Gene Disruption Causes Globozoospermia and Infertility in Male Mice

REPRODUCTIONRESEARCH Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice Joanne Doran1, Cara Walters2, Victoria Kyle2, Peter Wooding2, Rebecca Hammett-Burke2 and William Henry Colledge2 1Takeda Cambridge Ltd, Cambridge, UK and 2Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK Correspondence should be addressed to W H Colledge; Email: [email protected] Abstract The Mfsd14a gene, previously called Hiat1, encodes a transmembrane protein of unknown function with homology to the solute carrier protein family. To study the function of the MFSD14A protein, mutant mice (Mus musculus, strain 129S6Sv/Ev) were generated with the Mfsd14a gene disrupted with a LacZ reporter gene. Homozygous mutant mice are viable and healthy, but males are sterile due to a 100-fold reduction in the number of spermatozoa in the vas deferens. Male mice have adequate levels of testosterone and show normal copulatory behaviour. The few spermatozoa that are formed show rounded head defects similar to those found in humans with globozoospermia. Spermatogenesis proceeds normally up to the round spermatid stage, but the subsequent structural changes associated with spermiogenesis are severely disrupted with failure of acrosome formation, sperm head condensation and mitochondrial localization to the mid-piece of the sperm. Staining for β-galactosidase activity as a surrogate for Mfsd14a expression indicates expression in Sertoli cells, suggesting that MFSD14A may transport a solute from the bloodstream that is required for spermiogenesis. Reproduction (2016) 152 91–99 Introduction Spermatogenesis is the developmental process by which which include Atg7 (Wang et al. 2014), Csnk2a2 (Xu spermatozoa are produced from spermatogonial germ et al. 1999), Dpy19l2 (Pierre et al. 2012), Gopc (Yao cells in the gonads (Grootegoed et al. 1995, Jan et al. et al. 2002), Agfg1 (Hrb) (Kang-Decker et al. 2001), 2012). At the start of this process, spermatogonial cells Hsp19β1 (Audouard & Christians 2011), Pick1 (Xiao et give rise to primary spermatocytes, which progress al. 2009), Smap2 (Funaki et al. 2013), Spaca1 (Fujihara through meiosis to produce haploid spermatids. The et al. 2012) and Vps54 (Paiardi et al. 2011). Similarly, spermatids subsequently undergo spermiogenesis, a causative mutations of globozoospermia have been complex series of morphological changes to form sper- identified in humans inclu ding DPY19L2 (Harbuz et al. matozoa (Toshimori & Ito 2003). During spermiogen- 2011, Koscinski et al. 2011), PICK1 (Liu et al. 2010) and esis, chromatin condensation and nuclear remodelling SPATA16 (Dam et al. 2007b). occur, and also formation of the acrosome that contains The Mfsd14a (a.k.a. Hiat1) gene was originally iden- glycosylated enzymes essential for egg fertilization. The tified as an abundant transcript isolated from a fetal acrosome is formed by the fusion of proacrosomal vesi- mouse hippocampus cDNA library (Matsuo et al. 1997) cles derived from the Golgi apparatus, which fuse to and classified as a member of the major facilitator form a cap structure over the nucleus. A flagellum with superfamily of solute carrier proteins (SLCs) (Sreedharan the central 9 + 2 microtubular axoneme is also formed et al. 2011). The SLC’s consist of a large group of pro- during spermiogenesis and contains a mid-piece packed teins capable of transporting diverse substances includ- with mitochondria to provide energy for motility. ing amino acids, sugars, nucleosides and fatty acids Defects in spermiogenesis contribute to male infertil- (Hediger et al. 2004). The Mfsd14a gene shows modest ity problems in humans. Globozoospermia is one such sequence homology with the E. coli tetracycline-resistant syndrome that is found in around 0.1% of infertile men protein class C (31%) and with the mouse GLUT2 and (Dam et al. 2007a). The disorder is characterized by GLUT4 glucose transporters (29%). Furthermore, the round-headed sperm with a disrupted acrosome and protein has a similar structure to existing sugar transport- abnormal mitochondrial localization. Genes that cause ers including 12-transmembrane spanning α-helices, globozoospermia have been identified in mutant mice, a D-R/K-X-G-R-R/K motif between the 2nd and 3rd © 2016 Society for Reproduction and Fertility DOI: 10.1530/REP-15-0557 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org Downloaded from Bioscientifica.com at 10/01/2021 04:44:48AM via free access 10.1530/REP-15-0557 92 J Doran and others transmembrane domains and a region similar to the Mutant Mfsd14a allele, Reverse Primer: TGGC- facilitative glucose transporter specific P-E-S-P-R motif GAAAGGGGGATGTG at the end of the 6th transmembrane domain. These Wild-type Mfsd14a allele, Forward Primer: GTCTGGGAC- characte ristics suggest that the Mfsd14a gene may CAGCCCTTTAT encode a novel sugar transporter, but the solute specific- Wild-type Mfsd14a allele, Reverse Primer: ACGAGCAGGTA- ity of the protein is not known. AAGGCTCAA To establish the physiological function of the MFSD14A protein in vivo, we generated a transgenic RT-PCR mouse line with a LacZ gene insertion that disrupts the expression of the Mfsd14a gene. Phenotypic char- Total RNA was prepared from testes using an SV Total RNA acterization of these mutant mice indicated that the Isolation kit Z3101 (Promega) and converted into cDNA using a GoScript Reverse Transcription Kit, A5000 (Promega) MFSD14A protein is required for the spermiogenesis according to the manufacturer’s instructions. All primer pairs stage in sperm formation, whereby round spermatids are spanned introns to eliminate any amplification from genomic structurally remodelled into spermatozoa. DNA, and RNA samples were included without a reverse transcription step as a negative control. The primer pairs were the following: mHprtF (CAGGCCAGACTTTGTTGGAT)/mHprtR Materials and methods (TTGCGCTCATCTTAGGCTTT), 147 bp product; mMfsd14aEx1F Gene targeting and generation of mutant mice (ATGACCCAGGGGAAGAAAAAG)/mMfsd14aEx3R (GGTTTCATGCAATACCACCA), 195 bp product; mMfsd14aEx4F The transgenic mice were generated by standard methods in (GTTTGGGGCCGAAAGTCC) mMfsd14aEx5R (GCAAAAA- collaboration with Takeda Cambridge. The targeting vector was CCCCAGAAACAGA), 119 bp product. constructed using homology arms amplified from 129S6Sv/Ev The amplification cycle was 95°C, 5 min, (93°C, 0.5 min, mouse genomic DNA using the following primers: 60°C, 0.5 min, 70°C, 1 min) × 40. 5′armF: CCAACAAATAAGAGAGCGCTGCCTGTG; 5 armR: ACCAATAAGTGGGGCACTGAGGAATG; ′ Sperm and germ cell counts 3′armF: CTCTGATGAAGATCAGCCCGTGGTAAG; 3′armR: GCAGTAAGCCAGCCTGGGTATAGTAAAG. Mice were killed and sperm isolated from a fixed length of the vas deferens by squeezing into 100 µL of 1% PBS. The 5 armF/R primers amplified a 1.54 kb fragment, and the ′ A 25 µL sample was loaded onto a haemocytometer and 3 armF/R primer pair amplified a 3.9 kb fragment. The arms ′ the number of sperm was counted. For quantitation of germ were cloned on either side of a cassette containing an IRESLacZ cells, haematoxylin- and eosin-stained sections at stages reporter gene and a promoted neomycin phosphoribosyltrans- IV/V/VI of the seminiferous cycle were photographed at ferase selectable marker gene. Homologous recombination the same magnification and the number of each germ cell of this targeting construct results in the deletion of 70 bp of type was counted in a 100 200 m rectangle drawn on the exon 4 of the Mfsd14a locus, which changes the coding frame × µ photomicrograph. Counts were made from 49 rectangles for to one that contains 23 stop codons and terminates translation wild-type mice (n 4) and from 48 rectangles for mutant of the MFSD14A protein at Glycine 93. = mice (n 4). ES cells (CCB; 129S6/SvEv strain) were cultured, and = gene targeting was performed as described previously (Ratcliff et al. 1992). Targeted clones were identified by PCR. Testosterone ELISA Chimaeras were generated by injection into C57/Bl6 Total plasma testosterone levels were measured in wild-type blastocysts, and inbred mice were established by breeding and mutant mice at approximately 3 months of age using a germline chimeras with 129S6Sv/Ev mice. commercially available ELISA kit (DRG International, USA, EIA-1559) according to the manufacturer’s instructions. Animals The analytical sensitivity of the ELISA was 0.083 ng/mL, the intra-assay variation was 3.2% and the inter-assay variation All experiments were performed in accordance with the rele- was 6.7%. Blood (100 µL) was collected from the vena cava vant guidelines and regulation under the authority of a United and mixed with 2 µL 0.5 M ethylenediaminetetracetic acid Kingdom Home Office Project Licence and were approved (EDTA) anti-coagulant. Plasma was obtained by centrifuga- by the Local Ethical Review Committee of the University of tion of the sample at 16,500 g for 5 min and stored at 80°C Cambridge. − until assayed. Plasma samples were assayed without further extractions, so that the free testosterone levels were mea- Genotyping transgenic mice sured. Mice were genotyped by PCR using genomic DNA from ear biopsies. Genotyping primers were as follows: Histology Mutant Mfsd14a allele, Forward Primer: GTCTGGGAC- Tissues were fixed in 4% paraformaldehyde/PBS overnight at CAGCCCTTTAT 4°C, dehydrated through graded alcohols and embedded in Reproduction (2016) 152 91–99 www.reproduction-online.org Downloaded from Bioscientifica.com at 10/01/2021 04:44:48AM via free access Mfsd14a disruption

Load more