in different populations were determined. natalensis formed one of the subclades, whereas the remaining sequences formed the other subclade altogeth- er. Chorioptes was comprised of four species, namely, Results Chorioptes texanus, Chorioptes bovis, Chorioptes nr. moose,andChorioptes nr. panda,eachforminganin- Sequence alignment and variable site analysis dividual subclade. It should be noted that Caparinia sp formed a distinct clade between Otodectes and A total of 81 rDNA ITS2 sequences in Psoroptidae were in- Chorioptes–Psoroptes clades, indicating that it is an included in the final analysis, including ten sequences obtained dependent genus, i.e., Caparinia. in this study (Table 2). The sequences belonged to three genera, and the number of sequences in Psoroptes, Chorioptes, Intra-/interspecific and intergeneric divergence threshold and Otodectes were 31, 40, and 10, respectively. The sequence identity was 50.7 % (151/298), with 147 variable sites (Fig. 1). AsshowninTable3 and Fig. 4,rDNAITS2andthe A total of 28 mtDNA COI (630-bp at the 5′ terminal) se- 630-bp mtDNA COI at the 5′ terminal can effectively quences in Psoroptidae were included in the final analysis, classify the species within the three genera of including 15 sequences obtained in the study (Table 2). Psoroptidae. Psoroptes was classified into two species, Apart from the 8, 7, and 12 sequences belonging to i.e., one that exclusively parasitized buffalo and another Psoroptes, Chorioptes,andOtodectes, respectively, a new se- that parasitized different hosts in different countries; the quence was registered and defined as belonging to Caparinia. intraspecific divergences were 0.00–2.79 and 0.00– Sequence identity was 65.4 % (412/630), with 218 variable 2.12 %, while interspecific divergences were 6.69–8.71 sites (Fig. 2). and 17.32–17.54 %, respectively. Chorioptes was classified into four species, namely, C. bovis, C. texanus, Phylogenetic relationships C. nr. moose,andC. nr. panda, with intraspecific divergences of 0.00–5.20 and 0.00–1.13 %, and interspecific AsshowninFig.3, the NJ trees of rDNA ITS2 and divergences of 6.18–14.86 and 10.93–14.85 %, respec- mtDNA COI in Psoroptidae were basically similar. tively. The intergeneric divergences were 15.72–29.64 % Psoroptes, Chorioptes,andOtodectes formed a clade in rDNA ITS2 and 13.89–20.36 % in 630-bp mtDNA individually. Psoroptes and Chorioptes gathered together COI at the 5′ terminal. Both genes indicated that before joining Otodectes.ThefactthatOtodectes Otodectes mites parasitizing dog and cat were of the formed a single clade without a subclade suggested that same species, with divergences of 0.00–2.80 and 0.00– Otodectes might contain only a single species. 1.63 %, respectively.

Fig. 3 Radiative NJ phylogenetic trees of Psoroptidae. a rDNA ITS2. b mtDNA COI Table 3 Morphological classification and divergence thresholds of molecular identification

GeneGenus Morphological classification Molecular identification (divergence %)

Isolate Host Country Intraspecies Interspecies Intergenera

ITS2 Psoroptes Pso.cuniculi/1-24 Rabbit CN, JP, UK, IT, DE, ZA 0.00–2.79 Pso. Vs Pso.n 6.69-8.71 Pso Vs Cho 15.72-23.54 BE, MZ, NL Pso Vs Oto 21.05–25.37 Goat DE, IT, NZ, ZA Cho Vs Oto 23.42–29.64 Pso.cervinus/1 Cattle BE Pso.ovis/1-3 Cattle USA Sheep DE Pso.sp/1-2 Oryctolagus CH Ovis aries CH Author's Pso.natalensis/1 Buffalo CN – Chorioptes Cho.bovis/1-6 Horse DE 0.00–2.82 Cho.b Vs Cho.t 7.71–11.35 Llama DE Cho.b Vs Cho.sp4-15 11.46–14.86 Sheep IS Cho.b Vs Cho.sp16 6.18–8.22 Cattle NL

Cho.sp/1-2 Ovis aries CH personal Camelus CH Cho.texanus/1-18 Cattle DE, IL, USA, CN 0.00–5.20 Cho.t Vs Cho.sp4-15 9.33–14.73 Cow CN Cho.t Vs Cho.sp16 8.78–11.35 Cho.sp/3 Bos taurus CH Cho.sp/4-15 Moose SE 0.00–2.33 Cho.sp4-15 Vs Cho.sp16 10.59–12.83

Cho.sp/16 Panda CN –– – copy Otodectes Oto.cynotis/1-10 Dog DE 0.00–2.80 –– Cat DE COI Psoroptes Pso.cuniculi/1-7 Rabbit CN 0.0–2.12 Pso.c Vs Pso.n 17.32–17.54 Pso Vs Cho 16.41–20.34 Pso.natalensis/1 Buffalo CN – Pso Vs Oto 18.46–19.94 Chorioptes Cho.texanus/1-4 Cow CN 0.0–1.13 Cho.t Vs Cho.sp1 10.93–11.67 Pso Vs Cap 17.49–19.34 Cattle CN Cho.t Vs Cho.sp2 13.12–13.70 Cho Vs Oto 16.46–18.74 Cho.t Vs Cho.b1 14.27–14.85 Cho Vs Cap 18.91–20.36 Cho.sp/1 Alces alces SE – Cho.sp1 Vs Cho.sp2 12.79 Oto Vs Cap 13.89–14.68 Cho.sp1 Vs Cho.b1 12.37 Otodectes Cho.sp/2 Panda CN – Cho.sp2 Vs Cho.b1 14.49 Cho.bovis/1 Ovis aries IS –– – Oto.cynotis/1-12 Dog CN 0.0–1.63 –– Cat CN Felis catus USA

Caparinia Cap.sp/1A A.albiventris KR –– – Res Parasitol Author's personal copy

Parasitol Res

Fig. 4 Frequency distribution of sequence divergences in Psoroptidae. a, c rDNA ITS2. b, d mtDNA COI

Discussion Although rDNA ITS2 and 630-bp mtDNA COI at the 5′ terminal have been used for intra- and interspecies Against a backdrop of difficulty in both morphological classification and identification in Acari (Zhao et al. and molecular classification, the present study highlights 2014;Yangetal.2011;Chitimiaetal.2009), it is the following points: (1) rDNA ITS2 and the 630-bp unclear whether the two genes are suitable for interge- mtDNA COI at the 5′ terminal were jointly used as neric identification. In the present study, it was con- molecular markers to overcome the drawback of a sin- firmed for the first time that rDNA ITS2 can be used gle gene, which could not objectively reflect the evolu- not only for intra- and interspecies identification (intra- tionary relationship; (2) Samples of P. cuniculi and specific divergences threshold≤5.20 %, interspecific di- O. cynotis from dog and cat were acquired directly from vergences threshold≥6.18 %) but also for interspecies Xi’an, China, and genomic DNA was extracted and se- and intergenera identification (interspecific divergences quenced from individual mites. This overcame cross- threshold≤14.86 %, intergeneric divergences threshold≥ contamination caused by pooled mite samples (Gu 15.72 %) with an obvious barcoding gap. However, the et al. 2014; Sastre et al. 2013; Alasaad et al. 2008); 630-bp mtDNA COI at the 5′ terminal could only dif- (3) Corresponding sequences for Psoroptidae mites from ferentiate intra- and interspecies effectively (divergences different hosts and geographical locations were retrieved threshold≤2.12 % and≥10.93 %) but could not differ- from Genbank to maximize the number of samples. This entiate interspecies and intergenera as there were over- enhanced the statistical power of the study and credibil- laps between them without barcoding gap. ity of the conclusion; (4) Divergence thresholds suitable Based on the divergence threshold for molecular for the molecular identification of Psoroptidae were identification of Psoroptidae determined in this study, established by analyzing sequence divergences and weperformedverificationandcorrectiononthemor- reconstructing phylogenetic trees. phological classification of sequences obtained from Author's personal copy

Parasitol Res

Genbank. Psoroptidae was classified by the rDNA ITS2 display phenotype plasticity, cryptic species that are similar gene into three genera, namely, Psoroptes, Chorioptes, in appearance, damaged insect remains, and so forth. and Otodectes, in agreement with the classification based on morphology. Psoroptes was found to be com- Acknowledgments This work was supported by the National Natural prised of two species with host isolation observed. Science Foundation of China (Nos. 81271856 and 81471972). Psoroptes mites parasitizing buffalo was a single species (P. natalensis). However, Psoroptes mites parasitizing Conflict of interest None declared. horse, llama, sheep, and cattle were determined as belonging to the same species. This does not support results from morphological classification based on hosts. References This outcome also indicates that there is neither host nor geographical isolation among Psoroptes from these Alasaad S, Rossi L, Maione S, Sartore S, Soriguer RC, Pérez JM, Rasero four hosts. Chorioptes wasdeterminedtobecomprised R, Zhu XQ, Soglia D (2008) HotSHOT Plus ThermalSHOCK, a new and efficient technique for preparation of PCR-quality mite of four species, namely, C. bovis, C. texanus, C. nr. genomic DNA. Parasitol Res 103:1455–1457 moose (C. sweatmani sp nov), and Cho. nr. panda, Andre VB, Pavel BK, Gete H, Alexander PS (2014) Integrated Bayesian and the classification was in accordance with the iden- species delimitation and morphological diagnostics of chorioptic tification results of Andre et al. (2014) based on mor- mange mites (Acariformes: Psoroptidae: Chorioptes). Parasitol Res 113:2603–2627 phology and a Bayesian species delimitation analysis. Blot C, Kodjo A, Reynaud MC, Bourdoiseau G (2003) Efficacy of Chorioptes sp parasitizing Ovis aries and Camelus was selamectin administered topically in the treatment of feline identified as the same species with Chorioptes mites otoacariosis. Vet Parasitol 112:241–247 parasitizing horse, llama, sheep, and cattle (C. bovis). Burgess S, Downing A, Watkins CA, Marr EJ, Nisbet AJ, Kenyon F, Chorioptes sp parasitizing Bos taurus was identified as McNair C, Huntley JF (2012) Development of a cDNA microarray for the measurement of gene expression in the sheep scab mite the same species with Chorioptes mites parasitizing dif- Psoroptes ovis. Parasite Vector 5:30 ferent kinds of cattle from different countries Chitimia L, Lin RQ, Cosoroaba I, Braila P, Song HQ, Zhu XQ (2009) (C. texanus). However, it is worth emphasizing that cat- Molecular characterization of hard and soft ticks from Romania by tle are very likely to be infested with C. texanus and sequences of the internal transcribed spacers of ribosomal DNA. – C. bovis simultaneously as C. bovis was found to para- Parasitol Res 105:907 911 Essig A, Rinder H, Gothe R, Zahler M (1999) Genetic differentiation of sitize cattle (NL). Host isolation was found in mites of the genus Chorioptes (Acari: Psoroptidae). Exp Appl Chorioptes parasitizing moose and panda. They were Acarol 23:309–318 identified as two new species, namely, C. nr. moose Gu XB, Liu GH, Song HQ, Liu TY, Yang GY, Zhu XQ (2014) The and C. nr. panda. Otodectes mites parasitizing cat and complete mitochondrial genome of the scab mite Psoroptes cuniculi dog were identified as belonging to the same species, (Arthropoda: Arachnida) provides insights into Acari phylogeny. Parasite Vector 7:340 namely, O. cynotis, exhibiting neither host nor geo- Hestvik G, Zahler-Rinder M, Gavier-Widén D, Lindberg R, Mattsson R, graphical isolation. Morrison D, Bornstein S (2007) A previously unidentified Results from the identification of Psoroptidae based Chorioptes species infesting outer ear canals of moose (Alces alces): on the mtDNA COI gene were similar to those based characterization of the mite and the pathology of infestation. Acta Vet Scand 49:21–30 on the rDNA ITS2 gene. The difference was that Jia XY, Yang GY, Gu XB, Lai SJ (2008) Nucleotide variation in rDNA mtDNA COI identified Psoroptidae as being comprised ITS-2 differentiates Psoroptes isolates from rabbits and buffalo. of four genera. Apart from Psoroptes (two species: Acta Entomol Sin 51:545–550 P. cuniculi and P. natalensis), Chorioptes (four species: Kato T, Ito Y, Nakao H, Kadosaka T (2011) Tinnitus caused by tiny — C. bovis, C. texanus, C. nr. alces alces,andCho. nr. mites suspected cases of erratic migration of Otodectes cynotis and a case of Aleuroglyphus ovatus infestation. Med Entomol Zool panda)andOtodectes (single species: O. cynotis), 62:199–204 Caparinia sp that parasitizes Atelerix albiventris was Khaing TM, Shim JK, Lee KY (2014) Molecular identification and phy- identified as an independent genus, i.e., Caparinia, logenetic analysis of economically important acaroid mites (Acari: which was in line with the results of phylogenetic Astigmata: Acaroidea) in Korea. Entomol Res 44:331–337 analysis. Knaus M, Rapti D, Shukullari E, Kusi I, Postoli R, Xhaxhiu D, Silaghi C, Hamel D, Visser M, Winter R, Rehbein S (2014) Characterisation of From molecular identification and classification of ecto- and endoparasites in domestic cats from Tirana, Albania. Psoroptidae, we highlight an important insight that molecular Parasitol Res 113:3361–3371 classification is the most accurate and reliable research meth- Lohse J, Rinder H, Gothe R, Zahler M (2002) Validity of species status of od available to date. It serves as a supplement and verification the parasitic mite Otodectes cynotis. Med Vet Entomol 16:133–138 of classification based on morphology. This technique has the Mendes-de-Almeida F, Crissiuma AL, Gershony LC, Willi LMV, Paiva JP, Guerrero J, Labarthe N (2011) Characterization of ectoparasites potential for widespread use, particularly in the classification in an urban cat (Felis catus Linnaeus, 1758) population of Rio de and identification of organisms that are minute in size or Janeiro, Brazil. Parasitol Res 108:1431–1435 Author's personal copy

Parasitol Res

Noge K, Mori N, Tanaka C, Nishida R, Tsuda M, Kuwahara Y (2005) China based on COI and 18S rDNA gene sequences. Vet Parasitol Identification of astigmatid mites using the second internal tran- 184:392–397 scribed spacer (ITS2) region and its application for phylogenetic Xu Y, Yang G, Lai S (2004) The research progress of psoroptic mange. study. Exp Appl Acarol 35:29–46 Chin Anim Husb Vet Med 31:42–45 Nong X, Li SH, Wang JH, Xie Y, Chen FZ, Liu TF, He R, Gu XB, Peng Yang B, Cai J, Cheng X (2011) Identification of astigmatid mites using XR, Yang GY (2014) Acaricidal activity of petroleum ether extracts ITS2 and COI regions. Parasitol Res 108:497–503 from Eupatorium adenophorum against the ectoparasitic cattle mite, Zahler M, Essig A, Gothe R, Rinder H (1998) Genetic evidence suggests Chorioptes texanus. Parasitol Res 113:1201–1207 that Psoroptes isolates of different phenotypes, hosts and geographic Ochs H, Mathis A, Deplazes P (1999) Single nucleotide variation in origins are conspecific. Int J Parasitol 28:1713–1719 rDNA ITS-2 differentiates Psoroptes isolates from sheep and rabbits Zahler M, Hendrix WML, Essig A, Rinder H, Gothe R (2001) Taxonomic from the same geographical area. Parasitology 119:419–424 reconsideration of the genus Chorioptes Gervais and van Beneden, Pegler K, Evans L, Stevens J, Wall R (2005) Morphological and molec- 1859 (Acari: Psoroptidae). Exp Appl Acarol 25:517–523 ular comparison of host-derived populations of parasitic Psoroptes Zhao YE, Xu JR, Hu L, Wu LP, Wang ZH (2012) Complete sequence mites. Med Vet Entomol 19:392–403 analysis of 18S rDNA based on genomic DNA extraction from Sastre N, Ravera I, Ferreira D, Altet L, Sánchez A, Bardagí M, Francino individual Demodex mites (Acari: Demodicidae). Exp Parasitol O, Ferrer L (2013) Development of a PCR technique specific for 131:45–51 Demodex injai in biological specimens. Parasitol Res 112:3369– Zhao YE, Cheng J, Hu L, Ma JX (2014) Molecular identification and 3372 phylogenetic study of Demodex caprae. Parasitol Res 113:3601– Shang XF, Miao XL, Lv HP,Wang DS, Zhang JQ, He H, Yang ZQ, Pan H 3608 (2014) Acaricidal activity of usnic acid and sodium usnic acid Zhao YE, Cao ZG, Cheng J, Hu L, Ma JX, Yang YJ, Wang XP, Zeng JH, against Psoroptes cuniculi in vitro. Parasitol Res 113:2387–2390 Wang TP (2015) Population identification of Sarcoptes hominis and Wang S, Gu X, Fu Y, Lai S, Wang S, Peng X, Yang G (2012) Molecular Sarcoptes canis in China using DNA sequences. Parasitol Res 114: taxonomic relationships of Psoroptes and Chorioptes mites from 1001–1010