Detection and Characterization of Betaretroviral Sequences, Related to Sheep Jaagsiekte Virus, in Africans from Nigeria and Cameroon

CORE Metadata, citation and similar papers at core.ac.uk

Provided by Elsevier - Publisher Connector

Virology 327 (2004) 162–168 www.elsevier.com/locate/yviro Rapid Communication Detection and characterization of betaretroviral sequences, related to sheep Jaagsiekte virus, in Africans from Nigeria and Cameroon

V.A. Morozova,1, S. Lagayeb,J.Lfwera,*,R.Lfwera

aPaul-Ehrlich-Institut, 63225 Langen, Germany bINSERM Unite´ 561 Immunologie, Hoˆpital Saint Vincent-de-Paul, 75014 Paris, France

Received 11 April 2004; accepted 28 May 2004 Available online 4 August 2004

Abstract

Jaagsiekte retrovirus (JSRV) causes ovine pulmonary adenomatosis (OPA) that resembles bronchioloalveolar carcinoma (BAC) in humans. To test the possible role of JSRV in human diseases, DNA specimens from 103 individuals either healthy or suffering from lung carcinomas were analyzed for JSRV sequences. orf-x sequences were detected in 19 of 64 samples and gag-prt sequences in 4 of 38 samples, predominantly in individuals from Africa. Sequences obtained from orf-x amplimers varied in-between each other and differed from control endogenous ovine JSRV sequence. No association with lung cancer was found. This is the first report of JSRV-like sequences detected in humans. D 2004 Elsevier Inc. All rights reserved.

Keywords: Betaretrovirus; JAAGSIEKTE retrovirus; Human blood; Africans; Nucleotide sequence; Alignment

Introduction 1996). Less copies of enJSRV-like proviruses were revealed in other species of the Bovidae family (Hecht Exogenous Jaagsiekte sheep retrovirus (JSRV) and et al., 1996). Two regions of the viral genome were ovine and caprine enzootic nasal tumor virus (ONAV shown to be different between JSRV and enJSRV: one in and CNAV, both also designated ENTV) are betaretrovi- the U3 region of the LTR, another in the env gene (Bai et ruses that were isolated from contagious tumors of al., 1996). enJSRV expression observed in the ovine secretory epithelial cells of sheep and goats: JSRV from uterus is very likely progesterone dependent (Palmarini et ovine pulmonary adenocarcinoma (OPA, reviewed by Fan al., 2001). The fact that JSRV-induced OPAs resemble et al., 2003) and ENTV from intranasal tumors (reviewed bronchioloalveolar carcinomas (BAC) in other mammals by De las Heras et al., 2003). JSRV and ENTV are 88.8% and man (DeMartini and York, 1997; Palmarini and Fan, identical at the nucleotide level. Both viruses contain an 2001) has initiated attempts to detect JSRV-like viruses in additional gene, designated orf-x, of unknown function humans with BAC and related malignancies. However, (York et al., 1992). Fifteen to twenty copies of conflicting data were obtained (De las Heras et al., 2000; endogenous counterparts of JSRV (enJSRV) are present Hiatt and Highsmith, 2002; Yousem et al., 2001). To in the genomes of sheep and goats (Palmarini et al., analyze possible JSRV circulation in humans, we examined DNA specimens from a group of Africans (Came- * Corresponding author. Paul-Ehrlich-Institut, Paul-Ehrlich-Str. 51–59, roon and Nigeria) and Europeans with hemophilia 63225 Langen, Germany. Fax: +496103771240. E-mail address: [email protected] (J. Lfwer). (Germany), healthy blood donors (France), and patients 1 Present address: Robert Koch-Institut, Nordufer 20, 13353 Berlin, with BAC and small cell lung carcinoma (SCLC; Russia Germany. and Germany).

Results donors from France was PCR-positive, however his history is unknown. The amount of JSRV orf-x sequences was very In our screening for JSRV genomes in humans, we low in some samples and could be detected only after examined DNA specimens isolated from whole blood Southern hybridization. Characteristic results obtained with collected in Africa and Europe. The study composed DNA the nested PCR or Southern hybridization approach are from 20 Nigerian AIDS patients and 44 blood donors from depicted in Fig. 1. DNA samples from Cameroonian blood Cameroon as well as DNA from a European cohort donors were found to be JSRV orf-x positive by nested PCR consisting of 20 hemophiliacs, 15 blood donors, and 4 or Southern hybridization independently in two laboratories patients with BAC or SCLC. A group of 14 nonhuman Old (Germany, France). To further strengthen our finding, we World primates (five species) was included as well. As aimed to amplify further parts of JSRV in positive samples. enJSRV is closely related to the exogenous JSRV forms, we Another relatively conserved region of JSRV genomes is the used DNA isolated from the bone marrow of a sheep as 3Vpart of the gag gene and the 5Vpart of the protease (prt) positive control. The PCR screening for JSRV genomes gene. Using the same nested PCR or Southern hybridization focused on three regions of the viral genome: orf-x, gag- approach with primers gag1579f, prt1921f and prt2257r, protease (gag-prt), and 5VLTR-gag. and prt2300r, and a probe specific for this region, we are able to demonstrate the presence of JSRV gag-prt sequences Detection of JSRV sequences in Africans in one sample from Cameroon and in three samples from Nigeria. We also used primers to amplify the region between Orf-x is the most conserved gene of all known LTR and gag (LTR1f and LTR167f as forward and gag575r endogenous and exogenous JSRV (Rosati et al., 2000). It and gag607r as reverse primers), but were unable to detect is a gene unique for JRSV/ENTV and thus a prime candidate any amplimer with the nested PCR or Southern hybrid- to look for JSRV-like sequences in human. All DNA ization approach. Likewise, the attempt failed to amplify the specimens were initially tested by nested PCR with orf-x- entire region between gag and orf-x with primers prt1921f specific primers followed by Southern hybridization. 353 bp and orfxr as well as gag1579f and orfx2r using DNA from of the roughly 500 bp comprising the JSRV orf-x gene was samples that had been tested positive for gag-prt and orf-x. first amplified with primers orfxf and orfxr (Table 1) followed by a second round of amplification with primers Analysis of JSRV sequences obtained from samples orfx2f and orfx2r to generate a 248-bp-long fragment. The identity of this amplimer was confirmed with an orf-x- The seven orf-x amplimers that were visible in agarose specific probe. Concomitantly, this approach further gel electrophoresis were further characterized by two enhanced the sensitivity of our screening test. direction sequencing and compared to published JSRV JSRV orf-x sequences were detected in samples from sequences. Sequence alignments are shown on Fig. 2A. The Africa. Ten of the 44 blood donors from Cameroon (C) and JSRV orf-x sequences obtained from two samples from 8 of the 20 HIV-1-infected individuals from Nigeria (N) Nigeria (N) and five samples from Cameroon (C) differed were tested positive. Only one out of 15 healthy blood by one to four single nucleotides in-between each other and from an enJSRV positive control sequence (GenBank accession no. Y18307). The sequence of one sample, Table 1 191N, turned out to be identical to the orf-x sequence of Primers used for PCR and nested PCR (JSRV GenBank accession no. NC001494, mt DNA GenBank accession no. AF010406) an exogenous JSRV (GenBank accession no. AF128926). Primer Sequence nt position in Transition of C to T (alignment position 81) was observed in JSRV or mt DNA three out of seven amplimers. This substitution was LTR1f gcaaggtatcagccgttctgg 1–21 described in both enJSRV (GenBank accession nos. LTR167f gccactactctcattaa 167–184 AF129877 and AF129876) and exogenous JSRV (GenBank gag258f taaatatgggacacacgcatag 258–279 accession nos. AF136851 and AF128926). Amplimers gag575r atggagaggatcttcttcctg 579–595 193N and 1C look similar with two identical substitutions. gag607r ggaggaggatcataactaggtacc 607–630 None of the nucleotide differences created a stop codon in gag1579f cgctaactctgcttgtcaagct 1579–1600 prt1921f agatgttcaaggcaatcctt 1921–1940 the open reading frame. Accuracy of PCR and sequencing prt2257r ttaggagcggaggctaatat 2257–2276 was confirmed by repeated PCR amplification and sequenc- prt2300r gaagttgagctattcgctgtc 2300–2320 ing of the positive control (sheep DNA) that clearly revealed orfxf atcttgctctacttgtcc 4703–4720 a single sequence identical to enJSRV (GenBank accession orfxr ccctgtggattataagga 5056–5030 no. Y18307). orfx2f aatatggtgtcaaccctcgaggttta 4741–4766 orfx2r aacggctagtataaccaggtc 4969–4989 The 200-bp-long orf-x sequences, determined in this mt1f tatagtaggaaccgccttaagcctac 5412–5437 study, were aligned using the MegAlign program (Laser mt2f tactcggagatgaccaaatctacaacg 5471–5497 Gene, DNASTAR, Inc., USA) and analyzed in rooted mt3r tattcaggtttcggtccgttagtagtattg 5951–5980 phylogenetic tree (Clustal W). The tree analysis shows that mt4r tacttcagggtgcccaaagaatcagaatag 6041–6070 not a single sequence was identical to a known enJSRV, but 164 V.A. Morozov et al. / Virology 327 (2004) 162–168

Fig. 1. JSRV-like orf-x (A and B) and gag-prt (C and D) sequences detected by nested PCR or Southern hybridization in healthy blood donors from Cameroon and in AIDS patients from Nigeria. PC: positive control (sheep DNA), NC: negative control (H2O), M: Marker. (A) JSRV orf-x sequence in 1/9 Nigerian AIDS patients. 1–9: DNA from Nigerian AIDS patients. (B) JSRV orf-x sequences in 3/5 blood donors from Cameroon. 10–30: DNA samples from Cameroonian donors 1–3 (first round PCR); PC0: positive control (first round PCR); 1–5: DNA samples from Cameroonian donors 1–5 (second round PCR); arrowheads: position of the amplimers (first and second round). (C) JSRV gag-prt sequence in 1/7 blood donors from Cameroon. 1–7: DNA specimens from Cameroonian donors. (D) JSRV gag-prt sequence in 1/5 Nigerian AIDS patients. 1–5: DNA specimens from Nigerian AIDS patients. that the 191N amplimer was indistinguishable from an Sheep mitochondria markers were not detected in human exogenous JSRV sequence (GenBank accession no. DNA samples AF128926). Other sequences cluster with at least two groups of known enJSRV. It should be noted that exogenous Foreign DNA taken up by food might not be completely strains of South African JSRV are very closely related to degraded in the gastrointestinal tract of mammals. Frag- enJSRV (Rosati et al., 2000). ments of foreign DNA have been detected in spleen and Further, we partially sequenced two gag-prt amplimers: liver of mice up to 24 h after feeding (Schubbert et al., one from a sample from Nigeria and one from a sample 1997). Sheep and goat meat, milk, and cheese made from from Cameroon. An enJSRV sequence amplified from fresh milk are common dishes in Africa. As we could isolate genomic sheep DNA was used for comparison. This genomic DNA and amplify enJSRV sequences from goat’s sequence was identical to enJSRV (GenBank accession (GenBank accession no. AY340643) and sheep’s cream no. AF136224). Again the human sequences displayed cheeses, as well as from goat milk, one could argue that some single nucleotide polymorphisms (Fig. 2B). The 211- fragments of sheep and goat DNA containing enJSRV bp-long 193N sequence differed by four nucleotides from sequences might have reached the blood stream after a meal. the sheep enJSRV control sequence. The 4C sequence Such a phenomenon, however, would not be restricted to differed by two nucleotides (as detected by unidirectional JSRV sequences only. To test if other fragments of sheep sequencing). Fig. 2B displays an 80-bp-long section of 4C DNA were present in the tested samples, we focussed on that has been sequenced in both directions. The described sheep mitochondrial (mt) DNA because the amount of mt human amplimers are most homologous to enJSRV. DNA per cell is most probably not less, but much higher Interestingly, the prt-like sequence and the orf-x sequence (depending on cells), than reported amounts of enJSRV. In detected in the same individual likely cluster with two addition, circular mt DNA is likely to be more stable than different JSRV variants. During screening tests in the fragments of linear genomic DNA. Specific primers were laboratory, we avoided any cloning procedures to prevent used to amplify 409 bp of the sheep mt cytochrome-c- cross-contamination. Several amplimers were cloned when oxidase subunit 1 in a nested PCR or Southern hybridization the initial screening tests were completed. Alignments of approach. The primers were designed to discriminate two cloned sequences derived from the DNA of a Nigerian between human and sheep or goat sequences. Although AIDS patient are shown in Fig. 2B (p193N cl.1 and p193N mt sequences were detected already after the first round of cl.2, respectively). Comparison of the directly sequenced prt PCR in 100 ng of sheep and goat genomic DNA or DNA amplimer and cloned sequences revealed slight differences isolated from sheep and goat cheese, we were unable to indicating that within the bulk of the amplimer sequences detect any traces of mt sequences in human DNA tested minor variants might be hidden. positive for the JSRV orf-x gene. V.A. Morozov et al. / Virology 327 (2004) 162–168 165

No antibodies to SRV-3 p27 (CA) detected in Africans from against JSRV protein cannot be expected. Nevertheless, we Cameroon analyzed sera from five bPCR orf-x-positiveQ donors from Cameroon by ECL Western blot. Sucrose gradient purified The absence of LTR-gag sequences in borf-x-positiveQ Simian retrovirus SRV-3 was used as an antigen because individuals will theoretically abolish any possibility of anti-CA JSRV cross reacts with SRV-3 CA (De las Heras JSRV transcription and, therefore, an immune response et al., 1991). We did not observe any definite signal with

Fig. 2. Analysis of JSRV-like sequences detected in Africans from Cameroon (C) and Nigeria (N). (A) Alignment of 200 bp long JSRV orf-x-like sequences with enJSRV (GenBank accession no. Y18307, starting with nucleotide 214). (B) Alignment of JSRV prt-like amplimers and cloned (cl.1 and cl.2) fragments with enJSRV (GenBank accession no. AF136224, starting with nucleotide 2300). 166 V.A. Morozov et al. / Virology 327 (2004) 162–168

Fig. 2 (continued). p27 (CA). Sera from bPCR-positiveQ Nigerian patients proteins. Secondly, the suppression of an anti-viral immune were not available. response observed in infected animals (Summers et al., 2002) and the extremely low provirus copy number in PBMC prevented the development of a fast and cheap Discussion diagnostic test. However, the clear etiological role of JSRV in OPA, a disease similar to BAC in cattle, dogs, and humans, Investigation of JSRV and ENTV molecular biology and makes the search for circulating JSRV (ENTV) in man pathogenesis is hampered by several problems. Firstly, the intriguing especially because the cell-surface receptor for the lack of an appropriate replication system makes it difficult to JSRV (HYAL2) was detected on human cells (Rai et al., analyze important steps in JSRV infections like morpho- 2001). genesis, virus activation and suppression by cellular factors, Immunohistochemical staining using anti-CA (JSRV) of and the exact mechanisms of cell transformation by viral a panel of human lung tumors resulted in a positive reaction V.A. Morozov et al. / Virology 327 (2004) 162–168 167 predominantly in BAC tissues (De las Heras et al., 2000). of orf-x sequences in Africans might result from the fact that However, these data were not confirmed by molecular– this gene is the most conserved one among JSRVs. Our biological methods on the same samples. Using PCR and attempt to detect longer segments of the JSRV genome in RT-PCR approaches, two research groups failed to detect bPCR-positiveQ (gag-prt and orf-x) individuals has failed so JSRV gag sequences in humans with BAC (Hiatt and far. The reason for this failure might be the extremely low Highsmith, 2002; Yousem et al., 2001), indicating that amount of viral DNA that could prevent successful long JSRV might not be linked to BAC. However, it could also range PCR. be true that the amount of virus was below the detection Sequence analysis confirmed that the amplimers were limit of the methods used. closely related to JSRV. However, a clear difference was We have used the most sensitive combination of detected between the sequence of the individual amplimers methods—nested PCR followed by Southern hybridiza- and the sequence amplified from endogenous JSRV. The tion—that allows to detect down to one provirus copy in absence of sheep- or goat-specific mitochondrial DNA nearly 106 cells, as it was tested in serial dilution of sheep indicated that the presence of JSRV sequences in African DNA (estimating 20 provirus copies/cell) in human JSRV- samples was not simply a result from consumption of food. negative DNA. Like other groups, we failed to detect JSRV Our data favor the possibility that a JSRV-like virus gag and orf-x sequences in patients with BAC and poorly circulates among people from certain regions of Africa. differentiated SCLC. However, only four DNA specimens Because we could only amplify certain regions of the JSRV from BAC patients and nine DNA specimens from SCLC genome, we cannot exclude that the circulating virus is a patients were examined. In addition, we failed to detect viral recombinant between different betaretroviruses or a repli- sequences in 20 hemophiliacs from Germany. No JSRV-like cation incompetent JSRV variant. It may be nonpathogenic sequences were found in five nonhuman primate species. because many JSRV PCR-positive samples came from This result was to some extent in contrary to an earlier healthy blood donors, but it may also be a latent virus that report (Hecht et al., 1996); however, DNA samples from a induces disease very slowly. The observation that JSRV New World howler monkey (Allouatta caraya) were not sequences were more frequently detected in HIV patients is available. Data on JSRV genome screening are summarized consistent with the fact that AIDS predisposes for further in Table 2. virus infections including nonpathogenic passenger viruses. JSRV orf-x-like sequences were revealed in nearly 26% As JSRV sequences were hard to detect in PBMC, another and JSRV gag-prt-like sequences in more than 10% of tissue might be the primary target. In summary, this is the Africans from Nigeria and Cameroon. It is worth mention- first report that JSRV-related sequences can be detected in ing that 10 of the 18 orf-x positive samples were found humans. positive only after Southern hybridization. That clearly indicates a very low provirus load in PBMCs. Difficulties in JSRV sequence detection in PBMCs of infected sheep were Materials and methods reported previously (Gonzales et al., 2001). The prevalence Samples Table 2 Summary Blood samples collected with informed consent from DNA specimen Number Amplicon Amplicon Amplicon healthy blood donors living in a rural area of Cameroon (C) analyzed with orf-x with gag-prt with were kindly provided by Prof. P.-F. Bougne`res (St-Vincent- primers and prt–prt LTR-gag de-Paul Hospital, Paris, France) and Dr. A. Gessain, primers primers (Pasteur Institute, Paris, France). Blood samples from Blood donors 44 10/44 1/18a 0/10* from Cameroon healthy blood donors were obtained from two hospitals in AIDS patients 20 8/20 3/20a 0/8* Paris (France). DNA samples from HIV-1-positive Nigerian from Nigeria (N) patients and German hemophiliacs were obtained from Blood donors 15 1/15 0/15 n.d. C. Kqcherer (Robert-Koch-Institute, Berlin, Germany). from France DNA specimens from BAC and small cell lung carcinoma Hemophiliacs 20 0/20 0/20 n.d. from Germany (SCLC) patients from Russia were a gift from Dr. I. BAC patients 4 0/4 0/4 n.d. Zaborovskaya (N.N. Blokhin Cancer Research Center from Russia RAMS, Moscow, Russia). Blood samples from Papio and Germany hamadryas, Macaca nemestrina, Macaca fascicularis, SCLC patients 9 0/9 0/9 n.d. Cercopithecus aethiops, Macaca mulatta,andagoat from Russia Healthy 14 0/14 0/14 n.d. (Capra hircus) were kindly provided by C. Coulibaly nonhuman (Paul-Ehrlich-Institut, Langen, Germany). The genomic primates DNA preparation DNeasy kit (Qiagen GmbH, Hilden, Total 126 19/126 4/100 0/18 Germany) was used to isolate DNA from above-mentioned a All PCR-orf-x-positive DNA specimens were examined. blood samples, from bone marrow of a domestic sheep 168 V.A. Morozov et al. / Virology 327 (2004) 162–168

(Ovis aries) and from white cheese made from goat and De las Heras, M., Sharp, J.M., Garcia de Jalon, J.A., Dewar, P., 1991. sheep milk. Sucrose gradient-purified Mason–Pfizer mon- Enzootic nasal tumor of goats: demonstration of a type D-related retrovirus in nasal fluids and tumors. J. Gen. Virol. 72, 2533–2555. key virus (SRV-3) and goat anti-SRV-3 were obtained from De las Heras, M., Barsky, S.H., Hasleton, P., Wagner, M., Larson, E., Program Resources, Inc./DynCorp, Frederick, MD, USA. Egan, J., Ortin, A., Gimenez-Mas, J.A., Palmarini, M., Sharp, J.M., Anti-CA JSRV was kindly provided by Prof. J. DeMartini 2000. Evidence for a protein related immunologically to the (Colorado State University, USA). Jaagsiekte sheep retrovirus in some human lung tumors. Eur. Respir. J. 16, 330–332. De las Heras, M., Ortı´n, A., Cousens, C., Minguijo´n, E., Sharp, J.M., 2003. PCR, Southern hybridization, cloning Enzootic nasal adenocarcinoma of sheep and goats. Curr. Top. Microbiol. Immunol. 275, 201–223. PCR primers were designed based on JSRV virus DeMartini, J.C., York, D.F., 1997. Retrovirus-associated neoplasms of the (GenBank accession no. NC001494) and sheep mitochon- respiratory system of sheep and goats. Ovine pulmonary carcinoma dria sequence (GenBank accession no. AF010406). and enzootic nasal tumor. Vet. Clin. North Am.: Food Anim. Pract. 13, 55–77. Genomic DNA (500 ng) was used in the following PCR Fan, H., Palmarini, M., DeMartini, J.C., 2003. Transformation and amplification cycle: 94 8C for 4 min; 94 8C for 30 s, 46–52 oncogenesis by Jaagsiekte sheep retrovirus. Curr. Top. Microbiol. 8C for 30 s, 72 8C for 40 s (42 cycles); 72 8C for 10 min Immunol. 275, 139–177. (1 cycle). Nested PCR was performed with 3 Al of the first Gonzales, L., Garcia-Goti, M., Cousense, C., Dewar, P., Cortabarria, N., PCR reaction. A PCR reaction (10 Al) was separated on a Extramiana, A.B., Ortin, A., De Las Heras, M., Sharp, J.M., 2001. Jaagsiekte sheep retrovirus can be detected in the peripheral blood 2% agarose gel. Southern hybridization was performed by during the pre-clinical period of sheep pulmonary adenomatosis. J. Gen. using digoxigenin (DIG)-based DIG-High prime DNA Virol. 82, 1355–1358. labeling and detection starter kit I and II (Roche Hecht, S.J., Stedman, K.E., Carlson, J.O., DeMartini, J.C., 1996. Diagnostics GmbH, Mannheim Germany). Agarose gel- Distribution of endogenous type B and type D retrovirus sequences purified PCR amplimers were cloned in pGEM-T easy in ungulates and other mammals. Proc. Natl. Acad. Sci. U.S.A. 93, 3297–3302. vector (Promega, Madison, WI USA). Hiatt, K.M., Highsmith, W.E., 2002. Lack of DNA evidence for Jaagsiekte sheep retrovirus in human bronchioloalveolar carcinoma. Hum. Pathol. Protein electrophoresis and Western blotting 33, 680. Palmarini, M., Fan, H., 2001. Retrovirus-induced ovine pulmonary Simian retrovirus SRV-3 proteins were separated in a 10– adenocarcinoma, an animal model for lung cancer. J. Natl. Cancer Inst. 93, 1164–1603. 20% gradient Tricine polyacrylamide sodium dodecyl Palmarini, M., Cousens, C., Dalziel, R.G., Bai, J., Stedman, K., DeMartini, sulfate gel (Novex, Invitrogene, USA) and blotted on a J.C., Sharp, J.M., 1996. The exogenous form of Jaagsiekte retrovirus is 0.22 Am Protran membrane (Schleicher and Schuell, BA83, specifically associated with a contagious lung cancer of sheep. J. Virol. Germany). Membranes were blocked using 7% dry milk. 70, 1618–1623. Sera samples were diluted 1:100 and 1:200. Both anti-SRV- Palmarini, M., Gray, C.A., Carpenter, K., Fan, H., Bazer, F.W., Spenser, T.E., 2001. Expression of endogenous betaretroviruses in the ovine 3 (1:500) and anti-CA JSRV (1:1000–1:2000) were used as uterus: effects of neonatal age, estrous cycle, pregnancy, and positive controls. An ECL Western blotting detection kit progesterone. J. Virol. 75, 11319–11327. (Amersham, Freiburg Germany) was used. Rai, S.K., Duh, F.M., Vigdorovich, V., Danilkovitch-Miagkova, A., Lerman, M.I., Miller, A.D., 2001. Candidate tumor suppressor HYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell-surface Jaagsiekte Acknowledgments sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc. Natl. Acad. Sci. U.S.A. 98, 4443–4448. Rosati, S., Pittau, M., Alberti, A., Pozzi, S., York, D.F., Sharp, J.M., We are indebted to Prof. P.-F. Bougne`res, Dr. A Gessain, 2000. An accessory open reading frame (orf-x) of Jaagsiekte sheep Dr. C. Kqcherer, Dr. C. Coulibaly, and Dr. I. Zaborovskaya retrovirus is conserved between different virus isolates. Virus Res. for providing the samples that enabled us to accomplish this 66, 109–116. investigation. Their respective contribution is indicated in Schubbert, R., Renz, D., Schmitz, D., Doerfler, W., 1997. Foreign (p13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver Materials and methods. We acknowledged Prof. DeMartini via the intestinal wall mucosa and can be covalently linked to mouse for his generous gift of anti-CA JSRV and cloned JSRV. We DNA. Proc. Natl. Acad. Sci. U.S.A. 94, 961–966. would also like to thank Dr. Frobfse (Kreiskrankenhaus Summers, C., Neill, W., Dewar, P., Gonzales, L., van der Molen, R., Kfsching, Germany) who drew our attention to the possible Norval, M., Sharp, J.M., 2002. Systemic immune responses following role of JSRV in human pathology. infection with Jaagsiekte sheep retrovirus and in the terminal stages of ovine pulmonary adenocarcinoma. J. Gen. Virol. 83, 1753–1757. York, D.F., Vigne, R., Verwoerd, D.W., Querat, G., 1992. Nucleotide sequence of the Jaagsikte retrovirus, an exogenous and endoge- References nous type D and B retrovirus of sheep and goats. J. Virol. 66, 4930–4939. Bai, J., Zhu, R.Y., Stedman, K., Cousens, C., Carlson, J., Sharp, J.M., Yousem, S.A., Finkelstein, S.D., Swalsky, P.A., Bakker, A., Ohori, DeMartini, J.C., 1996. Unique long terminal repeat U3 sequence N.P., 2001. Absence of Jaagsiekte sheep retrovirus DNA and distinguish exogenous Jaagsiekte sheep retroviruses associated with RNA in bronchioloalveolar and conventional human pulmonary ovine pulmonary carcinoma from endogenous loci in the sheep genome. adenocarcinoma by PCR and RT-PCR analysis. Hum. Pathol. 32, J. Virol. 70, 3159–3168. 1039–1042.