Molecular Epidemiology of Clinical Enterococcus Faecium Hanna

From the Division of Clinical Microbiology, Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden

Molecular Epidemiology of Clinical Enterococcus faecium

Hanna Billström

Stockholm 2008

All previously published papers were reproduced with permission from the publisher.

Published by Karolinska Institutet. Printed by Larserics Digital Print AB.

Till min fantastiska Familj

3 ABSTRACT

Enterococci are today the third most commonly isolated species from blood- stream infections, and problems with ampicillin and vancomycin resistance are increasing. Some putative virulence factors such as the enterococcal surface protein (Esp) and hyaluronidase (Hyl) have been described in Enterococcus faecium. Multilocus sequence typing (MLST) has revealed the existence of a genetic lineage, denoted clonal complex 17 (CC17), associated with hospital outbreaks and nosocomial infections worldwide.

The general aim of the present study was to investigate if blood-stream infections caused by E. faecium were of endogenous origin or the result of nosocomial transmission, and also to determine the conjugation ability, presence of virulence determinants, antibiotic resistance, and to clarify if the globally spread CC17 occurred in Sweden.

A total of 596 clinical E. faecium isolates consecutively collected during year 2000 to 2007 were included. All isolates originated from a blood-culture collection at the Karolinska University Hospital Huddinge, Sweden, deriving from hospitalized patients with blood-stream infections in the southern part of Stockholm.

The conjugation ability was tested using in vitro filter mating. The genetic relatedness between isolates was analyzed using pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number tandem repeat analysis (MLVA) and MLST. Presence of virulence genes was determined with polymerase chain reaction (PCR). Antibiotic susceptibility to seven different antibiotics was also investigated.

The vanA gene cluster was frequently transferred to E. faecium isolates in vitro. The conjugation frequencies among isolates harbouring esp were significantly higher compared to esp-negative isolates. Nearly half (43%) of the patients included were involved in cross-transmission events and the infecting strains disseminated both within and between all hospital categories. Clinical ampicillin susceptible isolates and normal microflora isolates displayed a similar and higher level of genetic diversity compared to esp-positive isolates. The esp gene was found in 56% of the isolates, hylfm in 4%, whilst the other virulence genes were only sporadically detected. The presence and spread of CC17 were found, which has not previously been described in Sweden. The most common MLVA type was MT-1 which was partly replaced in 2007 with MT-159 harbouring more antibiotic resistance and virulence determinants. The overall resistance to ampicillin increased from 68% to 86% whilst the levels of ciprofloxacin and imipenem resistance remained stable throughout the entire study period. In 2007, the resistance to gentamicin was significantly increased.

The presence of esp significantly increased during the investigation period and 72% of the isolates harboured esp in 2007. The number of isolates harbouring hyl significantly increased during the study period, reaching a level of 35% in 2007.

In conclusion, the E. faecium subpopulation belonging to the CC17 cluster, exhibiting enhanced properties for causing infections, are commonly occurring in the hospital environment in the Stockholm area, indicating a non endogenous origin for infection. The resistance to ampicillin and presence of the virulence genes esp and hyl increased markedly during the study period.

5 LIST OF PUBLICATIONS

This thesis is based on the following papers, which will be referred to in the text by their Roman numerals (I-IV).

I. Lund B, Billström H and Edlund C. Increased conjugation frequencies in clinical Enterococcus faecium strains harbouring the enterococcal surface protein gene esp. Clinical Microbiology and Infection, 2006, 12:588-591.

II. Billström H, Sullivan Å and Lund B. Cross-transmission of clinical Enterococcus faecium in relation to esp and antibiotic resistance. Journal of Applied Microbiology, 2008, accepted.

III. Billström H, Lund B, Sullivan Å and Nord CE. Virulence and antibiotic resistance in clinical Enterococcus faecium. International Journal of Antimicrobial Agents, 2008, 32:374-377.

IV. Billström H, Top J, Edlund C and Lund B. Epidemiological study of clinical Enterococcus faecium using multiple-locus variable-number tandem repeat analysis and multilocus sequence typing. Journal of Clinical Microbiology, 2008, submitted.

TABLE OF CONTENTS

ABSTRACT...... 4 LIST OF PUBLICATIONS ...... 6 LIST OF ABBREVIATIONS ...... 9 INTRODUCTION...... 11 The Enterococcus genus...... 11 Taxonomy...... 11 Enterococcus faecium...... 12 Characteristics ...... 12 Natural habitats...... 12 Virulence...... 12 Exchange of genetic material...... 14 Enterococcus faecium as a nosocomial pathogen...... 15 Epidemiology ...... 15 Infection control...... 16 Subspecies typing methods...... 17 Advantages and disadvantages of different typing methods.. 17 Antibiotic resistance ...... 17 Antibiotic susceptibility tests...... 18 Intrinsic resistance...... 18 Acquired resistance...... 18 Novel agents...... 21 AIMS OF THE THESIS ...... 22 General aims...... 22 Specific aims ...... 22 MATERIAL AND METHODS ...... 23 Bacterial samples...... 23 Strain collection...... 23 Reference strains...... 23 Microbiological assays ...... 24 The agar dilution method...... 24 In vitro conjugation assay using filter mating ...... 24 PCR...... 25 Sequencing ...... 27 Genotyping ...... 28 Pulsed-field gel electrophoresis ...... 28 Multiple-locus variable-number tandem repeat analysis ...... 30 Multilocus sequence typing ...... 31 Statistical and data analyses...... 32 RESULTS ...... 34 Bacterial isolates ...... 34 Antibiotic susceptibility...... 34 Clinical E. faecium isolates...... 34 Normal microflora ...... 35 Conjugation frequencies ...... 36

7 Presence of virulence genes...... 37 Conjugation assay...... 38 Genetic diversity...... 39 Cross-transmission...... 42 Multiple-locus variable-number tandem repeat analysis...... 42 Multilocus sequence typing ...... 43 DISCUSSION ...... 45 GENERAL SUMMARY...... 49 POPULÄRVETENSKAPLIG SAMMANFATTNING...... 51 ACKNOWLEDGEMENTS...... 53 REFERENCES ...... 55

LIST OF ABBREVIATIONS

Ace Collagen binding protein Adk Adenylate kinase AFLP Amplified fragment length polymorphism API Available phenotypic identification system AtpA ATP synthase, alpha subunit AREfm Ampicillin-resistant Enterococcus faecium ATCC American Type Culture Collection Asa1 Aggregation substance bp Base pair CC17 Clonal complex 17 CCUG Culture Collection University of Gothenburg CFU Colony-forming units CHEF Contour-clamped homogenous electric field CLSI Clinical and Laboratory Standards Institute CoNS Coagulase-negative Staphylococcus CylA Cytolysin D-Ala-D-Lac D-alanine-D-lactate D-Ala-D-Ser D-alanine-D-serine Ddl D-alanine-D-alanine ligase DLV Double locus variant DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphate EfaAfs Enterococcus faecalis endocarditis antigen ESBL Extended-spectrum β-lactamase Esp Enterococcal surface protein Espfm Enterococcal surface protein E. faecium variant EUCAST European Committee on Antimicrobial Susceptibility Testing FDA Food and Drug Administration Gdh Glucose-6-phosphate dehydrogenase GelE Gelatinase GI Gastrointestinal Gyd Glyceraldehyde-3-phosphate dehydrogenase GyrA DNA gyrase subunit A GyrB DNA gyrase subunit B h Hours HLGR High-level gentamicin resistance Hyl Hyaluronidase HylEfm Hyaluronidase E. faecium variant ICU Intensive care unit kb Kilo base pair MDR Multi-drug resistant MIC Minimal inhibitory concentration min Minutes

9 MLST Multilocus sequence typing MLVA Multiple-locus variable-number tandem repeat analysis MRSA Methicillin-resistant Staphylococcus aureus MRSE Methicillin-resistant Staphylococcus epidermidis MT MLVA type MQ MilliQ-water n Number PAI Pathogenicity island ParC DNA topoisomerase IV subunit C ParE DNA topoisomerase IV subunit E PBS Phosphate-buffered saline PBP Penicillin binding protein PCR Polymerase chain reaction PFGE Pulsed-field gel electrophoresis Q/D Quinopristin/dalfopristin PurK Phosphoribosylaminoimidazol carboxylase ATPase subunit PstS Phosphate ATP-binding cassette transporter RAPD Random amplified polymorphic DNA PhP PhenePlateTM biochemical typing system Rpm Routes per minutes rRNA Ribosomal ribonucleic acid sec Seconds SLV Single locus variant SmaI Restriction enzyme SMI Swedish Institute for Infectious Disease Control spp. Species ST Sequence type UPGMA Unweighted pair group method using arithmetic averages VanA D-Ala-D-Lac ligase VanB D-Ala-D-Lac ligase VanH Dehydrogenase that reduces pyruvat to lactate VanR Response regulator in the vancomycin resistance operon VanS Histidine kinase that senses the presence of glycopeptides VanX Dipeptidase that removes D-Ala-D-Ala VanY Carboxypeptidase hydrolyzing pentapeptides VanZ Gene product conferring low-level teicoplanin resistance VNTR Variable-number tandem-repeat VRE Vancomycin resistant enterococci VREF Vancomycin resistant E. faecium VRSA Methicillin resistant S. aureus displaying vancomycin resistance

INTRODUCTION

THE ENTEROCOCCUS GENUS Taxonomy Enterococci were for a long time referred to as “streptococci of faecal origin”. The first reports on Enterococcus were probably in 1899 when Thiercelin depicted bacteria found in human faeces (1899), and MacCallum and Hastings described a bacterium isolated from a patient with endocarditis subsequently named Micrococcus zymogenes (1899). Streptococcus faecalis was first described in 1906 (Andrews and Horder 1906) and a description of a second species, Streptococcus faecium that differed from S. faecalis in fermentation patterns, was presented 13 years later (Orla-Jensen 1919). Although a proposal for the genus Enterococcus came already in 1970 (Kalina 1970), it was not accepted until 1984 (Schleifer and Kilpper-Balz 1984). Today the genus Enterococcus consists of 34 species (Table 1) based on 16S rRNA sequencing, DNA-DNA reassociation, and whole-cell protein analysis (Köhler 2007; Tanasupawat et al. 2008).

Table 1. The Enterococcus genus currently comprises 34 different Enterococcus species. Enterococcus aquimarinus Enterococcus faecalis Enterococcus pallens Enterococcus asini Enterococcus faecium Enterococcus phoeniculicola Enterococcus avium Enterococcus gallinarum Enterococcus pseudoavium Enterococcus caccae Enterococcus gilvus Enterococcus raffinosus Enterococcus canintestini Enterococcus haemoperoxidus Enterococcus ratti Enterococcus canis Enterococcus hermanniensis Enterococcus saccharolyticus Enterococcus casseliflavus Enterococcus hirae Enterococcus silesiacus Enterococcus cecorum Enterococcus italicus Enterococcus sulfureus Enterococcus columbae Enterococcus malodoratus Enterococcus termitis Enterococcus devriesei Enterococcus moraviensis Enterococcus thailandicus Enterococcus dispar Enterococcus mundtii Enterococcus villorum Enterococcus durans

11 ENTEROCOCCUS FAECIUM Characteristics Enterococci are facultative anaerobic Gram-positive and catalase-negative cocci that grow in pairs or short chains at a wide temperature range (10 to 45ºC) with an optimal growth temperature of 35ºC. All enterococci can grow in 6.5% NaCl and hydrolyze esculine in the presence of 40% bile salts as well as leucine-β-naphtylamide (LAP). Many, but not all, can hydrolyze pyrrolindonyl-β-naphtylamide (PYR). All of these tests can be used as a way to differentiate Enterococcus spp. from other Gram-positive cocci (Facklam and Collins 1989). Enterococci have a hardy nature and can survive extreme environmental conditions such as presence of 28% NaCl, pH from 4.8 to 9.6, for 10 min at 65ºC (Kearns et al. 1995) and they also display intrinsic resistance to antibiotics and tolerance to detergents. Because of this durable nature, enterococci can survive for long time-periods on dry surfaces and plastic ware (Wendt et al. 1998; Neely and Maley 2000). Persistent contaminations with Enterococcus faecium in hospital environments have been reported (Bonilla et al. 1997).

Natural habitats Enterococcus spp. are a part of the intestinal microflora of most mammals and birds (Murray 1990). Less than 1% of the microflora in the gastrointestinal tract (GI) in humans is comprised of Enterococcus spp., whilst the anaerobes are the most prevalent bacteria found in this microbiota (Sghir et al. 2000). Enterococci can also less frequently be found in the oral cavity, vaginal vaults and on the skin of humans (Murray 1990; Torell et al. 2001). Enterococci are found on plants, in soil and water as well as in various food products such as cheese, sausage, milk and meat (Eaton and Gasson 2001).

Virulence Enterococci are generally considered to be low virulent. Today E. faecium have emerged as a common nosocomial pathogen and the presence of possible virulence determinants among clinical isolates are increasing (Klare et al. 2005; Top et al. 2008b). The presence and function of different suggested characteristics related to virulence have previously mainly been studied in Enterococcus faecalis and little is known about the virulence in E. faecium (Mundy et al. 2000).

Enterococcal surface protein, Esp The enterococcal surface protein, Esp, is a cell wall-associated protein first described in infection-derived E. faecalis isolates (Shankar et al. 1999). In 2001 a variant esp gene (espfm) was found in E. faecium (Willems et al. 2001). Not much is known about the function of esp in E. faecium but it has been demonstrated that esp is enriched in clinical E. faecium isolates (Willems et al. 2001; Woodford 2001; Coque et al. 2002; Billström et al. 2008a) and that the presence of esp promotes adhesion to eukaryotic cells (Lund and Edlund 2003). The role of esp in biofilm formation in E. faecium is so far ambiguous (Mohamed and Huang 2007) and it has been shown that the levels of surface exposed Esp varies between different strains (Van Wamel et al. 2007).

Hyaluronidase, Hyl Hyaluronidase (Hylfm), a newly discovered putative virulence determinant, was found to be enriched in clinical E. faecium isolates (Rice et al. 2003). Hylfm shows homology to hyaluronidase found in Streptococcus pyogenes, Streptococcus pneumoniae and Staphylococcus aureus, where it is believed to enable the spread of pathogens from the initial site of infection by contributing to tissue destruction (Hynes and Walton 2000). The role of hyaluronidase in E. faecium is still unclear.

Aggregation substance, AS Aggregation substance in E. faecalis, encoded by asa1, is a pheromone- inducible surface protein that promotes mating aggregation during conjugation (Mundy et al. 2000). AS also mediates binding to cultured renal tubular cells as well as increasing adherence to gut epithelial cells (Kreft et al. 1992; Sartingen et al. 2000). AS has rarely been described in E. faecium, in which its function is unknown (Elsner et al. 2000; Serio et al. 2007; Billström et al. 2008a).

Cytolysin, Cyl Cyl is a bacterial toxin previously described in E. faecalis with bactericidal activity against a broad range of Gram-positive organisms (Davie and Brock 1966). The auto-induction of Cyl is regulated via a two-component regulatory quorum-sensing mechanism, and the operon is usually plasmid encoded but can be found on the chromosome within a pathogenicity island (Haas et al. 2002; Shankar et al. 2002). Presence of this virulence determinant has been reported in a few clinical E. faecium isolates (Sabia et al. 2008).

Collagen binding protein, Ace Ace was discovered in E. faecalis, with domains homologous to collagen binding protein (Cna) from S. aureus (Rich et al. 1999). Acm, a Cna homologue, has been described in clinical E. faecium isolates belonging to clonal complex 17 (CC17) (Nallapareddy et al. 2003; Nallapareddy et al. 2008) and a second collagen adhesin (Scm) has recently been identified in E. faecium (Sillanpää et al. 2008).

E. faecalis endocarditis antigen, EfaAfs EfaAfs was identified in serum from patients with E. faecalis endocarditis showing amino acid sequence homology to streptococcal adhesins (Lowe et al. 1995). Mice infected with mutants lacking functional efaAfs showed prolonged survival compared to those infected with the corresponding wild-type strain, indicating a role in disease (Singh et al. 1998b). A gene with 73% similarity to efaAfs was found in E. faecium DNA libraries and denoted efaAfm (Singh et al. 1998a). Enterococci harbouring the efaAfs and efaAfm have been isolated both from infections and food (Eaton and Gasson 2001).

13 Gelatinase, GelE GelE is an extracellular zinc-containing metalloproteinase that hydrolyses proteins such as gelatine, casein and collagen (Mäkinen et al. 1989). Animal studies indicate increased lethality in infections with gelatinase producing E. faecalis (Singh et al. 1998b). The presence of gelE as well as expression of the gene have been reported in E. faecium of both clinical and food origin (Lopes et al. 2006; Biavasco et al. 2007; Sabia et al. 2008).

Pathogenicity island, PAI In 2002, a pathogenicity island (PAI) harbouring virulence determinants such as esp, asa and cyl, was described in E. faecalis (Shankar et al. 2002), and 2 years later another PAI, completely different from the one in E. faecalis, was found in E. faecium. The esp gene is believed to be a marker for the presence of PAI in clinical E. faecium (Leavis et al. 2004). A new genetic island, possibly involved in metabolism, has been discovered mainly in CC17 E. faecium. The acquisition of this pathogenicity island might give an competitive advantage over the normal microflora (Heikens et al. 2008).

Exchange of genetic material In order to become a successful species, bacteria have to evolve and adapt. This is achieved through alteration of the genome via mutations and horizontal exchange of genetic material. Three main mechanisms of horizontal gene transfer have been described, transformation (bacteria acquire free DNA from different sources), transduction (phages are used as intermediates for spread of DNA) and conjugation (mating process), in which bacteria can gain new genes coding, e.g. antibiotic resistance and virulence. There are a number of different mobile genetic elements described. Conjugative plasmids and transposons are genetic elements commonly involved in conjugation with a broad host range (Salyers and Amabile-Cuevas 1997; Summers 2006), and enterococci often harbour conjugative plasmids. The conjugative transposon Tn916 in E. faecalis encoding tetracycline resistance is one of the most studied transposons (Rice 1998). The vanA gene cluster coding for vancomycin resistance is located on the conjugative transposon Tn1546 (Arthur et al. 1993) whilst the vanB operon has been described on Tn1547, Tn1549 and Tn5382 (Launay et al. 2006; Grabsch et al. 2008). Pheromone-responsive and non-pheromone-responsive are two types of plasmids that can be transferred through conjugation in enterococci. Pheromone-responsive plasmids have a narrow host range with efficient transfer frequencies (Hirt et al. 2002) and they have mainly been described in E. faecalis and are rarely found in E. faecium (Magi et al. 2003). Non-pheromone- responsive plasmids can only be transferred on a solid surface and this transfer is more broad range and less effective, although the non-pheromone plasmid pMG1 conferring gentamicin resistance has been transferred in broth (Ike et al. 1998).

ENTEROCOCCUS FAECIUM AS A NOSOCOMIAL PATHOGEN Epidemiology The vast numbers of bacteria colonizing our bodies are usually referred to as normal microflora and function as a barrier against invading pathogens. This barrier is not always functioning and infections caused by endogenous or exogenous bacteria are frequently occurring. Enterococci can cause bacteraemia/septicaemia, intra-abdominal infections, pelvic and neonatal infections and endocarditis (Murray 1990). A European study on nosocomial urinary tract infections reported enterococci as the second most commonly isolated microorganism (Bouza et al. 2001). There are several suggested risk factors for development of enterococcal infections including prolonged hospitalization, intravascular devices, previous antibiotic treatment with cephalosporins or vancomycin and interhospital transfer of patients (Safdar and Maki 2002). The susceptible patient groups at risk for enterococcal infections such as more medically compromised elderly, transplanted patients and neonates are also increasing. Blood-stream infections are the 10th most common cause of death in the US and enterococci are the third most commonly isolated bacteria causing blood-stream infections after CoNS and S. aureus (Wisplinghoff et al. 2004).

E. faecalis and E. faecium are the most common causes of enterococcal infections, with E. faecalis being most prevalent, although other enterococcal species have also been reported to cause infection in humans (Murray 1990). Lately, the proportion of infections caused by E. faecium seems to be increasing. The ratio between E. faecalis and E. faecium was previously considered to be 10:1, whilst recent studies indicate that the ratio has decreased to 3:1 (Murdoch et al. 2002; Simonsen et al. 2003; Top et al. 2007). The GI tract can serve as a reservoir for nosocomial pathogens and elevated colonization pressure has been reported to increase the risk of infection (Bonten et al. 1998; Lund et al. 2002b; Donskey 2004). The colonization with E. faecium among severely ill patients is seldom investigated and it is believed to be much more frequently occurring in contrast to the number of nosocomial infections observed, indicating that the infections seen are just the “tip of the iceberg” (Figure 1).

Infection

Transmission of isolates between patients Colonization

Figure 1. “Tip of the iceberg”. The colonization pressure in a hospital environment is high and only a fraction of colonized patients will develop an infection.

15 A hospital adapted subpopulation of clinical E. faecium has been reported worldwide, denoted clonal complex 17 (CC17). Enterococci causing infections in a hospital environment were traditionally considered to always be of endogenous origin although recent data indicates an exogenous nosocomial origin of most of these isolates. Isolates belonging to CC17 are characterized by ampicillin and ciprofloxacin resistance as well as presence of esp (Willems et al. 2005). Furthermore, enterococci are recovered twice as often in nosocomial blood-stream infections compared to community acquired blood-stream infections (Biedenbach et al. 2004).

Infection control The hardy nature of enterococci combined with antibiotic resistance renders enterococci well suited for survival and spread in hospital environments. Enterococci have been shown to colonize the skin, oral cavity and respiratory tract of hospitalized patients and high antibiotic pressure may favour transmission (Bonten et al. 1998; Lund et al. 2002b). There are several different pathways for possible spread and cross-transmission of bacteria in a hospital environment (Figure 2). Sufficient hygiene routines such as use of protective clothing and proper hand hygiene routines as well as controlled utilization of antibiotics help prevent nosocomial infections. Hand washing with an alcohol- based disinfectant is the best way of hindering cross-transmission between patients and limiting nosocomial infections (Pittet et al. 2000; Blot 2008).

4 3 2 5

Figure 2. Illustration of possible pathways for bacterial cross-transmissions. Bacteria in a hospital environment can be transmitted from patient to patient, via health-care workers (1) or via contaminated instruments and solutions (2, 3) as well as endogenous transmission (4). Bacteria acquired in the community can also be transferred to hospitalized patients through visitors (5).

SUBSPECIES TYPING METHODS There are several different ways of typing and characterizing enterococci below species level. The methods chosen depend on the origin of the sample as well on what kind of information the test is supposed to reveal. The PhenePlateTM (PhP) biochemical typing system is a phenotypic typing method composed of 23 different biochemical tests used to separate isolates belonging to the same species (Kühn et al. 1995). An array of different molecular based methods for subspecies identification has emerged during the last decade. These genotypic methods are often based on polymorphism in DNA patterns or whole genome analysis. Different PCR based methods such as random amplified polymorphic DNA (RAPD), where short primers amplify DNA randomly, and amplified fragment length polymorphism PCR (AFLP), where polymorphism in the DNA is analyzed, can be performed on E. faecium (Vancanneyt et al. 2002). Two new genotyping methods, multiple-locus variable-number tandem repeat analysis (MLVA) and multilocus sequence typing (MLST), have recently been described (Homan et al. 2002; Top et al. 2004). These two methods are very useful when examining the clonal spread of E. faecium worldwide. Pulsed-field gel electrophoresis (PFGE) is the most suitable method to use for surveillance of hospital outbreaks. This method allows analysis on the entire bacterial chromosome by separation of large DNA fragments using electrophoresis.

Advantages and disadvantages of different typing methods PFGE is by many considered the gold standard for subspecies typing. The method is highly discriminatory and excellent for outbreak analysis. Draw-backs with PFGE is that it is relatively labour intensive and time consuming and there is also a lack of standardization regarding electrophoresis and interpretation of banding patterns, rendering inter-laboratory comparisons difficult. MLVA is a good method to use when investigating clonal spread nationwide and the results are easily compared between laboratories. Typing of hospital-adapted isolates belonging to CC17 can generally be performed without difficulties although is it possible that isolates of endogenous origin causing infection without the typical markers for CC17, such as ampicillin resistance and esp, are lacking one or more of the variable-number tandem repeats (VNTRs) needed for generation of a MLVA profile. MLST is best suited for worldwide analysis of transmission and spread of strains of both clinical and environmental origin although it is labour intensive and expensive.

ANTIBIOTIC RESISTANCE The introduction of antibiotics in the field of medicine made it possible to treat previously mortal infections. Today infectious diseases account for more than 13 million deaths yearly (Cohen 2000) and antibiotic-resistant microorganisms represents a serious treat to all humans. Vancomycin-resistant enterococci (VRE), methicillin-resistant S. aureus (MRSA), extended-spectrum β-lactamase (ESBL) producing Gram-negative rods, multi-drug resistant (MDR) Mycobacterium tuberculosis and pneumococci are examples of microorganisms that nowadays are hard to treat due to resistance development. Antibiotics have different mechanisms of action such as inhibition of the cell wall synthesis, inhibition of the RNA or DNA synthesis or inhibition of the protein synthesis.

17 Antibiotic compounds are either produced naturally by different microorganisms, synthetically or semi-synthetically manufactured. The sulfonamides were the first antibiotics to be introduced in the 1930s. These were later on more or less replaced by penicillin, and since then several different classes of antibiotics have been introduced. Antimicrobial compounds can be either bacteriostatic (inhibiting bacterial growth) or bacteriocidal (killing bacteria). Antibiotics can exhibit either a narrow-spectrum, with activity against Gram- positive, Gram-negative, aerobic or anaerobic bacteria, or broad-spectrum, with activity on e.g. Gram-positive and Gram-negative bacteria.

Antibiotic susceptibility tests There are different approaches that can be used when investigating if a certain antibiotic exhibits activity against a particular isolate of a bacteria. Different guidelines for interpretation of antibiotic susceptibility (S, susceptible; I, intermediate; R, resistant) are available through the European Committee on Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI). The minimal inhibitory concentration (MIC) is the lowest concentration of the antibiotic needed to inhibit bacterial growth. There are three main methods for determining MIC. Disk diffusion is a test where bacteria are grown on an agar plate with a small paper disk impregnated with a specific concentration of an antibiotic placed on the surface of the plate. This is the crudest way of determining antibiotic susceptibility. The Epsilon test (Etest) provides a more sophisticated method where a strip containing an antibiotic gradient is used. The agar and broth dilution methods are the most exact techniques, where agar plates or tubes with broth with increasing concentrations of antibiotics are used.

Intrinsic resistance Enterococci are intrinsically resistant to a number of different antibiotics, for example cephalosporins and clindamycin (Murray 1990). Enterococci generally express low level resistance to aminoglycosides (Chow 2000) and ciprofloxacin (Lynch et al. 1997). Intrinsic resistance to dalfopristin in E. faecalis (Eliopoulos 2003) and low level resistance to vancomycin in E. gallinarum and E. casseliflavus (Gholizadeh and Courvalin 2000) are well known.

Acquired resistance Besides the intrinsic resistance among enterococci, they also have an inclination to acquire or develop further resistances. This is unfortunate and may lead to enterococcal infections that are difficult to treat with the different antibiotics available. The most troublesome acquired resistances are probably resistance to ampicillin and vancomycin (VRE).

β-Lactam resistance β-Lactam antibiotics are a wide group of antibiotics where the beta-lactam ring is the common denominator. The mechanism of action for β-lactam antibiotics is to bind to penicillin binding proteins (PBPs) that are involved in the peptidoglycan synthesis. Binding to these PBPs will lead to inhibition of the cell wall synthesis. The PBPs in enterococci display a natural low affinity to β- lactams, resulting in higher MIC compared to other Gram-positive bacteria (Murray 1990). Resistance to penicillin is most often a result of alterations in the PBPs although production of β-lactamase in E. faecalis has been reported (Murray 1990; Arias and Murray 2008). Ampicillin is a broad spectrum β- lactam antibiotic and the number of clinical E. faecium isolates resistant to ampicillin (AREfm) is high both in Europe (Claesson et al. 2007; Top et al. 2007; Billström et al. 2008b; de Regt et al. 2008; Lester et al. 2008) and in the United States (Murdoch et al. 2002). E. faecium are generally resistant to carbapenem (Arias and Murray 2008).

Aminoglycoside resistance Aminoglycosides such as gentamicin, amikacin, tobramycin and netilmicin function by binding to the 16S rRNA of the 30S ribosomal subunit and thereby inhibiting the protein synthesis. Treating enterococcal infections with an aminoglycoside alone is not effective since the drug is unable to cross the enterococcal cell membrane. A synergistic bactericidal effect can be accomplished when combining an aminoglycoside with a cell wall active antibiotic such as ampicillin or vancomycin. Enterococci have acquired several different aminoglycoside resistance genes where the aac(6′)-Ie-aph(2″)-Ia is the clinically most important, conferring high level resistance (HLGR) to nearly all clinically available aminoglycosides (Chow 2000; Tendolkar et al. 2003).

Glycopeptide resistance Glycopeptides, such as vancomycin and teicoplanin, are active against Gram- positive bacteria. The bulky glycopeptide inhibits the cell wall formation by binding with high affinity to the D-alanine-D-alanine termini of the peptidoglycan precursor (Courvalin 2006). Vancomycin is mainly used to treat severe infections caused by MRSA, MRSE and Clostridium difficile. The first reports on VRE came in 1986 (Leclercq et al. 1988; Uttley et al. 1988) and VRE have since then emerged in Europe, Asia and South America and are commonly occurring in the US (Cetinkaya et al. 2000; Bonten et al. 2001). Five different genotypes of acquired glycopeptide resistance denoted VanA, VanB, VanD, VanE and VanG have so far been described, with VanA and VanB being the most commonly occurring genotypes worldwide. The VanC genotype confers intrinsic resistance in E. gallinarum and E. casseliflavus (Table 2).

19 Table 2. Description of the six different genotypes in Enterocccus spp. conferring vancomycin resistance. Adapted from Courvalin 2006 and Gholizadeh 2000. Genotype VanA VanB VanC1/C2/C3 VanD VanE VanG

Origin Acquired Acquired Intrinsic Acquired Acquired Acquired Vancomycin 64-1000 4-1000 2-32 64-128 8-32 16 MIC (mg/L) Teicoplanin 16-512 0.5-1 0.5-1 4-64 0.5 0.5 MIC (mg/L) Modified D-Ala-D-Lac D-Ala-D-Lac D-Ala-D-Ser D-Ala-D-Lac D-Ala-D-Ser D-Ala-D-Ser precursor Location Plasmid Plasmid Chromosome Chromosome Chromosome Chromosome Chromosome Chromosome Mobile Tn1546 Tn1547 or ― ― ― ― element Tn1549 Constitutive Expression Inducible Inducible Constitutive Inducible Inducible inducible Conjugation Positive Positive Negative Negative Negative Positive

The vanA gene cluster is comprised of nine different genes with various functions (Figure 3). ORF1 and ORF2 are involved in the transposition of the genetic element. Once the gene cluster has been acquired, VanH will reduce pyruvate to lactate after which the VanA ligase attaches alanine with lactate. The dipeptide D-Ala-D-Lac will replace the dipeptide D-Ala-D-Ala, normally used in the formation of peptidoglycan, whilst the endogenously produced D-Ala-D- Ala is hydrolyzed by VanX. The two regulatory genes, vanS and vanR, control the level of expression of the resistance genes. VanS is phosphorylated when glycopeptides are present in the environment surrounding the bacteria, leading to activation of VanR which in turn will activate co-transcription of the resistance genes by binding to the two promotors (PR and PH). The accessory protein VanY will remove pentapeptides formed from D-Ala-D-Ala which has escaped the VanX dipeptidase. The role of VanZ is still unknown but it confers low-level resistance to teicoplanin. Vancomycin resistance due to acquisition of the vanB gene cluster is regulated in a different manner given that teicoplanin does not function as an inducer, although the function and organization is similar to that of VanA (Gholizadeh and Courvalin 2000; Courvalin 2006). The emergence of MRSA displaying resistance to vancomycin (VRSA) was first reported in the US in 2002, and VRSA has since then been described in different parts of the world (Aligholi et al. 2008; Saha et al. 2008; Sievert et al. 2008).

PR PH ORF1 ORF2 vanR vanS vanH vanA vanX vanY vanZ

Transposition Regulatory genes Resistance genes Accessory genes Figure 3. Illustration of the vanA gene cluster (Courvalin 2006 and Gholizadeh 2000)

Flouroquinolone resistance The most widely used flouroquinolone in the clinical setting is ciprofloxacin. This antibiotic was developed for treatment of infections caused by Gram- negative bacteria and displays moderate activity against enterococci. Flouroquinolones inhibit DNA replication in bacteria by interacting with DNA gyrase and topoisomerase IV. DNA gyrase and topoisomerase IV are each composed of two subunits encoded by gyrA, gyrB, or parC, parE, respectively. High-level resistance to ciprofloxacin in E. faecium is a result of point mutations in the genes coding for the antimicrobial target and these isolates are most likely all a part of CC17 (Leavis et al. 2006).

Novel agents The presence of MDR Gram-positive bacteria causing infection is troublesome and requires development of new antibiotics that can be used as treatment alternatives. Linezolid, daptomycin, tigecycline and quinopristin/dalfopristin (Q/D) are antibiotic compounds approved for clinical use. Linezolid is an oxazolidinone, a new class of antibiotics that inhibits protein synthesis. Resistance to linezolid among E. faecium seems to increase. Daptomycin is a lipopeptide used to treat skin and soft tissue infections and daptomycin- resistant E. faecium and E. faecalis have been reported. Tigecycline is a broad- spectrum glycylcycline which may be used to treat infections caused by vancomycin-susceptible E. faecalis, among others. Neither daptomycin nor tigecycline are approved for treatment of infections caused by E. faecium. Q/D was the first antibiotic approved by the food and drug administration (FDA) for treatment of VRE infections. Q/D is a mixture of quinopristin and dalfopristin with a ratio of 30:70 which inhibits the protein synthesis. Q/D is not active against E. faecalis, probably due to an efflux pump. Resistance to Q/D in enterococci occurs in clinical E. faecium isolates. Some new antibiotics, in a late stage of clinical development, are ceftobiprole, ceftaroline and iclaprim as well as the lipoglycopeptides dalbavancin, oritavancin and telavancin (Arias and Murray 2008; Lentino et al. 2008).

21 AIMS OF THE THESIS

General aims The primary aim of this thesis was to elucidate if blood-stream infections caused by E. faecium were of endogenous origin or the result of nosocomial transmission. The secondary aim was to determine the characteristics of the infection causing E. faecium isolates in terms of conjugation ability, presence of virulence determinants, antibiotic resistance and to clarify if the globally spread clonal complex 17 occurs in Sweden.

Specific aims

I. To investigate the in vitro ability of E. faecium isolates of different origin (clinical and normal microflora isolates) to gain the vanA gene-cluster by conjugation in relation to the occurrence of esp.

II. To determine possible cross-transmission events between patients and transfer of strains between different hospital settings as well as to investigate the genetic relationship between infection-causing E. faecium isolates.

III. To determine the occurrence of seven different putative virulence genes in clinical E. faecium isolates and also to investigate whether there is any correlation between antibiotic resistance and presence of these genes.

IV. To determine if any of the clinical E. faecium isolates from Sweden belonged to the globally spread CC17 and also to investigate the genetic profile of isolates causing blood-stream infections in Sweden.

MATERIAL AND METHODS

BACTERIAL SAMPLES Strain collection All clinical E. faecium isolates in the study originated from a blood-culture collection at the Karolinska University Hospital Huddinge. The Department of Clinical Microbiology at the hospital receives blood-samples for species identification from patients with blood-stream infections admitted to hospitals in the southern part of the Stockholm area. All the isolated bacteria are routinely stored in freezers for a period of 5 years before discarded. The isolates included in these studies are from this blood-culture collection consisting of all consecutively collected E. faecium isolates from year 2000 to 2007. Only one sample from each patient was included in the analysis.

In Paper I, a total of 29 consecutive clinical E. faecium isolates from the blood- culture collection isolated during year 2000 to 2001 and 30 normal microflora isolates were included. The normal microflora isolates were collected, prior to drug administration, from faeces of 30 healthy Swedish volunteers participating in clinical trials (Lund et al. 2000; Oh et al. 2000). One probiotic E. faecium strain, SF68 strain (Ventrux, AB Cernelle, Ängelholm, Sweden), was also included. In Paper II, a total of 101 consecutive clinical E. faecium isolates collected during year 2000 to 2002 were analysed. Normal microflora was represented by 20 different isolates collected from faeces of 20 healthy Swedish volunteers participating in clinical trials (Lund et al. 2000; Oh et al. 2000). Two representative E. faecium isolates from previously acknowledged regional outbreaks in university hospitals elsewhere in Sweden (denoted UHL and UHU) (Torell et al. 2001; Saeedi et al. 2004) as well as one isolate representing CC17 (Top et al. 2007) were included. A total of 263 consecutive clinical E. faecium isolates collected during 2000 to 2006 were used in Paper III. Two representative outbreak strains (UHL, UHU) were also included. In Paper IV, a total of 203 consecutive clinical E. faecium isolates collected from year 2004 to 2007 were included as well as one regional outbreak strain (UHU).

Reference strains A vancomycin-resistant E. faecium strain, CCUG 36804, harbouring the vanA gene cluster was used as donor in the conjugation assays, with the exception of the conjugation assay with the probiotic SF68 strain, where one additional donor, a vancomycin-resistant clinical isolate (SMI 141 isolated in 1995 at SMI), was used (Paper I). E. faecalis ATCC 29212 (Paper I-IV) was used as reference strains for the antibiotic susceptibility tests. Positive controls in the PCR reactions were E. faecalis MMH 594 for the esp gene (Paper I-IV), asa1 and cylA (Paper III), E. faecalis ATCC 29212 for gelE (Paper III) and two clinical isolates collected at the Karolinska University Hospital Huddinge, E. faecalis HS1 for ace and efaAfs (Paper III) and E. faecium HS2 for hylfm (Paper II-IV).

23 E. faecium CCUG 36804 was used as a reference for the vanA gene cluster and E. faecalis SSI, previously isolated at the Karolinska University Hospital Huddinge, for the vanB gene cluster (Paper II).

MICROBIOLOGICAL ASSAYS The agar dilution method Minimal inhibitory concentrations (MIC) were determined using the agar dilution method according to the CLSI (2006a). Resistance to ampicillin (AstraZeneca, Södertälje, Sweden), ciprofloxacin (Bayer, Elberfeldt, Germany), gentamicin (Sigma-Aldrich, St. Louis, MO, USA), imipenem (Merck Sharp & Dohme B.V, Haarlem, Netherlands), linezolid (Pharmacia & Upjohn, Uppsala, Sweden) and vancomycin (Abbott Scandinavia AB, Solna, Sweden) was investigated (Paper II-IV). Resistance to ampicillin, gentamicin and vancomycin using disk diffusion was investigated in Paper I. Etest strips (AB Biodisk, Solna, Sweden) were used for detection of daptomycin resistance (Paper III). The clinical breakpoints used were those recommended by EUCAST (www.eucast.org) when available, and otherwise those from the CLSI (2006b) (Table 3).

Table 3. Demonstrating the resistance breakpoints used in the different studies. The numeric values refer to antibiotic concentrations (mg/L). Antibiotic S< I R> Reference

Ampicillin 4 - 8 EUCAST Ciprofloxacin 1 2 4 CLSI Gentamicin - - 500 CLSI Imipenem 4 - 8 EUCAST Linezolid 4 - 4 EUCAST Vancomycin 4 - 8 EUCAST

In vitro conjugation assay using filter mating (Paper I) The conjugation assay was performed as previously described by Murray and Hodel-Christian (1991) with some small modifications. Broth cultures of donor and recipients strains were mixed, at a ratio of 1:10, and filtered through a 0.45 µm filter (Millipore Corporation, Bedford, MA, USA) using a vacuum pump. The number of bacteria in the mating-mix were in the magnitude of 107/mL for the donors and 108/mL for the recipients. The filters were placed on blood-agar plates and incubated overnight (37°C). A ten-fold dilution series of suspensions from filters were plated on Luria-agar plates containing appropriate antibiotics. Colonies growing on media containing 100 µg/mL rifampicin and 8 µg/mL vancomycin were considered potential transconjugants. The number of recipients and donors in each reaction mixture was determined by viable count. The conjugation frequency for each isolate was calculated as the number of colony forming units (CFU) transconjugants per CFU donor.

PCR The PCR procedure requires template DNA, two specific oligonucleotide primers, a heat-stable DNA polymerase and a nucleotide mix. A typical PCR protocol is comprised of 30 cycles and each cycle is divided into three different phases. In the first denaturation step, the double stranded DNA are separated using heat (94ºC). In the second step, the temperature is lowered and the specific primers bind to the complementary parts of the DNA strands (annealing). In the last phase (elongation), the heat stable DNA polymerase extends the DNA strands by adding new nucleotides (Figure 4). Since the PCR reaction is exponential (2n, where n is the number of cycles), large quantities of DNA can be synthesized rapidly.

Figure 4. Illustration of the three different steps (denaturation, annealing and elongation) in a PCR reaction.

The different primers used in the PCR reactions (Paper I-IV) are presented in Table 4. Templates used in the PCR reactions were purified by resuspension of overnight cultured bacteria in 100 µL of MQ, heated at 95°C for 15 min followed by centrifugation at 15 000 rpm for 5 min.

25 Table 4. The different primers used in the PCR reactions. Product Target gene Primers Sequence (5’- 3’) size asa 11 CACGCTATTACGAACTATGA Aggregation 375 bp substance asa 12 TAAGAAAGAACATCACCACGA ace 1 GGAATGACCGAGAACGATGGC Collagen binding 616 bp protein ace 2 GCTTGATGTTGGCCTGCTTCCG cyt I ACTCGGGGATTGATAGGC Cytolysin 688 bp cyt IIb GCTGCTAAAGCTGCGCTT efaA 1 CGTGAGAAAGAAATGGAGGA E. faecalis 499 bp endocarditis antigen efaA 2 CTACTAACACGTCACGAAT esp 14F AGATTTCATCTTTGATTCTTG G Enterococcal surface 510 bp protein esp 12R AATTGATTCTTTAGCATCTGG gel 11 TATGACAATGCTTTTTGGGAT Gelatinase 213 bp gel 12 AGATGCACCCGAAATAATATA hyl n1 ACAGAAGAGCTGCAGGAAATG Hyaluronidase 276 bp hyl n2 ACTGACGTCCAAGTTTCCAA vanA 1 GGGAAAACGACAATTGC vanA gene cluster 732 bp vanA 2 GTACAATGCGGCCGTTA vanB 1 ATGGGAAGCCGATAGTC vanB gene cluster 635 bp vanB 2 GATTTCGTTCCTCGACC

Detection of the vanA gene cluster (Paper I) All recipients and their corresponding transconjugants (rifR and vancoR) were screened for the presence of the vanA gene with PCR (Dutka-Malen et al. 1995) for confirmation of a conjugation event (Figure 5).

Figure 5. Illustration of the PCR protocol used for amplification of the vanA and vanB gene-cluster (Paper I, II).

Detection of putative virulence genes All isolates were screened for the presence of esp and hyl (Figure 6) (Paper I- IV). A total of 50 µL mastermix containing 2 µL template, 1 x PCR Gold Buffer without MgCl2, 2.5 mM MgCl2, 200 µM dNTP x 4 (Sigma-Aldrich, Stockholm, Sweden) and 1 U Taq Polymerase Gold (AmpliTaq Gold; Applied Biosystems, Solna, Sweden) with 0.1 mM of each esp primer and 0.2 mM of each hyl primer (Thermo Electron GmbH, Ulm, Germany) was used. The virulence genes, ace, asa1, gelE, cylA and efaAfs, were analysed in separate PCR reactions, using 2 µL template in a total of 50 µL mastermix containing 1 x PCR

Gold Buffer, 2.5 mM MgCl2, 200 µM dNTP x 4 (Sigma-Aldrich, St. Louis, MO, USA), 1 U Taq Polymerase Gold (AmpliTaq Gold; Applied Biosystems, Solna, Sweden) and 0.4 mM each primer pairs (Thermo Electron GmbH, Ulm, Germany). For details of the PCR programs, see Figure 6. (Paper III).

Figure 6. Illustrating the PCR protocol used for amplification of putative virulence genes. Annealing of 56°C was used for asa1, cylA, esp, gelE and hyl and annealing at 58°C for ace, efaAfs (Paper I-IV).

Sequencing (Paper III) The identity of the amplicons and genes of interest was confirmed by sequencing the reference strains and one positive representative clinical isolate for each target gene. Amplification was achieved by PCR, using the same primer pairs previously described (Table 4). The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Solna, Sweden). Sequence analysis, using ABI 310 Genetic Analyser, was performed according to the manufacturer (Perkin Elmer, Waltham, MA, USA). The sequences were aligned with the software FinchTV (www.geospiza.com/finchtv/) and ClustaW Multiple sequence alignment at the European Bioinformatics Institute, Cambridge, United Kingdom (www.ebi.ac.uk/Tools/clustalw/index.html), and positively identified in the BLAST program (www.ncbi.nlm.nih.gov).

27 GENOTYPING Pulsed-field gel electrophoresis (Paper I and II) Chromosomal DNA was prepared by embedding whole bacteria in agarose- disks (1.5% SeaPlaque agarose; FMC Bioproducts, Rockland, ME, USA) according to a protocol based on descriptions by De Lencastre et al. (1999) with some modifications (Lund et al. 2002a). The bacteria were lysed using EC- buffer (6.0 mM Tris pH 8.0, 1.0 M NaCl, 0.1 M EDTA pH 8.0, 0.2% Na- deoxycholate, 0.5% Sarkosyl, 0.5% Brij-58) with added lysozyme (1 mg/mL, Sigma-Aldrich) and RNAse (50 µL/mL, Sigma-Aldrich) at 37°C for 24 h. The EC-buffer was removed and protein was degraded using ES-buffer (0.5% EDTA pH 8.9 and 1% Sarkosyl) with added Proteinase K (2 mg/mL, Sigma-Aldrich) in a 50°C water bath for 24 h. The ES-buffer was removed and the disks were digested for 24 h at 37°C using SmaI restriction enzyme (10 U, Promega Corporation, Madison, WI, USA) (Figure 7). For analysis, a contour-clamped homogenous electric field apparatus (CHEF) (GenePathsystem; BioRad Laboratories, Hercules, CA, USA) was used. Electrophoresis was run for 20 h at 14°C. The pulse time was linearly ramped from an initial switch time of 5.3 sec to a final switch time of 34.9 sec and the voltage was set at 6.0 (V/Cm). For a schematic overview of the PFGE method see Figure 8.

5'….CCC▼GGG…3'

3'…GGG▲CCC…5' Figure 7. Cleavage-site for the rare-cutting restriction enzyme SmaI resulting in blunt ends.

Calculation of dendrograms and gel image analysis The PFGE banding patterns were either inspected visually (Paper I) or analyzed with BioNumerics, version 3.5 (Applied Maths, St-Martens-Latem, Belgium) (Paper II). Calculation of similarity matrices and creation of dendrograms was carried out utilizing the unweighted pair group method using arithmetic averages (UPGMA). Similarity coefficients were calculated according to the method of Dice. The software program assigned bands, which thereafter were manually controlled and accepted. The relatedness of the isolates was assessed according to previously described criteria (Tenover et al. 1995). The following categories were described: indistinguishable, closely related, possibly related and unrelated. Indistinguishable isolates display no detectable genetic difference, resulting in identical banding patterns. Closely related isolates can be separated by a single genetic event, leading to a 2-3 fragment difference of banding patterns. Isolates that are possibly related differ with 4-6 fragments as a result of two genetic events. Isolates are considered to be unrelated when three or more genetic events have occurred. The banding pattern will then differ with ≥ 7 bands. A conjugation event was considered confirmed when recipient and donor had identical banding patterns (Paper I). The spread of isolates between different hospital settings were only regarded for isolated displaying identical banding patterns. Isolates clustering above 85% similarity (≤ 3 bands difference) were considered to belong to the same clone (Paper II).

- Over-night cultured bacterial cells

- Whole bacterial cells embedded in agarose (disks)

- Lysis of the bacterial cells inside the disks - Cleavage of the whole bacterial chromosome using the rare cutting restriction enzyme SmaI, resulting in large DNA fragments

+ + - - - Separation of large - DNA fragments using a - + multidirectional electric + + field + - -

- Specific fingerprint for each isolates - Analysis of the entire bacterial chromosome

Figure 8. Schematic overview of pulsed-field gel electrophoresis (PFGE).

29 Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA) (Paper IV) All isolates were genotyped using the typing scheme described by Top et al. (2004) and MLVA profiles were assigned using the MLVA website (www.umcutrecht.nl/subsite/MLVA). The different primers used are illustrated in Table 5. Three colonies of overnight cultured bacteria were resuspended in 20 µL lysis buffer (0.25% SDS, 0.05 M NaOH), incubated at 95ûC for 5 min, shortly centrifuged and diluted in 180 µL buffer (10 mM Tris-HCl pH 8.5). An additional centrifugation at 13 000 rpm for 5 min was performed after thoroughly mixing the samples. VNTR-1, VNTR-2, VNTR-7, VNTR-8, VNTR-9 and VNTR-10 were amplified using three different PCR protocols (Figure 9a, b, c). Each PCR reaction had a final volume of 25 µL comprising 12.5 µL HotStartTaq® Master Mix (HS) (Qiagen, Solna, Sweden), 2 µL of each primer (5 pmol, Eurofins MWG Operon, Ebersberg, Germany), 3.5 µL MQ and 5 µl of template. A 1.5% agarose gel was used for VNTR-1, 1% for VNTR-2 and 2% for VNTR-7, VNTR-8, VNTR-9 and VNTR-10. Two different DNA ladders were used for size determination of fragments on the agarose gels, 1 kB DNA Plus Ladder and 123 bp DNA Ladder (Invitrogen, Täby, Sweden).

Table 5. Illustration of the different primers used in the MLVA analysis. Product Primer Sequence (5’- 3’) size VNTR-1F CTGTGATTTGGAGTTAGATGG 123 bp VNTR-1R CATTGTCCAGTAGAATTAGATTTG VNTR-2F GATGCTTATTTCCACTGCTTGTTG 279 bp VNTR-2R GTTTTACCCTCTCTTTTAAGGTCAATG VNTR-7F CTATCAGTTTCAGCTATTCCATC 121 bp VNTR-7R CTGGTACGAATCAAATCAAGTG VNTR-8F GGGGAGTGGCAAAAAATAGTGTG 121 bp VNTR-8R CAGATCATCAACTATCAACCGCTG VNTR-9F CTGCATCTAATAACAAGGACCCATG 121 bp VNTR-9R ACATTCCGATTAACGCGAAATAAG VNTR-10F CCTACAGAAAATCCAGACGG 120 bp VNTR-10R TTTTTTCCATCCTCTTGAATTG

c) Figure 9. Illustration of the different PCR protocols used in the MLVA analysis. a) The protocol used for amplification of VNTR-1. b) A touchdown PCR protocol was used for VNTR-2. The temperature decreased 1°C for each cycle (*) from 70°C to 60°C. c) Touchdown PCR protocol used for VNTR-7, VNTR-8, VNTR-9 and VNTR-10. The temperature decreased 1°C for each cycle (*) from 65°C to 55°C for.

Multilocus Sequence Typing (MLST) (Paper IV) Amplification of seven different genes, adk (adenylate kinase), atpA (ATP synthase, alpha subunit), ddl (d-alanine:d-alanine ligase), gdh (glucose-6- phosphate dehydrogenase), gyd (glyceraldehyde-3-phosphate dehydrogenase), purK (phosphoribosyl-aminoimidazol carboxylase ATPase subunit) and pstS (phosphate ATP-binding cassette transporter), was achieved using primers (Table 6) and PCR protocol according to the instructions on the MLST website (http://efaecium.mlst.net).

31 In a 25 µL reaction, 12.5 µL of HS (Qiagen), 2 µL of each primer (5 pmol, Eurofins MWG Operon), 6.5 µL of MQ and 2 µL of template were used. PCR amplification was performed using the same PCR program as for VNTR-1 (Figure 9a). Unpurified PCR product was sent to Eurofins MWG Operon for sequencing.

Table 6. Illustration on the different primers used in the MLST analysis and the corresponding size of the amplified product. Product Target gene Primer Sequence (5’- 3’) size adk1n-F GAACCTCATTTTAATGGGG Adenylate kinase 437 bp adk2n-R TGATGTTGATAGCCAGACG atpA1n-F TTCAAATGGCTCATACGG ATP synthase, alpha subunit 556 bp atpA2n-R AGTTCACGATAAGCAACAGC ddl1-F GAGACATTGAATATGCCTTATG D-alanine-D-alanine ligase 465 bp ddl2-R AAAAAGAAATCGCACCG Glucose-6-phosphate gdh1-F GGCGCACTAAAAGATATGGT 530 bp dehydrogenase gdh2-R CCAAGATTGGGCAACTTCGTCCCA Glyceraldehyde-3-phosphate gyd1-F CAAACTGCTTAGCTCCAATGGC 395 bp dehydrogenase gyd2-R CATTTCGTTGTCATACCAAGC Phosphoribosylaminoimidzol purK1n-F CAGATTGGCACATTGAAAG 492 bp carboxylase ATPase subunit purK2n-R TTCATTCACATATAGCCCG Phosphate ATP-binding pstS1n-F TTGAGCCAAGTCGAAGC 583 bp cassette transporter pstS2-R CGTGATCACGTTCTACTTCC

Statistical and data analyses Mann-Whitney U-test (Paper I) The strains were first grouped according to origin (normal microflora or blood) followed by subgrouping according to presence of esp. The median conjugation frequency value was calculated for the different groups. Differences in conjugation frequencies between the groups and between subgroups were calculated with the Mann-Whitney U-test for unpaired observations. A p-value of ≤ 0.05 was considered significant and p-values > 0.05 but ≤ 0.10 were interpreted as indicating a tendency.

Chi-square test A Chi-square test (Statistica, release 8; Statsoft®, Uppsala, Sweden) was used to analyze whether there were significant differences in the number of non- conjugants between the total number of esp-positive and esp-negative isolates (Paper I). Differences in the presence of esp and antibiotic resistance between clinical isolates from three different hospital categories (Paper II) and whether a correlation between the occurrence of virulence genes and antibiotic resistance occurred (Paper III) were also calculated with the Chi-square test. In Paper IV, the same method was used for testing whether antibiotic resistance and the presence of esp or hyl altered significantly from year 2004 to 2007. A p-value of < 0.05 was considered significant. Correction for multiple significance tests was calculated according to the Bonferroni method (Bland 2000) (Paper III).

Data analysis The MLVA and MLST profiles were clustered with the Bionumerics software (version.5.00, Applied Maths, Sint-Martens-Latem, Belgium) using a categorical coefficient and the graphing method minimum spanning tree, as previously described (Schouls et al. 2004).

33 RESULTS

BACTERIAL ISOLATES All clinical E. faecium used in the study originated from the blood-culture collection previously described (Paper I-VI). The isolates used in Paper III were divided into three different categories depending which type of hospitals and healthcare facilities, all located in the southern part of Stockholm, they originated from. The Karolinska University Hospital was denoted tertiary hospital (n=1) and larger community hospitals (n=2) were denoted secondary hospitals. Small county hospitals and community care facilities (n=5) were denoted primary hospitals. The majority of isolates (58%) were collected at the tertiary hospital, 24% of the isolates came from secondary hospitals and the remaining isolates (12%) were from primary hospitals. The majority of isolates from the tertiary hospital had been isolated at the haematology (45%) and transplantation (24%) departments. The intensive care unit, the surgery and internal medicine departments were the most common wards for isolates deriving from secondary hospitals. Most of the isolates from primary hospitals were sent from a geriatric division with oncology patients (58%).

ANTIBIOTIC SUSCEPTIBILITY Clinical E. faecium isolates The number of isolates resistant to ampicillin increased from 68% in 2000 to 86% in 2007. The overall resistance to ciprofloxacin (89% in 2000, 81% in 2007) and imipenem (76% in 2000, 86% in 2007) was quite stable throughout the 8 study years. The resistance to gentamicin (HLGR) and vancomycin increased significantly (p < 0.005) during the last year of the study period. Two separate peaks with VREF were detected, the first one appeared in 2001-2002 and the second during 2007. For more details of resistance, see Figure 10. No resistance to either daptomycin or linezolid was detected.

Antibiotic resistance

100

ampR 60 cipR

% genR 40 impR vanR

0 2000 2001 2002 2003 2004 2005 2006 2007 n=38 n=22 n=51 n=54 n=58 n=52 n=50 n=43 Ye ar

Figure 10. Graf illustrating the antibiotic resistance during the entire 8-year study period. Abbreviations: ampR, ampicillin resistance; cipR, ciprofloxacin resistance; genR, gentamicin resistance; impR, imipenem resistance; vanR, vancomycin resistance; n, number of isolates.

A total of 18 isolates resistant to imipenem but susceptible to ampicillin were found. This is a rare but previously described resistance profile (El Amin et al. 2001; Billström et al. 2008b) (Paper II, IV). The occurrence of ampicillin and imipenem resistance was significantly higher (p < 0.001) among isolates deriving from the tertiary hospital compared to the secondary and primary hospitals. The most common profile (in regard to resistance and presence of virulence genes) among the isolates was carriage of esp combined with resistances to ampicillin, ciprofloxacin and imipenem. These isolates dominated at the tertiary hospital (66%, 39/59), whilst 38% (9/24) and 8% (1/12) of isolates from secondary and primary hospitals expressed this specific profile. Isolates solemnly resistant to ciprofloxacin, and lacking esp, were only found from primary (17%, 2/12) and secondary (33%, 8/24) hospitals (Figure 11) (Paper III). A significant increase in resistance from 2004 to 2007 was found for gentamicin (p < 0.001) and vancomycin (p < 0.005) (Paper IV).

Normal microflora All normal microflora isolates were susceptible to ampicillin, gentamicin and vancomycin (Paper I-II).

35 70

40 Primary Secondary 30 Teritiary % of isolates % of

0 esp+, ampR, cipR, imiR ampR, cipR, imiR cipR Antibiotic resistance combined with presence of esp

Figure 11. Occurrence of isolates with the three most common profiles of antibiotic resistance with or without concurrent presence of esp, found at the primary, secondary and tertiary hospitals. Abbreviations: esp+, positive carriage of the enterococcal surface protein; ampR, ampicillin resistance; cipR, ciprofloxacin resistance; imiR, imipenem resistance.

CONJUGATION FREQUENCIES Isolates with a conjugation frequency below the detection limit (<107) were denoted as non-conjugants (n=22). A total of 18% of all the esp-positive and 45% of all the esp-negative isolates were regarded as non-conjugants. In the blood isolate group, the esp-positive isolates had a significant higher conjugation frequency compared to esp-negative ones (p < 0.001). The conjugation frequencies were still significantly higher when all esp-positive isolates were compared to the total number of esp-negative (p < 0.02), whilst there was no difference between the total number of blood isolates compared to the total number of normal intestinal microflora isolates (p > 0.10) (Table 7). All but one of the infection-derived non-conjugants lacked esp. The rate of conjugation per donor for the SF68 strain was 1.5 x 10-6 CFU (Paper I).

Table 7. Summary of data deriving from the in vitro conjugation assays. Conjugation frequencies: transconjugants/donor No of No of Range Median Groups non- p-value isolates conjugants (Min-Max) value B tot 29 10 < 10-7 - 3.7 x 10-5 8.0 x 10-7 > 0.1 N tot 30 12 < 10-7 - 3.9 x 10-5 2.5 x 10-7 B esp+ 15 1 < 10-7 - 3.7 x 10-5 6.4 x 10-6 < 0.001 B esp- 14 9 < 10-7 - 1.2 x 10-5 < 10-7 esp+ tot 17 3 < 10-7 - 3.7 x 10-5 5.6 x 10-6 < 0.02 B tot 42 19 < 10-7 - 3.9 x 10-5 1.5 x 10-7 Abbreviations: B, blood isolates; N, normal microflora isolates. P-value calculated according to Mann-Whitney U-test for unpaired observations.

PRESENCE OF VIRULENCE GENES The overall presence of esp significantly increased from 55% in 2000 to 72% in 2007 (p < 0.01). The presence of hyl was below 3% during the first 3 study years (2000-2002), and the following 3 years (2003-2005) the levels showed a small increase to approximately 5.5%. In 2007, there was a significant increase to 35% (p < 0.001) (Figure 12). Only two of the normal microflora isolates were positive for the esp gene.

Presence of virulence genes

74 72 60 63 58 55 57 49 esp 35 % 40 45 hyl

16 20

5,5 5 2,6 4 0 2 0 2000 2001 2002 2003 2004 2005 2006 2007 n=38 n=22 n=51 n=54 n=58 n=52 n=50 n=43 Year

Figure 12. The presence of esp and hyl during the 8-year study period. The numbers shown in the figure represent percentage of isolates positive for the virulence gene in question.

37 The esp gene was more common among isolates deriving from the tertiary hospital (68%, 40/59) compared to isolates from secondary (42%, 10/24), p < 0.05, and primary (8%, 1/12) hospitals, p < 0.001 (Paper II). The more rare virulence determinants asa1, ace, efaAfs and gelE were mainly detected during year 2004 and 2005. For more detailed information see Figure 13. Three isolates harboured these rare virulence genes and none of the isolates carried cylA (Paper III).

10 asa1 8 ace

6 efaAfs gelE 4

Number of isolates hylfm 2

0 2000 2001 2002 2003 2004 2005 Year

Figure 13. Occurrence of putative virulence determinants ace, asa1, cylA, efaAfs, gelE and hyl, in clinical E. faecium isolates, during a 6-year period.

CONJUGATION ASSAY All colonies that grew on agar plates supplemented with vancomycin and rifampicin were regarded as potential transconjugants and were thereby included in the PFGE analysis as part of the conjugation assay. The banding pattern of each recipient compared with the corresponding transconjugants showed pair-wise identical patterns (Figure 14) (Paper I).

R T R T R T R T R T R T R T R T R T R T

Figure 14. Demonstration of the identical banding patterns displayed by 10 different pairs of recipients (R) and their corresponding transconjugants (T).

GENETIC DIVERSITY The esp-positive isolates were more genetically related compared to the esp- negative ones. The esp-positive isolates were grouped into six separate clones where the largest consisted of 33 isolates (61%, denoted C) and the majority of the isolates (93%, 50/54) clustered above 85% identity. Although 76% (35/46) of the esp-negative clinical isolates grouped into different clones, these were all small; the largest clone contained six isolates (13%, denoted i) and the remaining 13 clones consisted of only three or two isolates (Figure 15) (Paper II).

a A b

c B

d e

C h

l D m n E

a) b) Figure 15. Dendrogram of a) esp-negative isolates (n=46) and b) esp-positive isolates (n=54). The dotted lines represent an 85% cut-off value (≤ 3 band difference). Letters (a-n, A-F) denotes different clones.

The normal microflora isolates displayed a genetic diversity similar to that of ampicillin-susceptible clinical isolates, possibly indicating an endogenous origin of ampicillin susceptible isolates (Figure 16) (Paper II).

Figure 16. Dendrograms of a) ampicillin-susceptible clinical E. faecium and b) normal microflora isolates. Abbreviations: Prim, primary hospitals; Sec, secondary hospitals; Tert, tertiary hospital; nd, not determined; cip, ciprofloxacin resistance; gen, gentamicin resistance; imi, imipenem resistance.

41 CROSS-TRANSMISSION A group of at least two isolates with identical PFGE banding pattern was considered a strain. A total of 43 patients were involved in a cross-transmission event, i.e. the same strain was isolated from different patients. These minor outbreaks (n=14) was the result of fourteen different strains, each isolated from two to nine patients at each occasion. Eight of these epidemic strains were spread between the different hospital categories whilst six strains disseminated only within the tertiary hospital. The transmitted strains expressed, most often, a consistent resistance profile. In two cases the strain accumulated antibiotic resistance and esp when transmitted from a primary or secondary hospital to the tertiary hospital (Figure 17). (Paper II).

Primary hospitals Secondary hospitals

[I [I] [II] [III] [IV] [V] [VI] [VII] [VIII] V

[I] [II] [III] [IV] [V] [VI] [VII] [VIII]

Tertiary hospital

Figure 17. Dissemination of strains between the different hospital categories. Roman numeral in brackets denotes PFGE type. Abbreviations: ampR, ampicillin resistance; cipR, ciprofloxacin resistance; impR, imipenem resistance. ( ) esp, ampR, cipR, impR; ( ) esp, cipR, impR; ( ) ampR, cipR, impR; ( ) cipR.

MULTIPLE-LOCUS VARIABLE-NUMBER TANDEM REPEAT ANALYSIS A total of 23 different MLVA types were found including 10 not previously described MTs. A total of 167 isolates generated an MLVA profile whilst 36 isolates displayed incomplete profiles. Eleven of these isolates were ampicillin resistant and nine harboured esp. Three isolates susceptible to ampicillin were positive for esp. MT-1 was the dominating MLVA type containing 109 isolates (65%) as well as the outbreak strain (UHU), whilst 21 isolates (13%) belonged to MT-159. A shift from MT-1 to MT-159 was detected in 2007 when 40% (17/43) of the isolates belonged to MT-159, in contrast to 8% (4/50) in 2006.

Identification of CC17 specific MTs based on the different repeat combinations for VNTR-7, VNTR-8 and VNTR-10 revealed that 94% (157/167) of the isolates belonged to CC17. A total of 96% (162/167, 17/23 MTs) of the isolates where genetically related including all single locus variants (SLV) and double locus variants (DLV) from MT-1. The high genetic relatedness among the isolates, the presence of resistance to ampicillin or gentamicin and the carriage of esp or hyl are illustrated in Figure 18.

a) b)

c) d)

Figure 18. Cluster analysis of all MTs. The grey part of the circle represents a) ampicillin resistance, b) gentamicin resistance, c) presence of esp, d) presence of hyl.

MULTILOCUS SEQUENCE TYPING Eleven isolates belonging to eight different MTs were selected in order to investigate the extent of the clonal spread of CC17 specific isolates. Six and three isolates belonging to MT-1 and MT-159, respectively, were selected to determine whether the isolates shared the same genetic origin. A total of 10 different sequence types (STs) were identified, and eight of these were a part of CC17 (Table 8). Different STs were found among a single MT, MT-1 comprised ST-17 and ST-80, which differ in 2 of the 7 loci (DLV), whilst MT-159 comprised the SLVs ST-78 and ST-192. Different MTs were also discovered within the same ST. ST-192 comprised isolates belonging to both MT-12 as well as MT-159 (Paper IV).

Table 8. Illustration of the 20 different isolates selected for MLST analysis. Year of MTs STs CC17 isolation esp hyl AMP CIP GEN IMP VAN 1 17 + 2007 + + + + + 1 17 + 2007 + + + + + + 1 17 + 2006 + + + + + 1 17 + 2005 + + + + 1 80 + 2005 + + + + 1 17 + 2004 + + + + 159 192 + 2007 + + + + + + + 159 78 + 2007 + + + + 159 192 + 2007 + + + + + + 12 192 + 2006 + + + + + 12 18 + 2004 + + + 7 17 + 2007 + + + 7 440 + 2006 + + + + 11 441 - 2007 + + + + + 11 441 - 2006 + + + + 4 80 + 2004 + + + + 16 16 + 2006 + + + + + + 39 168 + 2005 + + + 51 92 - 2007 205 18 + 2007 + + + Abbreviations: esp, enterococcal surface protein; hyl, hyaluronidase; AMP, ampicillin; CIP, ciprofloxacin; GEN, gentamicin (HLGR); IMP, imipenem; VAN, vancomycin. + indicates resistance or presence of a virulence gene.

DISCUSSION

E. faecium were for a long time considered to be harmless inhabitants of the GI tract. However, an increased prevalence of severe enterococcal infections in combination with limited knowledge regarding their pathogenesis, especially from a molecular epidemiological perspective, warrants more research on these microorganisms. The first reports on AREfm came in the 1980s (Grayson and Eliopoulos 1990) and AREfm have since then become a significant problem in hospitals worldwide. A hospital acquired infection can be defined as an infection occurring during the patient’s stay at the hospital or within 48 h after dismission from the hospital. The infection-causing organism can be of endogenous (from the patient’s own normal microflora) or of exogenous (acquired at the hospital) origin. Another possibility is a secondary endogenous origin where the patient, once in a hospital environment, first becomes colonized for a period of time with nosocomial bacteria, which at a later time point cause an infection. For a relatively low virulent organism which is easily established in the GI microflora, such as E. faecium, this two-step scenario is highly likely.

Previously E. faecium infections were thought to be solemnly of endogenous origin. Data contradicting this view are accumulating. The E. faecium subpopulation belonging to CC17, exhibiting enhanced properties for causing infections are commonly occurring in the hospital environment, indicating a non endogenous origin for infection. Also, the frequent cross-transmissions with E. faecium strains between hospitalized patients suggest an exogenous origin (Paper II) (Lund et al. 2002b). The majority of the E. faecium isolates causing blood-stream infections in the studied hospitals were shown to be a part of CC17. Some isolates were not typable using MLVA, which might be a result of the absence of one or more of the VNTRs. It is possible that these untypable isolates, with deviating profiles regarding resistance and presence of esp, were of endogenous origin. Apparently, ampicillin-susceptible and esp-negative E. faecium can cause blood-stream infections (Paper I-IV) and it is possible that these isolates are derived from the patients own normal microflora (Paper II) since they less frequently occur in cross-transmission events. According to the PFGE results, frequent spread and survival of these endogenous isolates do not occur in the hospital environment (Paper II). This is further supported by the observation that isolates harbouring esp were more genetically related compared to esp-negative ones (Paper II) indicating a divergent origin of these two groups of isolates. The antibiotic pressure is high in many hospital wards and it seems to be a presence of more fit bacteria displaying antibiotic resistance and virulence features in this environment, with which susceptible bacteria cannot compete. It is questionable whether a normal microflora isolate deficient of virulence traits would cause infection in one patient and then be transmitted and cause infection in another patient. It was further demonstrated that the pattern of genetic relatedness among clinical ampicillin-susceptible isolates and normal microflora isolates are similar (Paper II). Together these data suggest an endogenous origin

45 of ampicillin-susceptible esp-negative isolates and an exogenous origin of ampicillin-resistant esp-positive isolates (Paper II).

The difference between nosocomial colonization and nosocomial infection is apparent. When screening patients during a hospital outbreak, colonization is high (Lund et al. 2002b) and AREfm are frequently encountered whilst the number of patients actually developing an infection remains low (Torell et al. 1999). The direction of transfer of strains between the different hospital settings cannot be determined with certainty in the present study. However it seems likely that the strain has been transferred from a patient at a tertiary hospital to a patient in a primary or secondary hospital since antibiotic resistance expressed by the transmitted strains was much more prevalent in the tertiary hospital, although a transmission of strains in the opposite direction cannot be excluded (Paper II). The only way to be certain of the transmission pathway is to screen all patients for colonization before admittance and then genotype both the colonizing isolates as well as infection-causing isolates and compare their genetic profiles. The question of when a normal microflora isolate becomes a clinical strain and when, or if a colonizing isolate becomes a part of the hosts own microflora, is not easily elucidated.

E. faecium have the competence to acquire antibiotic resistance (Paper I) and to accumulate virulence genes (Paper III, IV). The decreasing ratio seen between clinically isolated E. faecalis and E. faecium (Murdoch et al. 2002; Simonsen et al. 2003; Top et al. 2007) has mainly been explained by the suggestion that antibiotic resistance is a more severe problem among E. faecium compared to E. faecalis. Resistance to both vancomycin and ampicillin is approximately 10 times more common among clinical E. faecium compared to clinical E. faecalis (Arias and Murray 2008), providing these strains with an advantage in a clinical setting where the antibiotic pressure is high. However, one cannot exclude the possibility that clinical E. faecium isolates are becoming increasingly virulent and thereby contributing to this shift (Paper III).

The fraction of infecting bacteria of a particular species in comparison with colonizing bacteria is dependent on their pathogenicity. Thus, a strain with enhanced virulence is more likely to cause infection. Although the role of esp and hyl is unknown, their frequent occurrence among clinical isolates indicate that their presence indirectly or directly enhances survival and dissemination in the hospital environment. Another possibility is that the CC17 population is taking over in the clinical environment. It is also plausible that a more virulent part of the CC17 population displaying increased antibiotic resistance outcompetes E. faecalis. There are reports on the replacement of E. faecalis with AREfm (Top et al. 2007; Top et al. 2008b) and the emergence of VRE in the US was preceded by increased levels of AREfm (Grayson et al. 1991; Jones et al. 1995). It is possible that Europe is following the development in the US with a 10-year delay. It has been suggested by others that E. faecium first acquired ampicillin resistance and later on the esp gene (Willems et al. 2005). This correlates with our results, where the levels of ampicillin resistant isolates are higher compared to the number of isolates harbouring esp (Paper I-IV). A

46 strong correlation between ampicillin resistance and presence of esp was also described (Paper III).

In Paper IV we reveal the presence and spread of CC17, which has not previously been described in Sweden. The genetic relatedness among the isolates genotyped with MLVA was high. The most common MLVA type was MT-1, but in 2007 this MT was partly replaced by MT-159, an MT previously reported to cause nosocomial outbreaks in different parts of the world. Here, these isolates were resistant to ampicillin, ciprofloxacin and gentamicin (HLGR), and they also harboured the esp and hyl genes. MLST analysis demonstrated the possible change of isolates collected in 2006, harbouring esp and hyl, belonging to MT-12 with sequence type 192, into its SLV MT-159 with ST-192 now also expressing a broader resistance. One can speculate whether ST-192 will be the dominating clone in Stockholm hospitals during the next few years due to the increased resistance and virulence among these isolates. Different ST were found among the same MT, and the opposite case with multiple MT within the same ST also occurred. This could be a result of differences in the genetic events for tandem repeats compared to housekeeping genes and such rearrangements do most likely not occur simultaneously.

The different methods used for subspecies analysis (PFGE, MLVA and MLST) all have their different advantages and disadvantages. PFGE is the most discriminatory method compared to MLVA and MLST, whilst MLVA is a good method for assigning E. faecium into nosocomial complexes (Werner et al. 2007; Top et al. 2008a). The analysis of PFGE gel images is a more or less a subjective interpretation. If a standardized protocol as well as an electrophoresis scheme, including a reference strain, is used, the method could probably be used for interhospital comparisons, but PFGE is generally not considered to be suited for these types of comparisons. Another problem with PFGE interpretation is in the case when isolates collected over long time periods are analyzed. In this situation, it can be difficult to conclude the relatedness among these isolates due to lack of interpretation guidelines regarding the genetic rearrangements that may have occurred. Although the modern molecular typing methods often provide more exact and readily interpreted results, we cannot exclude phenotypic tests. When working with bacteria, it is important to have a thorough competence to handle, phenotypically observe and biochemically classify bacteria before applying molecular methods on a sample. A molecular test is only as good as the material used. If the quality of the sample is hampered by e.g. contamination, the molecular results achieved will be useless. Antibiotic susceptibility is another example of why we still need to culture bacteria since MIC cannot be investigated using for example PCR. We can screen for presence of a gene coding for antibiotic resistance, but the presence of a gene does not necessarily mean phenotypic expression. The ability and knowledge of growing pure cultures of bacteria is still a prerequisite for a successful genotypic analysis.

47 In conclusion, the results of the present study has revealed important information about the epidemiology of E. faecium isolated from blood-stream infections in patients treated at different healthcare facilities in the Stockholm area. Sweden can be regarded as a model of past evolution of E. faecium virulence and resistance acquisition already completed in other parts of the world. By closely monitoring the genetic profile of clinical E. faecium isolates in “low resistance countries” we will gain important information on how development and establishment of resistant and virulent clones have occurred.

GENERAL SUMMARY

The hardy nature of enterococci combined with intrinsic and acquired resistance to several antibiotic classes render treatment of these infections difficult. Different putative virulence factors, such as esp and hyl, have been demonstrated to be enriched in clinical E. faecium isolates. The ratio between isolated E. faecalis and E. faecium has decreased from 10:1 to 3:1 and the hospital adapted CC17 E. faecium genetic complex, now spread all over the world, has previously been reported to replace E. faecalis. In the present thesis we demonstrate an increased number of MDR isolates. A significant increase of esp and hyl was also detected. We also report the common occurrence of CC17 E. faecium in the Stockholm area and frequent cross-transmission of strains between patients and different hospital settings. Combined, these results demonstrate that a dominating part of clinical E. faecium isolates causing blood- stream infections in the Stockholm area are not of endogenous origin.

The major findings in this thesis are:

• Horizontal conjugation with the vanA gene cluster in vitro was frequently occurring between E. faecium isolates and isolates harbouring esp had significantly higher conjugation frequencies compared to esp-negative isolates. • Cross-transmission events with MDR E. faecium are commonly occurring between patients as well as between different hospital settings. • Antibiotic resistance to ampicillin and imipenem, as well as presence of esp was significantly more common among E. faecium isolates deriving from the tertiary hospital. • Genetic analysis revealed that esp-positive isolates were more genetically related compared to esp-negative ones. • E. faecium isolates susceptible to ampicillin and normal microflora isolates display a similar pattern of genetic diversity. • E. faecium isolates susceptible to ampicillin but resistant to imipenem, a rare resistance profile, were found. • The esp gene was the most commonly occurring virulence determinant in clinical E. faecium isolates. The presence of esp in clinical isolates significantly increased during the entire study period from 55% to 72%. The second most common putative virulence gene was hyl. The presence of hyl significantly increased from 3% in 2000 to 35% in 2007. The more rare virulence genes were only sporadically detected. • A significant correlation was found between the presence of esp and resistance to ampicillin, ciprofloxacin and imipenem. • The globally spread CC17 are present in Sweden, which has not previously been described. We demonstrated a clonal spread of CC17 E. faecium both within and outside the Stockholm area.

49 • The most common MT was MT-1, which was partly replaced in 2007 with MT-159. MT-159 harbours resistance to ampicillin, ciprofloxacin and imipenem, and some of the isolates collected in late 2007 also displayed resistance to gentamicin (HLGR) and vancomycin. All of the isolates belonging to MT-159 were esp-positive and almost all harboured hyl. • The resistance to ampicillin increased from 68% in 2000 to 86% in 2007. A significant increase in resistance to gentamicin and vancomycin was detected in 2007. The resistance to ciprofloxacin and imipenem was commonly occurring and remained stable throughout the entire study period. • No resistance to either linezolid or daptomycin was detected.

POPULÄRVETENSKAPLIG SAMMANFATTNING

Enterokocker är bakterier som de flesta människor har i sin mag-tarmkanal. Vanligen orsakar dessa bakterier inte infektioner men vissa patientgrupper, såsom äldre individer och personer med nedsatt immunförsvar, kan bli infekterade. Normalt behandlas dessa patienter med antibiotika men 1986 kom de första rapporterna om enterokocker som var motståndskraftiga (resistenta) mot antibiotikumet vankomycin. Sedan dess har vankomycinresistensen stadigt ökat, vilket är mycket bekymmersamt eftersom vankomycin många gånger är en sista utväg som behandlingsalternativ.

De två vanligaste typerna som orsakar infektioner hos människa är Enterococcus faecalis och Enterococcus faecium. Det verkar som om det är en undergrupp av dessa enterokocker som finns och sprids på våra sjukhus och orsakar infektioner. Denna typ av ”sjukhussjuka” har på senare år allt oftare noterats vara orsakad av E. faecium, vilket är oroande eftersom dessa i regel är mer motståndskraftiga mot antibiotika jämfört med E. faecalis.

Enterokocker anses normalt inte vara speciellt framgångsrika på att orsaka sjukdom hos den värd de lever i. Det finns dock vissa gener som forskare har börjat intressera sig speciellt för, som man tror kan påverka bakteriernas förmåga att orsaka infektioner. Förekomsten av en av dessa gener, esp, har påvisats vara högre hos sjukdomsorsakande enterokocker jämfört med de som hittas i den normala tarmfloran hos friska personer. Denna gen tros bland annat hjälpa bakterien att lättare vidhäfta till celler, bilda skyddande slemlager runt sig samt lättare undvika immunförsvaret.

Det är väldigt viktigt att undersöka och studera olika sjukdomsalstrande bakterier som sprids inom sjukhus. Epidemiologiska och molekylärbiologiska undersökningar är extremt värdefulla verktyg för att få fram denna kunskap. Genom att undersöka bakteriernas motståndskraft mot olika antibiotika samt leta efter olika, potentiellt viktiga gener, kan mycket information om den typ av E. faecium som orsakar infektioner samlas.

Vi har undersökt ett stort antal E. faecium-isolat samlade från patienter med infektion i blodet, så kallad blodförgiftning, under åren 2000-2007. Just dessa prover är intressanta att studera eftersom vi i Sverige ännu inte har så stora problem med spridning av motståndskraftiga enterokocker jämfört med övriga delar av världen. Våra resultat visar att antibiotikaresistensen bland dessa E. faecium-isolat har ökat sedan år 2000. Jämfört med tidigare, har fler av de studerade bakterierna även de gener som kan stärka deras förmåga att orsaka infektioner. Resultaten visar också att dessa enterokocker har god förmåga att plocka upp gener som ger antibiotikaresistens. Genetiska studier visar att de flesta E. faecium som orsakar blodinfektioner i Stockholmsområdet inte kommer från patientens egen normala mag-tarmflora utan tillhör en undergrupp av E. faecium som orsakar sjukhusrelaterade infektioner över hela världen.

51 Dessutom är det vanligt att dessa stammar sprids mellan patienter inom och mellan olika sjukhus. Genom att undersöka individuella bakterier är det möjligt att se att olika patienter har blivit infekterade av exakt samma bakterie. Denna typ av noggrann karaktärisering kan kanske i framtiden leda till att vi snabbt kan hindra utbrott på sjukhus genom att tidigt identifiera patienter som är bärare av dessa bakterier.

ACKNOWLEDGEMENTS

There are many people whom I would like express my gratitude and appreciation. I would especially like to thank:

DDS, PhD Bodil Lund, my excellent supervisor who always have time for me even when you have a million different things to do. Thank you for our great discussions regarding everything from science to dogs as well as for the guidance, help and pep talks. It’s been a pleasure getting to know you and you’ve really made my time as a PhD enjoyable. I am deeply honoured that I got the opportunity to be you PhD student!

Docent Åsa Sullivan, my co-supervisor who helped me in my day to day work with both scientific and personal advice. You are also a great travel partner!

Professor Charlotta Edlund, my co-supervisor for all your help, good advice and support.

Docent Annika Rosén, my mentor for your positive attitude and fun discussions.

I couldn’t have had more enthusiastic and supportive supervisors. You have made my time here the best!

Professor Anders Vahlne, head of the department of Clinical Microbiology for providing a good scientific atmosphere. Professor Carl-Erik Nord for all your support and help. Professor Andrej Weintraub for your help and interest in my work especially during our seminars. Professor Bengt Wretlind for constantly sharing your knowledge. I also want to thank Professor Matti Sällberg, Professor Gunnar Sandström, Professor Jan-Ingmar Flock and Professor Birgitta Evengård.

Sonja, there has been a lot of laughter and also some science… You are a great friend. Thank you for always being there when I need help, for finkaffe and nice dinners, the next one is on me!

All PhD students and Post-docs, past and present, a big thank you to all of you! Halime for our constant chatting and nice “glasstunder”, Emma for always having a smile on your face and your excellent taste in music. Antony for your constant help with everything from computer troubles to emptying PCR machines and Axana for always bringing a loud laughter. Thank you to Malin, Jessica, Babbi, Farideh, Annica, Alenka, Eva, Anna, Lars, Gustav, Tobias, Catharina, Samir, Masoud, Nogol, Selina, Sohel, Eric, Samuel, Hanna G, Anna F, Anna R, Cristina, Andreas, Tara, Benjamin, Hadi, Amir, Haihui, Christian, Sanna, Herin, Nagwa, Margareta and Trung.

53 My colleagues; Ann-Chatrin for all your help and endless knowledge, Gudrun, Eva and Kerstin B for always taking time to help me with what ever my current problem was. And of course the rest of you, Monika, Karin, Lisa, Lena E, Ingegerd, Lena L, Hong, Ann-Katrine, Kerstin and Marit for your support and making my time in the lab fun.

My friends and family, Hanna, Julle and Stina, I’ve known you for a long time and you are the best! To the rest of you supporters, thank you! Mamma Ann- Marie and pappa Jörgen, for always supporting and believing in me and for you help with my BJ. Lisa, wohoo! You are crazy and I love you for it, we have had a lot of fun! Pöss. Frida, my better half, what would life be without you?! You are always by my side looking out for me, best friend and sister in one. Hugge bugg, words are not enough… You are the best family ever and I love you.

Last but not least, my Micke. Thank you for standing by side, supporting and helping me and for being you. You are almost too good to be true. I think you will make an excellent “Doktorinna”!

A dog leaves paw prints on your heart

REFERENCES

Aligholi, M., Emaneini, M., Jabalameli, F., Shahsavan, S., Dabiri, H. and Sedaght, H. (2008). Emergence of high-level vancomycin-resistant Staphylococcus aureus in the Imam Khomeini Hospital in Tehran. Med Princ Pract 17(5): 432-434. Andrews, E. and Horder, T. (1906). A study of streptococci pathogenic for man. Lancet 2: 708-713. Arias, C.A. and Murray, B.E. (2008). Emergence and management of drug-resistant enterococcal infections. Expert Rev Anti Infect Ther 6(5): 637-655. Arthur, M., Molinas, C., Depardieu, F. and Courvalin, P. (1993). Characterization of Tn1546, a Tn3-related transposon conferring glycopeptide resistance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J Bacteriol 175(1): 117-127. Biavasco, F., Foglia, G., Paoletti, C., Zandri, G., Magi, G., Guaglianone, E., Sundsfjord, A., Pruzzo, C., Donelli, G. and Facinelli, B. (2007). VanA-type enterococci from humans, animals, and food: species distribution, population structure, Tn1546 typing and location, and virulence determinants. Appl Environ Microbiol 73(10): 3307-3319. Biedenbach, D.J., Moet, G.J. and Jones, R.N. (2004). Occurrence and antimicrobial resistance pattern comparisons among blood-stream infection isolates from the SENTRY Antimicrobial Surveillance Program (1997-2002). Diagn Microbiol Infect Dis 50(1): 59-69. Billström, H., Lund, B., Sullivan, Å. and Nord, C.E. (2008a). Virulence and antimicrobial resistance in clinical Enterococcus faecium. Int J Antimicrob Agents 32(5): 374-377. Billström, H., Sullivan, Å. and Lund, B. (2008b). Cross-transmission of clinical Enterococcus faecium in relation to esp and antibiotic resistance J Appl Microbiol. Accepted. Bland, M.J. (2000). An Introduction to Medical Statistics. Oxford Medical Publications. Blot, S. (2008). Limiting the attributable mortality of nosocomial infection and multidrug resistance in intensive care units. Clin Microbiol Infect 14(1): 5-13. Bonilla, H.F., Zervos, M.A., Lyons, M.J., Bradley, S.F., Hedderwick, S.A., Ramsey, M.A., Paul, L.K. and Kauffman, C.A. (1997). Colonization with vancomycin- resistant Enterococcus faecium: comparison of a long-term-care unit with an acute-care hospital. Infect Control Hosp Epidemiol 18(5): 333-339. Bonten, M.J., Slaughter, S., Ambergen, A.W., Hayden, M.K., van Voorhis, J., Nathan, C. and Weinstein, R.A. (1998). The role of ”colonization pressure” in the spread of vancomycin-resistant enterococci: an important infection control variable. Arch Intern Med 158(10): 1127-1132. Bonten, M.J., Willems, R. and Weinstein, R.A. (2001). Vancomycin-resistant enterococci: why are they here, and where do they come from? Lancet Infect Dis 1(5): 314-325. Bouza, E., San Juan, R., Munoz, P., Voss, A. and Kluytmans, J. (2001). A European perspective on nosocomial urinary tract infections II. Report on incidence, clinical characteristics and outcome (ESGNI-004 study). European Study Group on Nosocomial Infection. Clin Microbiol Infect 7(10): 532-542. Cetinkaya, Y., Falk, P. and Mayhall, C.G. (2000). Vancomycin-resistant enterococci. Clin Microbiol Rev 13(4): 686-707. Chow, J.W. (2000). Aminoglycoside resistance in enterococci. Clin Infect Dis 31(2): 586-589.

55 Claesson, C., Hallgren, A., Nilsson, M., Svensson, E., Hanberger, H., Nilsson, L.E. and Group, T.S. (2007). Susceptibility of staphylococci and enterococci to antimicrobial agents at different ward levels in four north European countries. Scand J Infect Dis 39(11): 1002-1012. Clinical and Laboratory Standards Institute, CLSI. (2006a). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; Approved Standard-Seventh edition. M7-A7, Wayne, PA, USA. Clinical and Laboratory Standards Institute, CLSI. (2006b). Performance Standards for Antimicrobial Susceptibility Testing; Sixteenth Informational Supplement. M100-S16. Vol. 26. No. 3, Wayne, PA, USA. Cohen, M.L. (2000). Changing patterns of infectious disease. Nature 406(6797): 762- 767. Coque, T.M., Willems, R., Canton, R., Del Campo, R. and Baquero, F. (2002). High occurrence of esp among ampicillin-resistant and vancomycin-susceptible Enterococcus faecium clones from hospitalized patients. J Antimicrob Chemother 50(6): 1035-1038. Courvalin, P. (2006). Vancomycin resistance in gram-positive cocci. Clin Infect Dis 42 Suppl 1: S25-34. Davie, J.M. and Brock, T.D. (1966). Action of streptolysin S, the group D hemolysin, and phospholipase C on whole cells and spheroplasts. J Bacteriol 91(2): 595- 600. de Lencastre, H., Brown, A.E., Chung, M., Armstrong, D. and Tomasz, A. (1999). Role of transposon Tn5482 in the epidemiology of vancomycin-resistant Enterococcus faecium in the pediatric oncology unit of a New York City Hospital. Microb Drug Resist 5(2): 113-129. de Regt, M.J., van der Wagen, L.E., Top, J., Blok, H.E., Hopmans, T.E., Dekker, A.W., Hene, R.J., Siersema, P.D., Willems, R.J. and Bonten, M.J. (2008). High acquisition and environmental contamination rates of CC17 ampicillin-resistant Enterococcus faecium in a Dutch hospital. J Antimicrob Chemother. E- published. Donskey, C.J. (2004). The role of the intestinal tract as a reservoir and source for transmission of nosocomial pathogens. Clin Infect Dis 39(2): 219-226. Dutka-Malen, S., Evers, S. and Courvalin, P. (1995). Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol 33(1): 24-27. Eaton, T.J. and Gasson, M.J. (2001). Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol 67(4): 1628-1635. El Amin, N., Lund, B., Tjernlund, A., Lundberg, C., Jalakas, K. and Wretlind, B. (2001). Mechanisms of resistance to imipenem in imipenem-resistant, ampicillin-sensitive Enterococcus faecium. Apmis 109(11): 791-796. Eliopoulos, G.M. (2003). Quinupristin-dalfopristin and linezolid: evidence and opinion. Clin Infect Dis 36(4): 473-481. Elsner, H.A., Sobottka, I., Mack, D., Claussen, M., Laufs, R. and Wirth, R. (2000). Virulence factors of Enterococcus faecalis and Enterococcus faecium blood culture isolates. Eur J Clin Microbiol Infect Dis 19(1): 39-42. Facklam, R.R. and Collins, M.D. (1989). Identification of Enterococcus species isolated from human infections by a conventional test scheme. J Clin Microbiol 27(4): 731-734. Gholizadeh, Y. and Courvalin, P. (2000). Acquired and intrinsic glycopeptide resistance in enterococci. Int J Antimicrob Agents 16 Suppl 1: S11-17. Grabsch, E.A., Chua, K., Xie, S., Byrne, J., Ballard, S.A., Ward, P.B. and Grayson, M.L. (2008). Improved detection of vanB2-containing Enterococcus faecium with vancomycin susceptibility by Etest using oxgall supplementation. J Clin Microbiol 46(6): 1961-1964.

Grayson, M.L. and Eliopoulos, G.M. (1990). Antimicrobial resistance in the intensive care unit. Semin Respir Infect 5(3): 204-214. Grayson, M.L., Eliopoulos, G.M., Wennersten, C.B., Ruoff, K.L., De Girolami, P.C., Ferraro, M.J. and Moellering, R.C., Jr. (1991). Increasing resistance to beta- lactam antibiotics among clinical isolates of Enterococcus faecium: a 22-year review at one institution. Antimicrob Agents Chemother 35(11): 2180-2184. Haas, W., Shepard, B.D. and Gilmore, M.S. (2002). Two-component regulator of Enterococcus faecalis cytolysin responds to quorum-sensing autoinduction. Nature 415(6867): 84-87. Heikens, E., van Schaik, W., Leavis, H.L., Bonten, M.J. and Willems, R.J. (2008). Identification of a novel genomic island specific for hospital-acquired CC17 Enterococcus faecium. Appl Environ Microbiol. E-published. Hirt, H., Schlievert, P.M. and Dunny, G.M. (2002). In vivo induction of virulence and antibiotic resistance transfer in Enterococcus faecalis mediated by the sex pheromone-sensing system of pCF10. Infect Immun 70(2): 716-723. Homan, W.L., Tribe, D., Poznanski, S., Li, M., Hogg, G., Spalburg, E., Van Embden, J.D. and Willems, R.J. (2002). Multilocus sequence typing scheme for Enterococcus faecium. J Clin Microbiol 40(6): 1963-1971. Hynes, W.L. and Walton, S.L. (2000). Hyaluronidases of Gram-positive bacteria. FEMS Microbiol Lett 183(2): 201-207. Ike, Y., Tanimoto, K., Tomita, H., Takeuchi, K. and Fujimoto, S. (1998). Efficient transfer of the pheromone-independent Enterococcus faecium plasmid pMG1 (Gmr) (65.1 kilobases) to Enterococcus strains during broth mating. J Bacteriol 180(18): 4886-4892. Jones, R.N., Sader, H.S., Erwin, M.E. and Anderson, S.C. (1995). Emerging multiply resistant enterococci among clinical isolates. I. Prevalence data from 97 medical center surveillance study in the United States. Enterococcus Study Group. Diagn Microbiol Infect Dis 21(2): 85-93. Kalina, A.P. (1970). The taxonomy and nomenclature of enterococci. Int J Syst Bacteriol 20: 193-199. Kearns, A.M., Freeman, R. and Lightfoot, N.F. (1995). Nosocomial enterococci: resistance to heat and sodium hypochlorite. J Hosp Infect 30(3): 193-199. Klare, I., Konstabel, C., Mueller-Bertling, S., Werner, G., Strommenger, B., Kettlitz, C., Borgmann, S., Schulte, B., Jonas, D., Serr, A., Fahr, A.M., Eigner, U. and Witte, W. (2005). Spread of ampicillin/vancomycin-resistant Enterococcus faecium of the epidemic-virulent clonal complex-17 carrying the genes esp and hyl in German hospitals. Eur J Clin Microbiol Infect Dis 24(12): 815-825. Köhler, W. (2007). The present state of species within the genera Streptococcus and Enterococcus. Int J Med Microbiol 297(3): 133-150. Kreft, B., Marre, R., Schramm, U. and Wirth, R. (1992). Aggregation substance of Enterococcus faecalis mediates adhesion to cultured renal tubular cells. Infect Immun 60(1): 25-30. Kühn, I., Burman, L.G., Haeggman, S., Tullus, K. and Murray, B.E. (1995). Biochemical fingerprinting compared with ribotyping and pulsed-field gel electrophoresis of DNA for epidemiological typing of enterococci. J Clin Microbiol 33(11): 2812-2817. Launay, A., Ballard, S.A., Johnson, P.D., Grayson, M.L. and Lambert, T. (2006). Transfer of vancomycin resistance transposon Tn1549 from Clostridium symbiosum to Enterococcus spp. in the gut of gnotobiotic mice. Antimicrob Agents Chemother 50(3): 1054-1062. Leavis, H., Top, J., Shankar, N., Borgen, K., Bonten, M., van Embden, J. and Willems, R.J. (2004). A novel putative enterococcal pathogenicity island linked to the esp virulence gene of Enterococcus faecium and associated with epidemicity. J Bacteriol 186(3): 672-682.

57 Leavis, H.L., Willems, R.J., Top, J. and Bonten, M.J. (2006). High-level ciprofloxacin resistance from point mutations in gyrA and parC confined to global hospital- adapted clonal lineage CC17 of Enterococcus faecium. J Clin Microbiol 44(3): 1059-1064. Leclercq, R., Derlot, E., Duval, J. and Courvalin, P. (1988). Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med 319(3): 157-161. Lentino, J.R., Narita, M. and Yu, V.L. (2008). New antimicrobial agents as therapy for resistant gram-positive cocci. Eur J Clin Microbiol Infect Dis 27(1): 3-15. Lester, C.H., Sandvang, D., Olsen, S.S., Schonheyder, H.C., Jarlov, J.O., Bangsborg, J., Hansen, D.S., Jensen, T.G., Frimodt-Moller, N. and Hammerum, A.M. (2008). Emergence of ampicillin-resistant Enterococcus faecium in Danish hospitals. J Antimicrob Chemother. E-published. Lopes, M.F., Simoes, A.P., Tenreiro, R., Marques, J.J. and Crespo, M.T. (2006). Activity and expression of a virulence factor, gelatinase, in dairy enterococci. Int J Food Microbiol 112(3): 208-214. Lowe, A.M., Lambert, P.A. and Smith, A.W. (1995). Cloning of an Enterococcus faecalis endocarditis antigen: homology with adhesins from some oral streptococci. Infect Immun 63(2): 703-706. Lund, B., Adamsson, I. and Edlund, C. (2002a). Gastrointestinal transit survival of an Enterococcus faecium probiotic strain administered with or without vancomycin. Int J Food Microbiol 77(1-2): 109-115. Lund, B., Agvald-Ohman, C., Hultberg, A. and Edlund, C. (2002b). Frequent transmission of enterococcal strains between mechanically ventilated patients treated at an intensive care unit. J Clin Microbiol 40(6): 2084-2088. Lund, B. and Edlund, C. (2003). Blood-stream isolates of Enterococcus faecium enriched with the enterococcal surface protein gene, esp, show increased adhesion to eukaryotic cells. J Clin Microbiol 41(11): 5183-5185. Lund, B., Edlund, C., Barkholt, L., Nord, C.E., Tvede, M. and Poulsen, R.L. (2000). Impact on human intestinal microflora of an Enterococcus faecium probiotic and vancomycin. Scand J Infect Dis 32(6): 627-632. Lynch, C., Courvalin, P. and Nikaido, H. (1997). Active efflux of antimicrobial agents in wild-type strains of enterococci. Antimicrob Agents Chemother 41(4): 869- 871. MacCallum, W.G. and Hastings, T.W. (1899). A case of acute endocarditis caused by Micrococcus zymogenes (nov. spec.), with a description of the microorganism. Journal of Experimental Medicine 4(5-6): 521-534. Magi, G., Capretti, R., Paoletti, C., Pietrella, M., Ferrante, L., Biavasco, F., Varaldo, P.E. and Facinelli, B. (2003). Presence of a vanA-carrying pheromone response plasmid (pBRG1) in a clinical isolate of Enterococcus faecium. Antimicrob Agents Chemother 47(5): 1571-1576. Mohamed, J.A. and Huang, D.B. (2007). Biofilm formation by enterococci. J Med Microbiol 56(Pt 12): 1581-1588. Mundy, L.M., Sahm, D.F. and Gilmore, M. (2000). Relationships between enterococcal virulence and antimicrobial resistance. Clin Microbiol Rev 13(4): 513-522. Murdoch, D.R., Mirrett, S., Harrell, L.J., Monahan, J.S. and Reller, L.B. (2002). Sequential emergence of antibiotic resistance in enterococcal blood-stream isolates over 25 years. Antimicrob Agents Chemother 46(11): 3676-3678. Murray, B. and Hodel-Christian, S. (1991). Bacterial resistance: theoretical and practical consoderations, mutations to antibiotic resitstance, characterization of R plasmids, and detection of plasmmid-specified genes. Antibiotics in laboratory medicine, 3rd ed. Baltimore, Williams and Wilkins.: 556-598. Murray, B.E. (1990). The life and times of the Enterococcus. Clin Microbiol Rev 3(1): 46-65.

Mäkinen, P.L., Clewell, D.B., An, F. and Mäkinen, K.K. (1989). Purification and substrate specificity of a strongly hydrophobic extracellular metalloendo- peptidase (”gelatinase”) from Streptococcus faecalis (strain 0G1-10). J Biol Chem 264(6): 3325-3334. Nallapareddy, S.R., Singh, K.V., Okhuysen, P.C. and Murray, B.E. (2008). A functional collagen adhesin gene, acm, in clinical isolates of Enterococcus faecium correlates with the recent success of this emerging nosocomial pathogen. Infect Immun 76(9): 4110-4119. Nallapareddy, S.R., Weinstock, G.M. and Murray, B.E. (2003). Clinical isolates of Enterococcus faecium exhibit strain-specific collagen binding mediated by Acm, a new member of the MSCRAMM family. Mol Microbiol 47(6): 1733- 1747. Neely, A.N. and Maley, M.P. (2000). Survival of enterococci and staphylococci on hospital fabrics and plastic. J Clin Microbiol 38(2): 724-726. Oh, H., Nord, C.E., Barkholt, L., Hedberg, M. and Edlund, C. (2000). Ecological disturbances in intestinal microflora caused by clinafloxacin, an extended- spectrum quinolone. Infection 28(5): 272-277. Orla-Jensen, S. (1919). The lactic acid bacteria. Mem Acad Roy Sci Danemark. Sect Sci Ser 2(5): 81-197. Pittet, D., Hugonnet, S., Harbarth, S., Mourouga, P., Sauvan, V., Touveneau, S. and Perneger, T.V. (2000). Effectiveness of a hospital-wide programme to improve compliance with hand hygiene. Infection Control Programme. Lancet 356(9238): 1307-1312. Rice, L.B. (1998). Tn916 family conjugative transposons and dissemination of antimicrobial resistance determinants. Antimicrob Agents Chemother 42(8): 1871-1877. Rice, L.B., Carias, L., Rudin, S., Vael, C., Goossens, H., Konstabel, C., Klare, I., Nallapareddy, S.R., Huang, W. and Murray, B.E. (2003). A potential virulence gene, hylEfm, predominates in Enterococcus faecium of clinical origin. J Infect Dis 187(3): 508-512. Rich, R.L., Kreikemeyer, B., Owens, R.T., LaBrenz, S., Narayana, S.V., Weinstock, G.M., Murray, B.E. and Hook, M. (1999). Ace is a collagen-binding MSCRAMM from Enterococcus faecalis. J Biol Chem 274(38): 26939-26945. Sabia, C., de Niederhausern, S., Guerrieri, E., Messi, P., Anacarso, I., Manicardi, G. and Bondi, M. (2008). Detection of bacteriocin production and virulence traits in vancomycin-resistant enterococci of different sources. J Appl Microbiol 104(4): 970-979. Saeedi, B., Hallgren, A., Isaksson, B., Jonasson, J., Nilsson, L.E. and Hanberger, H. (2004). Genetic relatedness of Enterococcus faecalis isolates with high-level gentamicin resistance from patients with bacteraemia in the south east of Sweden 1994-2001. Scand J Infect Dis 36(6-7): 405-409. Safdar, N. and Maki, D.G. (2002). The commonality of risk factors for nosocomial colonization and infection with antimicrobial-resistant Staphylococcus aureus, enterococcus, gram-negative bacilli, Clostridium difficile, and Candida. Ann Intern Med 136(11): 834-844. Saha, B., Singh, A.K., Ghosh, A. and Bal, M. (2008). Identification and characterization of a vancomycin-resistant Staphylococcus aureus isolated from Kolkata (South Asia). J Med Microbiol 57(Pt 1): 72-79. Salyers, A.A. and Amabile-Cuevas, C.F. (1997). Why are antibiotic resistance genes so resistant to elimination? Antimicrob Agents Chemother 41(11): 2321-2325. Sartingen, S., Rozdzinski, E., Muscholl-Silberhorn, A. and Marre, R. (2000). Aggregation substance increases adherence and internalization, but not translocation, of Enterococcus faecalis through different intestinal epithelial cells in vitro. Infect Immun 68(10): 6044-6047.

59 Schleifer, K.H. and Kilpper-Balz, R. (1984). Transfer of Streptococcus faecalis and Streptococcus faecium to the genus Enterococcus norn. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. Int J Syst Bacteriol 34(1): 31-34. Schouls, L.M., van der Heide, H.G., Vauterin, L., Vauterin, P. and Mooi, F.R. (2004). Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J Bacteriol 186(16): 5496-5505. Serio, A., Paparella, A., Chaves-Lopez, C., Corsetti, A. and Suzzi, G. (2007). Enterococcus populations in Pecorino Abruzzese cheese: biodiversity and safety aspects. J Food Prot 70(7): 1561-1568. Sghir, A., Gramet, G., Suau, A., Rochet, V., Pochart, P. and Dore, J. (2000). Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol 66(5): 2263-2266. Shankar, N., Baghdayan, A.S. and Gilmore, M.S. (2002). Modulation of virulence within a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature 417(6890): 746-750. Shankar, V., Baghdayan, A.S., Huycke, M.M., Lindahl, G. and Gilmore, M.S. (1999). Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun 67(1): 193-200. Sievert, D.M., Rudrik, J.T., Patel, J.B., McDonald, L.C., Wilkins, M.J. and Hageman, J.C. (2008). Vancomycin-resistant Staphylococcus aureus in the United States, 2002-2006. Clin Infect Dis 46(5): 668-674. Sillanpää, J., Nallapareddy, S.R., Prakash, V.P., Qin, X., Hook, M., Weinstock, G.M. and Murray, B.E. (2008). Identification and phenotypic characterization of a second collagen adhesin, Scm, and genome-based identification and analysis of 13 other predicted MSCRAMMs, including four distinct pilus loci, in Enterococcus faecium. Microbiology 154(Pt 10): 3199-3211. Simonsen, G.S., Smabrekke, L., Monnet, D.L., Sorensen, T.L., Moller, J.K., Kristinsson, K.G., Lagerqvist-Widh, A., Torell, E., Digranes, A., Harthug, S. and Sundsfjord, A. (2003). Prevalence of resistance to ampicillin, gentamicin and vancomycin in Enterococcus faecalis and Enterococcus faecium isolates from clinical specimens and use of antimicrobials in five Nordic hospitals. J Antimicrob Chemother 51(2): 323-331. Singh, K.V., Coque, T.M., Weinstock, G.M. and Murray, B.E. (1998a). In vivo testing of an Enterococcus faecalis efaA mutant and use of efaA homologs for species identification. FEMS Immunol Med Microbiol 21(4): 323-331. Singh, K.V., Qin, X., Weinstock, G.M. and Murray, B.E. (1998b). Generation and testing of mutants of Enterococcus faecalis in a mouse peritonitis model. J Infect Dis 178(5): 1416-1420. Summers, A.O. (2006). Genetic linkage and horizontal gene transfer, the roots of the antibiotic multi-resistance problem. Anim Biotechnol 17(2): 125-135. Tanasupawat, S., Sukontasing, S. and Lee, J.S. (2008). Enterococcus thailandicus sp. nov., isolated from fermented sausage ('mum') in Thailand. Int J Syst Evol Microbiol 58(Pt 7): 1630-1634. Tendolkar, P.M., Baghdayan, A.S. and Shankar, N. (2003). Pathogenic enterococci: new developments in the 21st century. Cell Mol Life Sci 60(12): 2622-2636. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H. and Swaminathan, B. (1995). Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33(9): 2233-2239. Thiercelin, E. (1899). Sur un diplocoque saprophyte de l'intestin susceptible dedevenir pathogene. C. R. Soc. biol. 5: 269-271.

Top, J., Banga, N.M., Hayes, R., Willems, R.J., Bonten, M.J. and Hayden, M.K. (2008a). Comparison of multiple-locus variable-number tandem repeat analysis and pulsed-field gel electrophoresis in a setting of polyclonal endemicity of vancomycin-resistant Enterococcus faecium. Clin Microbiol Infect 14(4): 363- 369. Top, J., Schouls, L.M., Bonten, M.J. and Willems, R.J. (2004). Multiple-locus variable- number tandem repeat analysis, a novel typing scheme to study the genetic relatedness and epidemiology of Enterococcus faecium isolates. J Clin Microbiol 42(10): 4503-4511. Top, J., Willems, R., Blok, H., de Regt, M., Jalink, K., Troelstra, A., Goorhuis, B. and Bonten, M. (2007). Ecological replacement of Enterococcus faecalis by multiresistant clonal complex 17 Enterococcus faecium. Clin Microbiol Infect 13(3): 316-319. Top, J., Willems, R. and Bonten, M. (2008b). Emergence of CC17 Enterococcus faecium: from commensal to hospital-adapted pathogen. FEMS Immunol Med Microbiol 52(3): 297-308. Torell, E., Cars, O. and Hambraeus, A. (2001). Ampicillin-resistant enterococci in a Swedish university hospital: nosocomial spread and risk factors for infection. Scand J Infect Dis 33(3): 182-187. Torell, E., Cars, O., Olsson-Liljequist, B., Hoffman, B.M., Lindback, J. and Burman, L.G. (1999). Near absence of vancomycin-resistant enterococci but high carriage rates of quinolone-resistant ampicillin-resistant enterococci among hospitalized patients and nonhospitalized individuals in Sweden. J Clin Microbiol 37(11): 3509-3513. Uttley, A.H., Collins, C.H., Naidoo, J. and George, R.C. (1988). Vancomycin-resistant enterococci. Lancet 1(8575-6): 57-58. Van Wamel, W.J., Hendrickx, A.P., Bonten, M.J., Top, J., Posthuma, G. and Willems, R.J. (2007). Growth condition-dependent Esp expression by Enterococcus faecium affects initial adherence and biofilm formation. Infect Immun 75(2): 924-931. Vancanneyt, M., Lombardi, A., Andrighetto, C., Knijff, E., Torriani, S., Bjorkroth, K.J., Franz, C.M., Foulquie Moreno, M.R., Revets, H., De Vuyst, L., Swings, J., Kersters, K., Dellaglio, F. and Holzapfel, W.H. (2002). Intraspecies genomic groups in Enterococcus faecium and their correlation with origin and pathogenicity. Appl Environ Microbiol 68(3): 1381-1391. Wendt, C., Wiesenthal, B., Dietz, E. and Ruden, H. (1998). Survival of vancomycin- resistant and vancomycin-susceptible enterococci on dry surfaces. J Clin Microbiol 36(12): 3734-3736. Werner, G., Klare, I. and Witte, W. (2007). The current MLVA typing scheme for Enterococcus faecium is less discriminatory than MLST and PFGE for epidemic-virulent, hospital-adapted clonal types. BMC Microbiol 7: 28. Willems, R.J., Homan, W., Top, J., van Santen-Verheuvel, M., Tribe, D., Manzioros, X., Gaillard, C., Vandenbroucke-Grauls, C.M., Mascini, E.M., van Kregten, E., van Embden, J.D. and Bonten, M.J. (2001). Variant esp gene as a marker of a distinct genetic lineage of vancomycin-resistant Enterococcus faecium spreading in hospitals. Lancet 357(9259): 853-855. Willems, R.J., Top, J., van Santen, M., Robinson, D.A., Coque, T.M., Baquero, F., Grundmann, H. and Bonten, M.J. (2005). Global spread of vancomycin- resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg Infect Dis 11(6): 821-828. Wisplinghoff, H., Bischoff, T., Tallent, S.M., Seifert, H., Wenzel, R.P. and Edmond, M.B. (2004). Nosocomial blood-stream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis 39(3): 309-317. Woodford, N., Soltani, M., K. and Hardy, J. (2001). Frequency of esp in Enterocoocus faecium Isolates. The Lancet Vol 358: 584.