THE ROLE OF THE RETINOL-BINDING PROTEIN RECEPTOR STRA6 IN REGULATION OF DIURNAL INSULIN RESPONSES
by
CHRISTY M GLINIAK
Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy
Department of Nutrition
CASE WESTERN RESERVE UNIVERSITY
August, 2017
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the dissertation of
Christy M Gliniak
candidate for the degree of PhD*.
Committee Chair
Danny Manor
Committee Member
J. Mark Brown
Committee Member
Colleen Croniger
Committee Member
Roman Kondratov
Committee Member
Mark Jackson
May 22, 2017
*We also certify that written approval has been obtained for any
proprietary material contained therein.
2
To Noa Noy
3 Table of Contents
List of Tables ...... 8
List of Figures ...... 9
Acknowledgements ...... 10
List of Abbreviations ...... 12
Abstract ...... 14
CHAPTER 1 ...... 16
INTRODUCTION AND STATEMENT OF PURPOSE ...... 16
1.1 INTRODUCTION ...... 16
1.2 VITAMIN A ...... 17
1.3 ABSORPTION, STORAGE AND TRAFFICKING OF VITAMIN A ...... 20
1.3.1 Absorption ...... 21
1.3.2 Storage ...... 23
1.3.3 Trafficking ...... 24
1.4 STRA6 ...... 26
1.4.1 STRA6 Structure ...... 26
1.4.2 RBP4 Receptor-2 ...... 29
1.4.3 STRA6 expression ...... 30
1.4.4 STRA6 function as ROH transporter ...... 30
1.4.5 STRA6 mutations in humans ...... 31
1.4.6 STRA6 is a signaling receptor ...... 32
1.4.7 Importance of CRBP and LRAT for vitamin A signaling ...... 34
4 1.5 RBP IS ASSOCIATED WITH IMPAIRED GLUCOSE METABOLISM ...... 36
1.5.1 STRA6 mediates RBP's effect on insulin receptor signaling .... 36
1.5.2 RBP and STRA6 are associated with type II diabetes ...... 37
1.6 CIRCADIAN PATTERNS IN INSULIN SENSITIVITY ...... 38
1.6.1 Circadian rhythms ...... 38
1.6.2 Circadian clock gene network ...... 39
1.6.3 Circadian disruption is pathogenic ...... 42
1.7 ROLE OF ADIPOSE TISSUE IN INSULIN SENSITIVITY ...... 44
CHAPTER 2 ...... 46
THE ROLE OF THE RETINOL-BINDING PROTEIN RECEPTOR STRA6
IN REGULATION OF DIURNAL INSULIN RESPONSES ...... 46
2.1 INTRODUCTION ...... 46
2.2 MATERIALS AND METHODS ...... 49
2.3 RESULTS ...... 54
2.3.1 Key players in vitamin A metabolism and signaling display
circadian rhythmicity in white adipose tissue ...... 54
2.3.2 Serum RBP4 and TTR levels display circadian rhythmicity .... 57
3.2.3 The circadian transcription factor Rev-erbα binds the promoters
of STRA6, CRBP1, and LRAT ...... 59
2.3.4 STRA6 regulates diurnal insulin responses in mice ...... 64
2.3.5 STRA6-null mice have altered diurnal carbohydrate
metabolism ...... 66
5 2.3.6 STRA6 expression opposes gene expression of targets
regulated by insulin signaling ...... 67
2.3.7 The activation of STRA6 by holo-RBP is diurnal ...... 70
2.3.8 STRA6 expression regulates circadian expression of
transcriptional targets of STAT5 ...... 72
2.4 DISCUSSION ...... 73
CHAPTER 3 ...... 82
GENERAL DISCUSSION ...... 82
3.1 OVERALL SUMMARY ...... 82
3.2 FUTURE DIRECTIONS ...... 82
3.2.1 Which genes does STRA6 regulate in WAT? ...... 82
3.2.2 How does STRA6 signaling regulate downstream gene
expression in WAT? ...... 83
3.2.3 Does STRA6 signaling inhibit insulin receptor responses via
SOCS3 in WAT? ...... 85
3.2.4 How does STRA6 inhibit signaling downstream of insulin
receptor? ...... 86
3.2.5 Does RBP secreted by adipocytes stimulate autocrine signaling
of STRA6? ...... 88
3.2.6 Does STRA6 regulate diurnal insulin action
in muscle or liver? ...... 89
3.2.7 Does STRA6 regulate the serum levels or circadian expression
of adiponectin or leptin? ...... 90
6 3.2.8 How is the expression of STRA6 regulated? ...... 90
3.2.9 How does STRA6 level of expression and circadian gene
expression change on a high fat diet? ...... 91
3.2.10 Does STRA6 have a role the brain? ...... 91
3.2.11 Is there a role for calmodulin in STRA6 activity? ...... 92
3.2.12 Development of an STRA6 inhibitor ...... 93
3.3 IMPLICATIONS OF FINDINGS ...... 94
APPENDIX ...... 95
CHAPTER 2 ...... 95
Supplemental table ...... 95
CHAPTER 3 ...... 96
Supplemental figures ...... 96
REFERENCES ...... 98
7 List of Tables
Table 2.1. Putative RORE located on mouse and human STRA6, CRBP1, and LRAT ...... 60
Table a2.1. Primer sequences used for ChIP ...... 95
8 List of Figures
Figure 1.1 Vitamin A metabolism ...... 18
Figure 1.2 Vitamin A storage and transport ...... 25
Figure 1.3 The structure of STRA6 in complex with calmodulin ...... 28
Figure 1.4. Architecture of zebrafish STRA6 protomer ...... 33
Figure 1.5. The retinol-binding protein receptor STRA6 signaling pathway ...... 35
Figure 1.6 The molecular core clock gene network in mammals ...... 41
Figure 2.1. STRA6, CRBP1 and LRAT display circadian patterns of expression in WAT ...... 55
Figure 2.2. Serum RBP4 and TTR levels display circadian rhythmicity ... 58
Figure 2.3. STRA6, CRBP1, and LRAT expression is inverse to Rev-erbα in WAT ...... 61
Figure 2.4. Rev-erbα binds to the promoters of STRA6, CRBP1, and LRAT...... 63
Figure 2.5. STRA6 regulates diurnal insulin responses in WAT ...... 65
Figure 2.6. STRA6 regulates genes controlled by insulin action ...... 69
Figure 2.7. Effectors downstream of STRA6 signaling show diurnal variations ...... 71
Figure a3.1. STRA6 regulates diurnal insulin responses in WAT ...... 96
Figure a3.2. STRA6 and LRAT expression is circadian in skeletal muscle ...... 97
9 Acknowledgements
I would like to foremost thank my mentor Dr. Noa Noy, for without her inspiration from the start I would not have developed the kind of passion for science I have now. She was an amazing scientist, and she is in my memory each day, guiding me to be thoughtful and rigorous, but also with a warm smile and telling me not to worry so much. I would like to thank Dr. J. Mark Brown who has advised me this last year, with his advice and help, we brought the project to the finish line - one of the hardest parts of the process. His fresh perspective and generous nature rounded out what has been an exciting but challenging project.
I would like to thank the members of my committee, all scientists I admire, for their advice and suggestions that moved this project forward all these years. Thank you to Norbert B. Ghyselinck (Département de
Génétique Fonctionnelle et Cancer, Institut de Génétique et de Biologie
Moléculaire et Cellulaire; Centre National de la Recherche Scientifique;
INSERM; and Université de Strasbourg, Illkirch, France) for the generous gift of the STRA6-null mouse.
I could not have achieved anything in life without past teachers, and mentors like Dr. James Fleet, Dr. Liraz Levi and Dr. Danny Manor. Thank you to my labmates for good training and fun times, from Noy lab bonfires and Brown lab all-nighters.
It goes without saying I owe a huge thanks to my friends and family.
Thank you to my mother, a constant and unselfish source of love,
10 kindness, and gluten free food. I'd be lost if her common sense didn't rub off on me. Thank you to my Dad who through genetics and nurture I gained my work ethic and perseverance, and who provided everything I needed to succeed in life. Lastly, thank you John, for making me laugh everyday, and for the countless things you have done for me, including moving to Cleveland and doing all of the dishes.
11 List of Abbreviations
ACACA, acetyl-CoA carboxylase alpha
BCMO1, β-carotene-15,15' monooxygenase
BMAL1, brain and muscle ARNT-like 1
CLOCK, circadian locomotor output cycles kaput
CRBP1, cellular retinol binding protein 1
CRY, cryptochrome
DGAT, diacylglycerol O-acyltransferase
FASN, fatty acid synthase
HSC, hepatic stellate cell
Insig1, Insulin induced gene 1
IR, insulin receptor
IRS, insulin receptor substrate
JAK, janus kinase
LRAT, lecithin-retinol acyltransferase
N-CoR, nuclear receptor corepressor
PNPLA3, patatin like phospholipase domain containing 3
PDK4, pyruvate dehydrogenase kinase 4
PER, period
RORE, RAR-related orphan receptor alpha response element
RBP4, retinol binding protein 4
RE, retinyl ester
REH, retinyl ester hydrolase
12 Rev-erbα, nuclear receptor subfamily 1 - group D - member 1
ROH, retinol
RPE, retinal pigment epithelium
SCN, suprachiasmatic nucleus
SNPs, single nucleotide polymorphisms
SOCS3, suppressor of cytokine signaling 3
SR-B1, scavenger receptor class B type 1
SREBP-1c, sterol regulatory element-binding protein 1c
STAT, signal transducer and activator of transcription
STRA6, stimulated by retinoic acid 6
TTR, transthyretin
WAT, white adipose tissue
ZT, zeitgeber
13 The Role of the Retinol-Binding Protein Receptor STRA6 in Regulation of Diurnal Insulin Responses
Abstract
by
CHRISTY M. GLINIAK
It has long been appreciated that insulin action is closely tied to circadian rhythms. However, mechanisms that dictate diurnal insulin sensitivity in metabolic tissues are not well understood. Retinol binding protein 4
(RBP4) has been implicated as a driver of insulin resistance in rodents and humans, and has become an attractive drug target in type 2 diabetes.
RBP4 is synthesized primarily in the liver where it binds retinol and transports it to tissues throughout the body. The retinol-RBP4 complex
(holo-RBP) can be recognized by a cell surface receptor known as stimulated by retinoic acid 6 (STRA6) which transports retinol into cells.
Coupled to retinol transport, holo-RBP can activate STRA6-driven janus kinase (JAK) signaling and downstream induction of signal transducer and activator of transcription (STAT) target genes. STRA6 signaling in white adipose tissue has been shown to inhibit insulin receptor responses. Here we examined diurnal rhythmicity of the RBP4-STRA6 signaling axis, and investigated whether STRA6 is necessary for diurnal variations in insulin sensitivity. We show that adipose tissue STRA6 undergoes circadian patterning driven in part by the nuclear transcription factor Rev-erbα.
Furthermore, STRA6 is necessary for diurnal rhythmicity of insulin action and JAK/STAT signaling in adipose tissue. These findings establish that
14 holo-RBP and its receptor STRA6 are potent regulators of diurnal insulin responses, and suggest that the holo-RBP/STRA6 signaling axis may represent a novel therapeutic target in type 2 diabetes.
.
15 CHAPTER 1
INTRODUCTION AND STATEMENT OF PURPOSE
1.1 Introduction
Many aspects of energy metabolism show clear variations between day and night(1). Plasma glucose levels are maintained within a narrow range during these distinct daily phases, and it is partially because insulin sensitivity follows a diurnal pattern(2,3). Humans are more insulin sensitive during the morning versus the evening(3). Type II diabetes is a chronic disorder of glucose metabolism that has become a global epidemic(4-6). The disease is defined by a resistance to the action of the hormone insulin to properly regulate blood glucose levels(7). Therefore, understanding how insulin responses are regulated in physiological and pathological circumstances is essential for discovering new treatments for type II diabetes. While we know that glucose metabolism is controlled by circadian rhythm, little is known about how the circadian clock regulates diurnal insulin sensitivity and glucose homeostasis(1,8).
Despite much progress in the understanding of insulin action, the molecular basis for the development of human insulin resistance or diurnal insulin responses remain unclear(1). Considering that vitamin A signaling through retinol binding protein (RBP) activation of its receptor stimulated by retinoic acid 6 (STRA6) regulates insulin receptor responses in white adipose tissue (WAT)(9), I hypothesized that STRA6 may regulate diurnal
16 insulin responses under normal physiological conditions. The aim of the studies in this dissertation was to test whether STRA6 displays circadian patterns of expression and signaling in WAT, and determine whether
STRA6 is necessary for diurnal variations of insulin responses in WAT.
1.2 Vitamin A
Vitamin A, all-trans-retinol, was discovered over a century ago and has become one of the most studied fat-soluble vitamins(10). All-trans-retinol
(ROH) serves as a precursor for both the bioactive and storage forms of vitamin A(11). The term retinoids refer to the natural and synthetic compounds that are structurally similar to all-trans-retinol(12). All-trans retinol and retinyl esters (RE) are the most abundant forms of retinoid in the body. Retinyl esters are formed when a fatty acyl group is esterified to the hydroxyl terminus of all-trans-retinol(13). RE serves as the storage form of retinol in cells, but are also important substrates in the eye for the formation of the visual chromaphore 11-cis retinal(14). In tissues other than the eye, many physiological actions of vitamin A are carried out by the bioactive metabolite retinoic acid (RA)(15). ROH is converted to RA by a two-step process. ROH is first converted to all-trans-retinal by retinal dehydrongenase (RDH) (Fig. 1.1)(16). Then, all-trans-retinal can be converted to all-trans-retinoic acid by retinaldehyde dehydrogenase
(RALDH) enzymes (Fig. 1.1)(17). RA molecules are ligands for ligand- dependent nuclear transcription factors that regulate gene expression
17 (18). All-trans-retinoic acid is a natural ligand for nuclear hormone receptors known as retinoic acid receptors (RARα,-β, and γ)(18,19). 9-cis- retinoic acid is a natural ligand for the retinoid X receptors (RXRα, -β, and
γ)(20-22), and RA activates both retinoic acid receptor and peroxisome proliferator activated receptor β/δ(23-25).
Figure 1.1 Vitamin A metabolism
β-carotene and retinyl esters (commonly found in the diet as retinol palmitate) are converted to all-trans-retinol by the enzymes β-carotene-
15,15' monooxygenase (BCMO1) or retinyl ester hydrolases
(REH)(26,27). Retinol is converted to retinyl esters by lecithin:retinol acyltransferase (LRAT), or retinyl esters can be converted back to ROH by retinyl ester hydrolases (REH)(13,28). All-trans-retinol can be converted to
18 retinal by retinal dehydrongenase (RDH)(16). RDH enzymes also reverse the conversion of retinal to ROH(29). all-trans-retinal can be converted to all-trans-retinoic acid in an irreversible reaction catalyzed by retinaldehyde dehydrogenase (RALDH) enzymes(17).
It has been reported that RA can modulate over 500 target genes in various tissues via the nuclear transcription factors RAR and RXR(30).
Retinoids regulate numerous biological functions in the embryo and adult including growth and development, differentiation, maintenance of epithelial barriers, immune function, and vision(10,14,27,31). It has been suggested that retinoids can also have effects independent of transcriptional regulation that could mediate cell differentiation and growth, but this is a developing area of research (11,15).
Animals cannot synthesize vitamin A, therefore it is an essential nutrient for health that must be obtained from the diet. ROH, RE, or RA can be consumed from animal products such as dairy, fish, and meat(27).
Consumption of retinoid from plants is in the form of provitamin A carotenoids(32). The most abundant form of carotenoid is β- carotene(32,33). In developing nations, provitamin A carotenoids provide a majority of dietary vitamin A (34). However, in industrialized nations,
65% of dietary vitamin A is in the form of ROH or RE (33).
Vitamin A deficiency (VAD), while uncommon in industrialized countries, is common worldwide and affects children in
19 particular(34). Because vitamin A is an important regulator for cell division, VAD affects fetal organ development, skeletal growth and maturation, and development of vision in the fetus(35). An estimated
500,000 children worldwide become blind due to inadequate dietary retinoid(36). Children with VAD are immune deficient and susceptible to infection before the onset of visual symptoms(37). In adults, VAD classically presents as night blindness or susceptibility to infection(37,38).
Conversely, vitamin A toxicity in the developing fetus is teratogenic
(39). Long-term toxicity in adults can result in osteoporosis, bone malformations, hip fracture, or autoimmune disease(34). Toxicity can occur through retinoid supplementation or from excess retinoid consumption, but rarely due to ingestion of provitamin A carotenoids(34).
The absorption and cleavage of provitamin A carotenoids is a highly regulated process that is suppressed by cellular retinoic acid(40,41).
Therefore, toxicity from provitamin A from plant sources has been found to be almost impossible(40).
1.3 Absorption, storage and trafficking of vitamin A
Because vitamin A has extensive potent physiological effects, vertebrates have evolved strategies for the maintenance of vitamin A in serum and tissue, resulting in a highly regulated process at the level of absorption, storage, and trafficking(42). Vitamin A storage and metabolism is regulated similar to other vitamins (such as vitamin D) where there is a
20 high concentration of the precursor molecule and low concentrations of the active metabolites(43). Vitamin A homeostasis is also controlled by vitamin A binding proteins that function to solubilize, protect, or detoxify retinoids in the extra-cellular and intra-cellular environment(11).
1.3.1 Absorption
Most vitamin A and carotenoids are absorbed in the proximal portion of the small intestine(32). Dietary RE cannot be directly absorbed until it is hydrolyzed to ROH by luminal pancreatic enzymes such as pancreatic triglyceride lipase (PTL) and cholesterol ester hydrolase(44,45). Enzymes with retinol ester hydrolase activity can also be associated with the brush border(27). Any free ROH in the intestine is absorbed through passive diffusion through the brush border membrane of the enterocyte by retinyl ester hydrolases (REH)(12). Once in the enterocyte 90% of ROH is then re-esterified to long chain fatty acids by the enzyme lecithin:retinol acyltransferase (LRAT) (Fig. 1.2)(46). LRAT catalyzes the transesterification of long chain fatty acids present at the sn-1 position of phophatidylcholine to retinol, thereby forming RE(28). The remainder of
ROH in the enterocyte can be esterified to RE by diacylglycerol acyltransferase 1 (DGAT1), which is an acyl-CoA: retinol acyltransferase(47).
Carotenoids are absorbed through a regulated process through the scavenger receptor class B type 1 (SR-B1) transporter(32). In the
21 enterocyte, β-carotene is cleaved into 2 symmetric molecules of retinal by the enzyme β-carotene-15,15' monooxygenase (BCMO1)(48). Retinal then will be reduced to form ROH by retinal reductases of which there are many isoforms, and then synthesized to RE by LRAT or DGAT1(32,49).
REs formed in the enterocyte are packaged for export into nascent chylomicrons along with other dietary lipids(50). The chylomicrons are secreted into the lymphatic system, then enter general circulation (Fig.
1.2) (27). Postprandially, tissues can obtain retinoids from chylomicrons, chylomicron remnants, very low-density lipoprotein (VLDL), low-density lipoprotein (LDL), and high-density lipoprotein (HDL)(12). REs carried within circulating lipoproteins can be hydrolyzed to ROH by the cell surface enzyme lipoprotein lipase (LpL) before entering cells(51,52).
About 70% of RE from chylomicrons remnants are cleared by the liver through action of the LDL receptor or the LDL receptor-related protein expressed in hepatocytes (Fig. 1.2)(53,54). β-carotene can also be packaged into chylomicrons or lipoproteins and delivered to tissues, where it can be later converted to ROH(32,55).
22 1.3.2 Storage
Unlike other vitamins, vitamin A can be stored at high levels(36). 70% of retinoid in the body is stored in the liver, and other significant retinol depots are in the adipose, lung, and kidney(54,56). Storage of vitamin A allows vertebrates to maintain homeostasis despite fluctuations in dietary supply. Hepatocytes take up chylomicron remnants via endocytosis facilitated by receptor mediated pathways(57). The REs are rapidly hydrolyzed to ROH by a number of enzymes including retinyl ester hydrolases, carboxylesterases, and lipases(13,27,58,59). ROH is transferred to hepatic stellate cells (HSCs) by a mechanism not yet defined(27). HSCs are specialized cells that reside between the hepatocytes and small blood vessels in the liver, and are unique as they contain large lipid droplets rich in RE(60). After ROH is transferred to HSC from hepatocytes it is esterified back to RE by LRAT for storage(46).
While HSC only make up 6-8% of total cells within the liver(60), 70-90% of liver retinoid are stored in the HSCs(60). Studies show that HSC retinoid content reflects the level of retinoid in the diet(61). However, it remains unknown how HSCs sense low dietary retinoid or how extra-hepatic peripheral tissues signal to HSCs to stimulate mobilization of retinoid stores(27). HSCs express several retinyl ester hydrolase enzymes capable of creating free ROH from RE(27). Therefore, during dietary or tissue retinoid deficiency, HSCs mobilizes ROH stores, and the ROH is transferred back to hepatocytes for secretion(27,62).
23 1.3.3 Trafficking
Liver hepatocytes mobilize ROH stores on a specific carrier protein, retinol binding protein (RBP), a 21 kDa protein that binds one molecule of all- trans-retinol (Fig. 1.2)(50). In the liver, RBP is expressed exclusively by hepatocytes(63). While many other tissues express RBP, including adipose tissue, kidney, lung, heart, skeletal muscle, spleen, eye, and testis, the liver is the main site of synthesis and secretion of this protein(62). RBP is secreted from the liver bound to transthyretin
(TTR)(64). TTR is a 55 kDa homotetrameric protein, synthesized in liver, choroid plexus, retinal pigment epithelium, and pancreas(65,66). TTR is present in serum and cerebrospinal fluid, and binds to holo-RBP and thyroxine(67). In the serum, holo-RBP is found in complex with TTR in a
1:1 molar ratio(68-70). It is thought that the function of holo-RBP binding to TTR prevents glomeruli filtration of the small RBP molecule by the kidney(64,68).
Unlike post-prandial periods when retinol is mainly delivered to peripheral tissues by chylomicrons, ROH bound RBP (holo-RBP) is the predominant fraction of retinoid in the blood during fasting(50). Therefore, one important physiological role of RBP is to mobilize ROH from hepatic stores and deliver it to peripheral tissues(71). Two models have been proposed to account for uptake of ROH into cells from holo-RBP. The lipophilic ROH molecule can be delivered from holo-RBP into cells by spontaneous dissociation from the complex, and diffuse across the
24 plasma membrane(72-76). Alternatively, ROH can also be transported into target cells from holo-RBP by the cell surface receptors stimulated by retinoic acid 6 (STRA6) and RBP4 receptor-2 (RBPR2)(9,77,78).
Figure 1.2 Vitamin A storage and transport
Vitamin A is consumed in the diet either as retinyl esters (RE) or as β- carotene(27). It is absorbed as retinol in the enterocyte and packaged into
RE and secreted at chylomicrons into the circulation(27). Tissues can then absorb retinol from chylomicrons through the plasma membrane using the enzyme lipoprotein lipase(57). About 2 hours after a meal the chylomicron remnants reach the liver and the retinol is stored as retinyl esters(60). To supply extra-hepatic tissues with vitamin A, the liver can mobilize its RE and secrete retinol to target tissues via holo-RBP:TTR complex(79).
25 1.4 STRA6
In the 1970s it was suspected that there was a cell surface receptor for
RBP present on the retinal pigment epithelium (RPE) in the eye(80). Other tissues that were described to have a putative RBP receptor were placenta, choroid plexus, testis, and macrophages(81-83). Sun, H. and colleagues were the first to identify the putative receptor for RBP using a novel technique(77). They created a recombinant His-tagged RBP protein cross-linked with an amine reactive group and also a photoreactive group termed (AP-tagged RBP). The AP-tagged RBP was designed to form a covalent complex with its putative binding partner. Using mass spectrometry they identified the holo-RBP binding partner to be a previously identified protein, STRA6(77). STRA6 was confirmed to be a receptor for holo-RBP with additional experiments that showed STRA6 mediating ROH uptake into cells from extracellular holo-RBP, and STRA6 localization to previously described regions where the putative RBP receptor was located(77).
1.4.1 STRA6 Structure
Before STRA6 was identified as a receptor for RBP, the STRA6 gene was identified in a screen for cDNA fragments that were upregulated in response to retinoic acid - hence its name, Stimulated by Retinoic Acid
6(84). When the gene was first discovered, computational analysis predicted that it was a hydrophobic protein with 9 transmembrane
26 spanning domains(85). In addition, STRA6 was shown to localize with the plasma membrane(85). Sequence comparison identified no known homolog to STRA6, and it was classified as a new type of membrane protein(85).
The structure of zebrafish STRA6 was determined recently by cryo- electron microscopy (Fig. 1.3)(86). STRA6 was shown to be assembled as a symmetric dimer with 18 transmembrane (TM) helices (9 per protomer) and 2 long horizontal intramembrane (IM) helices that interact at the center where the 2 dimers interface(86). Interestingly, each protomer of
STRA6 was associated with one molecule of calmodulin forming a 180 kDa complex(86). Calmodulin is ubiquitously expressed in eukaryotic cells and is a calcium receptor protein that is known to mediate many cellular processes(87). In the STRA6 crystal structure, calmodulin was found to be bound on the cytoplasmic side of STRA6 (Fig. 1.3)(86). This was an unexpected finding as there are no previous reports showing STRA6 associated with calmodulin or that there is a direct link between calcium and retinol transport. However, calmodulin binds to STRA6 with high affinity and the STRA6-calmodulin complex is stable (86).
One protomer of the STRA6 structure can be characterized by 3 distinct regions (Fig. 1.3). 1) The N-terminal domain and one of the 3 calmodulin binding domains. 2) The central domain containing TM6-9 and the 2 IM helices. 3) the C-terminal tail that contains 2 of the 3 calmodulin containing domains(86).
27 Residues on human STRA6 that were previously identified as RBP interacting sites through functional mutagenesis were found to be located on N-terminal domain extracellular-facing cleft of the STRA6-calmodulin structure (86,88). In this structure RBP would bind to the extracellular N- terminal domain near a hydrophobic cleft that is open to the bilayer(86).
This cleft has a window into the membrane bilayer, therefore this arrangement suggests that STRA6 may facilitate diffusion of ROH from
RBP directly into the cell membrane(86). However, more research needs to be done to determine how STRA6 facilitates transport of ROH from holo-RBP.
Figure 1.3 The structure of STRA6 in complex with calmodulin
The STRA6 dimer, drawn as a ribbon representation with one protomer in dark red and the other in black, is associated with two molecules of
28 calmodulin (CaM), drawn in gray and gold. The internal volume of the outer cleft is represented as a semitransparent blue surface. Calcium ions are represented as green spheres. From [Chen, Y., Clarke, O. B., Kim, J.,
Stowe, S., Kim, Y. K., Assur, Z., Cavalier, M., Godoy-Ruiz, R., von Alpen,
D. C., Manzini, C., Blaner, W. S., Frank, J., Quadro, L., Weber, D. J.,
Shapiro, L., Hendrickson, W. A., and Mancia, F. (2016) Structure of the
STRA6 receptor for retinol uptake. Science 353]. Reprinted with permission from AAAS.
1.4.2 RBP4 Receptor-2
There is a report of another cell surface ROH transporter protein, RBP4
Receptor-2 (RBPR2) that is expressed in the liver, small intestine, jejunum, and ileum of mice(78). Cell culture studies showed that RBPR2 is localized to the membrane, displays high affinity binding to RBP, and transports retinol from holo-RBP into cells(78). RBPR2 is a single chain protein in mice, but in primates the RBPR2 gene is encoded by two separate genes in different loci that form a double chain protein(78). The amino acid sequence of RBPR2 displays an 18% homology to STRA6, and does not contain any sequence motifs known to promote receptor signaling(78). The role of RBPR2 in human physiology has yet to be investigated.
29 1.4.3 STRA6 expression
STRA6 is well conserved among vertebrates(42). STRA6 expression is enriched at blood organ barriers in the developing and adult mouse(85).
During development STRA6 is also expressed in developing limbs and during endochondrial ossification and in the differentiating nervous system and in the gastrointestinal tract(85,89). STRA6 expression in adults is limited to the retinal pigment epithelium in the eye, brain, white adipose tissue (WAT), spleen, kidney, testis, female genital tract, and in the placenta(85). It is expressed in the heart and lung at lower levels, and notably STRA6 is not expressed in the liver(85,90).
1.4.4 STRA6 function as ROH transporter
STRA6 expression is highest in the retinal pigment epithelial layer, which is located between the retinal visual neurons and the vascular bed(77,91).
Holo-RBP is delivered to the RPE by the choriocapillaris blood and interacts with STRA6 on the basal side of the RPE(92). STRA6 then transports ROH into the RPE cells that have the unique ability to convert
RE into 11-cis-retinal, the photopigment essential for vision(91).
Accordingly, it has been shown in mice that STRA6 has an important function as a ROH transporter in the eye(92). STRA6-null mice show reduced retinoid levels and have a 95% reduction of RE in the RPE(92).
STRA6-null mice have morphological changes in the eye such as shortening in length of the inner and outer segments of the retina and a
30 persistent primary vitreous body(9,92). These defects result in a 20% decrease in visual responses in the STRA6-null mouse as compared to controls as measured by electroretinogram(92). This is a moderate visual impairment, suggesting STRA6 ROH transport is not the only way the
RPE are obtaining ROH(9,92).
1.4.5 STRA6 mutations in humans
The fact that mutations in STRA6 are associated with malformation of the human eye highlights the important role of STRA6 as a ROH transporter.
Mutations in the human STRA6 gene have been associated with Matthew-
Wood syndrome(93). The syndrome may present with a combination of the following: microphthalmia, anophthalmia, developmental cardiac defects, pulmonary dysgenesis, and diaphragmatic hernia, or mental retardation(93-95). Various STRA6 mutations have been identified in patients, the severity of the syndrome can vary among patients that share a specific mutation(6,96,97). Some studies show that patients presenting this syndrome are negative for STRA6 mutations(93,97). Due to the phenotypic variability it appears Matthew-Wood syndrome is not a genetically homogenous syndrome. It is possibly several distinct syndromes overlapping in clinical presentation due to several genetic defects(96). To date, the role of STRA6 in Matthew-Wood syndrome has yet to be determined. It is unknown why STRA6-null mice display a phenotype in the eye that is much less severe than mutations in humans.
31 Besides for the visual phenotype, STRA6-null mice develop normally and are healthy(9,92). This may be because STRA6 is expressed at much lower levels in tissues other than the eye, and its function as a transporter may not be necessary for maintaining retinoid stores in these tissues(9).
1.4.6 STRA6 is a signaling receptor
STRA6 is a unique protein, as it is the only plasma membrane transporter that can also act as a signaling receptor. Upon binding of extracellular holo-RBP, STRA6 not only transports ROH across the plasma membrane, but it also triggers a janus kinase 2 (JAK2) signal transducer and activator of transcription (STAT) signaling cascade(9,98). The structure of zebrafish
STRA6 defines the location of the JAK2 binding motif (EEGIQLV) to be located on the cytoplasmic tail of STRA6 (Fig. 1.4)(86). The STAT binding motif (TYLL) is located just distal to the JAK2 motif on the cytoplasmic tail of STRA6 (Fig. 1.4)(86). Upon binding of holo-RBP, STRA6 recruits JAK2 to the cytosolic C-terminal tail of STRA6 (Fig. 1.5)(99). The transport of
ROH through STRA6 triggers activation of JAK2, which then phosphorylates a tyrosine residue (Y643) of the cytosolic tail of STRA6
(Fig. 1.5)(99). Phosphorylation at this residue of the receptor leads to recruitment and activation of the transcription factors STAT3 or STAT5 in a cell-specific manner(98,100). Consequently, activation of STRA6 signaling by holo-RBP leads to induction of STAT target genes (Fig.
1.5)(98,100). Notably, RBP association with TTR in the serum prevents
32 binding of holo-RBP to STRA6. Thus STRA6 mediates ROH uptake and signaling only when holo-RBP level exceeds the level of TTR(72).
Traditionally it had been thought that only vitamin A metabolites regulated gene expression. However, since the discovery that holo-RBP activates
STRA6 signaling, ROH has also been identified as a regulator of gene expression(101).
Figure 1.4. Architecture of zebrafish STRA6 protomer
Schematic representation of the connectivity and structural elements of where JAK2, CRBP1, and STAT5 motifs have been identified on STRA6 protomer. Residue locations annotated with the human/zebrafish residue location(86).
33 1.4.7 Importance of CRBP and LRAT for vitamin A signaling
Both ROH uptake and cell signaling by STRA6 are critically linked to intracellular transport and metabolism of vitamin A(99). It was reported in regard to this, that cellular retinol binding protein 1 (CRBP1), a cytosolic
ROH carrier protein, binds an intracellular portion of STRA6 and directly accepts ROH transferred from extracellular RBP through STRA6 (Fig.
1.5)(99). Ligand-bound CRBP1 then dissociates from STRA6 and delivers
ROH to metabolizing enzymes such as LRAT, which catalyzes the conversion of ROH to retinyl esters for storage (Fig. 1.5)(12). By storing
ROH, LRAT creates an inward gradient of ROH across the cell. This allows for the regeneration of apo-CRBP1, which can re-bind to STRA6 and allow for continuing influx of ROH and STRA6 signaling (Fig. 1.5)(99).
It has been demonstrated that both CRBP1 and LRAT are required for
STRA6-dependent vitamin A uptake and signaling(99,102).
34
Figure 1.5. The retinol-binding protein receptor STRA6 signaling pathway
STRA6 binds extracellular holo-RBP4 and transports ROH to receptor- associated CRBP1(99). The activity of STRA6 to transport and signal is dependent on the maintenance of an inward gradient of ROH across the plasma membrane(103). This is maintained as CRBP1 delivers ROH to the enzyme LRAT for ROH conversion to RE for storage(102). The transfer of retinol through STRA6 activates the ability of STRA6 to signal, triggering the recruitment and activation of JAK2 and STAT5 that can bind the c-terminal tail of STRA6(99). Activated STAT proteins translocate to the nucleus where they induce target gene expression(9). One gene
35 upregulated by STRA6 signaling is suppressor of cytokine signaling 3
(SOCS3), an inhibitor of insulin receptor responses(98).
1.5 RBP is associated with impaired glucose metabolism
It has been reported that in obese mice and humans, the plasma level of
RBP is elevated(9,104). In humans, RBP elevation shows a strong correlation with obesity as well as various obesity-associated pathologies, including inflammation, fatty liver disease, and insulin resistance(105-107).
Administration of holo-RBP to cultured adipocytes or lean mice has been shown to result in reduced insulin receptor phosphorylation and insulin responses(98,104). In addition, mice lacking RBP are protected from insulin resistance induced by a high fat diet(104).
1.5.1 STRA6 mediates RBP's effect on insulin receptor signaling
The discovery that STRA6 activates JAK/STAT signaling provides a rationale for how RBP causes insulin resistance. Adipocyte JAK/STAT signaling is well known for regulating systemic insulin responses and glucose metabolism(108). In obese mice, holo-RBP levels are elevated above the level of TTR(104). This results in a physiological circumstance when the ligand for STRA6 is increased, allowing for increased activation of the receptor(72). Specifically, it was shown that STRA6 expression was essential for RBP-induced STAT5 target genes in WAT and skeletal muscle(9). This includes the gene for suppressor of cytokine signaling 3
36 (SOCS3), a potent inhibitor of the insulin receptor(98). Moreover, utilizing
STRA6-null mice, it was demonstrated that STRA6 is required for RBP- induced insulin resistance(9). In addition, STRA6-null mice were found to be resistant to high fat diet induced insulin resistance(9). It has been reported that even a partial knockdown of STRA6 specific to adipocytes was sufficient to increase insulin responsiveness in mice fed a high fat diet(109).
1.5.2 RBP and STRA6 are associated with type II diabetes
Obesity and type II diabetes have become a global epidemic, affecting one-third of adults in the United States alone and the numbers are on the rise(4-6). Type II diabetes is characterized by progressive insulin resistance, hyperinsulinemia, and beta cell dysfunction(112). Insulin resistance is a major driver of type II diabetes as it results in diminished insulin-stimulated signaling cascades that regulate many metabolic processes, including the transport of glucose into skeletal muscle and adipose tissue and proper suppression of hepatic gluconeogenesis in the liver(113). A gain of function mutation in RBP4 was discovered to increase risk of type II diabetes by 80% in human homozygous carriers of the mutation(110). In addition, SNPS in STRA6 are significantly associated with type II diabetes(111). Therefore, understanding the factors that regulate insulin signaling, including RBP mediated STRA6 signaling under
37 physiological and pathological circumstances is essential for discovering new treatments for type II diabetics.
1.6 Circadian patterns in insulin sensitivity
It is well established that insulin sensitivity follows a diurnal pattern (2,3).
Humans are more insulin sensitive during the morning versus the evening(3). This phenomenon can partially explain why plasma glucose levels are maintained at a narrow range during distinct daily metabolic phases. During daytime feeding, tissues are more insulin sensitive and serum glucose is more efficiently cleared and utilized(114). Alternatively, during the nighttime fast, tissues are relatively insulin resistant which assists with glucose level maintenance(3,114). Mice however are nocturnal mammals, and it is known that their hormonal rhythms, behavior, and insulin sensitivity are opposite relative to the light/dark cycle of humans(1,115).
1.6.1 Circadian rhythms
From cyanobacteria to mammals, living cells have evolved to be in synchrony with the natural environment(116,117). Circadian rhythms are self-sustaining, with a period very close to 24 hours(118,119). In mammals the endogenous clock coordinates behaviors like the sleep-wake cycle and feeding behavior, and physiological processes such as thermogenesis and glucose and lipid metabolism(1,118). One of the main features of
38 circadian rhythm is that it can be entrained by external cues termed
Zeitgebers such as light, temperature, or food. The other main feature of circadian rhythms is that they are temperature compensated, meaning that the endogenous biological clock does not speed up or slow down with changing temperature(120). A key Zeitgeber is light exposure(121). In mammals, light is first sensed in the retina by melanopsin expressing retinal ganglion cells in non-image forming responses(122). These retinal ganglion cells project through the retino-hypothalamic tract to the suprachiasmatic nuclei (SCN) located in the hypothalamus(123).
The SCN clock is considered the central pacemaker that drives behavioral rhythms controlled by the brain(124,125). SCN-driven rhythms coordinate the clocks in peripheral tissues through the autonomic nervous system, secretion of hormones, and by regulation of core body temperature so that they maintain proper phase relationships with each other(126,127). Peripheral tissues such as liver, muscle and adipose have clocks of their own and can be entrained by outputs of the SCN, but are also synchronized by Zeitgebers such as feeding behavior(126,128).
1.6.2 Circadian clock gene network
Circadian rhythms are controlled by a circadian clock gene network present in nearly all cells(129). While non-transcriptional oscillating events have been identified to control cellular circadian rhythms, in mammals, the best-defined circadian clock mechanism is maintained by an auto-
39 regulated transcriptional/translational feedback loop(116-118). At its core are 2 transcription factors, circadian locomotor output cycles kaput
(CLOCK) or its paralog neuronal PAS domain protein 2 (NPAS2) and brain and muscle ARNT-like 1 (BMAL1)(130). The positive arm of the feedback loop begins when CLOCK/NPAS2 and BMAL1 heterodimerize and bind to promoter E-box response elements and transcriptionally induce targets such as other circadian genes. period 1, 2, and 3 (Per1/2/3) and cryptochromes 1 and 2 (Per1/2) (Fig. 1.6)(131). PER and CRY proteins are part of the repressive arm of the molecular clock. They rhythmically accumulate in the cytosol, dimerize with each other, return to the nucleus and act to inhibit the ability of CLOCK/BMAL1 complex to transactivate genes (Fig. 1.6). Therefore, by inhibiting CLOCK/BMAL1,
PER and CRY inhibit their own transcription, closing the end of the negative part of the feedback loop(131). The negative feedback loop is also closed as the PER/CRY repressor complex is removed from the cytosol by ubiquitination and degradation by the proteasome(132,133).
The reduction of PER/CRY relieves the repression of BMAL1 and CLOCK allowing the positive arm of the feedback loop to begin again(133).
Interlinked with this core feedback loop are other interconnecting feedback loops(134). One of the most characterized loops involves the nuclear hormone receptor Rev-erbα. BMAL1 and CLOCK regulate the transcription Rev-erbα (NR1D1), that acts as a transcriptional repressor through the recruitment of nuclear receptor corepressor-histone
40 deacetylase 3 (HDAC3)(135). Rev-erbα regulates the expression of the core clock gene BMAL1, thereby fine-tuning the core circadian clock, but it also transcriptionally represses many metabolic genes (Fig. 1.6)(134,135).
Circadian clock transcriptional loops can also be fine-tuned by non- transcriptional mechanisms. Levels of cyclic adenosine monophosphate
(cAMP) and the NAD+/NADH ratio can vary during the fed and fasted state, and can lead to post-transcriptional modifications of clock proteins thereby controlling circadian cycles of genes involved in glucose and lipid metabolism(136,137). These mechanisms are strong regulators of peripheral tissues, while the SCN is entrained mainly by light(123,128).
Figure 1.6 The molecular core clock gene network in mammals
The mammalian circadian clock is primarily regulated by a transcriptional- translational feedback loop(118). The positive arm of the loop is controlled by the transcription factors CLOCK and BMAL1. They bind to E-box promoter elements and transactivate expression of other clock genes such
41 as Per1-3, Cry1/2, and Rev-erbα/β(133). CLOCK and BMAL1 are thereby initiating the negative arm of the feedback loop. PER and CRY proteins dimerize in the cytosol and translocate to the nucleus and inhibit the ability of the CLOCK/BMAL1 complex to transactivate genes, including Per and
Cry, thereby concluding the negative arm of the feedback loop(133). REV-
ERB proteins are transcriptional repressors, and also act as a negative arm of the feedback loop by repressing Bmal1 expression(138).
1.6.3 Circadian disruption is pathogenic
Several lines of evidence from clinical and epidemiologic studies suggest that circadian disruption has been associated with increased incidence of obesity, diabetes, cardiovascular disease, cancer and inflammatory disorders(124,139,140). Improper circadian entrainment of the SCN master clock can be disrupted in humans by activities such as jet lag, shift work, sleep deprivation, and bright-light exposure at night(139,141,142).
These observations suggest that chronic misalignment of rest and activity with fasting and feeding contribute to the initiation and progression of obesity and metabolic syndrome(121).
Numerous cross-sectional and prospective clinical studies have shown that poor sleep or sleep for a short duration predicts the development of type II diabetes and obesity(143-145). For example, shift work in Japanese male workers was found to be a risk factor for weight gain(146), and a cross-sectional study in Sweden found an association
42 between shift work and metabolic syndrome(142). Restricted or altered sleep wake cycles have been associated with increased BMI(145), and alterations in neuroendocrine hormones controlling appetite(147).
Therefore, there is strong evidence from epidemiological studies that there is a relationship between circadian clock rhythm and energy homeostasis.
Interestingly, several single nucleotide polymorphisms (SNPs) have been identified in the human CLOCK gene, and these SNPs were significantly associated with obesity and metabolic syndrome(148). Per2
SNPs also were associated with abdominal obesity which is often associated with insulin resistance and metabolic syndrome(149,150).
In mice, the circadian regulation of metabolism has been studied by either the generation of circadian clock gene mutants or by disrupting the external environment causing circadian disruption. CLOCK mutant mice on a high fat diet have disrupted diurnal feeding patterns, are hyperphagic, obese, hyperglycemic and hyperinsulinemic - all signs of defects pertaining to insulin(151). Global and adipose-specific clock Bmal1 gene mutant mice display dysregulated lipid and glucose metabolism(152,153).
Studies in Rev-erbα knockout mice revealed a mild metabolic phenotype(138). Rev-erbβ (NR1D2) is a closely related protein to Rev- erbα and is recruited to the same binding sites and regulates many of the same genes as Rev-erbα(154). In a double knockout mouse with the depletion of both Rev-erb proteins, the mice developed hepatic steatosis and had increased serum triglycerides and glucose levels(134,154).
43 Despite the links between circadian clocks and control of lipid and glucose metabolism, the mechanisms that integrate the clock and metabolism are not clear.
1.7 Role of adipose tissue in insulin sensitivity
The adipose tissue circadian clock regulates lipid storage and mobilization(153,155). One main role mature adipocytes serve within white adipose tissue is to store or mobilize energy in the form of triglycerides(156). To achieve this, adipocytes respond to periods of feeding and fasting(157). Fasting triggers adipocyte lipolysis, or the breaking down of triglycerides into free fatty acids and glycerol(155).
Feeding and concomitant insulin stimulation trigger lipogenesis which generates fatty acids that will be made into triglycerides for storage(155).
Adipose tissue has been shown to be influential in regulation of systemic metabolic homeostasis and insulin sensitivity(158). This is due to the fact that the adipocyte is an endocrine organ that can respond to nutrient availability and in turn secrete adipokines, which serve to communicate between adipocytes and other organs to preserve metabolic homeostasis(159). The secretion of adipokine hormones leptin and adiponectin into serum are circadian in humans and mice(155). These hormones regulate energy balance, appetite, and the processes of lipogenesis and lipolysis(160). Furthermore, it has been reported that adipose tissue secretes the adipokine RBP(161). As previously
44 mentioned, RBP plays a role in regulating insulin sensitivity(104,162). It remains poorly understood how circadian factors in adipose ultimately control diurnal insulin sensitivity or the regulation of diurnal glucose and lipid homeostasis.
45 CHAPTER 2
THE ROLE OF THE RETINOL-BINDING PROTEIN RECEPTOR STRA6
IN REGULATION OF DIURNAL INSULIN RESPONSES
2.1 Introduction
Obesity and type II diabetes have become a global epidemic, affecting one-third of adults in the United States alone and the numbers are on the rise(4-6). Type II diabetes is characterized by progressive insulin resistance, hyperinsulinemia, and beta cell dysfunction(112). Insulin resistance is a major driver of type II diabetes as it results in diminished insulin-stimulated signaling cascades that regulate many metabolic processes, including the transport of glucose into skeletal muscle and adipose tissue, and proper suppression of hepatic gluconeogenesis in the liverl(113). Therefore, understanding the factors regulating insulin signaling under physiological and pathological circumstances is essential for discovering new treatments for type II diabetics.
It is well appreciated that misalignment of circadian rhythms contribute to insulin resistance and type II diabetes(163,164). In mammals, the circadian clocks in the hypothalamic suprachiasmatic nucleus (SCN) and peripheral tissues coordinate insulin responsiveness and energy metabolism, and synchronize them with the external environment(165). Near 24-hour rhythms of metabolic gene expression
46 are regulated by a set of transcriptional-translational feedback loops(118).
At the core of this mechanism are the heterodimeric transcription factors
CLOCK and BMAL1, which act as the positive arm of the loop and activate the transcription of period (Per) and crytpochrome (Cry) via E-box elements in their promoters(133). Then, acting as the negative arm of the loop, the repressive PER/CRY complex translocates to the nucleus to inhibit CLOCK/BMAL1 transcriptional activity(133). This results in the repression of Per and Cry genes, thereby lifting repression of
CLOCK/BMAL1 and the loop begins again(118). Additional nuclear transcription factors such as Rev-erbα act to fine-tune the core clock and can also modulate the expression of metabolic genes(135,166).
It is well established that insulin sensitivity follows a diurnal pattern(2,3). Humans are more insulin sensitive during the morning versus the evening(3). This phenomenon can partially explain why plasma glucose levels are maintained at a narrow range during distinct daily metabolic phases. During daytime feeding, tissues are more insulin sensitive and serum glucose is more efficiently cleared and utilized(167).
Alternatively, during the nighttime fast, tissues are relatively insulin resistant which assists with glucose level maintenance(3,114). Mice however, are nocturnal mammals, and it is known that their hormonal rhythms, behavior, and insulin sensitivity are opposite relative to the light/dark cycle compared to humans(1,115). It has been shown in humans that circadian disruption due to sleep disorders, shift work, or jet
47 lag can promote obesity and insulin resistance, and even increases the risk of breast and colon cancer(114,146,168-170). Global and adipose- specific clock gene mutants display dysregulated glucose metabolism(151-153). However, it remains poorly understood what circadian factors ultimately control diurnal insulin sensitivity
It has been reported that obesity and insulin resistance increases serum levels of retinol-binding protein 4 (RBP4)(104). RBP4 is the serum carrier for vitamin A (retinol, ROH), but RBP4 has been shown to promote insulin resistance(104,162). The liver is the main site of production and secretion of RBP4(79). The retinol-RBP4 complex (holo-RBP) can be recognized by a cell surface receptor known as Stimulated by Retinoic
Acid 6 (STRA6)(77). STRA6 is expressed in white adipose tissue (WAT) and skeletal muscle, yet is not expressed in the liver(77,85,90). Upon binding of extra-cellular holo-RBP, STRA6 transports ROH from holo-RBP across the plasma membrane, and also triggers a JAK2/STAT3 or 5 signaling cascade depending on cell type(98,100). It has been reported that plasma RBP4 levels are elevated in obese mice and humans(104,106). Furthermore, RBP4 has been shown to promote insulin resistance in mice(104). The discovery that STRA6 activates JAK/STAT signaling provides a rationale for how RBP can promote insulin resistance.
Specifically, it was shown that STRA6 expression was essential for RBP- induced STAT target gene expression in WAT and skeletal muscle(98).
STRA6-driven activation of JAK/STAT signaling activates transcription of
48 the gene encoding suppressor of cytokine signaling 3 (SOCS3), a potent inhibitor of insulin receptor responses(9,98,171) Utilizing STRA6-null mice, it was demonstrated that STRA6 is required for RBP-induced insulin resistance(9).
Considering that RBP4 activation of STRA6 regulates insulin receptor responses in WAT, we hypothesized that STRA6 in white adipose may regulate diurnal insulin responses under normal physiological conditions. Here we directly tested whether STRA6 may display circadian patterns of expression and signaling in WAT, and determined whether STRA6 is necessary for diurnal variations of insulin responses in WAT.
2.2 Materials and Methods
2.2.1 Mouse experiments – Global STRA6-null mice were a gift from
Norbert B. Ghyselink of the University of Strasbourg, Illkirch, France(92).
The STRA6-null mouse expresses a truncated STRA6 protein, composed of the first 88 amino acid residues and is not functional as it lacks 10 of the
11 transmembrane domains(9). Mice were maintained 12-hour light & 12- hour dark cycle. Male and female mice 12-16 weeks of age were used for serum and tissue collection experiments for mRNA. Serum was collected by intracardiac puncture, and WAT was collected, flash-frozen, and stored at -80°C until the time of analysis. Mice were housed and experiments performed in compliance with an IACUC protocol approved by the Case
49 Western Reserve University and the Lerner College of Medicine,
Cleveland Clinic.
2.2.2 Analysis of mRNA and of gene expression – RNA was isolated from
WAT with Trizol (Qiagen). cDNA was synthesized with High Capacity cDNA kit (Applied Biosystems). Quantitative real time PCR was performed using Taqman Gene Expression Assay Probes for STRA6
(Mm00486457_m1), SOCS3 (Mm01249143), CRBP1(Mm00441119_m1),
LRAT(Mm00469972_m1), Rev-erbα (Hs00253876_m1,
Mm00520708_m1) and β-actin (Mm00607939_s1). RBP4 Fwd: 5'GCA
GGA GGA GCT GTG CCT AGA'3 Rev: 5'GGA GGG CCT GCT TTG ACA
GT'3, Adiponectin Fwd: 5'CCC AAG GGA ACT TGT GCA GGT TGG
ATG'3 Rev: 5'GTT GGT ATC ATG GTA GAG AAG AAA GCC'3, PNPLA3
Fwd: 5'ATT CCC CTC TTC TCT GGC CTA'3 Rev: 5'ATG TCA TGC TCA
CCG TAG AAA GG'3, Leptin Fwd: 5'CAA GCA GTG CCT ATC CAG A'3
Rev: 5'AAG CCC AGG AAT GAA GTC CA'3, PDK4 Fwd: 5'GGT ACG
CCT GAA ACT CAG TCA'3 Rev: 5'GGT CAG GGA GCA CAC CTT A'3,
Insig1 Fwd: 5'CAG CGT TAT GCG CTG TAT TG'3 Rev: 5'CCA AAG AGA
GGG CTG CTA AA'3, IRS2 Fwd: 5'TCC AGG CAC TGG AGC TTT'3 Rev:
5'GGC TGG TAG CGC TTC ACT'3, SREBP-1c Fwd: 5'TCT CAC TCC
CTC TGA TGC TAC'3 Rev: 5' GCA ACC ACT GGG TCC AAT TA'3,
ACACA Fwd: 5'CCT GAG GAA CAG CAT CTC TAA C'3 Rev: 5'GCC GAG
TCA CCT TAA GTA CAT ATT'3, FASN Fwd: 5'GTC ACC ACA GCC TGG
50 ACC GC'3 Rev: 5' CTC GCC ATA GGT GCC GCC TG3'3, DGAT2 Fwd:
5'TTC CTG GCA TAA GGC CCT ATT'3 Rev: 5'AGT CTA TGG TGT CTC
GGT TGA C'3 Gene expression was analyzed via the delta delta Ct method(172).
2.2.3 Immunoblotting - Protein from WAT was extracted from homogenized tissue samples with Cell Lysis Buffer (#9808, Cell Signaling) supplemented with Halt Protease & Phosphatase Inhibitors (Pierce). Total protein per sample was determined by Bradford assay (Bio-rad). 20-60µg protein was separated on 8-12% Tris-glycine acrylamide gels and transferred to nitrocellulose membranes. Antibodies against CRBP1
(ab154881, Abcam), LRAT (ab116784, Abcam), IR (#3025S, Cell
Signaling), pIR (#3204S, Cell Signaling), Rev-erbα (13418S, Cell
Signaling), JAK2 (3230S, Cell Signaling), and pJAK2 (3776S, Cell
Signaling), were used at the dilution proposed by the manufacturer. An internal standard was used in order to compare individual blots when quantified. Western blots were analyzed with ImageJ (NIH) for quantification by densitometry.
2.2.4 Analysis of serum metabolites – Serum RBP4 was measured using a mouse RBP4 ELISA (R&D). TTR was measured using a mouse
Prealbumin ELISA (Innovative Research, Inc.) Serum insulin levels were determined by ELISA (Millipore).
51 2.2.5 Chromatin immunoprecipitation – ChIP assays were performed in human 293T cells (ATCC) or NIH3T3-L1 (ATCC) mouse pre-adipocytes treated for 2 hours with a differentiation media (containing DMEM + 10% fetal bovine serum, 10ug/ml insulin & 0.25mmol/L dexamethasone). CHIP was performed using SimpleChIP® Enzymatic Chromatin IP Kits (Cell
Signaling) with antibodies for REV-ERBα (13418S, Cell Signaling) and
IGG (sc-2025, Santa Cruz). PCR primers (Table a2.1) were designed for individual ROREs predicted by bioinformatics analysis (Alibaba2.1, Niels
Grabe, www.gene-regulation.com). Immunoprecipitations were performed in triplicate.
2.2.6 Recombinant holo-RBP injection – Following the procedure described in(173). At 16-weeks old male mice were injected with 1mg of recombinant holo-RBP4 at ZT0 and ZT12. 2-hours post injection blood and WAT were collected, flash frozen, and stored at -80°C until the time of analysis.
2.2.7 Insulin injection – After 14-hour fast, 12-16 week old male (n=6) mice were anesthetized and infused with 0.75 units/kg insulin (Sigma) into the inferior vena cava. Tissues were collected before and after insulin injection.
52 2.2.8 Insulin tolerance testing – After 4-hour fast, 12-16 week old male WT or STRA6-null were injected with IP injection of 0.75 units/kg insulin
(Humalin R, Lilly) (n=4-5). Whole blood glucose was determined sequentially by sampling blood at 0, 30, 60, 90 and 120 minutes using a portable glucometer (Accu-Chek Performa II). ITT tests were performed at
ZT2 and ZT14. Fasting glucose levels were determined from the sample at time 0.
2.2.9 Indirect calorimetry – WT and STRA6-null male mice 12 weeks of age were housed in individual metabolic chambers on a 12-hour light and
12-hour dark cycle. Oxygen consumption and locomotor activity were measured by the Comprehensive Lab Animal Monitoring System (CLAMS)
(Columbus Instruments).
2.2.10 Statistical analysis – Data are expressed as mean +/- standard error of the mean (SEM). Statistical analyses were performed using 2-tail
Student’s t-test. Area under the curve was calculated for the ITT tests using Prism6, GraphPad. Differences were considered significant at p<0.05.
53 2.3 Results
2.3.1 Key players in vitamin A metabolism and signaling display circadian rhythmicity in white adipose tissue
To investigate whether the holo-RBP/STRA6 signaling cascade is under circadian control in white adipose tissue, we collected tissue from ad libitum fed mice every 4 hours over a 24-hour period. STRA6 mRNA expression displays circadian rhythmicity with a significant peak observed at ZT22-2 and a nadir observed at ZT14 with a 4-fold increase in expression compared to ZT2 (Fig. 2.1A). Increased STRA6 expression at
ZT2 corresponds to the light/inactive phase when mice are known to be relatively insulin resistant compared to the dark/active phase.
Measurement of STRA6 protein expression is not currently feasible due to the lack of specific antibodies.
54
Figure 2.1. STRA6, CRBP1 and LRAT display circadian patterns of expression in WAT
A-C) STRA6, CRBP1, and LRAT mRNA expression from epididymal WAT collected every 4 hours over a 24-hour period determined by quantitative real time PCR. Data shown is double plotted data. Zeitgeber time (ZT) 0 refers to the hour mice are first exposed to light. D) Western blot analysis for CRBP1 and LRAT protein expression from epididymal WAT at indicated ZTs. E and F) Quantification of Western blot analysis for CRBP1 and LRAT protein expression normalized by beta actin loading control.
Data shown is double plotted data. Data represented as mean ± SEM. * indicates significance at least p < 0.05.
55 Both ROH uptake and cell signaling by STRA6 are critically linked to intracellular transport and metabolism of vitamin A. It has been demonstrated that both cellular retinol binding protein 1 (CRBP1) and lecithin retinol acyltransferase (LRAT) are required for STRA6-dependent vitamin A uptake and signaling(99,102,103). CRBP1 is a cytosolic ROH carrier protein that binds an intracellular portion of STRA6 and directly accepts ROH transferred from extracellular RBP through STRA6(99).
CRBP1 delivers ROH to the enzyme LRAT that catalyzes the conversion of ROH to retinyl esters for storage(12,174). By storing ROH, LRAT creates an inward gradient of ROH across the cell. This allows for the regeneration of apo-CRBP1, which can re-bind to STRA6 and allow for continuing influx of ROH and STRA6 signaling(99). We hypothesized that
CRBP1 and LRAT may also display circadian patterns of expression to further support STRA6 signaling. In WAT, CRBP1 mRNA expression has
2 significant peaks at ZT10 and 22, showing a 6-fold increase at ZT22 compared to ZT2 (Fig. 2.1B). CRBP1 protein expression is increased at
ZT2 following the largest mRNA peak for CRBP1 at ZT22 (Fig. 2.1D and
2.1E). Expression of the retinol-esterifying enzyme LRAT also shows circadian patterns of expression with a peak in both mRNA and protein at
ZT2 compared to ZT14 (Fig. 2.1C and 2.1F). The expression of CRBP1 and LRAT protein are synchronized with the peak in STRA6 mRNA at ZT2 expression during the light/inactive phase.
56 2.3.2 Serum RBP4 and TTR Levels Display Circadian Rhythmicity
Since we observed circadian expression of STRA6 in WAT we investigated whether the ligand for STRA6 also displayed circadian patterns in serum. In WT mice, serum RBP4 maintains constant levels across the day except for a significant drop at ZT10 (Fig. 2.2A). STRA6- null mice also show a decrease at ZT10, approaching significance at p=0.07 (Fig. 2.2A).
In serum, holo-RBP is found in complex with transthyretin (TTR) in a 1:1 molar ratio(68-70). It is thought that the function of holo-RBP binding to TTR is to prevent glomeruli filtration of the small RBP molecule by the kidney(64). RBP4 can only bind and exert its effects on insulin resistance through STRA6 when it is unbound or exceeds its serum carrier TTR(72).
Therefore, we also investigated the level of circulating TTR. Serum TTR levels display a circadian pattern of expression with a peak at ZT2 and a significant nadir at ZT10 (Fig. 2.2B). The circadian pattern of TTR is similar to the serum pattern for RBP4.
57
Figure 2.2. Serum RBP4 and TTR levels display circadian rhythmicity
A) Serum RBP4 levels over a 24-hour period in WT and STRA6-null mice.
* indicates significant difference of at least p < 0.05 between WT at ZT10 and 14. B) Serum TTR levels over a 24-hour period in WT and STRA6-null mice. * indicates significant difference in WT between ZT2 and 10. ** indicates significant difference in KO between ZT2 and 10. C) Liver RBP4 mRNA expression over a 24-hour period in WT and STRA6-null mice. D)
WAT RBP4 mRNA expression over a 24-hour period in WT and STRA6- null mice. Data shown is double-plotted data.
Hepatocytes are the principal source of RBP4 in the circulation(175). Since we observed serum RBP levels fluctuated in the serum we examined the circadian pattern of RBP4 mRNA in the liver. WT mice show a slight, yet not significant peak at ZT14 (Fig. 2.2C). Liver
58 RBP4 mRNA in STRA6-null mice trends lower than WT, with a pattern showing a slight, yet not significant peak at ZT18. In WAT RBP4 mRNA expression does not display a circadian pattern in WT or STRA6-null mice
(Fig. 2.2D).
3.2.3 The circadian transcription factor Rev-erbα binds the promoters of
STRA6, CRBP1, and LRAT
Since we observed circadian patterns of expression for STRA6, CRBP1, and LRAT in WAT we investigated whether these genes were under transcriptional control by circadian clock proteins. Circadian patterns of gene expression are dependent on transcriptional regulation by several core clock proteins including the nuclear transcription factor Rev- erbα(134,135). Rev-erbα regulates the expression of the core circadian clock transcriptional machinery, but it also has been shown to directly regulate metabolic genes(135). Rev-erbα is an orphan nuclear receptor and it lacks the c-terminal activation domain but binds the nuclear receptor co-repressor (N-CoR) and therefore functions as a transcriptional repressor(176). Rev-erbα binds the response element termed the RAR- related orphan receptor alpha response element (RORE) (134). ROREs are defined as nuclear receptor half-site motifs flanked 5’ by an A/T rich sequence (A/TPuGGTCA)(134). Bioinformatics analyses (AliBaba2.1) revealed the presence of putative ROREs in the promoters of mouse and human STRA6, CRBP1, and LRAT (Table 2.1).
59
Table 2.1. Putative RORE for STRA6, CRBP1, and LRAT Table 1. Putative RORE determined by Alibaba2 promoter analysis
Gene Species Location Putative Sequence STRA6 NM_001199040.1 Human -1651 CT/AGGTCA STRA6 NM_001199040.1 Human -3214 AA/AGGTCA STRA6 NM_001199040.1 Human -3746 ATTTG/TGGTCA STRA6 NM_009291.2 Mouse +241 AG/AGGTCA STRA6 NM_009291.2 Mouse -176 TAAC/AGGTCA STRA6 NM_009291.2 Mouse -339 GC/AGGTCA STRA6 NM_009291.2 Mouse -1543 AG/AGGTCT STRA6 NM_009291.2 Mouse -2244 AA/GGGTCA STRA6 NM_009291.2 Mouse -2688 AA/AGGTGA STRA6 NM_009291.2 Mouse -3708 AG/AGGTCA STRA6 NM_009291.2 Mouse -4040 AA/AGGGCA CRBP1 NC_000003.12 Human +241 ATGT/TGGTCA CRBP1 NC_000003.12 Human -64 AA/GGGTCA CRBP1 NC_000003.12 Human -480 TG/AGGTCA CRBP1 NC_000003.12 Human -854 ATT/AGGTGA CRBP1 NC_000075.6 Mouse -1162 AGT/AGGTCA/AA/AGGTCA CRBP1 NC_000075.6 Mouse -2142 AG/TGGTCA CRBP1 NC_000075.6 Mouse -2513 T/GGGTTCA CRBP1 NC_000075.6 Mouse -3519 CA/AGGTCAACC LRAT NC_000004.11 Human -609 AA/AGGTCC LRAT NC_000004.11 Human -728 TTCGGCT LRAT NC_000004.11 Human -914 AGGTTC LRAT NM_023624.4 Mouse -174 GGGTCA LRAT NM_023624.4 Mouse -405 TTAA/AGGTCT LRAT NM_023624.4 Mouse -1725 AA/AGGTCA LRAT NM_023624.4 Mouse -3218 TGC/TGGTCA LRAT NM_023624.4 Mouse -4060 TC/AGGTCA
Table 2.1. Putative RORE located on mouse and human STRA6,
CRBP1, and LRAT
Promoter analysis was performed using Alibaba2.1. Location of the putative RORE are denoted as distance from the start site of the gene base pair distal to the A of the ATG defined as -1.
Similar to published literature(157), Rev-erbα protein expression in
WAT displays significant expression at ZT10 and 14 (Fig. 2.3A). Likewise,
WAT Rev-erbα mRNA expression is circadian with a significant peak flanking ZT10 (Fig. 2.3B). In the liver, Rev-erbα expression peaks at ZT6 and is low throughout the dark cycle (Fig. 2.3C). Importantly, the circadian
60 nature of Rev-erbα is not altered in mice lacking STRA6 (Fig. 2.3B and
2.3C). Examination of Rev-erbα mRNA expression in WAT compared to the STRA6, CRBP1, and LRAT mRNA expression revealed that the expression Rev-erbα is inverse to the expression of these genes (Fig.
2.3D-2.3F).
Figure 2.3. STRA6, CRBP1, and LRAT expression is inverse to Rev- erbα in WAT
A) Western blot analysis for Rev-erbα protein expression from epididymal
WAT at indicated ZTs. B and C) Rev-erbα mRNA expression from epididymal WAT and liver from WT or STRA6-null mice collected every 4 hours over a 24-hour period determined by quantitative real time PCR. D-
E) mRNA expression of Rev-erbα superimposed on the mRNA expression pattern of STRA6, CRBP1, and LRAT from epididymal WAT collected
61 every 4 hours over a 24-hour period determined by quantitative real time
PCR. Data shown is double plotted data.
To determine whether Rev-erbα directly binds the promoters of
STRA6, CRBP1, and LRAT chromatin immunoprecipitation (ChIP) assays were carried out using the murine pre-adipocyte cell line NIH3T3 L1. Prior to the assay the cells were treated with adipocyte differentiation media
(DMEM + 10% fetal bovine serum, 10ug/ml insulin and 0.25mmol/L dexamethasone) for 2 hours that served to increase the endogenous expression of Rev-erbα (Fig. 2.4A). We found that endogenous Rev-erbα binds to ROREs identified on STRA6, CRBP1, and LRAT (Fig. 2.4B and
2.4C). Rev-erbα did not bind to a region -890 base pairs upstream from the start site on the STRA6 promoter that does not contain an RORE (Fig.
2.4B and 2.4C). In agreement, we observed that Rev-erbα also binds to
ROREs identified on human DNA, assessed by ChIP assays in the human
293T cell line overexpressing human Rev-erbα (Fig. 2.4D and 2.4E).
62 Figure 2.4. Rev-erbα binds to the promoters of STRA6, CRBP1, and
LRAT
A) Western blot analysis for Rev-erbα protein expression in NIH 3T3-L1 pre-adipocytes with or without treatment with differentiation media for 2 hours. B) ChIP assays determined by semi-quantitative PCR in NIH-3T3
L1 cells treated with differentiation media for 2 hours to analyze the Rev- erbα recruitment to ROREs at sites denoted as distance from start site on the genes indicated. C) Quantification of ChIP that were performed in triplicate. Data are represented as mean ± SEM * indicates significance at least p < 0.05 D) Western blot analysis for Rev-erbα protein expression in
293T cells with or without overexpression of human Rev-erbα. E) ChIP assays determined by semi-quantitative PCR in 293T cells overexpressing
63 Rev-erbα to analyze the Rev-erbα recruitment to ROREs at sites denoted as distance from start site on the genes indicated.
2.3.4 STRA6 regulates diurnal insulin responses in mice
To determine whether STRA6 regulates whole body diurnal patterns in insulin responsiveness, we performed insulin tolerance tests (ITT)
(0.75U/kg) in WT and STRA6-null male mice at ZT2 and ZT14 (Fig. 2.5A-
2.5C). Serum glucose levels after a 4-hour fast did not vary between genotypes at ZT2 or 14 (Fig. 2.5C). ITT tests show that WT mice display diurnal insulin sensitivity with increased insulin sensitivity at ZT14 (Fig.
2.5A and 2.5B). These data agree with previously published reports that mice are more insulin responsive during the dark phase when compared to the light phase(177). In contrast, STRA6-null mice no longer display diurnal patterns in insulin sensitivity and remain insulin sensitive both ZT2 and ZT14 (Fig. 2.5A).
STRA6 signaling suppresses insulin receptor phosphorylation and promotes insulin resistance in mice(9). To determine whether the circadian expression of STRA6 regulates diurnal insulin receptor phosphorylation, male mice were fasted for 14 hours and tissue was collected before and after a 5-minute bolus injection of insulin. WAT was collected and Western blot was performed to determine the ratio of phosphorylated insulin receptor compared to the total insulin receptor
(pIR/IR). At ZT2, insulin treatment increases pIR/IR in WT and STRA6-null
64 mice above basal pIR levels, which are nearly undetectable (Fig. 2.5D). In response to insulin at ZT2, STRA6-null mice have increased pIR/IR compared to WT mice (Fig. 2.5D and 2.5G). In contrast, at ZT14 both WT and STRA6-null mice have similar responses to insulin (Fig. 2.5E and
2.5H), corresponding to when STRA6 expression is low in WAT (Fig.
2.1A). pIR/IR in WT mice compared between ZT2 and 14 showed a trend
(p=0.01) toward significance whether blotted using an internal standard for all blots (Fig. 2.5G and 2.5H) or when all insulin stimulated samples were compared (Fig. 2.5F and 2.5I)
Figure 2.5. STRA6 regulates diurnal insulin responses in WAT
A) ITT (0.75U/kg) in WT and STRA6-null male mice performed at ZT2 and
14. Data are represented as mean ± SEM. * denotes p<0.02 comparing
WT between timepoints ZT2 and 14. # denotes p<0.05 comparing WT vs.
65 KO at same timepoint. B) Area above the curve calculated from baseline from the ITT. C) Serum glucose levels in male mice after a 4-hour fast at
ZT2 and 14 in WT and STRA6-null mice. D and E) Western blot analysis for pIR and IR from epididymal WAT collected from male mice before and after 5 min injection of insulin (1ug/g) in WT and STRA6-null mice performed at ZT2 or 14. F) Western blot analysis for pIR and IR from epididymal WAT from samples after 5 min injection of insulin (1ug/g) in
WT and STRA6-null mice performed at ZT2 or 14. G and H) Quantification of Western blots D and E from n=6 mice per group. Each blot contained an internal standard in order to comparison among blots. I) Quantification of Western blot in panel F.
2.3.5 STRA6-null mice have altered diurnal carbohydrate metabolism
Since we observed STRA6 regulated diurnal insulin receptor responses, we evaluated whether serum insulin levels were altered in WT and
STRA6-null mice. Serum insulin levels from ad libitum chow fed mice were not different at ZT2 or 14 in WT or STRA6-null mice (Fig. 2.6A). To investigate the phenotype of STRA6-null mice on chow we performed indirect calorimetry using the CLAMS metabolic cage system. We found the respiratory exchange ratio (RER) was significantly lower for STRA6- null mice during the dark/active phase compared to WT mice (Fig. 2.6A).
A lower RER indicates that STRA6-null mice are using more fat than
66 carbohydrate for fuel compared to WT mice. This effect was not due to differences in activity (Fig. 2.6C).
2.3.6 STRA6 expression opposes gene expression of targets regulated by insulin signaling
Our data suggests that STRA6-null mice are insulin sensitive during the light/rest phase when WT mice show relative insulin resistance. We investigated how STRA6 expression altered genes known to be regulated by insulin. To examine this we performed a fasted/re-feeding study using
WT and STRA6-null mice. Mice were fasted overnight for 12 hours from
ZT12 to ZT0. At ZT0, the tissues from fasted mice were collected. For the refeeding group, standard chow was given from ZT0 for 6 hours and tissues were collected at ZT6. Body weight did not differ between the WT and the KO in this study (Fig. 2.6D). In order to observe the effects of
STRA6 on insulin responsive genes we studied gene expression induced by insulin action during the light phase when STRA6 is expressed. We observed that fasting lowered glucose levels and upon refeeding, glucose levels rose similarly in WT and STRA6-null mice (Fig. 2.6E). Insulin responsive genes in WAT such as adiponectin(178) and PNPLA3(179) increased in WT mice upon refeeding (Fig. 2.6F and 2.6G). STRA6 KO mice showed no significant difference in adiponectin and PNPLA3 expression compared to WT mice in the fasted state (Fig. 2.6F and 2.6G).
However, upon refeeding STRA6-null mice had a significant increase in
67 these insulin regulated genes compared to WT (Fig. 2.6F and 2.6G).
Leptin mRNA levels were higher in STRA6-null mice (Fig. 2.6H). Pyruvate dehydrogenase kinase 4 (PDK4), a major regulator of glycolysis, was significantly decreased compared to WT in both the fasted and refed condition (Fig. 2.6I). Insulin induced gene 1 (Insig1) increased in STRA6- null mice upon refeeding compared to WT (Fig. 2.6J). IRS2 is repressed by insulin, and was significantly lower in STRA6-null mice (Fig. 2.6K)(180).
Another insulin regulated gene, sterol regulatory element-binding protein 1
(SREBP-1c) is increased in STRA6-null mice compared to WT mice during fasting and refeeding (Fig. 2.6L). SREBP-1c drives the expression of lipogenic genes in WAT(160). We observe that STRA6-null mice have significantly increased levels of the lipogenic genes acetyl-CoA carboxylase alpha (ACACA), fatty acid synthase (FASN), and diacylglycerol O-acyltransferase 2 (DGAT2) in both the fasted and refed states compared to WT mice (Fig. 2.6M-O). There were no changes between WT and STRA6-null mice in the fasted or refed states for the leptin receptor, patatin like phospholipase domain containing 2 (PNPLA2), abhydrolase domain-containing protein 5 (ABHD5), GLUT4, Acyl-CoA
Oxidase 1 (AOX), and carnitine palmitoyltransferase 1B (CPT1B) (data not shown).
68
Figure 2.6. STRA6 regulates genes controlled by insulin action
A) Serum insulin levels from ad libitum chow fed WT and STRA6-null mice at ZT2 and 14. B) Respiratory exchange ratio for male mice measured each hour over a 24-hour period. * denotes p<0.05 between WT and
STRA6-null at the same timepoint C) Horizontal x-axis movements for male mice measured each hour over a 24-hour period. D) Body weight for male mice in the fasted/refed study. E) Glucose levels in WT and STRA6- null mice after a 12-hour fast or the 6-hour refeeding period. * denotes p<0.05. F-O) mRNA expression for the indicated genes in WT and
69 STRA6-null mice after a 12-hour fast or after the 6-hour refeeding period. * denotes p<0.05.
2.3.7 The activation of STRA6 by holo-RBP is diurnal
Upon the binding of extracellular holo-RBP, STRA6 propagates a
JAK2/STAT5 signaling cascade(9,102,181). We wanted to directly test whether RBP activates the STRA6 receptor in a diurnal fashion. Male mice were injected with recombinant holo-RBP for 2 hours at either ZT0
(light/inactive phase) or ZT12 (dark/active phase). Tissues were then collected at the timepoints ZT2 and ZT14. We performed Western blots to determine the ratio of phosphorylated JAK2 to total JAK2 expression
(pJAK2/JAK2) in WAT at ZT2 and ZT14 (Fig. 2.7A-2.7D). At ZT2, basal pJAK2/JAK2 in WAT is low (Fig. 2.7A). However, following holo-RBP treatment pJAK2/JAK2 levels are increased on average 18-fold (Fig. 2.7A and 2.7C). At ZT14 there are no differences in pJAK2/JAK2 before and after RBP injection (Fig. 2.7B and 2.7D). These data indicate that the activation of STRA6-driven JAK2 signaling by holo-RBP is occurring at
ZT2, when STRA6 mRNA expression is highest. In contrast, holo-RBP fails to stimulate JAK2 activation when STRA6 expression is lowest at
ZT14 (Fig. 2.7B and 2.7D).
70 Figure 2.7. Effectors downstream of STRA6 signaling show diurnal variations
A and B) Western blot analysis for the ratio of pJAK/JAK protein levels from epididymal WAT collected from male mice injected with vehicle or recombinant RBP (1mg) mice after 2 hours (n=4). Tissue collection was performed at ZT2 and 14. C and D) Quantification of Western blots for pJAK/JAK at ZT2 and 14. E) mRNA expression of PDK4 from epididymal
WAT from WT or STRA6-null mice collected every 4 hours over a 24-hour period determined by quantitative real time PCR * denotes p<0.05 comparing WT and KO at the same timepoint. F) mRNA expression of
SOCS3 from epididymal WAT from WT or STRA6-null mice collected
71 every 4 hours over a 24-hour period determined by quantitative real time
PCR. * denotes p<0.02 comparing WT between timepoints ZT2 and 14. # denotes p<0.05 comparing WT vs. KO at same timepoint. G) Serum levels of RBP and SOCS3 mRNA levels from WAT from WT mice interleaved on the same graph.
2.3.8 STRA6 expression regulates circadian expression of transcriptional targets of STAT5
STRA6 has been shown to specifically activate STAT5 in adipocytes(181).
PDK4 is transcriptionally induced by STAT5 in mature adipocytes and is a regulator of glycolysis(182). We measured PDK4 expression in WAT collected over a 24-hour period. WT mice display a circadian pattern of
PDK4 expression with a peak at ZT10-14 and a valley at ZT22-6 (Fig.
2.7E). STRA6-null mice show a nearly opposite pattern of expression than
WT, with a peak at ZT2 and significantly decreased levels compared to
WT mice at ZT10 and 18 (Fig. 2.7E).
In WAT, STRA6 signaling upregulates the STAT target gene
SOCS3, a potent inhibitor of insulin receptor phosphorylation and responses(98,171). We hypothesized that since STRA6 expression and activation is circadian, that the expression of SOCS3 in WAT would reflect
STRA6 activity at the times when it is most highly expressed. In WT mice,
SOCS3 mRNA expression is increased at both ZT10 and 22 (Fig. 2.7H).
The peak of SOCS3 at ZT22 corresponds to the expression pattern of
72 STRA6 and is 4-fold higher at ZT22 vs. ZT2 (Fig. 2.7H). In contrast to this, this rhythmic expression of SOCS3 is completely abolished in STRA6-null mice (Fig. 2.7H). Interestingly, when serum RBP levels and SOCS3 mRNA levels from WT mice are compared, it is revealed that induction of
SOCS3 beginning at ZT6 is congruent with the decrease in serum RBP beginning at ZT6 (Fig. 2.7G).
2.4 Discussion
It is well established that insulin sensitivity follows a diurnal pattern, which is crucial for maintaining blood glucose at steady state concentrations to meet the needs of tissues before and after meals, or during the overnight fast(114,167,183). This study identifies the holo-RBP receptor STRA6 as a direct regulator of diurnal insulin sensitivity and a major regulator of genes important for insulin action and insulin sensitivity. STRA6 is not expressed in the liver, and therefore is regulating whole-body insulin sensitivity through extra-hepatic tissues(77,85,90). We show that STRA6 expression is circadian in WAT, peaking just prior to and during the light/rest phase when mice are known to be relatively insulin resistant(177). Interestingly, proteins that are critical for STRA6 activity,
CRBP1 and LRAT, also display circadian expression in WAT with increases during the light/rest phase, similar to STRA6 (Fig. 2.1). The circadian expression of these genes along with STRA6 may serve to support signaling, although this will require further investigation.
73 Therefore, with STRA6, CRBP1, and LRAT and present early in the light phase, conditions are primed at this time of day for STRA6 activity.
Plasma holo-RBP4 is the ligand for STRA6, and we found serum
RBP4 levels were maintained across the day except for a decrease at
ZT10 (Fig. 2.2A). Levels of RBP4 did not exceed TTR at any time across the day, indicating that the liver is secreting RBP4 and TTR in tandem. In addition, this data suggests that there is not a specific time of day when the levels of RBP exceed TTR, possibly in that circumstance triggering increased STRA6 activity. In fact, the levels of RBP4 are the same at ZT2 and 14 when we have performed insulin tolerance tests and observe the effects of STRA6 expression on diurnal insulin tolerance. This indicates that effects on insulin sensitivity at these times is not due to changes in
RBP, but due to the circadian expression of STRA6.
RBP4 mRNA expression patterns in the liver and WAT do not correlate with the decrease in serum RBP4 at ZT10 (Fig. 2.2C and 2.2D).
It is not known how the liver senses vitamin A status and regulates the secretion of RBP(12). RBP secretion is thought to be tightly controlled - in fact we have observed that even a 12-hour fast does not change RBP levels in the serum (data not shown). Immediately following ZT6, SOCS3 mRNA levels rise in WAT at the same time serum RBP4 levels begin to drop (Fig. 2.7H). At ZT6 the liver is not decreasing RBP synthesis, therefore it is possible a factor is enhancing RBP4 excretion. apo-RBP4 cannot bind TTR and is rapidly filtered by the kidney(68). We speculate
74 that STRA6 may be relieving RBP of ROH at ZT6, resulting in excretion and a decrease in plasma RBP during ZT6-10. The fact that SOCS3 is induced at the same time (ZT6-10) suggests STRA6 protein present at the plasma membrane following its mRNA peak at ZT2. ZT6-10 is also when we observe the STAT5 target gene PDK4 increase in WT mice, but not in
STRA6-null mice (Fig 2.7E).
STRA6 expression was highest during the light/rest phase when mice are relatively insulin resistant (Fig. 2.1A). Insulin tolerance tests show that STRA6-null mice are more insulin sensitive than WT mice at
ZT2 during the light/rest phase (Fig. 2.5A). In contrast, WT and STRA6- null mice are similarly insulin sensitive during the dark/active phase, ZT14.
Therefore, the data demonstrate that it is primarily during the light/rest phase that expression of STRA6 is affecting insulin responses, corresponding to the pattern of STRA6 expression in WAT. Analogous to the insulin tolerance results, additional experiments show that WAT of
STRA6-null mice insulin receptor phosphorylation levels are increased compared to WT at ZT2 (Fig. 2.5D and 2.G). However, WT and STRA6- null mice show similar IR phosphorylation at ZT14 (Fig. 2.5E and 2.H).
These data demonstrate that STRA6 regulates the phosphorylation of the insulin receptor in a diurnal manner, affecting WT mice predominantly at
ZT2, and not at ZT14 when STRA6 expression is low in WAT. Therefore,
STRA6 plays a role regulating normal physiological diurnal insulin
75 responses in the WAT and it results in whole-body regulation of diurnal insulin sensitivity.
We observed during the light/rest phase, that STRA6-null mice have increased mRNA levels of the insulin inducible genes Insig1 and
SREBP-1c (Fig. 2.6J and 2.L). Gene expression of genes regulating lipogenesis, ACACA, FASN, and DGAT2 were increased in STRA6-null mice compared to controls during the daytime fasted/refeeding study (Fig.
2.6M-O). This data indicates that STRA6-null mice are more insulin sensitive than WT mice, corresponding to the insulin tolerance tests during the light phase.
We discovered that STRA6-null mice have increased adiponectin mRNA compared to WT mice in the fed-state suggesting STRA6 insulin receptor inhibition may be regulating adiponectin levels (Fig. 2.6F).
Adiponectin is an insulin-sensitizing hormone, and stimulates fatty acid oxidation in liver and muscle(184). If STRA6-null mice have increased circulating adiponectin, it provides one potential explanation why STRA6- null mice have a lower RER and are oxidizing more fat during the dark/rest phase compared to WT mice.
Leptin mRNA levels were also increased in STRA6-null mice during the light phase (Fig. 2.6H). Leptin is a hormone secreted mainly by adipocytes, and is a crucial regulator of food intake and energy expenditure(185). STRA6-null mice fed a chow diet appear to have a more complex metabolic phenotype than previously considered. WAT from
76 STRA6-null mice display a completely reorganized expression pattern of genes involved in glucose and lipid metabolism compared to WT mice.
Future work investigating the circadian rhythmicity of circulating hormones and gene expression that regulate glucose tolerance, insulin action, and lipogenesis in a comprehensive study in STRA6-null mice and adipose specific knockdown could elucidate the role of WAT STRA6 in whole-body metabolism.
A key event in the STRA6 signaling cascade is the phosphorylation of JAK2, which resides on the cytoplasmic tail of STRA6(99). Two hours after an injection holo-RBP4, JAK2 phosphorylation in WAT increased 18- fold during ZT2 when STRA6 expression is high, and not at all during
ZT14 when STRA6 expression is low (Fig. 2.7A-D). Accordingly, STRA6 signaling in WAT in response to serum holo-RBP is diurnal and corresponds with light/rest phase, when the effects of STRA6 on insulin sensitivity are observed.
Since STRA6 signals via JAK2/STAT5 we investigated known
STAT5 targets in mature adipocytes. Relatively few STAT5 target genes have been identified in adipocytes to date and most have been studied using growth hormone of prolactin treatment(108). PDK4 is induced by
STAT5 in mature adipocytes, and repressed by insulin signaling(182,186).
Therefore, PDK4 mRNA levels are regulated by a balance of these two opposing mechanisms. WT and STRA6-null mice show a nearly opposite pattern of expression in WAT(Fig. 2.7E). During the day, when WT mice
77 are relatively insulin resistant, the presence of STRA6 STAT signaling increases PDK4 beginning at ZT6 (Fig. 2.7E). When STRA6 is lowest at
ZT14, mice are feeding and insulin levels will rise resulting in a decrease in PDK4 transcription. The effect of insulin action is occurring at ZT14 unopposed by STRA6 at this time. In STRA6-null lack a peak beginning at
ZT6 and as they are insulin sensitive PDK4 remains low during the dark phase, until ZT2 when PDK4 levels peak (Fig. 2.7E).
We also examined a downstream effector of STRA6-mediated
STAT5 signaling, SOCS3. Our data show that WT mice display two peaks of SOCS3 expression across the day in WAT (Fig. 2.7F). However, in
STRA6-null mice SOCS3 induction is completely abrogated (Fig. 2.7F).
While the SOCS3 peak at ZT22 corresponds with STRA6 mRNA expression, it appears the circadian expression of SOCS3 at both times is regulated by STRA6. SOCS3 is a part of the inhibitory mechanisms employed by many cytokine receptors(171,187,188), so it is possible that the second peak is indirect, due to crosstalk with another signaling receptor. One way that SOCS3 inhibits insulin receptor responses is by binding to specific phospho-tyrosine residues on IR and thereby preventing IRS1 or IRS2 phosphorylation and the downstream effects(187). Therefore, one mechanism by which STRA6 may regulate the diurnal insulin receptor phosphorylation is by upregulating SOCS3 during the light/rest phase. Several studies have shown that the leptin receptor upregulates SOCS3 and that SOCS3 also inhibits leptin
78 signaling(189,190). The adipocyte hormone resistin uses a similar mechanism via SOCS3 in adipose tissue to inhibit insulin receptor phosphorylation(191). Collectively, these data support the possibility that
STRA6-driven upregulation of SOCS3 may be central to the regulation of diurnal insulin responses.
The daily rhythms of metabolic functions are governed by circadian clocks in the SCN and in other tissues such as liver, muscle, and adipose(1,157,192). Studies employing the knockout of clock genes such as Rev-erbα show metabolic perturbations(134,193). It remains poorly understood which mediators downstream of clock proteins ultimately control diurnal insulin sensitivity. We found that Rev-erbα expression is inverse to the expression of STRA6, CRBP1, and LRAT in WAT (Fig.
2.3E-F). Multiple canonical RORE were identified on the promoters of
STRA6, CRBP1 and LRAT, and CHIP assays show that endogenous Rev- erbα binds to the promoters of these genes in a pre-adipocyte cell line
(Table 2.1 and Fig. 2.4C). The fact that Rev-erbα regulates the circadian expression of a signaling protein like STRA6 provides one explanation of how circadian rhythms can have broad cellular effects on metabolism.
However, additional studies are needed to determine whether STRA6 is necessary for Rev-erbα to regulate diurnal metabolic reprogramming in mice.
It has recently been reported that in mice RBP4 displays a small increase in plasma at ZT4(194). Our analysis of RBP in the serum
79 revealed a different circadian pattern with a decrease at ZT10 (Fig. 2.2A).
Our data regarding the expression of RBP in the liver and WAT are similar to the analysis in this article(194). The liver mRNA expression pattern does not correspond to either the peak at ZT4 or the decrease we observe at ZT10 indicating RBP secretion into the serum by the liver is regulated by some other mechanism. This work also showed that hepatic knockdown of RBP4 increased insulin sensitivity compared to WT mice at
ZT4, but not at ZT16. While this study shows a role for hepatic RBP4 in diurnal insulin sensitivity there is no implication for how serum RBP4 exerts its effects. Plasma holo-RBP4 protein on its own has no intrinsic function except to carry ROH. Our data shows that STRA6-null mice have increased insulin sensitivity compared to WT mice only at ZT2 when the protein is expressed, and not at ZT14 when expression is low (Fig. 2.5A).
It is likely that RBP4 had no effect on insulin sensitivity during the dark/active phase in the previous study because STRA6 is not abundantly expressed at ZT14.
Our data shows that STRA6 signaling in adipose results in a large effect on whole body insulin sensitivity. Adipocyte JAK/STAT signaling is well known for regulating systemic insulin responses and glucose metabolism(108). While our experiments were carried out using a global
STRA6 knockout, it has been previously shown that even a partial knockdown of STRA6 in the adipocyte results in improved glucose tolerance(109). In addition, multiple groups have shown that the ability of
80 STRA6 to induce insulin resistance in WAT is not due to changes in retinol uptake(9,109). This indicates that the mechanism via which STRA6 mediates its effects on insulin resistance is not due to its ability to transport ROH, but rather via its ability to signal.
The effects of circadian rhythmicity on glucose regulation have important clinical implications to understand the development of and design therapeutics for type II diabetes. Despite much progress in the understanding of insulin action, the molecular basis for the development of human insulin resistance or diurnal insulin responses remain unclear.
Overall, our results identify the STRA6 signaling receptor as a novel regulator of diurnal insulin responses. Our data provide mechanistic insight into how STRA6 controls diurnal insulin sensitivity under normal daily physiological conditions. To date, the development of treatments for insulin resistance have not been not successful. There are reports showing agents that lower circulating RBP4 improve insulin sensitivity in obese mice, but as a whole RBP4 as a therapeutic agent is still unexplored(195,196). The recently solved structure for zebrafish STRA6 may lead to the design of effective small molecular inhibitors in the future(86). Therefore, the RBP4/STRA6 axis may develop into an attractive pathway for early detection of or as a potential therapeutic target for pre-diabetes or type II diabetes.
81 CHAPTER 3
GENERAL DISCUSSION
3.1 Overall summary
Since the identification of STRA6 in 2007, much of its role in physiology remains unknown. It is clear that STRA6 is important to maintain retinoid stores in the eye, and the role for STRA6 regulation of insulin signaling has also been defined(9,92). STRA6 is expressed in skin, kidney, ovaries, and placenta where roles of RBP4 in pathogenesis have been identified(90,197-200). However, it has not been tested whether STRA6 is essential for the effects of RBP in these studies. Recently STRA6 has been identified as oncogene in breast and colon cancer, and it will be critical to elucidate how STRA6 drives cancer initiation and proliferation(100). Still, many questions remain regarding the role of the holo-RBP/STRA6 signaling axis in diurnal metabolism. There are also fundamental aspects of RBP-mediated STRA6 signaling that have yet to be elucidated.
3.2 Future directions
3.2.1 Which genes does STRA6 regulate in WAT?
We show herein that STRA6 regulates a number of genes stimulated by insulin signaling. However, there has not been a comprehensive study of
82 genes that are regulated by STRA6 in WAT. Using RNA-seq we could examine adipose from WT and STRA6-null mice to identify genes and pathways most affected by STRA6 expression. It may be necessary to also administer recombinant holo-RBP in lean or chow-fed mice before tissue collection to obtain significant changes in STRA6-mediated gene expression. Furthermore, the inclusion of a group of STRA6-null mice treated recombinant holo-RBP would allow us to dissect out which genes may be regulated by RBP alone, and which genes are mediated by
RBP/STRA6 signaling. These studies could be expanded to include samples from WAT that were collected from different times of the day such as ZT2 when expression of STRA6 is high, and ZT14 when expression is low to determine the effect of STRA6 on diurnal gene expression changes. This data would provide insight into the role of
STRA6 in adipose tissue, informing the direction for future studies.
3.2.2 How does STRA6 signaling regulate downstream gene expression in
WAT?
In the mature adipocytes, STAT5 signaling has been tested in cells or mice treated with growth hormone or prolactin to identify and study STAT5 targets(108). Surprisingly, few STAT5 target genes in mature adipocytes have been identified(108). So far, 3 genes that regulate lipid metabolism have been identified as STAT5 targets: AOX, FABP4, and FASN(201-
203). PDK4 has also been identified as a STAT5 target in WAT(182).
83 PDK4 expression and activity is also regulated by insulin(182,186). Lastly, adiponectin has been identified to be regulated by STAT5(204). Of these targets, adiponectin, FABP4, FASN, and PDK4 have been shown to display circadian patterns of expression(1,157,205). RBP-mediated
STRA6 signaling may regulate gene expression of STAT5 target genes in adipocytes in two ways. Either by directly regulating STAT5 target genes in WAT that affect metabolism or by regulating genes like SOCS3 that oppose insulin receptor signaling.
We found that PDK4 mRNA expression is circadian in WAT, and
STRA6 regulates the circadian expression pattern. However, it is difficult to delineate precisely how STRA6 regulates PDK4. Is it a direct STAT5 target or is it a result of STRA6 inhibition of insulin action? In the future, we could determine which genes STRA6 signaling regulates directly or indirectly in WAT by performing additional studies in mice in the absence and presence of insulin. Using WT and STRA6-null mice that have been fasted (low insulin conditions) we could stimulate STRA6 signaling with the administration of recombinant holo-RBP and within a short time frame and determine which STAT5 targets are increased. Then we could perform the same experiments in the fed state (high insulin condition) and determine which insulin responsive genes STRA6 primarily opposes.
84 3.2.3 Does STRA6 signaling inhibit insulin receptor responses via SOCS3 in WAT?
Studies have shown that STRA6 signaling through JAK/STAT upregulates
SOCS3, which is a potent inhibitor of insulin receptor responses(9,98).
Our data show that in WT mice, SOCS3 displays 2 peaks at ZT10 and 22.
Interestingly in STRA6-null mice, the circadian pattern of SOCS3 mRNA is completely abrogated. Since STRA6 peaks at only one time from ZT22-2 it is not known why SOCS3 mRNA expression has 2 peaks regulated by
STRA6. To follow up on this data, I would determine the circadian pattern of SOCS3 protein expression in WT and STRA6-null mice to better understand the time of day SOCS3 may be exerting its effects.
SOCS3 inhibits insulin responses by a number of mechanisms(206). We did not strongly support the hypothesis that STRA6 is inhibiting IR response through SOCS3, especially in a circadian manner. One way SOCS3 inhibits insulin signaling is that it can bind directly to phospho-tyrosine 960 on IR and prevent STAT5b activation by insulin(207,208). Our data show that STRA6 regulates diurnal insulin receptor phosphorylation, and it may be mediated by SOCS3 in this way.
However, SOCS3 could also oppose insulin signaling by additional mechanisms. Insulin signaling is regulated largely in WAT by insulin receptor substrate (IRS) proteins(209,210). SOCS3 has been found to bind to and target IRS1 and IRS2 and target them for degradation(171). In fact, chronic stimulation with insulin has been shown to reduce levels of
85 IRS1 and IRS2(211,212). STRA6-null mice appear to be chronically insulin sensitive. Therefore, by examining IRS1 and 2 levels in WT and
STRA6-null mice we could determine if this is a mechanism by which
STRA6 mediates insulin receptor responses through SOCS3.
Furthermore, we have not investigated whether STRA6 may upregulate other SOCS isoforms such as SOCS1 or 6, as they are also regulated by
STAT signaling and have been shown to attenuate insulin signaling(187).
It may be possible that STRA6 may inhibit its own signaling through SOCS protein induction. SOCS 1 and 3 bind JAK proteins and can inhibit the enzymatic activity to phosphorylate or send JAK for degradation(206,213).
3.2.4 How does STRA6 inhibit signaling downstream of insulin receptor?
We have not investigated in detail how STRA6 expression affects signaling downstream of IR at ZT2 and 14. We have examined downstream protein kinase B (AKT) phosphorylation (pAKT) at S473 in response to insulin in WT and STRA6-null mice at ZT2 and 14
(Supplemental Fig. a3.1). WT mice show an increase in pAKT/AKT at
ZT14 compared to ZT2, indicating WT mice have increased downstream pAKT in response to insulin during the dark phase. WT mice display increased pAKT/AKT at ZT14 while the STRA6 null mice do not. STRA6- null mice, in fact, have lower pAKT/AKT levels than at ZT2.
This data leads to questions about how STRA6 regulates downstream insulin signaling in WAT, especially since we have shown 1)
86 that in ITT tests STRA6-null mice are insulin sensitive similar to WT mice at Z14 and 2) WT and STRA6-null mice have similar insulin receptor phosphorylation levels at ZT14. Why is it that pAKT/AKT at ZT14 is lower in STRA6-null mice compared to WT? It is possible that STRA6-null mice have triggered a negative feedback mechanism downstream of insulin receptor phosphorylation in the WAT at this time of day. In WAT, insulin sensitivity is largely mediated by insulin receptor signaling via IRS mediated phosphatidyl-3-OH kinase (PI3K) signaling(214). PI3K catalyzes the formation of phosphatidylinositol-3-phosphates, which bind to and regulate signaling proteins, such as phosphoinositide-dependent kinase 1
(PDK1)(215). AKT is partially activated by phosphorylation of T308 by
PDK1(216). AKT requires phosphorylation of S473 for full activation, which can be catalyzed by, mechanistic target of rapamycin complex
(mTORC2)(217). Therefore, we could investigate whether STRA6 expression changes any of these mediators downstream of insulin receptor responses.
Other possibilities to explain why STRA6-null mice have lower pAKT/AKT at ZT14 compared to WT could be that STRA6-null mice display increased levels of proteins involved in inhibition insulin receptor signaling. For example, protein tyrosine phosphatase 1B (PTP1B) dephosphorylates IR and IRS isoforms(218,219). Another possibility is that STRA6-null mice have altered levels of phosphatase and tensin homolog (PTEN) or type-II SH2-domain-containing inositol 5-phosphatase
87 (SHIP2) that inhibit PI3K activity(220,221). In summary, the regulation of insulin signaling is complex, and it will be important to determine how
STRA6 exactly mediates effects downstream of IR.
3.2.5 Does RBP secreted by adipocytes stimulate autocrine signaling of
STRA6?
It has been reported in obese or insulin resistant humans and mice that
RBP is elevated in the serum(104). Studies have proposed that adipocytes are responsible for the increase in serum RBP, as under HFD conditions RBP4 mRNA is increased in mice and humans(104). Recent studies employing the hepatocyte-specific RBP knockout have shown that adipose RBP secretion into serum is minimal(175). The mRNA level of
RBP increased in WAT of hepatocyte specific RBP KO mice, still serum levels of RBP were not detectable(175). It is known however, that RBP does cause insulin resistance in WAT(98,104,162). Overall, these studies suggest that the adipocyte may secrete RBP and act in an autocrine fashion. Autocrine signaling describes cell signaling in which a cell secretes a chemical messenger to activate receptors on that same cell(222). In the future, I would like to investigate whether RBP is secreted by adipocytes, and if so, whether it stimulates STRA6 activation. It is possible that RBP secreted locally by adipocytes may interact with other cells in the adipose tissue microenvironment, such as macrophages(162).
88 It would also be interesting to investigate whether RBP autocrine signaling may also play a role in cancer related STRA6 activation(100).
3.2.6 Does STRA6 regulate diurnal insulin action in muscle or liver?
We show STRA6 expression is circadian in WAT. Preliminary data show that STRA6 is circadian in muscle, but opposite from WAT it shows a decrease at ZT22 (Supplementary Fig. a3.2). It would be interesting to follow up on this and examine whether STRA6 regulates insulin sensitivity in the muscle, and regulates the circadian expression of genes involved in glucose and lipid metabolism.
We show STRA6-null mice have a lower RER during the dark phase, indicating increased fatty acid oxidation at this time. While STRA6 is not expressed in the liver, it is possible that circadian expression of
STRA6 in WAT or muscle may have indirect effects on the liver. Insulin does not stimulate glucose uptake in the liver but inhibits gluconeogenesis and stimulates glycogen synthesis(113). We could determine whether
STRA6 expression at ZT2 and 14 affected genes involved in these liver functions.
In addition to these experiments, I would like to determine how
STRA6 expression regulates diurnal glucose uptake in liver, WAT, and muscle. Using 2-deoxy-D-glucose infusion in WT and STRA6-null mice at
ZT2 and ZT14, we could determine how STRA6 affects diurnal circadian glucose uptake in each of these tissues.
89 3.2.7 Does STRA6 regulate the serum levels or circadian expression of adiponectin or leptin?
Our data show that STRA6-null mice have increased levels of leptin and adiponectin mRNA in WAT during the light phase. We did not investigate whether serum levels or the circadian pattern of adiponectin or leptin are altered by STRA6 expression. STRA6-null mice show decreased RER during the dark phase, indicating increased fatty acid oxidation compared to WT. Adiponectin stimulates fatty acid oxidation in WAT, it is possible
STRA6-null mice have elevated serum adiponectin. Leptin may also be contributing to the STRA6 phenotype. Leptin not only regulates the inhibition of food intake, but in WAT it stimulates fatty acid oxidation and inhibits lipogenesis(223,224). Therefore, to elucidate the mechanism by which STRA6 regulates diurnal metabolism on a whole body level it would be important to study the how STRA6 regulates these hormones and their downstream effects.
3.2.8 How is the expression of STRA6 regulated?
STRA6 was first discovered in a screen for genes that are responsive to retinoic acid(84). Retinoic acid acts through nuclear receptors RAR,
PPAR(β/δ) and RXR to regulate target genes(15). Otherwise, not much is known about how STRA6 is regulated. We propose STRA6 is regulated by the circadian transcription factor Rev-erbα. Our data shows that Rev-erbα binds to the promoter of STRA6, and in the future I would like to test
90 whether Rev-erbα regulates the expression of STRA6, CRBP1, and LRAT directly. It would be interesting to study how additional circadian factors may be regulating the circadian expression of STRA6, such as the glucocorticoid receptor.
3.2.9 How does STRA6 level of expression and circadian gene expression change on a high fat diet?
Previous studies show that STRA6-null mice are protected from high-fat diet-induced insulin resistance(9). High-fat diet feeding in mice results in the decrease in amplitude and levels of expression of circadian genes such as Rev-erb(225). High-fat diet can also induce the circadian oscillation of genes that were not previously circadian(225). Since a high- fat diet is common in Western societies, and associated with obesity and type II diabetes, it would be relevant investigate whether STRA6 expression level or circadian expression is altered in mice on a high fat diet(7,226). If so, we could examine how these changes affect diurnal insulin responses.
3.2.10 Does STRA6 have a role the brain?
STRA6 is expressed in the choroid plexus that contains the cells producing the cerebrospinal fluid in the ventricles of the brain(82). STRA6 is also expressed in the 3rd ventricle, which is a fluid-filled cavity surrounding the thalamus and hypothalamus within the brain(227). It is
91 known that RA signaling regulates hippocampal neurogenesis(228). In addition, RA regulates gene expression in the hypothalamus(229,230). I propose that STRA6 may be important for maintaining retinoid homeostasis in the brain, as RBP cannot cross the blood brain barrier.
This role would be similar to how STRA6 is important in blood retinal barrier RPE cells for the maintenance of retinol in the eye(92). I would first determine the location of STRA6 expression in the brain, and determine if the expression is circadian. If STRA6 is important for ROH homeostasis in the brain, I would test whether retinoic acid responsive genes are affected by STRA6 expression. I could then follow up with some behavioral experiments in WT and STRA6-null mice to see if STRA6 affects learning and memory.
3.2.11 Is there a role for calmodulin in STRA6 activity?
The discovery that the zebrafish STRA6 structure co-crystalized with calmodulin raises new questions about the function of STRA6 bound to calmodulin(86). There are no previous reports showing STRA6 associated with calmodulin, or whether there is a direct link between calcium and retinol transport(86). It is not known whether calmodulin binds human
STRA6. Calmodulin is ubiquitously expressed and is the major regulator of calcium-dependent signaling in eukaryotic cells(87). Intracellular calcium ions regulate membrane potential, neurotransmitter release, and gene expression(87). The calcium-binding protein calmodulin regulates a broad
92 spectrum of functions and can interact with and modulate the function of hundreds of target proteins(87).
It has been shown that insulin increases the phosphorylation of the myosin regulatory light chain 2 in adipocytes via the calcium-calmodulin- dependent myosin light chain kinase, which regulates GLUT4 translocation to the plasma membrane(231). Therefore, in studies where intracellular calcium has been chelated in cells, calcium has been shown to promote insulin stimulation of glucose transport(232,233). If STRA6 regulates calmodulin or vice versa, the aforementioned proteins may regulate downstream effects of IR calcium signaling.
First, I would first determine whether human or mouse STRA6 binds calmodulin, and whether this was dependent on the presence of
CRBP1 that binds an intracellular loop of STRA6 defined to be a calmodulin-binding domain(86,99). Then I would investigate whether calmodulin affected the ability of STRA6 to transport ROH or signal. I could then perform some functional cell culture studies to see if calmodulin expression affects holo-RBP/STRA6 signaling responses in adipocytes or in other cells where STRA6 signaling is known to have effects.
3.2.12 Development of an STRA6 inhibitor
A STRA6 inhibitor would be the ultimate tool to study the effects of STRA6 on normal and pathophysiology. This would require the development of a sensitive screening assay capable of an output such as fluorescence that
93 would change upon STRA6 inhibition. The assay could then be used for high-throughput screening of commercially available compound libraries.
A STRA6 inhibitor has potential as a therapeutic tool for treatment of breast and colon cancer or to prevent or treat insulin resistance. Since
STRA6 is not necessary for maintaining retinoid stores in tissues other than the eye, it may not affect maintenance of vitamin A levels in most tissues. Supplementation with vitamin A to maintain eye health could be possible to alleviate any visual side effect.
3.3 Implications of findings
In summary, the work described in this dissertation has revealed a novel role for RBP-mediated STRA6 signaling as a regulator of diurnal insulin responses, and as a regulator of downstream insulin action in WAT. This data show that the RBP4/STRA6 axis may develop into an attractive pathway for early detection of, or as a potential therapeutic target for pre- diabetes or type II diabetes.
94 Appendix
Table a2.1. Primer sequences used for ChIP
Table 2. ChIP Primer Sequences
Gene RORE Species 5'-3' Sequence STRA6 -1651 Human Fwd: GGCAAAACTTCCCCTAGGTC Rev: TGTACCCCAGACTCCAACAC STRA6 -3214 Human Fwd: TTGCCTTGGAGGGGCTAAAG Rev: TCTCAGGGGTTTGTGCCTTC CRBP1 +241 Human Fwd: CAACTGGCTCCAGTCACTCC Rev: GCGCAGGTACTCCTCGAAAT CRBP1 -64 Human Fwd: TCCGGTCTCCTCTTCCTTTGT Rev: GGATGTCGAAGGGTCAGGTTT LRAT -609 Human Fwd: CACCGAAGACTACCGCGAAG Rev: CCGGTTGCACTACTGGCTTT GAPDH +3555 Human Fwd: TTGCCCTCAACGACCACTTT Rev: TCAGGGCCCTTTTTCTGAGC STRA6 -339 Mouse Fwd: GCGGGCAGTTTGCACAAGAG Rev: AGAGTGTTCTGCACCCCTGG STRA6 -2244 Mouse Fwd: GCTGAGTGTCTGTGACCCTT Rev: ATCCAGTCTGGCAAAACCACT CRBP1 -1162 Mouse Fwd: CACAGGCTCCTAGGCTCTGA Rev: CGTGGCTTCTGATCCTTGTT CRBP1 -2142 Mouse Fwd: AGGAGATGGCCAAAGTGG Rev: ACAGAGGTTGCTCCAGGT LRAT -3218 Mouse Fwd: CTGAGTGTGGGCTTCCTTGA Rev: GAAAAGTTGGACCCCAAGTCA LRAT -4060 Mouse Fwd: ATCTGAGCTCTGGAGCAGAC Rev: CCTTTGACCTGAGTTTCTCATGC STRA6 -890 Mouse Fwd: AGCTCCTCTGGGAGGATAGG Rev: AAGATGGATGGCTGCTGACC
Table a2.1. Primer sequences used for ChIP
Primer sequences used for ChIP on ROREs found on the promoters of
STRA6, CRBP1, and LRAT. RORE indicated by the distance from the
STRA6 start site.
95
Figure a3.1. STRA6 regulates diurnal insulin responses in WAT
A and B) Western blot analysis for pIR and IR from epididymal WAT collected from male mice before and after 5 min injection of insulin (1ug/g) in WT and STRA6-null mice performed at ZT2 or 14. C and D) Western blot analysis for pAKT at S473 and AKT from epididymal WAT collected from male mice before and after 5 min injection of insulin (1ug/g) in WT and STRA6-null mice performed at ZT2 or 14.
96
Figure a3.2. STRA6 and LRAT expression is circadian in skeletal muscle
A-C) STRA6, CRBP1, and LRAT mRNA expression from skeletal muscle collected every 4 hours from WT mice over a 24-hour period determined by quantitative real time PCR. Data shown is double-plotted data.
Zeitgeber time (ZT) 0 refers to the hour mice are first exposed to light.
Data represented as mean ± SEM. * indicates significance at least p <
0.05 compared to ZT2 in panel A and ZT6 in panel C.
97 REFERENCES
1. Kumar Jha, P., Challet, E., and Kalsbeek, A. (2015) Circadian rhythms in glucose and lipid metabolism in nocturnal and diurnal mammals. Molecular and cellular endocrinology 418 Pt 1, 74-88
2. Gibson, T., and Jarrett, R. J. (1972) Diurnal variation in insulin sensitivity. Lancet 2, 947-948
3. Saad, A., Dalla Man, C., Nandy, D. K., Levine, J. A., Bharucha, A. E., Rizza, R. A., Basu, R., Carter, R. E., Cobelli, C., Kudva, Y. C., and Basu, A. (2012) Diurnal pattern to insulin secretion and insulin action in healthy individuals. Diabetes 61, 2691-2700
4. Ogden, C. L., Carroll, M. D., Kit, B. K., and Flegal, K. M. (2013) Prevalence of obesity among adults: United States, 2011-2012. NCHS data brief, 1-8
5. Centers for Disease Control and Prevention. National Diabetes Statistics Report: Estimates of Diabetes and Its Burden in the United States, A., GA: U.S. Department of Health and Human Services; 2014.
6. Guo, F., and Garvey, W. T. (2016) Trends in Cardiovascular Health Metrics in Obese Adults: National Health and Nutrition Examination Survey (NHANES), 1988-2014. Journal of the American Heart Association 5
7. Kahn, S. E., Hull, R. L., and Utzschneider, K. M. (2006) Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 444, 840-846
98 8. Arble, D. M., Bass, J., Behn, C. D., Butler, M. P., Challet, E., Czeisler, C., Depner, C. M., Elmquist, J., Franken, P., Grandner, M. A., Hanlon, E. C., Keene, A. C., Joyner, M. J., Karatsoreos, I., Kern, P. A., Klein, S., Morris, C. J., Pack, A. I., Panda, S., Ptacek, L. J., Punjabi, N. M., Sassone-Corsi, P., Scheer, F. A., Saxena, R., Seaquest, E. R., Thimgan, M. S., Van Cauter, E., and Wright, K. P. (2015) Impact of Sleep and Circadian Disruption on Energy Balance and Diabetes: A Summary of Workshop Discussions. Sleep 38, 1849-1860
9. Berry, D. C., Jacobs, H., Marwarha, G., Gely-Pernot, A., O'Byrne, S. M., DeSantis, D., Klopfenstein, M., Feret, B., Dennefeld, C., Blaner, W. S., Croniger, C. M., Mark, M., Noy, N., and Ghyselinck, N. B. (2013) The STRA6 receptor is essential for retinol-binding protein-induced insulin resistance but not for maintaining vitamin A homeostasis in tissues other than the eye. The Journal of biological chemistry 288, 24528-24539
10. McCollum, E. V. a. D., M. (1913) The necessity of certain lipins in the diet during growth The Journal of biological chemistry, 167-175
11. Brun, P. J., Yang, K. J., Lee, S. A., Yuen, J. J., and Blaner, W. S. (2013) Retinoids: Potent regulators of metabolism. BioFactors 39, 151-163
12. O'Byrne, S. M., and Blaner, W. S. (2013) Retinol and retinyl esters: biochemistry and physiology. Journal of lipid research 54, 1731- 1743
13. Schreiber, R., Taschler, U., Preiss-Landl, K., Wongsiriroj, N., Zimmermann, R., and Lass, A. (2012) Retinyl ester hydrolases and
99 their roles in vitamin A homeostasis. Biochimica et biophysica acta 1821, 113-123
14. Wald, G. (1968) The molecular basis of visual excitation. Nature 219, 800-807
15. Al Tanoury, Z., Piskunov, A., and Rochette-Egly, C. (2013) Vitamin A and retinoid signaling: genomic and nongenomic effects. Journal of lipid research 54, 1761-1775
16. Kakkad, B. P., and Ong, D. E. (1988) Reduction of retinaldehyde bound to cellular retinol-binding protein (type II) by microsomes from rat small intestine. The Journal of biological chemistry 263, 12916-12919
17. Duester, G. (2000) Families of retinoid dehydrogenases regulating vitamin A function: production of visual pigment and retinoic acid. European journal of biochemistry 267, 4315-4324
18. Chambon, P. (1996) A decade of molecular biology of retinoic acid receptors. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 10, 940-954
19. Renaud, J. P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378, 681-689
20. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B., Eichele, G., Evans, R. M., and Thaller, C. (1992) 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 68, 397-406
100 21. Chawla, A., Repa, J. J., Evans, R. M., and Mangelsdorf, D. J. (2001) Nuclear receptors and lipid physiology: opening the X-files. Science 294, 1866-1870
22. Egea, P. F., Mitschler, A., Rochel, N., Ruff, M., Chambon, P., and Moras, D. (2000) Crystal structure of the human RXRalpha ligand- binding domain bound to its natural ligand: 9-cis retinoic acid. The EMBO journal 19, 2592-2601
23. Schug, T. T., Berry, D. C., Shaw, N. S., Travis, S. N., and Noy, N. (2007) Opposing effects of retinoic acid on cell growth result from alternate activation of two different nuclear receptors. Cell 129, 723-733
24. Berry, D. C., and Noy, N. (2009) All-trans-retinoic acid represses obesity and insulin resistance by activating both peroxisome proliferation-activated receptor beta/delta and retinoic acid receptor. Molecular and cellular biology 29, 3286-3296
25. Shaw, N., Elholm, M., and Noy, N. (2003) Retinoic acid is a high affinity selective ligand for the peroxisome proliferator-activated receptor beta/delta. The Journal of biological chemistry 278, 41589- 41592
26. Lindqvist, A., and Andersson, S. (2002) Biochemical properties of purified recombinant human beta-carotene 15,15'-monooxygenase. The Journal of biological chemistry 277, 23942-23948
27. D'Ambrosio, D. N., Clugston, R. D., and Blaner, W. S. (2011) Vitamin A metabolism: an update. Nutrients 3, 63-103
101 28. Batten, M. L., Imanishi, Y., Maeda, T., Tu, D. C., Moise, A. R., Bronson, D., Possin, D., Van Gelder, R. N., Baehr, W., and Palczewski, K. (2004) Lecithin-retinol acyltransferase is essential for accumulation of all-trans-retinyl esters in the eye and in the liver. The Journal of biological chemistry 279, 10422-10432
29. Liden, M., and Eriksson, U. (2006) Understanding retinol metabolism: structure and function of retinol dehydrogenases. The Journal of biological chemistry 281, 13001-13004
30. Balmer, J. E., and Blomhoff, R. (2002) Gene expression regulation by retinoic acid. Journal of lipid research 43, 1773-1808
31. Ross, A. C. (1992) Vitamin A status: relationship to immunity and the antibody response. Proceedings of the Society for Experimental Biology and Medicine. Society for Experimental Biology and Medicine 200, 303-320
32. Reboul, E. (2013) Absorption of vitamin A and carotenoids by the enterocyte: focus on transport proteins. Nutrients 5, 3563-3581
33. Weber, D., and Grune, T. (2012) The contribution of beta-carotene to vitamin A supply of humans. Molecular nutrition & food research 56, 251-258
34. Penniston, K. L., and Tanumihardjo, S. A. (2006) The acute and chronic toxic effects of vitamin A. The American journal of clinical nutrition 83, 191-201
35. Wilson, J. G., Roth, C. B., and Warkany, J. (1953) An analysis of the syndrome of malformations induced by maternal vitamin A
102 deficiency. Effects of restoration of vitamin A at various times during gestation. The American journal of anatomy 92, 189-217
36. Li, Y., Wongsiriroj, N., and Blaner, W. S. (2014) The multifaceted nature of retinoid transport and metabolism. Hepatobiliary surgery and nutrition 3, 126-139
37. Sommer, A. (2008) Vitamin a deficiency and clinical disease: an historical overview. The Journal of nutrition 138, 1835-1839
38. Dowling, J. E. (1966) Night blindness. Scientific American 215, 78- 84
39. McCaffery, P. J., Adams, J., Maden, M., and Rosa-Molinar, E. (2003) Too much of a good thing: retinoic acid as an endogenous regulator of neural differentiation and exogenous teratogen. The European journal of neuroscience 18, 457-472
40. van Vliet, T., van Vlissingen, M. F., van Schaik, F., and van den Berg, H. (1996) beta-Carotene absorption and cleavage in rats is affected by the vitamin A concentration of the diet. The Journal of nutrition 126, 499-508
41. Lobo, G. P., Amengual, J., Palczewski, G., Babino, D., and von Lintig, J. (2012) Mammalian carotenoid-oxygenases: key players for carotenoid function and homeostasis. Biochimica et biophysica acta 1821, 78-87
42. Chelstowska, S., Widjaja-Adhi, M. A., Silvaroli, J. A., and Golczak, M. (2016) Molecular Basis for Vitamin A Uptake and Storage in Vertebrates. Nutrients 8
103 43. Fleet, J. C., DeSmet, M., Johnson, R., and Li, Y. (2012) Vitamin D and cancer: a review of molecular mechanisms. The Biochemical journal 441, 61-76
44. Weng, W., Li, L., van Bennekum, A. M., Potter, S. H., Harrison, E. H., Blaner, W. S., Breslow, J. L., and Fisher, E. A. (1999) Intestinal absorption of dietary cholesteryl ester is decreased but retinyl ester absorption is normal in carboxyl ester lipase knockout mice. Biochemistry 38, 4143-4149
45. van Bennekum, A. M., Fisher, E. A., Blaner, W. S., and Harrison, E. H. (2000) Hydrolysis of retinyl esters by pancreatic triglyceride lipase. Biochemistry 39, 4900-4906
46. O'Byrne, S. M., Wongsiriroj, N., Libien, J., Vogel, S., Goldberg, I. J., Baehr, W., Palczewski, K., and Blaner, W. S. (2005) Retinoid absorption and storage is impaired in mice lacking lecithin:retinol acyltransferase (LRAT). The Journal of biological chemistry 280, 35647-35657
47. Shih, M. Y., Kane, M. A., Zhou, P., Yen, C. L., Streeper, R. S., Napoli, J. L., and Farese, R. V., Jr. (2009) Retinol Esterification by DGAT1 Is Essential for Retinoid Homeostasis in Murine Skin. The Journal of biological chemistry 284, 4292-4299
48. Paik, J., During, A., Harrison, E. H., Mendelsohn, C. L., Lai, K., and Blaner, W. S. (2001) Expression and characterization of a murine enzyme able to cleave beta-carotene. The formation of retinoids. The Journal of biological chemistry 276, 32160-32168
49. Sahu, B., and Maeda, A. (2016) Retinol Dehydrogenases Regulate Vitamin A Metabolism for Visual Function. Nutrients 8
104 50. Noy, N. (2013) Vitamin A. . in Biochemical, Physiological, and Molecular Aspects of Human Nutrition (Stipanuk, M. H. a. C., M. A. ed.), 3rd Ed., Elsevier, St. Louis, Missouri. pp
51. Blaner, W. S., Obunike, J. C., Kurlandsky, S. B., al-Haideri, M., Piantedosi, R., Deckelbaum, R. J., and Goldberg, I. J. (1994) Lipoprotein lipase hydrolysis of retinyl ester. Possible implications for retinoid uptake by cells. The Journal of biological chemistry 269, 16559-16565
52. van Bennekum, A. M., Kako, Y., Weinstock, P. H., Harrison, E. H., Deckelbaum, R. J., Goldberg, I. J., and Blaner, W. S. (1999) Lipoprotein lipase expression level influences tissue clearance of chylomicron retinyl ester. Journal of lipid research 40, 565-574
53. Rohlmann, A., Gotthardt, M., Hammer, R. E., and Herz, J. (1998) Inducible inactivation of hepatic LRP gene by cre-mediated recombination confirms role of LRP in clearance of chylomicron remnants. The Journal of clinical investigation 101, 689-695
54. Goodman, D. W., Huang, H. S., and Shiratori, T. (1965) Tissue Distribution and Metabolism of Newly Absorbed Vitamin a in the Rat. Journal of lipid research 6, 390-396
55. Wyss, A., Wirtz, G. M., Woggon, W. D., Brugger, R., Wyss, M., Friedlein, A., Riss, G., Bachmann, H., and Hunziker, W. (2001) Expression pattern and localization of beta,beta-carotene 15,15'- dioxygenase in different tissues. The Biochemical journal 354, 521- 529
56. Tsutsumi, C., Okuno, M., Tannous, L., Piantedosi, R., Allan, M., Goodman, D. S., and Blaner, W. S. (1992) Retinoids and retinoid-
105 binding protein expression in rat adipocytes. The Journal of biological chemistry 267, 1805-1810
57. Cooper, A. D. (1997) Hepatic uptake of chylomicron remnants. Journal of lipid research 38, 2173-2192
58. Harrison, E. H. (2000) Lipases and carboxylesterases: possible roles in the hepatic utilization of vitamin A. The Journal of nutrition 130, 340S-344S
59. Sanghani, S. P., Davis, W. I., Dumaual, N. G., Mahrenholz, A., and Bosron, W. F. (2002) Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate. European journal of biochemistry 269, 4387-4398
60. Friedman, S. L. (2008) Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiological reviews 88, 125-172
61. Moriwaki, H., Blaner, W. S., Piantedosi, R., and Goodman, D. S. (1988) Effects of dietary retinoid and triglyceride on the lipid composition of rat liver stellate cells and stellate cell lipid droplets. Journal of lipid research 29, 1523-1534
62. Soprano, D. R. B., W.S. . (1994) Plasma Retinol-Binding Protein. in The Retinoids, Biology, Chemistry and Medicine (Sporn, M. B., Roberts, A.B., Goodman, D.S. ed.), Raven Press:, New York, NY, USA. pp
63. Blaner, W. S., Hendriks, H. F., Brouwer, A., de Leeuw, A. M., Knook, D. L., and Goodman, D. S. (1985) Retinoids, retinoid- binding proteins, and retinyl palmitate hydrolase distributions in
106 different types of rat liver cells. Journal of lipid research 26, 1241- 1251
64. van Bennekum, A. M., Wei, S., Gamble, M. V., Vogel, S., Piantedosi, R., Gottesman, M., Episkopou, V., and Blaner, W. S. (2001) Biochemical basis for depressed serum retinol levels in transthyretin-deficient mice. The Journal of biological chemistry 276, 1107-1113
65. Cavallaro, T., Martone, R. L., Dwork, A. J., Schon, E. A., and Herbert, J. (1990) The retinal pigment epithelium is the unique site of transthyretin synthesis in the rat eye. Investigative ophthalmology & visual science 31, 497-501
66. Jacobsson, B., Collins, V. P., Grimelius, L., Pettersson, T., Sandstedt, B., and Carlstrom, A. (1989) Transthyretin immunoreactivity in human and porcine liver, choroid plexus, and pancreatic islets. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 37, 31-37
67. Buxbaum, J. N., and Reixach, N. (2009) Transthyretin: the servant of many masters. Cellular and molecular life sciences : CMLS 66, 3095-3101
68. Episkopou, V., Maeda, S., Nishiguchi, S., Shimada, K., Gaitanaris, G. A., Gottesman, M. E., and Robertson, E. J. (1993) Disruption of the transthyretin gene results in mice with depressed levels of plasma retinol and thyroid hormone. Proceedings of the National Academy of Sciences of the United States of America 90, 2375- 2379
107 69. Bellovino, D., Morimoto, T., Tosetti, F., and Gaetani, S. (1996) Retinol binding protein and transthyretin are secreted as a complex formed in the endoplasmic reticulum in HepG2 human hepatocarcinoma cells. Experimental cell research 222, 77-83
70. Pfeffer, B. A., Becerra, S. P., Borst, D. E., and Wong, P. (2004) Expression of transthyretin and retinol binding protein mRNAs and secretion of transthyretin by cultured monkey retinal pigment epithelium. Molecular vision 10, 23-30
71. Quadro, L., Hamberger, L., Colantuoni, V., Gottesman, M. E., and Blaner, W. S. (2003) Understanding the physiological role of retinol- binding protein in vitamin A metabolism using transgenic and knockout mouse models. Molecular aspects of medicine 24, 421- 430
72. Berry, D. C., Croniger, C. M., Ghyselinck, N. B., and Noy, N. (2012) Transthyretin blocks retinol uptake and cell signaling by the holo- retinol-binding protein receptor STRA6. Molecular and cellular biology 32, 3851-3859
73. Fex, G., and Johannesson, G. (1988) Retinol transfer across and between phospholipid bilayer membranes. Biochimica et biophysica acta 944, 249-255
74. Hodam, J. R., and Creek, K. E. (1998) Comparison of the metabolism of retinol delivered to human keratinocytes either bound to serum retinol-binding protein or added directly to the culture medium. Experimental cell research 238, 257-264
108 75. Noy, N., and Xu, Z. J. (1990) Interactions of retinol with binding proteins: implications for the mechanism of uptake by cells. Biochemistry 29, 3878-3883
76. Noy, N., and Xu, Z. J. (1990) Kinetic parameters of the interactions of retinol with lipid bilayers. Biochemistry 29, 3883-3888
77. Kawaguchi, R., Yu, J., Honda, J., Hu, J., Whitelegge, J., Ping, P., Wiita, P., Bok, D., and Sun, H. (2007) A membrane receptor for retinol binding protein mediates cellular uptake of vitamin A. Science 315, 820-825
78. Alapatt, P., Guo, F., Komanetsky, S. M., Wang, S., Cai, J., Sargsyan, A., Rodriguez Diaz, E., Bacon, B. T., Aryal, P., and Graham, T. E. (2013) Liver retinol transporter and receptor for serum retinol-binding protein (RBP4). The Journal of biological chemistry 288, 1250-1265
79. Quadro, L., Blaner, W. S., Hamberger, L., Novikoff, P. M., Vogel, S., Piantedosi, R., Gottesman, M. E., and Colantuoni, V. (2004) The role of extrahepatic retinol binding protein in the mobilization of retinoid stores. Journal of lipid research 45, 1975-1982
80. Bok, D., and Heller, J. (1976) Transport of retinol from the blood to the retina: an autoradiographic study of the pigment epithelial cell surface receptor for plasma retinol-binding protein. Experimental eye research 22, 395-402
81. Sivaprasadarao, A., and Findlay, J. B. (1988) The interaction of retinol-binding protein with its plasma-membrane receptor. The Biochemical journal 255, 561-569
109 82. Smeland, S., Bjerknes, T., Malaba, L., Eskild, W., Norum, K. R., and Blomhoff, R. (1995) Tissue distribution of the receptor for plasma retinol-binding protein. The Biochemical journal 305 ( Pt 2), 419-424
83. Hagen, E., Myhre, A. M., Smeland, S., Halvorsen, B., Norum, K. R., and Blomhoff, R. (1999) Uptake of vitamin A in macrophages from physiologic transport proteins: role of retinol-binding protein and chylomicron remnants. The Journal of nutritional biochemistry 10, 345-352
84. Bouillet, P., Oulad-Abdelghani, M., Vicaire, S., Garnier, J. M., Schuhbaur, B., Dolle, P., and Chambon, P. (1995) Efficient cloning of cDNAs of retinoic acid-responsive genes in P19 embryonal carcinoma cells and characterization of a novel mouse gene, Stra1 (mouse LERK-2/Eplg2). Developmental biology 170, 420-433
85. Bouillet, P., Sapin, V., Chazaud, C., Messaddeq, N., Decimo, D., Dolle, P., and Chambon, P. (1997) Developmental expression pattern of Stra6, a retinoic acid-responsive gene encoding a new type of membrane protein. Mechanisms of development 63, 173- 186
86. Chen, Y., Clarke, O. B., Kim, J., Stowe, S., Kim, Y. K., Assur, Z., Cavalier, M., Godoy-Ruiz, R., von Alpen, D. C., Manzini, C., Blaner, W. S., Frank, J., Quadro, L., Weber, D. J., Shapiro, L., Hendrickson, W. A., and Mancia, F. (2016) Structure of the STRA6 receptor for retinol uptake. Science 353
87. Berchtold, M. W., and Villalobo, A. (2014) The many faces of calmodulin in cell proliferation, programmed cell death, autophagy, and cancer. Biochimica et biophysica acta 1843, 398-435
110 88. Kawaguchi, R., Yu, J., Wiita, P., Honda, J., and Sun, H. (2008) An essential ligand-binding domain in the membrane receptor for retinol-binding protein revealed by large-scale mutagenesis and a human polymorphism. The Journal of biological chemistry 283, 15160-15168
89. Chazaud, C., Bouillet, P., Oulad-Abdelghani, M., and Dolle, P. (1996) Restricted expression of a novel retinoic acid responsive gene during limb bud dorsoventral patterning and endochondral ossification. Developmental genetics 19, 66-73
90. Szeto, W., Jiang, W., Tice, D. A., Rubinfeld, B., Hollingshead, P. G., Fong, S. E., Dugger, D. L., Pham, T., Yansura, D. G., Wong, T. A., Grimaldi, J. C., Corpuz, R. T., Singh, J. S., Frantz, G. D., Devaux, B., Crowley, C. W., Schwall, R. H., Eberhard, D. A., Rastelli, L., Polakis, P., and Pennica, D. (2001) Overexpression of the retinoic acid-responsive gene Stra6 in human cancers and its synergistic induction by Wnt-1 and retinoic acid. Cancer research 61, 4197-4205
91. Hu, J., and Bok, D. (2010) Culture of highly differentiated human retinal pigment epithelium for analysis of the polarized uptake, processing, and secretion of retinoids. Methods in molecular biology 652, 55-73
92. Ruiz, A., Mark, M., Jacobs, H., Klopfenstein, M., Hu, J., Lloyd, M., Habib, S., Tosha, C., Radu, R. A., Ghyselinck, N. B., Nusinowitz, S., and Bok, D. (2012) Retinoid content, visual responses, and ocular morphology are compromised in the retinas of mice lacking the retinol-binding protein receptor, STRA6. Investigative ophthalmology & visual science 53, 3027-3039
111 93. Pasutto, F., Sticht, H., Hammersen, G., Gillessen-Kaesbach, G., Fitzpatrick, D. R., Nurnberg, G., Brasch, F., Schirmer-Zimmermann, H., Tolmie, J. L., Chitayat, D., Houge, G., Fernandez-Martinez, L., Keating, S., Mortier, G., Hennekam, R. C., von der Wense, A., Slavotinek, A., Meinecke, P., Bitoun, P., Becker, C., Nurnberg, P., Reis, A., and Rauch, A. (2007) Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation. American journal of human genetics 80, 550-560
94. Priolo, M., Casile, G., and Lagana, C. (2004) Pulmonary agenesis/hypoplasia, microphthalmia, and diaphragmatic defects: report of an additional case. Clinical dysmorphology 13, 45-46
95. Spear, G. S., Yetur, P., and Beyerlein, R. A. (1987) Bilateral pulmonary agenesis and microphthalmia. American journal of medical genetics. Supplement 3, 379-382
96. Chassaing, N., Golzio, C., Odent, S., Lequeux, L., Vigouroux, A., Martinovic-Bouriel, J., Tiziano, F. D., Masini, L., Piro, F., Maragliano, G., Delezoide, A. L., Attie-Bitach, T., Manouvrier-Hanu, S., Etchevers, H. C., and Calvas, P. (2009) Phenotypic spectrum of STRA6 mutations: from Matthew-Wood syndrome to non-lethal anophthalmia. Human mutation 30, E673-681
97. Chitayat, D., Sroka, H., Keating, S., Colby, R. S., Ryan, G., Toi, A., Blaser, S., Viero, S., Devisme, L., Boute-Benejean, O., Manouvrier- Hanu, S., Mortier, G., Loeys, B., Rauch, A., and Bitoun, P. (2007) The PDAC syndrome (pulmonary hypoplasia/agenesis, diaphragmatic hernia/eventration, anophthalmia/microphthalmia, and cardiac defect) (Spear syndrome, Matthew-Wood syndrome):
112 report of eight cases including a living child and further evidence for autosomal recessive inheritance. American journal of medical genetics. Part A 143A, 1268-1281
98. Berry, D. C., Jin, H., Majumdar, A., and Noy, N. (2011) Signaling by vitamin A and retinol-binding protein regulates gene expression to inhibit insulin responses. Proceedings of the National Academy of Sciences of the United States of America 108, 4340-4345
99. Berry, D. C., O'Byrne, S. M., Vreeland, A. C., Blaner, W. S., and Noy, N. (2012) Cross talk between signaling and vitamin A transport by the retinol-binding protein receptor STRA6. Molecular and cellular biology 32, 3164-3175
100. Berry, D. C., Levi, L., and Noy, N. (2014) Holo-retinol-binding protein and its receptor STRA6 drive oncogenic transformation. Cancer research 74, 6341-6351
101. Noy, N. (2016) Vitamin A in regulation of insulin responsiveness: mini review. The Proceedings of the Nutrition Society 75, 212-215
102. Marwarha, G., Berry, D. C., Croniger, C. M., and Noy, N. (2014) The retinol esterifying enzyme LRAT supports cell signaling by retinol-binding protein and its receptor STRA6. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 28, 26-34
103. Amengual, J., Golczak, M., Palczewski, K., and von Lintig, J. (2012) Lecithin:retinol acyltransferase is critical for cellular uptake of vitamin A from serum retinol-binding protein. The Journal of biological chemistry 287, 24216-24227
113 104. Yang, Q., Graham, T. E., Mody, N., Preitner, F., Peroni, O. D., Zabolotny, J. M., Kotani, K., Quadro, L., and Kahn, B. B. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature 436, 356-362
105. Kovacs, P., Geyer, M., Berndt, J., Kloting, N., Graham, T. E., Bottcher, Y., Enigk, B., Tonjes, A., Schleinitz, D., Schon, M. R., Kahn, B. B., Bluher, M., and Stumvoll, M. (2007) Effects of genetic variation in the human retinol binding protein-4 gene (RBP4) on insulin resistance and fat depot-specific mRNA expression. Diabetes 56, 3095-3100
106. Graham, T. E., Yang, Q., Bluher, M., Hammarstedt, A., Ciaraldi, T. P., Henry, R. R., Wason, C. J., Oberbach, A., Jansson, P. A., Smith, U., and Kahn, B. B. (2006) Retinol-binding protein 4 and insulin resistance in lean, obese, and diabetic subjects. The New England journal of medicine 354, 2552-2563
107. Tonjes, A., Bluher, M., and Stumvoll, M. (2010) Retinol-binding protein 4 and new adipocytokines in nonalcoholic fatty liver disease. Current pharmaceutical design 16, 1921-1928
108. Richard, A. J., and Stephens, J. M. (2014) The role of JAK-STAT signaling in adipose tissue function. Biochimica et biophysica acta 1842, 431-439
109. Zemany, L., Kraus, B. J., Norseen, J., Saito, T., Peroni, O. D., Johnson, R. L., and Kahn, B. B. (2014) Downregulation of STRA6 in adipocytes and adipose stromovascular fraction in obesity and effects of adipocyte-specific STRA6 knockdown in vivo. Molecular and cellular biology 34, 1170-1186
114 110. van Hoek, M., Dehghan, A., Zillikens, M. C., Hofman, A., Witteman, J. C., and Sijbrands, E. J. (2008) An RBP4 promoter polymorphism increases risk of type 2 diabetes. Diabetologia 51, 1423-1428
111. Nair, A. K., Sugunan, D., Kumar, H., and Anilkumar, G. (2010) Case-control analysis of SNPs in GLUT4, RBP4 and STRA6: association of SNPs in STRA6 with type 2 diabetes in a South Indian population. PloS one 5, e11444
112. Lebovitz, H. E. (2001) Insulin resistance: definition and consequences. Experimental and clinical endocrinology & diabetes : official journal, German Society of Endocrinology [and] German Diabetes Association 109 Suppl 2, S135-148
113. Saltiel, A. R., and Kahn, C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806
114. Van Cauter, E., Polonsky, K. S., and Scheen, A. J. (1997) Roles of circadian rhythmicity and sleep in human glucose regulation. Endocrine reviews 18, 716-738
115. Hughey, J. J., and Butte, A. J. (2016) Differential Phasing between Circadian Clocks in the Brain and Peripheral Organs in Humans. Journal of biological rhythms 31, 588-597
116. O'Neill, J. S., van Ooijen, G., Dixon, L. E., Troein, C., Corellou, F., Bouget, F. Y., Reddy, A. B., and Millar, A. J. (2011) Circadian rhythms persist without transcription in a eukaryote. Nature 469, 554-558
117. O'Neill, J. S., and Reddy, A. B. (2011) Circadian clocks in human red blood cells. Nature 469, 498-503
115 118. Green, C. B., Takahashi, J. S., and Bass, J. (2008) The meter of metabolism. Cell 134, 728-742
119. Reppert, S. M., and Weaver, D. R. (2002) Coordination of circadian timing in mammals. Nature 418, 935-941
120. Ruby, N. F., Burns, D. E., and Heller, H. C. (1999) Circadian rhythms in the suprachiasmatic nucleus are temperature- compensated and phase-shifted by heat pulses in vitro. The Journal of neuroscience : the official journal of the Society for Neuroscience 19, 8630-8636
121. Gerhart-Hines, Z., and Lazar, M. A. (2015) Circadian metabolism in the light of evolution. Endocrine reviews 36, 289-304
122. Hatori, M., Le, H., Vollmers, C., Keding, S. R., Tanaka, N., Buch, T., Waisman, A., Schmedt, C., Jegla, T., and Panda, S. (2008) Inducible ablation of melanopsin-expressing retinal ganglion cells reveals their central role in non-image forming visual responses. PloS one 3, e2451
123. Ramsey, D. J., Ramsey, K. M., and Vavvas, D. G. (2013) Genetic advances in ophthalmology: the role of melanopsin-expressing, intrinsically photosensitive retinal ganglion cells in the circadian organization of the visual system. Seminars in ophthalmology 28, 406-421
124. Bass, J., and Takahashi, J. S. (2010) Circadian integration of metabolism and energetics. Science 330, 1349-1354
116 125. Ralph, M. R., Foster, R. G., Davis, F. C., and Menaker, M. (1990) Transplanted suprachiasmatic nucleus determines circadian period. Science 247, 975-978
126. Lamia, K. A., Storch, K. F., and Weitz, C. J. (2008) Physiological significance of a peripheral tissue circadian clock. Proceedings of the National Academy of Sciences of the United States of America 105, 15172-15177
127. Albrecht, U. (2012) Timing to perfection: the biology of central and peripheral circadian clocks. Neuron 74, 246-260
128. Damiola, F., Le Minh, N., Preitner, N., Kornmann, B., Fleury-Olela, F., and Schibler, U. (2000) Restricted feeding uncouples circadian oscillators in peripheral tissues from the central pacemaker in the suprachiasmatic nucleus. Genes & development 14, 2950-2961
129. Yamamoto, T., Nakahata, Y., Soma, H., Akashi, M., Mamine, T., and Takumi, T. (2004) Transcriptional oscillation of canonical clock genes in mouse peripheral tissues. BMC molecular biology 5, 18
130. DeBruyne, J. P., Weaver, D. R., and Reppert, S. M. (2007) CLOCK and NPAS2 have overlapping roles in the suprachiasmatic circadian clock. Nature neuroscience 10, 543-545
131. Lowrey, P. L., and Takahashi, J. S. (2004) Mammalian circadian biology: elucidating genome-wide levels of temporal organization. Annual review of genomics and human genetics 5, 407-441
132. Siepka, S. M., Yoo, S. H., Park, J., Lee, C., and Takahashi, J. S. (2007) Genetics and neurobiology of circadian clocks in mammals. Cold Spring Harbor symposia on quantitative biology 72, 251-259
117 133. Hirayama, J., and Sassone-Corsi, P. (2005) Structural and functional features of transcription factors controlling the circadian clock. Current opinion in genetics & development 15, 548-556
134. Cho, H., Zhao, X., Hatori, M., Yu, R. T., Barish, G. D., Lam, M. T., Chong, L. W., DiTacchio, L., Atkins, A. R., Glass, C. K., Liddle, C., Auwerx, J., Downes, M., Panda, S., and Evans, R. M. (2012) Regulation of circadian behaviour and metabolism by REV-ERB- alpha and REV-ERB-beta. Nature 485, 123-127
135. Yin, L., Wu, N., Curtin, J. C., Qatanani, M., Szwergold, N. R., Reid, R. A., Waitt, G. M., Parks, D. J., Pearce, K. H., Wisely, G. B., and Lazar, M. A. (2007) Rev-erbalpha, a heme sensor that coordinates metabolic and circadian pathways. Science 318, 1786-1789
136. Peek, C. B., Affinati, A. H., Ramsey, K. M., Kuo, H. Y., Yu, W., Sena, L. A., Ilkayeva, O., Marcheva, B., Kobayashi, Y., Omura, C., Levine, D. C., Bacsik, D. J., Gius, D., Newgard, C. B., Goetzman, E., Chandel, N. S., Denu, J. M., Mrksich, M., and Bass, J. (2013) Circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice. Science 342, 1243417
137. Zmrzljak, U. P., Korencic, A., Kosir, R., Golicnik, M., Sassone- Corsi, P., and Rozman, D. (2013) Inducible cAMP early repressor regulates the Period 1 gene of the hepatic and adrenal clocks. The Journal of biological chemistry 288, 10318-10327
138. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U., and Schibler, U. (2002) The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110, 251-260
118 139. Garaulet, M., and Madrid, J. A. (2009) Chronobiology, genetics and metabolic syndrome. Current opinion in lipidology 20, 127-134
140. Ellingsen, T., Bener, A., and Gehani, A. A. (2007) Study of shift work and risk of coronary events. The journal of the Royal Society for the Promotion of Health 127, 265-267
141. Fonken, L. K., Aubrecht, T. G., Melendez-Fernandez, O. H., Weil, Z. M., and Nelson, R. J. (2013) Dim light at night disrupts molecular circadian rhythms and increases body weight. Journal of biological rhythms 28, 262-271
142. Karlsson, B., Knutsson, A., and Lindahl, B. (2001) Is there an association between shift work and having a metabolic syndrome? Results from a population based study of 27,485 people. Occupational and environmental medicine 58, 747-752
143. Kawakami, N., Takatsuka, N., and Shimizu, H. (2004) Sleep disturbance and onset of type 2 diabetes. Diabetes care 27, 282- 283
144. Spiegel, K., Tasali, E., Leproult, R., and Van Cauter, E. (2009) Effects of poor and short sleep on glucose metabolism and obesity risk. Nature reviews. Endocrinology 5, 253-261
145. Taheri, S., Lin, L., Austin, D., Young, T., and Mignot, E. (2004) Short sleep duration is associated with reduced leptin, elevated ghrelin, and increased body mass index. PLoS medicine 1, e62
146. Suwazono, Y., Dochi, M., Sakata, K., Okubo, Y., Oishi, M., Tanaka, K., Kobayashi, E., Kido, T., and Nogawa, K. (2008) A longitudinal
119 study on the effect of shift work on weight gain in male Japanese workers. Obesity 16, 1887-1893
147. Spiegel, K., Leproult, R., L'Hermite-Baleriaux, M., Copinschi, G., Penev, P. D., and Van Cauter, E. (2004) Leptin levels are dependent on sleep duration: relationships with sympathovagal balance, carbohydrate regulation, cortisol, and thyrotropin. The Journal of clinical endocrinology and metabolism 89, 5762-5771
148. Garaulet, M., Lee, Y. C., Shen, J., Parnell, L. D., Arnett, D. K., Tsai, M. Y., Lai, C. Q., and Ordovas, J. M. (2010) Genetic variants in human CLOCK associate with total energy intake and cytokine sleep factors in overweight subjects (GOLDN population). European journal of human genetics : EJHG 18, 364-369
149. Garcia-Rios, A., Perez-Martinez, P., Delgado-Lista, J., Phillips, C. M., Gjelstad, I. M., Wright, J. W., Karlstrom, B., Kiec-Wilk, B., van Hees, A. M., Helal, O., Polus, A., Defoort, C., Riserus, U., Blaak, E. E., Lovegrove, J. A., Drevon, C. A., Roche, H. M., and Lopez- Miranda, J. (2012) A Period 2 genetic variant interacts with plasma SFA to modify plasma lipid concentrations in adults with metabolic syndrome. The Journal of nutrition 142, 1213-1218
150. Garaulet, M., Corbalan-Tutau, M. D., Madrid, J. A., Baraza, J. C., Parnell, L. D., Lee, Y. C., and Ordovas, J. M. (2010) PERIOD2 variants are associated with abdominal obesity, psycho-behavioral factors, and attrition in the dietary treatment of obesity. Journal of the American Dietetic Association 110, 917-921
151. Turek, F. W., Joshu, C., Kohsaka, A., Lin, E., Ivanova, G., McDearmon, E., Laposky, A., Losee-Olson, S., Easton, A., Jensen, D. R., Eckel, R. H., Takahashi, J. S., and Bass, J. (2005) Obesity
120 and metabolic syndrome in circadian Clock mutant mice. Science 308, 1043-1045
152. Rudic, R. D., McNamara, P., Curtis, A. M., Boston, R. C., Panda, S., Hogenesch, J. B., and Fitzgerald, G. A. (2004) BMAL1 and CLOCK, two essential components of the circadian clock, are involved in glucose homeostasis. PLoS biology 2, e377
153. Paschos, G. K., Ibrahim, S., Song, W. L., Kunieda, T., Grant, G., Reyes, T. M., Bradfield, C. A., Vaughan, C. H., Eiden, M., Masoodi, M., Griffin, J. L., Wang, F., Lawson, J. A., and Fitzgerald, G. A. (2012) Obesity in mice with adipocyte-specific deletion of clock component Arntl. Nature medicine 18, 1768-1777
154. Bugge, A., Feng, D., Everett, L. J., Briggs, E. R., Mullican, S. E., Wang, F., Jager, J., and Lazar, M. A. (2012) Rev-erbalpha and Rev-erbbeta coordinately protect the circadian clock and normal metabolic function. Genes & development 26, 657-667
155. Shostak, A., Meyer-Kovac, J., and Oster, H. (2013) Circadian regulation of lipid mobilization in white adipose tissues. Diabetes 62, 2195-2203
156. Smith, U., and Kahn, B. B. (2016) Adipose tissue regulates insulin sensitivity: role of adipogenesis, de novo lipogenesis and novel lipids. Journal of internal medicine 280, 465-475
157. Zvonic, S., Ptitsyn, A. A., Conrad, S. A., Scott, L. K., Floyd, Z. E., Kilroy, G., Wu, X., Goh, B. C., Mynatt, R. L., and Gimble, J. M. (2006) Characterization of peripheral circadian clocks in adipose tissues. Diabetes 55, 962-970
121 158. Stern, J. H., Rutkowski, J. M., and Scherer, P. E. (2016) Adiponectin, Leptin, and Fatty Acids in the Maintenance of Metabolic Homeostasis through Adipose Tissue Crosstalk. Cell metabolism 23, 770-784
159. Trujillo, M. E., and Scherer, P. E. (2006) Adipose tissue-derived factors: impact on health and disease. Endocrine reviews 27, 762- 778
160. Kersten, S. (2001) Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO reports 2, 282-286
161. Abel, E. D., Peroni, O., Kim, J. K., Kim, Y. B., Boss, O., Hadro, E., Minnemann, T., Shulman, G. I., and Kahn, B. B. (2001) Adipose- selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409, 729-733
162. Norseen, J., Hosooka, T., Hammarstedt, A., Yore, M. M., Kant, S., Aryal, P., Kiernan, U. A., Phillips, D. A., Maruyama, H., Kraus, B. J., Usheva, A., Davis, R. J., Smith, U., and Kahn, B. B. (2012) Retinol- binding protein 4 inhibits insulin signaling in adipocytes by inducing proinflammatory cytokines in macrophages through a c-Jun N- terminal kinase- and toll-like receptor 4-dependent and retinol- independent mechanism. Molecular and cellular biology 32, 2010- 2019
163. Shi, S. Q., Ansari, T. S., McGuinness, O. P., Wasserman, D. H., and Johnson, C. H. (2013) Circadian disruption leads to insulin resistance and obesity. Current biology : CB 23, 372-381
122 164. Maury, E., Ramsey, K. M., and Bass, J. (2010) Circadian rhythms and metabolic syndrome: from experimental genetics to human disease. Circulation research 106, 447-462
165. Gachon, F., Nagoshi, E., Brown, S. A., Ripperger, J., and Schibler, U. (2004) The mammalian circadian timing system: from gene expression to physiology. Chromosoma 113, 103-112
166. Guillaumond, F., Dardente, H., Giguere, V., and Cermakian, N. (2005) Differential control of Bmal1 circadian transcription by REV- ERB and ROR nuclear receptors. Journal of biological rhythms 20, 391-403
167. Van Cauter, E., Blackman, J. D., Roland, D., Spire, J. P., Refetoff, S., and Polonsky, K. S. (1991) Modulation of glucose regulation and insulin secretion by circadian rhythmicity and sleep. The Journal of clinical investigation 88, 934-942
168. Nagaya, T., Yoshida, H., Takahashi, H., and Kawai, M. (2002) Markers of insulin resistance in day and shift workers aged 30-59 years. International archives of occupational and environmental health 75, 562-568
169. Schernhammer, E. S., Laden, F., Speizer, F. E., Willett, W. C., Hunter, D. J., Kawachi, I., Fuchs, C. S., and Colditz, G. A. (2003) Night-shift work and risk of colorectal cancer in the nurses' health study. Journal of the National Cancer Institute 95, 825-828
170. Schernhammer, E. S., Laden, F., Speizer, F. E., Willett, W. C., Hunter, D. J., Kawachi, I., and Colditz, G. A. (2001) Rotating night shifts and risk of breast cancer in women participating in the nurses' health study. Journal of the National Cancer Institute 93, 1563-1568
123 171. Shi, H., Tzameli, I., Bjorbaek, C., and Flier, J. S. (2004) Suppressor of cytokine signaling 3 is a physiological regulator of adipocyte insulin signaling. The Journal of biological chemistry 279, 34733- 34740
172. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408
173. Xie, Y., Lashuel, H. A., Miroy, G. J., Dikler, S., and Kelly, J. W. (1998) Recombinant human retinol-binding protein refolding, native disulfide formation, and characterization. Protein expression and purification 14, 31-37
174. Napoli, J. L. (2016) Functions of Intracellular Retinoid Binding- Proteins. Sub-cellular biochemistry 81, 21-76
175. Thompson, S. J., Sargsyan, A., Lee, S. A., Yuen, J. J., Cai, J., Smalling, R., Ghyselinck, N., Mark, M., Blaner, W. S., and Graham, T. E. (2017) Hepatocytes Are the Principal Source of Circulating RBP4 in Mice. Diabetes 66, 58-63
176. Harding, H. P., and Lazar, M. A. (1995) The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Molecular and cellular biology 15, 4791-4802
177. Prasai, M. J., Mughal, R. S., Wheatcroft, S. B., Kearney, M. T., Grant, P. J., and Scott, E. M. (2013) Diurnal variation in vascular and metabolic function in diet-induced obesity: divergence of insulin resistance and loss of clock rhythm. Diabetes 62, 1981-1989
124 178. Blumer, R. M., van Roomen, C. P., Meijer, A. J., Houben-Weerts, J. H., Sauerwein, H. P., and Dubbelhuis, P. F. (2008) Regulation of adiponectin secretion by insulin and amino acids in 3T3-L1 adipocytes. Metabolism: clinical and experimental 57, 1655-1662
179. Moldes, M., Beauregard, G., Faraj, M., Peretti, N., Ducluzeau, P. H., Laville, M., Rabasa-Lhoret, R., Vidal, H., and Clement, K. (2006) Adiponutrin gene is regulated by insulin and glucose in human adipose tissue. European journal of endocrinology 155, 461-468
180. Hirashima, Y., Tsuruzoe, K., Kodama, S., Igata, M., Toyonaga, T., Ueki, K., Kahn, C. R., and Araki, E. (2003) Insulin down-regulates insulin receptor substrate-2 expression through the phosphatidylinositol 3-kinase/Akt pathway. The Journal of endocrinology 179, 253-266
181. Berry, D. C., and Noy, N. (2012) Signaling by vitamin A and retinol- binding protein in regulation of insulin responses and lipid homeostasis. Biochimica et biophysica acta 1821, 168-176
182. White, U. A., Coulter, A. A., Miles, T. K., and Stephens, J. M. (2007) The STAT5A-mediated induction of pyruvate dehydrogenase kinase 4 expression by prolactin or growth hormone in adipocytes. Diabetes 56, 1623-1629
183. Jarrett, R. J., Baker, I. A., Keen, H., and Oakley, N. W. (1972) Diurnal variation in oral glucose tolerance: blood sugar and plasma insulin levels morning, afternoon, and evening. British medical journal 1, 199-201
125 184. Ruan, H., and Dong, L. Q. (2016) Adiponectin signaling and function in insulin target tissues. Journal of molecular cell biology 8, 101-109
185. Friedman, J. M., and Halaas, J. L. (1998) Leptin and the regulation of body weight in mammals. Nature 395, 763-770
186. Connaughton, S., Chowdhury, F., Attia, R. R., Song, S., Zhang, Y., Elam, M. B., Cook, G. A., and Park, E. A. (2010) Regulation of pyruvate dehydrogenase kinase isoform 4 (PDK4) gene expression by glucocorticoids and insulin. Molecular and cellular endocrinology 315, 159-167
187. Ueki, K., Kondo, T., and Kahn, C. R. (2004) Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Molecular and cellular biology 24, 5434-5446
188. Palanivel, R., Fullerton, M. D., Galic, S., Honeyman, J., Hewitt, K. A., Jorgensen, S. B., and Steinberg, G. R. (2012) Reduced Socs3 expression in adipose tissue protects female mice against obesity- induced insulin resistance. Diabetologia 55, 3083-3093
189. Bjorbak, C., Lavery, H. J., Bates, S. H., Olson, R. K., Davis, S. M., Flier, J. S., and Myers, M. G., Jr. (2000) SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. The Journal of biological chemistry 275, 40649-40657
190. Emilsson, V., Arch, J. R., de Groot, R. P., Lister, C. A., and Cawthorne, M. A. (1999) Leptin treatment increases suppressors of
126 cytokine signaling in central and peripheral tissues. FEBS letters 455, 170-174
191. Steppan, C. M., Wang, J., Whiteman, E. L., Birnbaum, M. J., and Lazar, M. A. (2005) Activation of SOCS-3 by resistin. Molecular and cellular biology 25, 1569-1575
192. Carrasco-Benso, M. P., Rivero-Gutierrez, B., Lopez-Minguez, J., Anzola, A., Diez-Noguera, A., Madrid, J. A., Lujan, J. A., Martinez- Augustin, O., Scheer, F. A., and Garaulet, M. (2016) Human adipose tissue expresses intrinsic circadian rhythm in insulin sensitivity. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 30, 3117-3123
193. Delezie, J., Dumont, S., Dardente, H., Oudart, H., Grechez- Cassiau, A., Klosen, P., Teboul, M., Delaunay, F., Pevet, P., and Challet, E. (2012) The nuclear receptor REV-ERBalpha is required for the daily balance of carbohydrate and lipid metabolism. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 26, 3321-3335
194. Ma, X., Zhou, Z., Chen, Y., Wu, Y., and Liu, Y. (2016) RBP4 functions as a hepatokine in the regulation of glucose metabolism by the circadian clock in mice. Diabetologia 59, 354-362
195. Zemany, L., Bhanot, S., Peroni, O. D., Murray, S. F., Moraes-Vieira, P. M., Castoldi, A., Manchem, P., Guo, S., Monia, B. P., and Kahn, B. B. (2015) Transthyretin Antisense Oligonucleotides Lower Circulating RBP4 Levels and Improve Insulin Sensitivity in Obese Mice. Diabetes 64, 1603-1614
127 196. Mody, N., and McIlroy, G. D. (2014) The mechanisms of Fenretinide-mediated anti-cancer activity and prevention of obesity and type-2 diabetes. Biochemical pharmacology 91, 277-286
197. Baran, A., Swiderska, M., and Flisiak, I. (2016) The effect of topical treatment and psoriasis severity on serum retinol-binding protein-4 levels. The Journal of dermatological treatment 27, 114-119
198. Choi, S. H., Chun, S. Y., Kim, T. H., and Kwon, T. G. (2016) Identifying the emerging role of adipokine as a diagnostic and prognostic biomarker of renal cell carcinoma. Urologic oncology 34, 259 e215-259
199. Jia, J., Bai, J., Liu, Y., Yin, J., Yang, P., Yu, S., Ye, J., Wang, D., and Yuan, G. (2014) Association between retinol-binding protein 4 and polycystic ovary syndrome: a meta-analysis. Endocrine journal 61, 995-1002
200. Lu, Q., Liu, C., Liu, Y., Zhang, N., Deng, H., and Zhang, Z. (2016) Serum markers of pre-eclampsia identified on proteomics. The journal of obstetrics and gynaecology research 42, 1111-1118
201. Hogan, J. C., and Stephens, J. M. (2005) The regulation of fatty acid synthase by STAT5A. Diabetes 54, 1968-1975
202. Coulter, A. A., and Stephens, J. M. (2006) STAT5 activators modulate acyl CoA oxidase (AOX) expression in adipocytes and STAT5A binds to the AOX promoter in vitro. Biochemical and biophysical research communications 344, 1342-1345
203. Richter, H. E., Albrektsen, T., and Billestrup, N. (2003) The role of signal transducer and activator of transcription 5 in the inhibitory
128 effects of GH on adipocyte differentiation. Journal of molecular endocrinology 30, 139-150
204. White, U. A., Maier, J., Zhao, P., Richard, A. J., and Stephens, J. M. (2016) The modulation of adiponectin by STAT5-activating hormones. American journal of physiology. Endocrinology and metabolism 310, E129-136
205. Kawai, M., and Rosen, C. J. (2010) PPARgamma: a circadian transcription factor in adipogenesis and osteogenesis. Nature reviews. Endocrinology 6, 629-636
206. Howard, J. K., and Flier, J. S. (2006) Attenuation of leptin and insulin signaling by SOCS proteins. Trends in endocrinology and metabolism: TEM 17, 365-371
207. Emanuelli, B., Peraldi, P., Filloux, C., Sawka-Verhelle, D., Hilton, D., and Van Obberghen, E. (2000) SOCS-3 is an insulin-induced negative regulator of insulin signaling. The Journal of biological chemistry 275, 15985-15991
208. Chen, J., Sadowski, H. B., Kohanski, R. A., and Wang, L. H. (1997) Stat5 is a physiological substrate of the insulin receptor. Proceedings of the National Academy of Sciences of the United States of America 94, 2295-2300
209. Tamemoto, H., Kadowaki, T., Tobe, K., Yagi, T., Sakura, H., Hayakawa, T., Terauchi, Y., Ueki, K., Kaburagi, Y., Satoh, S., and et al. (1994) Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 372, 182-186
129 210. Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I., Bonner- Weir, S., and White, M. F. (1998) Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-904
211. Rice, K. M., Turnbow, M. A., and Garner, C. W. (1993) Insulin stimulates the degradation of IRS-1 in 3T3-L1 adipocytes. Biochemical and biophysical research communications 190, 961- 967
212. Sun, X. J., Goldberg, J. L., Qiao, L. Y., and Mitchell, J. J. (1999) Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 48, 1359-1364
213. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki, T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., and Yoshimura, A. (1997) A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387, 921-924
214. Taniguchi, C. M., Emanuelli, B., and Kahn, C. R. (2006) Critical nodes in signalling pathways: insights into insulin action. Nature reviews. Molecular cell biology 7, 85-96
215. Vanhaesebroeck, B., and Alessi, D. R. (2000) The PI3K-PDK1 connection: more than just a road to PKB. The Biochemical journal 346 Pt 3, 561-576
216. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Characterization of a 3- phosphoinositide-dependent protein kinase which phosphorylates
130 and activates protein kinase Balpha. Current biology : CB 7, 261- 269
217. Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabatini, D. M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor- mTOR complex. Science 307, 1098-1101
218. Gonzalez-Rodriguez, A., Mas Gutierrez, J. A., Sanz-Gonzalez, S., Ros, M., Burks, D. J., and Valverde, A. M. (2010) Inhibition of PTP1B restores IRS1-mediated hepatic insulin signaling in IRS2- deficient mice. Diabetes 59, 588-599
219. Galic, S., Hauser, C., Kahn, B. B., Haj, F. G., Neel, B. G., Tonks, N. K., and Tiganis, T. (2005) Coordinated regulation of insulin signaling by the protein tyrosine phosphatases PTP1B and TCPTP. Molecular and cellular biology 25, 819-829
220. Rodgers, S. J., Ferguson, D. T., Mitchell, C. A., and Ooms, L. M. (2017) Regulation of PI3K effector signalling in cancer by the phosphoinositide phosphatases. Bioscience reports 37
221. Viernes, D. R., Choi, L. B., Kerr, W. G., and Chisholm, J. D. (2014) Discovery and development of small molecule SHIP phosphatase modulators. Medicinal research reviews 34, 795-824
222. Hemmingsen, M., Vedel, S., Skafte-Pedersen, P., Sabourin, D., Collas, P., Bruus, H., and Dufva, M. (2013) The role of paracrine and autocrine signaling in the early phase of adipogenic differentiation of adipose-derived stem cells. PloS one 8, e63638
223. Siegrist-Kaiser, C. A., Pauli, V., Juge-Aubry, C. E., Boss, O., Pernin, A., Chin, W. W., Cusin, I., Rohner-Jeanrenaud, F., Burger,
131 A. G., Zapf, J., and Meier, C. A. (1997) Direct effects of leptin on brown and white adipose tissue. The Journal of clinical investigation 100, 2858-2864
224. Wang, M. Y., Lee, Y., and Unger, R. H. (1999) Novel form of lipolysis induced by leptin. The Journal of biological chemistry 274, 17541-17544
225. Hatori, M., Vollmers, C., Zarrinpar, A., DiTacchio, L., Bushong, E. A., Gill, S., Leblanc, M., Chaix, A., Joens, M., Fitzpatrick, J. A., Ellisman, M. H., and Panda, S. (2012) Time-restricted feeding without reducing caloric intake prevents metabolic diseases in mice fed a high-fat diet. Cell metabolism 15, 848-860
226. Kopelman, P. G. (2000) Obesity as a medical problem. Nature 404, 635-643
227. Shearer, K. D., Goodman, T. H., Ross, A. W., Reilly, L., Morgan, P. J., and McCaffery, P. J. (2010) Photoperiodic regulation of retinoic acid signaling in the hypothalamus. Journal of neurochemistry 112, 246-257
228. McCaffery, P., Zhang, J., and Crandall, J. E. (2006) Retinoic acid signaling and function in the adult hippocampus. Journal of neurobiology 66, 780-791
229. Breen, J. J., Hickok, N. J., and Gurr, J. A. (1997) The rat TSHbeta gene contains distinct response elements for regulation by retinoids and thyroid hormone. Molecular and cellular endocrinology 131, 137-146
132 230. Zetterstrom, R. H., Lindqvist, E., Mata de Urquiza, A., Tomac, A., Eriksson, U., Perlmann, T., and Olson, L. (1999) Role of retinoids in the CNS: differential expression of retinoid binding proteins and receptors and evidence for presence of retinoic acid. The European journal of neuroscience 11, 407-416
231. Choi, Y. O., Ryu, H. J., Kim, H. R., Song, Y. S., Kim, C., Lee, W., Choe, H., Leem, C. H., and Jang, Y. J. (2006) Implication of phosphorylation of the myosin II regulatory light chain in insulin- stimulated GLUT4 translocation in 3T3-F442A adipocytes. Experimental & molecular medicine 38, 180-189
232. Pershadsingh, H. A., Shade, D. L., Delfert, D. M., and McDonald, J. M. (1987) Chelation of intracellular calcium blocks insulin action in the adipocyte. Proceedings of the National Academy of Sciences of the United States of America 84, 1025-1029
233. Worrall, D. S., and Olefsky, J. M. (2002) The effects of intracellular calcium depletion on insulin signaling in 3T3-L1 adipocytes. Molecular endocrinology 16, 378-389
133