IAEA-TECDOC-748
Radionuclides in molecular technology for diagnosis of communicable diseases
Edited by Professor Savanat Tharavanij and Dr. Srisin Khusmith
INTERNATIONAL ATOMIC ENERGY AGENCA / Y The IAEA does not normally maintain stocks of reports in this series. However, microfiche copies of these reports can be obtained from
ClearinghousS I N I e International Atomic Energy Agency Wagramerstrasse 5 0 10 P.Ox Bo . A-1400 Vienna, Austria
Orders should be accompanied by prepayment of Austrian Schillings 100,- in the form of a cheque or in the form of IAEA microfiche service coupons which may be ordered separately from the INIS Clearinghouse. originatine Th g Sectio f thino s documen IAEe th An i t was: Nuclear Medicine Section International Atomic Energy Agency Wagramerstrasse 5 P.O. Box 100 A-1400 Vienna, Austria
RADIONUCLIDES IN MOLECULAR TECHNOLOGY FOR DIAGNOSI COMMUNICABLF SO E DISEASES IAEA, VIENNA, 1994 IAEA-TECDOC-748 ISSN 1011-4289 Printe IAEe th AustriAn y i d b a May 1994 FOREWORD
Advance moleculan si r techniques continu madevee n b a t ro e a t increasin g rate. Thes related ean d procedures mann ,i f whicyo h radionuclide tracers pla importann ya t role, have f immensproveo e b o nt e potentia t onl no researchlyn i t als routinbu ,n o i e diagnosis of communicable diseases. Clinical problems, both diagnostic and therapeutic, are being solve usiny db approachew gne s made possibl advene th y f theseb o t e techniquesn I .
diagnosis the amplification of DMA by the polymerase chain reaction and hybridization with P-labelle32 d DMA probes has excited clinical microbiologists for such methods can specifically identify organisms directl clinican i y l specimen reducn ca e timd eth ean s required to identify fastidious pathogens, even in diseases such as tuberculous meningitis and Chagas disease, in which the paucity of the infectious organisms had previously frustrated laboratory diagnosi conventionay sb l techniques thest Ye . e technique oftee sar n inaccessible to many biomedical scientists and clinicians in developing countries and there is a clear need to add these powerful techniques to the range of tools available in developing countrie r researcsfo diagnosid han communicabln si e diseases.
One of the roles of international organizations is to assist in the transfer of such new technologie developino st g countries. With this objective IAEe th , A organizee th t da Facult f Tropicayo l Medicine, Mahidol University, Bangkok trainin,a g cours Septembeen i r 1992 on "Recent Nuclear Techniques in Diagnosis of Communicable Diseases" which was attende participant6 1 y db s fro Membe1 m1 r State Asie Pacifid th aan f so c Regiond an , a semina Novemben i r r 199 "Immunoassan o 2 Labelled y an Probe A dDN Diagnosin si f so Communicable Diseases" whic attendes participanth2 wa 11 y db s fro Membem7 1 r States.
The course focused largely on the teaching of molecular techniques, whereas the seminar presented the experiences of various experts in the application of such techniques in research and diagnosis. This TECDOC contains those aspects of the proceedings from the two events which focus on molecular techniques, and is in two parts: Part I contains the laboratory protocols that were taught at the course and Part II contains 9 of the 43 papers presente seminae th t da r which illustrat applicatioe eth f moleculano r techniques. EDITORIAL NOTE
preparingIn this document press,for IAEAthe staffof have pages madethe up from the original manuscripts as submitted by the authors. The views expressed do not necessarily reflect those of the governments of the nominating Member States or of the nominating organizations. The use of particular designations of countries or territories does not imply any judgement by publisher,the legalthe IAEA, to status the as of such countries territories,or of their authoritiesand institutions delimitationthe of or of their boundaries. The mention of names of specific companies or products (whether or not indicated as registered) does implyintentionnot any infringeto proprietary rights, should construednor be it an as endorsement or recommendation on the part of the IAEA. The authors are responsible for having obtained the necessary permission for the IAEA to reproduce, translate or use material from sources already protected by copyrights. CONTENTS
Introduction ...... 7
. I LABORATORY PROTOCOL MOLECULAR SFO R TECHNIQUES
Radioiodinatio f proteinno solution si n ...... 1 1 . J.B. Castelino Sodium dodecyl sulphate-polyacrylamide gel electrophoresis and western blotting for protein antigen analysis ...... 13 Pramuan Tapchaisri, Srisin Khusmith, Yuwaporn Ruangkunaporn Selected techniques in recombinant DNA technology ...... 21 Pramuan Tapchaisri Detection of enteroinvasive Escherichia col! on a colony blot filter paper by hybridization with a 17 kb probe ...... 31 Oralak Serichantalergs, Channarong Sanghiran, Wipawee Usawatanakul, Korbkit Cherdchu Pathogen detection by the polymerase chain reaction ...... 41 Suwicha Tim Chitpatima, D.R. Dvorak, Dhana Settachan, Jaturaporn Pornsilpatip, Unchalee Visawapoka
II. APPLICATIONS OF MOLECULAR TECHNIQUES
In vitro application radionuclidef so communicabln si e disease overvien A s- w ...9 .6 /. Nath Detection and identification of infectious organisms: Application of molecular probe technology ...... 5 7 . S.F. Yap Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis ...... 79 S.F. Yap, Y.C. Chert, P.W. Wong, T.S. Soo-Hoo Detectio f Mycobacteriumno tuberculosis clinican i l samples usine gth polymerase chain reaction: Avoiding amplicon contamination ...... 3 8 . A. Kolk, L. Kox, Dhanida Rienthong, A. Medo Miranda, Nibondh Udomsantisuk, K. Ellis, J. van Leeuwen, S. Kuijper A frequencstude th f yo f infectioyo f peripherano l blood mononuclear cellf so chronic hepatitis B virus carriers using the polymerase chain reaction and hybridization analysis ...... 93 S.F. Yap, P.W. Wong, K.L. Goh, N.W. Wong Expression-PCR rapiA : d metho vitrn i r od fo expressio productR PC f nso ...... 7 9 . K.C. Kain, P.A. Orlandi, D.E. Lanar A comparative study of using DNA probe (pPF 14) and microscopy in diagnosis of Falciparum malaria ...... 3 10 . Jianliang Yang, Yongqi Kong, Cunxing Yang, Huiming Lu Application of molecular probes in histopathology of communicable diseases .... 107 L.M. Loo/, P.L. Cheah Epstein-Barr Virus (EBV) gene expressio HIV-associaten i d oral hairy leukoplaki5 11 . a R. Pathmanathan, K. Gilligan, L Resnick, N. Raab-Traub
List of Partipants ...... 121 INTRODUCTION
Molecular techniques continue to advance at a striking and ever increasing pace and makinw areno g significant inroad mann si y clinicae areath f so l microbiology laboratory. These include method r straisfo n typing suc plasmis ha d A fingeDN f ro printinge us e th , hybridization tests for identification of pathogens, and the use of polymerase chain reaction deteco t t pathogens presen vern numberi tw ylo clinican si l specimens consequencA . e of this phenomenal rat f progreseo thesn si e method bees sha n that many cliniciand san biomedical scientists in developing countries have found it impossible to keep pace with current developments, a situation exacerbated by the free use of jargon, and, as with all rapidly growing fields, it will be some time before comprehensive textbooks catch up. This technical document has been prepared with the view to filling the resultant vacuum. It is based on a training course and a seminar organized jointly by the International Atomic Energy Agency and Mahidol University, Bangkok, during 1992.
In laboratories dealing with diagnosis of communicable diseases, the first analysis of clinical materia usualls i l y don lighy eb t microscopy after suitable staining. Whilst helpful in guiding therap r acutelyfo l patientsyil , microscopy techniques lac botn ki h sensitivity and specificity. Thus cultures remai gole nth d standard. However cleas i t i , r tha mann i t y case gole sth d standar 100a t %no d s sensitivei . Moreover, culture method generan i e sar l slo laboriousd wan t therincreasen a Ye . es i d desire from physician havo st e results more rapidly.
The need for rapid results is partially filled by immunological tests such as radioimmunoassays, ELISA (enzyme linked immuno-sorbent assay) and Western blot. The las thesf to e method labelline th indicato e d th sf an g o r reagent with 125iodin describee ear d in the first two papers of this TECDOC. These immunological tests, though sensitive, sometimes lack specificity, particularl developinn yi g countries where tests categorizes da 'highly specific industrializen i ' d countries cross-react wit hose hf th microorganism o t s present in many developing countries.
The second forma r rapifo t d testin nucleigs i c acid hybridization earls A 198.s ya 0 it was demonstrated that genetic information contained within an organism could be exploited as a means for its identification. Enterotoxigenic Escherichia coli were identified in stool samples after growth on agar plates. Since then there have been numerous reports on the effectiveness of DNA probes for identification of pathogenic microorganisms ranging from viruse helminthio st c worms succese nucleie Th . th f so c acid probes stems froe mth fact that the probe DNA (or in some cases, RNA) can be labelled with radioisotopes of high specific activity that allows the microbiologist to detect the binding of the probe to the target nucleic acid-contained within a specific organism. The use of the DNA hybridization method is described in the paper entitled "Detection of enteroinvasive Escherichia coli on a colony blot filter pape hybridizatioy rb probeb nK witidentifyinr 7 1 "fo ha g gastro-enteric pathogens.
The success of the nucleic acid hybridization method depends partly on the number of organisms in the specimen. Some diseases such as tuberculous meningitis and tuberculoid leprosy are noted for the low numbers of organisms present in clinical specimens r sucFo h. cases thira , d forma r rapifo t d testin bees gha n developee th d— amplification of specific segments of DNA by the polymerase chain reaction (PCR). The PCR is an in vitro method for the enzymatic synthesis of specific DNA (or cDNA) sequences usin oligonucleotido gtw e primers that hybridiz opposito et e strand fland san k the region of interest in the target DNA. A repetitive series of cycles involving template denaturation, primer annealing and extension of the annealed primers by DNA polymerase result exponentiae th n si l accumulatio specifia f no c fragment whose termin definee ar i d primerse ' end5 th f e bso y th . Becaus primee eth r extension products synthesizee on n di cycle can serve as a template in the next, the number of target DMA copies approximately double t evera s y cycle. yieldThuR 0 cycle2 PC ss f abouo s a milliot n fold (220) amplification. Protocol cDNd d amplif describeo t e an usinr an A sar R A fo V gyHI PC DN r dfo rabies papee viruth n si r entitled "Pathogen detectio polymerase th y nb e chain reaction".
The advent of molecular techniques has transformed the way researchers approach both fundamenta applied an l d problems associated with diseases. Parf thio sI I t document presents somapplicatione th f eo f sucso h techniques. Molecular technique beine sar g used to elucidate immune mechanisms and these are reviewed in the first paper by Indira Nath.
nucleid an ThR c eaciPC d hybridization method rapidle sar y becomin work-horse gth e of diagnosti histopathologd can y laboratories. The usee yar epidemiologyn d i routinn i , e diagnosi r identifyinfo d san causative gth e organism certain si n carcinomas. Examplef so these application tuberculosisn i s , hepatitis, malaria oran i d l hairan , y leucoplakie aar presente Pardn i . II t
provideR WhilsPC e a sensitivs th t e diagnostic method s susceptibli t i , o t e contamination. Given the capacity of PCR to synthesize millions of DNA copies, contamination of the sample reaction with either products of a previous reaction (product- carryover witr o ) h material fro exogenoun ma s sourc potentiaa s ei l problem particularl- y in those reactions initiated with only a few templates. Careful laboratory procedure, prealiquotin f gpositivo reagentse us e e displacementh , t e physicapipetteth d an sl separatio reactioe th f no n preparation fro analysie m th reactioe th f so n productl al e sar precautions that reduce risk. A. Kolk et al. describe the use of dUTP and uracil DNA glycosylase to prevent carry-over contamination in a paper on "Detection of Mycobacterium tubercolosis in clinical samples using the polymerase chain reaction: avoiding amplicon contamination".
consideres i Althoug R PC e hdth primaril methoya r producindfo g copie specifia f so c sequence, it is also a very powerful and precise way of altering a particular template sequence. Since the oligonucleotide primers become physically incorporated into the amplified product and mismatches between the 5' end of the primer and the initial template are tolerated possibls i t i , introduco et sequencw ene e information adjacen targee th o t t sequence via the primers. Thus, for cloning a given sequence, one is no longer constrained by the restriction sites nature provides but can add any restriction enzyme recognition prime sequence ' end5 th f e so r th leadin o formatioee t restrictio w th ne o g t a f no n site. Similarly, regulatory elements such as a T7 promoter can be added allowing the synthesis copieA producRN R sf o PC fro polymeraseA e tm th usin RN 7 gT . Suc methoha e b y dma used to synthesize proteins from genomic DNA as described by K.C. Kain et al. in the paper entitled "Expression PCR rapiA : d metho vitron i r d fo expressio products"R PC f no .
Molecular techniques hav vasea t potentia r solvinfo l g clinical problems associated with communicable diseases. The increasingle yar y use industrializedn i d countries where they often for bace mth k bon f diagnostieo c laboratories. This Technical Documens ha t been prepared in an effort to provide information on some of these techniques so that these tools may be used more extensively in developing countries.
Next page(s) left blank Parti
LABORATORY PROTOCOLS FOR MOLECULAR TECHNIQUES RADIOIODINATIO PROTEINF NO SOLUTIOSN I N
J.B. CASTELINO Nuclear Medicine Section, Divisio f Humano n Health, International Atomic Energy Agency, Vienna
Antibodie proteid san n antigens labelled with radioiodin widele ear y use researcdn i h and routine diagnosis of communicable diseases. Several methods of iodination exploit a simple chemical reaction, halogen substitution. Iodin solutiofounen i e b y eithedn i nma r reduced (iodide) or oxidized (iodine) form. When present in the oxidized form, iodine is directly substituted into phenolic rings presence Th . hydroxya f eo l grouphenolie th pn i c ring introduce slighsa t polarity which facilitate substitutioe sth n reaction contrastn I . , iodination of a benzine ring occurs readily. A phenolic ring is present in the amino acid tyrosine which suggests a relatively direct method of radiolabelling tyrosine-containing proteins to yield both diiodo and monoiodo tyrosine. Provided that suitable precautions are taken during the labelling with respect to the conditions and the amount of iodine introduced, labelled e prepareproteinb n ca sd whic e botar hh biologicalld an y immunologically indistinguishable fro naturae mth r pareno l t material.
The methods chosen for labelling will depend on the purity and quantity of protein available and the purpose for which the labelled preparation is required. The technique described belo particularls wi y applicabl r immunologicaefo diagnostid an l c studien i s communicable diseases.
IODOGEN METHO LABELLINF DO G WITH IODINE 125
lodogen is the trade name of 1, 3, 4, 6-tetrachloro-3a, 6a-diphenylglycouril, an oxidizing agent only sparingly soluble in water. A solution of iodogen in chloroform or methylene chlorid usees i coado t inne e tth r surfac tesa f eto tube, evaporatin solvente gth . Stockpiles of such coated tubes may be prepared in advance and stored in a desiccator. Whe aqueoun na s solutio f proteino radioiodind nan addecoates e i th o dt d tubee th , iodinatio f lessea tyrosineno o t rd extentan , , histidine, commences reactioe Th . s ni terminated by decanting or aspiration of the reaction solution. Because iodogen does not go into aqueous solution, denaturin f proteigo damagd nan livino et g cell minimizeds si .
MATERIALS
1. Carrier-free sodium iodide (125I): 2 mCi (this solution must be free from reducing agents).
2. Protein for labelling: anti-sporozoite IgG (1mg/ml).
3. 0.2M sodium phosphate buffer pH 7.2 (0.2M Na2HPO4+ 0.2M NaH2P04 and pH adjuste 7.2)o dt .
. 4 lodogen iodoge g l chloroformm 1m :5 n i .
5. Sephadex G-25M PD 10 column.
. 6 Phosphate buffered saline (27.282 (PBS7. H p ) 7 Nag 2HP04.12H20, 3.2 4KHg 2P04, 8.5 g NaCI in 1 L distilled water). azide+ A .BS + S PB . 7 PB 0.05d S containinan %A sodiuBS % g1 m azide.
11 PROCEDURE
1. Prepare iodogen tubes:
a. Dissolve 1 mg iodogen in 5 ml chloroform and aliquot 100//I of this solution into 12x75 mm (gamma counter) glass tubes.
b. Place tubes in a desiccator, attach to vacuum pump with double trap and apply vacuum until tubes dry.
. c Store tubes under vacuum.
2. Dilute stock solution Io ifn125 radiation safety hood. Add 20//I of 0.2M phosphate
125 buffeviae contentth x l containino Mi rt I. 125 i s carefullmC g2 y (fre volatils i I ed ean therefore hazardous).
3. Prepare column.
Wash a PD 10 column 5 times with PBS, leave the column with a small amount of PBS on top of the gel.
4. Prepare dialysis membrane. f dialysio m c s0 tubing2 o t 5 1 . t BoiCu l tubinminute0 1 r gfo distillen si d water.
Keep tubing in water until use.
5. Labelling procedure:
a. Take an iodogen-chloroform tube from desiccator. Rinse once with PBS and shake dry.
b. Add 20/ul anti-sporozoite IgG (1mg/ml).
20//d Ad I 125 . I c (0.5-1.5mCi/10//g protein).
. d Cover tub o prevenet t evaporatio incubatd an n t rooa e m temperaturr efo 20 minutes.
e. Add 55 fj\ PBS to the tube and transfer contents to a 10 ml tube containing Azid+ A e BS solution + S PB . l m 3 2.
f. Wash original iodogen tube with 100//I PBS and add this to the 10 ml tube.
. g columTransfeD P elut d e labellee l ntuban th e th m ro e t 0 content1 d e th f so protei BSA+ S n.PB usinl m g3
. h Collec l aliquotm 1 t plastin si c tubes. Retai firse nth t three tubes wite hth highest radioactivity.
i. Transfer the contents of these 3 tubes to a dialysis tube. Dialyse against PBS at 4°C in a jar with a stirbar with frequent changes of the PBS until the PBS has activity of less than 10 000 cpm/ml.
j. Store the labelled protein at 4°C until use.
12 SODIUM DODECYL SULPHATE-POLYACRYLAMIDL GE E ELECTROPHORESI WESTERD SAN N BLOTTINR GFO PROTEIN ANTIGEN ANALYSIS
Pramuan TAPCHAISRI, Srisin KHUSMITH, Yuwaporn RUANGKUNAPORN Departmen f Microbiologo t Immunologyd an y , Facult f Tropicayo l Medicine, Mahidol University, Bangkok, Thailand
Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) has now becom a standare d too n mosi l t laboratorie r proteifo s n analysi d purificationan s . Polyacrylamid severas eha l advantages ove othee th r r matrice s superioritit n si a s ya molecular seive. The gel has relatively high strength and its porosity can be consistently varied over a wide range by varying the acrylamide concentrations and the extent of its cross-linking. Polyacrylamide gelgeneratee ar s y chemicab d l polymerizatioe th f o n
acrylamide monomer (CH CH-CO-NH2= e th cross-linkin d an 2) g co-monomer, N-methylene-bis-acrylamide (CH CH-CO-NH-CH2= 2-NH-CO-C CHH polymerizatio= e 2)Th . n proces s i commonls y initiate y b usine d tertiarth g y amine TEMED (N,N,N'-,N-tetramethylethylenediamine catalyse th s ammoniud )a tan m persulphate th s ea initiator. The polymerization process is initiated as the sulphate free radical released from the persulphate reacts with the acrylamide monomer to form an acrylamide sulphate free radical which then reacts with other acrylamide molecules, thus, long straight chain polymers are formed. The presence of methylene bis-acrylamide provides cross-linking betwee e adjacenth n t strand d strengthean s e acrylamidth n e polymers. Since th e polymerization process is inhibited by the presence of oxygen, the polymerization mixture must be thoroughly deaerated before addition of persulphate and TEMED.
Several SDS-PAGE systems have been describe mose th t t wideldbu e th y s i use e don discontinuous buffer system introduced by Laemmli [1] for disc gel electrophoresis. This lates wa r adapte slado t b gel Studiey sb r syste[2]e .Th mcharacterizes i discontinuity db y in the buffer pH and in the polyacrylamide pore size. Two kinds of gels are used: the "stacking gel" with a large pore size in pH 6.8 buffer allows the protein samples to concentrat "runnine th d ean g gel "separatinr o " g gel" wit smale h8 th 8. l porH p ee sizth en i buffer provides separatio e proteith f o nn samples generaln I . , high concentratiof no acrylamide gives better separatio w moleculalo f o n r weight proteins whereaw lo s acrylamide concentration gives higher resolution of the high molecular weight proteins.
The protein samples require treatment with the detergent sodium dodecyl sulphate (SDS) and a reducing agent such as beta-mercaptoethanol or dithiotreitol prior to the electrophoresis. Such treatment change three-dimentionae sth l shape proteine th f so s into rod-like structures [3] ,protein Since bindS th constano a est SD t sa t weighe t ratith ] o[4 total number of the negative charges of the polypeptide-SDS complex is directly proportiona moleculenumbee S th SD o t lf ro s which reflec numbee tth f aminro o acidd san henc moleculae eth r weigh proteinse th f to . Thus SDS-PAG als n usee Eoca b determindo t e moleculae th r weight f unknowso n protein compariny sb g their relative electrophoretic mobilitie knowe th o st n molecular weight protein standard.
Western blotting or the process of transfer of the electrophoretically separated proteins onto immobilizing matrices such as nitrocellulose membrane is an extension of SDS-PAGE described by Towbin et al. [5]. This procedure provides, on the nitrocellulose blot, an identical copy of the electrophoretic separation pattern of the proteins present in the gels. The immobilized proteins can be further reacted with an appropriate probe such as antibody for identification of its corresponding antigen. The protein antigen/antibody complex is then detected by using radioactively labelled or enzyme-linked second antibody
13 probe. The blotting procedure involving detection of specific antigens employing the antibody probe consists of three elementary steps: componente Th Ste - protei e p1 th f so n antigen mixtur electrophoreticalle ear y separated. SDS-PAG commonlEs i y use t non-reducindbu g gels, acrylamid r agaroseo e gels as well as isoelectric focusing and two-dimentional gels have all been used successfully [5].
Step 2 - The separated proteins are transferred electrophoretically while maintaining their pattern of separation to a matrix, usually the nitrocellulose paper. During the transfer process, most of the SDS is removed thus the proteins recover their antigenicity.
Step 3 - The nitrocellulose blot is then treated with an appropriate antibody and the presenc boune th f eo d antibod detecteys i radionuclida y db enzymatir eo c probe.
technique Th vers ei y usefu r analysifo l characterizatiod an s f compleno x protein antigens using immune sera from several sources or vice versa. The protocol given below illustrates such a separation by which complex protein antigens of blood stages of Plasmodium vivax obtained from blood of patients with vivax malaria are fractionated by SDS-PAG treated Ean d with immune sera from patients with acute vivax malarie th d aan antigen/antibody complexformed are detected by 125l-labelled anti-human immunoglobulins.
SDS-PAGE PROTOCOL
EQUIPMENT AND MATERIALS
Sla l electrophoresibge s apparatus Glass plates, 16 cm x 20 cm (inner plate) and 18.3 cm x 20 cm (outer plate) Spacers, 1.5 mm thick Teflon combs well5 1 , s Power supply Gel casting stand Clamps Vacuum pump Staining boxes Rocking platform Reagents.
REAGENTS
. A Acrylamide/Bis acrylamide (30 %, 2.6T %) C
Acrylamide 29.2 g N,N'-Bis-methylene-acrylamidg 8 0. e
Make to 100 ml with distilled water. Filter and store at 4°C in a dark bottle.
WARNING: Acrylamide and bis-acrylamide are potent neurotoxins and can be absorbed through skin and inhaled as vapour! Always handle with gloves and never pipette by mouth.
14 B. 1.5MTris-HCI, pH 8.8
Tris base 18.15g
Dissolve in 50 ml of distilled water and adjust to pH 8.8 with 1N HCI. Make to l witm h0 distille10 d water.
C. 0.5M Tris-HCI, pH 6.8
g 0 6. Tris base
f distilleo l Dissolvm wit8 d0 HCI N 5 6. wateh 1 adjus n d H ei .p Mak an r o t t o et l witm h0 distille10 d water.
D. 10% SDS
SDS 10.0 g
Dissolv distilleen i d water with gentl witl e m stirrin h0 brindistilled 10 gan go t d water.
E. 10% ammonium persulphate (w/v)
g Ammoniu1 0. m persulphate
Make to 1 ml with distilled water. Make fresh daily.
F. TEMED
G. Sample buffer
Solutio nC 1.0ml l m 6 1. Solutio nD l m 8 0. Glycerol Beta-mercaptoethanol 0.4 ml 0.05% (w/v) Bromphenol blue 0.2ml l m 0 4. Distilled water
Dilute the protein sample at least 1:4 with sample buffer and heat at 95°C for 4 minutes.
H. Electrophoresis buffer3 8. H p ,
Tris base 3.03g Glycine 14.4 g g 0 1. SDS Distilled water 1000.0ml
I. Protein staining buffer
Coomasie brilliant blue R-250 1.25g Methanol 250.l 0m Acetic acid 50.l 0m
Make to 500 ml with distilled water.
15 Destaining solution
Methanol 200.0 ml Acetic acid 50.0ml Glycerol 25.0ml Distilled water 725.0ml
separatin% stackin10 % 4 d gan g gels (per slab gel)
Separating gel Stacking gel (ml) (ml)
Distilled water 12.08 6.05
Solution A 10.00 1.30
Solution B 7.50 -
Solution C - 2.50
SolutionD 0.30 0.10 Solution E 0.10 0.05
Solution F 0.02 0.005
Total volume 30.0 10.0
PROCEDURES
1. Assemble the glass plate sandwich (Fig. 1). The glass plates, spacers and clamps must be clean and dry. Place two spacers along the long edges of the outer glass plate. Plac innee eth r glas soutee platth f thaflusrs o o i e s plate t d i th en wit .e hon
2. Position the left and right clamps at the appropriate sides of the glass plates. Check that the spacers are flush against the sides of the clamps and tighten the clamps enough to hold plates in place.
. 3 Plac assemblee eth d glass plate sandwic alignmene th n hi levellee t th slo f l o t dge casting stand. Loosen the clamp screws just enough to allow the plates and the spacer surface aligo salignment e th t th n a f eo t slot.
4. Tighten the clamp screws. Pull the gel sandwich from the alignment slot. Check that the plates and spacers are flush at the bottom.
5. Place the aligned sandwich into one of the casting slots. Push the cams in and turn 180° to secure the sandwich in place. The sandwich is now ready for gel casting.
6. Prepare the 10% separating gel using the formula given above but without the ammonium persulphate and TEMED (solutions E and F). Deaerate the solution under vacuu t leasa minutes 5 r m1 tfo .
7. Add ammonium persulphate and TEMED to the monomer solution. Pour the solution smoothly belodowm c combteetspacesid e e e a levewe n2 th f th th - e th f o h o 1 l o . rt Immediately overlay the solution with distilled water. Care must be taken to prevent mixing with the monomer solution.
16 Figur . 1 eAssembl e glasth f so y plate sandwic r SDS-PAGEfo h . 1: inner and outer glass plates; 2: spacers; 3: comb; 4: clamps.
8. Allow the gel to polymerize for at least 1 -2 hours without disturbance.
9. About 30-60 minutes before starting electrophoresis, prepare the 4% stacking gel using the formula given above in the same manner as the separating gel, i.e., with solutions E and F added after deaeration.
. Pou 10 t liqui unpolymerized ou r dan d monomer fro separatine mth g gel. Rinse with distilled water and drain well.
. Pou 11 stackin e inserd th r combe an l th t gge . Allo stackine w th polymerizo t l gge r efo 30 to 45 minutes.
12. Remove the comb carefully. Rinse the wells with electrode buffer.
. Loa13 d with pretreated sample sample th n si e buffer containing 20-30 f proteinsjjo g . Standard molecular weight markers should also be loaded.
14. Assemble the upper buffer chamber. Place the whole assembly in the electrophoresis chamber already filled with electrophoresis buffer. Carefully fill the upper chamber with electrophoresis buffer. attacd an electricae . hd th Placli 15 e e th lowe e l th leads anods e i r ) electrod Th .+ e( e uppee ancathode th dth s i r one) e(- . Switcpowee th t n constanha ro t current (20 mA per slab gel until the tracking dye reach as the separating gel edge, then the slar currenpe b gelA m ) raises i 0 tunti 3 trackine fro m o aboudth ls t c i m e 5 g0. tdy the bottom edge of the separating gel. Mix the lower buffer well during the run with magnetia n ao r stiba rc stirrer.
17 . 16 After completion, switch power off, disconnec electricae th t l leads, remov lide eth , pour off the upper chamber buffer, gently remove the assembly, remove the upper chamber and clamps. Open the plates and remove the gel. proteir Fo n. staining17 stainine th n i l ,g plac ge solutio e houthee1 th d r nan rn fo destain in solutio nuntiJ bande th l s appear.
WESTERN BLOTTING
EQUIPMENT AND MATERIALS
Electrophoretic transfer cell Gel holders Porous support pads Power supply Rocking platform Nitrocellulose membrane, 0.45//m pore size Whatma chromatographiM n3M c paper.
REAGENTS
L. Transfer buffer, pH 8.3 Tris base 3.03 g Glycine 14.40 Methanol 200.l 0m Make to 1000 ml with distilled water. M. 0.01M phosphate buffered saline, pH 7.4
Na2HPO4 4.258 g NaH2P04 0.600g NaCI 30.681 g Mak 350o et l wit0m h distilled water.
N. Washing buffer
Solutio containinnM g 0.05% Twee0 n2
O. Blocking solution
Solutio containinnM gelatin% g1 bovin% 3 , e serum albumi 0.02d nan % sodium azide.
P. Serum diluent
Solutio containinnM g 0.2% bovine serum albumin, 0.2% gelati 0.02d nan % sodium azide.
WARNING: Sodium azid highls ei y toxic!
Q. Staining solution for nitrocellulose
Amido black 0.1 Og Methanol 45.0 ml Acetic acid 10.0 ml Make to 100 ml with distilled water.
18 R. Destaine r nitrocellulosfo r e
Methanol 40.0 ml Acetic acid 10.0ml l witm . h0 Makdistille10 o et d water.
PROCEDURES
. Afte18 r electrophoresis, place unstaine transfen i l dge r minutes5 buffe1 r fo r . sheea t f nitrocelluloso tCu . 19 e piecepape2 d f Whatmaan rso papeM n3M r exactle yth sam egele sizth f .e o Soa nitrocellulose kth e paper filtee th , r poroue paperth d ssan support pad in transfer buffer for 5 minutes. The membrane is fragile, handle with gloved hands.
l . holderOpege 20 e n.th shallo a Plac n i t ei w tra tha o gree ys th t y panee th flas i n l o t bottom of the tray. Place the buffer saturated fibre pad on the grey panel of the holder.
. Plac21 buffeea r saturated piec fibr e followe d f filteth eo ef pa e o th r p papey db to n o r now pre-equilibrated gel from the transfer buffer. Care must be taken in every step r bubblai trao y t et pan betweeno n each layer.
. Plac22 pre-wettee eth d nitrocellulos thel ge ne anotheth f o e sheep rto piecn o t f filteeo r poroue papeth d san r support pad.
23. Close the gel holder and place it in the transfer chamber half-filled with transfer buffer so that the grey panel of the holder is on the cathode side of the electrode panel (Fig. 2). n placei d li . . e Switce buffeFilth 24 th lt hpu rd begi powetand an nan n ko r electroblotting. Mix the buffer well with a stir bar on a magnetic stirrerto improve the heat transfer. r Electroblofo A m 0 t constanthour3 a t 12 r r fo so A m curren0 36 f o t 18 hours.
^ 3 r-7 ® *r *<4'V 0 K R X JS X \ o > I 0
M o $ O I o ] o o » ! o S t. 5 6 ;
Figur . Electroblottine2 proteif go n components from polyacrylamide genitrocelluloso lt e membrane Anode: 1 . Cathode: ;2 ; 3: gel holder; 4: porous supports; 5: nitrocellulose membrane buffe: acrylamid: 6 7 ; d ran l tankege .
19 25. After electroblotting, remove the gel holder, mark the membrane, wash briefly in washing solution and, if desired, cut into individual strips before blocking the unreacted sites on the membrane with blocking solution for 1 hour at 26°C in a plastic box.
26. Wash the membrane strips with the washing buffer two times for 10 minutes to remove excess blocking solution. Incubat membrane eth e tese stripth t n si seru m appropriately diluted wit serue hth m diluen hou1 r r fo t with gentle rocking.
27. Wash the membrane strips for 20 minutes 4 times with excess amount of washing buffer.
28. Incubate the membrane strips with 125l-labelled sheep anti-human immunoglobulins (0.5 to 1 x 106 cpm/ml) for 30 minutes at 26°C with gentle rocking.
29. Wash the strips in washing buffer 4 times for 20 minutes. Remove and air dry.
30. Autoradiograph the strips and examine for the immune reaction bands on X ray films.
REFERENCES
] [1 LAEMMLI, U.K., Cleavag f structuraeo l proteins durin assemble gth heae th f f do y o bacteriophage T4, Nature 227 (1970) 680-685. ] [2 STUDIER, F.W., Analysi f bacteriophagso earl7 eT y RNA proteind san slan so b gels, J. Mol. Biol. 79 (1973) 237-248. [3] REYNOLDS, J.A., TANFORD, C., The gross conformation of protein dodecyl sulfate complexes, J. Biol. Chem. 245 (1970a) 5161-6165. ] [4 REYNOLDS, J.A., TANFORD , BindinC. , f dodecygo l sulfat o proteinet t higa s h binding ratios, Possible implication for the state of proteins in biological membranes, Proc. Natl Acad. Sci (1970b6 .6 ) 1002-1007. [5] TOWBIN, H., STAEHELIN, T., GORDON, J., Electrophoretic transfer of proteins from polyacrylamide gel nitrocelluloso st e sheets: Procedur somd ean e applications, Proc. Natl Acad . 9791 Sci( 6 ). 7 4350-4354.
20 SELECTED TECHNIQUES IN RECOMBINANT DNA TECHNOLOGY
Pramuan TAPCHAISRI Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand
Recombinan technologA tDN y comprise complesa x serie f techniqueso fielde th sn si of nucleic acid biochemistr moleculad yan r biology. Obviously t possiblno s i t includ,i eo t e all of the methodologies involved, therefore, the main purpose of this presentation is to giv introductionn ea briea , f descriptio exampld nproceduree an th f eo f e somso th f eo basic techniques in the DNA cloning work currently used in our laboratory. For a more detailed descriptio techniquese th f no , consul varioue th t s laboratory manuals e citeth dn i References.
ISOLATION OF HIGH MOLECULAR WEIGHT GENOMIC DNA
INTRODUCTION
DNA exists in cells in complex or combination with other molecules such as proteins and carbohydrates. Therefore, it is necessary to release the DNA from the other cellular components. Normally, the cells are first lysed by digestion with enzymes such as proteinas presence th n i e K detergenf EDT a eo d Aan t suc sodius ha m dodecyl sulphate (SDS) detergene Th . t dissolve lipide sth s thus froreleasinA membranese mth DN e gth . Deproteination is made by successive extractions with phenol and the residual phenol is removed by chloroform/isoamyl alcohol treatment. Low molecular weight contaminants ca removee nb dialysisprecipitatey s di b A DN . d with contaminatinalcohoe th d an l A gRN is removed by treatment with RNase. This method yields purified genomic DNA which is generally satisfactor r cloninyfo g wor furthed kan r analyses.
ISOLATIO GENOMIF NO FROA CDN M Plasmodium vivax
Reagents
a. Digestion buffer (0.01 M Tris-CI pH 8.0, 0.01 M NaCI, 0.001 M EDTA, 2% SDS, 200//g/ml proteinase K). b. Phenol solution (water saturated, 0.0 hydroxyquinoline1% , 0.0 Tris-C1M 8.0)H p I . c. Chloroform/isoamyl alcohol (24:1). d. 0.01 M Tris-CI pH 8.0, 0.01 M NaCI, 0.001 M EDTA. e. RNas (stoceA k solution mg/ml)0 1 , . f. IMNaCI. g. TE buffer (0.01 M Tris-CI pH 8.0, 0.001 M EDTA).
Procedures
a. Digest packed cell samples containing enriche . vivaxdP infected cell digestion si n buffer (1 x 10 9 cells/ml) at 56°C for 3 hours: Pool the digested samples in a polypropylene centrifuge tube, b. Add an equal volume of phenol solution to the sample and mix gently by inverting the tube for 5 minutes, . c Centrifug minute0 1 tube r e th t 1,50 efo a t 4°C sa g 0x . Collec uppee th t r aqueous layer containin DNAe gth . . d Repea phenoe th t l extractio moro ntw e times.
21 equan a d l volumAd e. f chloroform/isoamyeo l alcohol gentlx mi ,d centrifugyan s ea above, f. Collect the aqueous supernatant and reextract with the chloroform/ isoamyl alcohol two more times, g. Dialys aqueoue eth s phase against 0.0 Tris-C1M 8.0H Ip , 0.01 NaCI, 0.00 EDT1M A fo hour2 r t 26°Csa . h. Add RNase A to a concentration of 100//g/ml and incubate the solution at 37°C for 1 hour, . i solutioA Extrac DM timeo ne tw th ts with phenol solutio chloroform/isolamyd nan l alcohol as above, aqueoue th d Ad s phas . j 1/1o et 0 volumvolume 2 NaC M d 1 f an Ie o f col so d absolute ethanol and leave at -20°C for at least 2 hours to precipitate the DNA. k. Collect the DNA pellet by centrifugation at 10,000 x g for 20 minutes at 4°C. . I pelleA WasDN t e onchth e witethanol% h70 , then briefly air-dry, m. Dissolve the DNA pellet in a small amount (20-50/vl) of TE buffer.
The amount of DNA can be determined by measuring the optical density at 260 nm (50/yg/m f double-strandeo l giveA optican dDN sa ratie l Th odensit . betwee1) f yo e nth readings at 260 nm and 280 nm also provides an estimate of the purity of the DNA. Pure preparation havA ratie e DN th f 1.8 oo f salso n mad.e oca b Quantitatio y A eb DN e th f no comparin fluorescene gth tethidiue yielth f do m bromide stained sample with thaa f o t series of DNA standards.
ISOLATION OF PLASMID DNA BY ALKALINE LYSIS METHOD
INTRODUCTION
Plasmids are mostly prepared from cultures grown in liquid medium containing the appropriate antibiotics. Many of the plasmid vectors, e.g., pUC series, replicate with high copy numbe thao s rsimpl e t b the n yyca obtained from latphasg elo e cultures whereas some vectors, e.g., pBR322, require selective amplification by incubating the partially grown bacterial cultures in chloramphenicol for a few hours.
alkaline Th e lysis metho simplds i r purifyinefo g plasmi froA mdDN Escherichia coli. The bacterial cell lysepresence e th sar dn whici S f NaOeSD o hd denaturHan proteine eth s and genomic DNA. Additio f sodiuno m acetate neutralize alkale permanentld sth an i y denature genomie sth whereaA cDN plasmie sth readilA dDN y renature solubles i d san . The plasmid DNA is separated from the precipitates of proteins/SDS complex and genomic DNA by centrifugation. The plasmid DNA is then precipitated by alcohol and reconstituted appropriatn a n i e buffer.
ISOLATION OF pUC19 PLASMID DNA FROM E. coli
Reagents
a. LB broth (1 % tryptone, 0.5% yeast extract, 1 % NaCI pH 7.5) containing 100/yg/ml ampicillin. b. NaOH/SDS solutio NaOH)N 1 n0. (0.5.n i S %SD c. 3M sodium acetate pH 4.8.
Procedures
a. Inoculate a single colony of E. coli containing pUC1 9 plasmid from an agar plate into 100 ml of LB broth. Incubate the culture for 18-24 hours at 37°C with vigorous shaking.
22 . b Chil culturee th l , transfe centrifugo t r e tubes centrifugd an 0 2 r t 500fo ea g 0x minutes at 4°C. Discard the supernatant, c. Pool the cells, wash once with TE buffer by centrifugation as above and resuspend bufferE T f o ,l m 2 n i f NaOH/SDo l m 8 d SAd solutiod cel.e th l suspensionno t suspensioe th x Mi . n gently fo minute5 r t 26°Csa . e. Add 4 ml of 3M sodium acetate pH 4.8 and gently mix the mixture for 5 seconds at 26°C. minutes0 2 r fo C , . 4° f t a Centrifugg x 0 mixture 00 eth 0 1 t ea . g Collec cleae th t r supernatant volumeo tw o t d f ethanoA sAd o . alloDN d e an lw th precipitate for 1 hour at - 20°C. h. Pellet DNA by centrifugation at 10 000 x g at 4°C for 20 minutes. Wash the pellet once witethano% h70 centrifugatioy b l n before dissolvin smala n i glt i amoun E T f to as above.
The plasmid DNA is suitable for most applications. RNA contamination in the preparation can be removed by RNase treatment prior to or at the same time of cutting the plasmi restrictioy db n endonucleases. Quantitatio purifiee th f e no b dn plasmica A dDN mad aboves ea .
RESTRICTION ENDONUCLEASE DIGESTION OF DNA
Genomic DNA and plasmid DNA can be resolved into precise fragments by digestion with typ restrictioI eI n endonucleases which recognize certain specifi and6 , ,5 , rarelyc4 , 7 or 8 nucleotide sequences and cleave the phosphodiester bonds in or near the vicinity sequencese oth f largA . e numbe restrictioe th f ro n enzymes (more tha enzyme0 n25 s sa of 1982) have been isolated and currently many are available commercially. A typical digestion reaction of the DNA can be done in buffers containing high, medium or low buffer
solutions containing NaCI, Tris-CI pH 7.4, MgSO4 or MgCI2. Bovine serum albumin and 2- mercaptoethano alsy includede ob ma l l restrictioAl . n endonucleasea ss a requir + + eMg cofactor. enzymee Mosrangth H p f f o tactiv7.2-7. e e o optimue th sar th n ei d 6an m temperature of 37°C although a few endonucleases prefer lower incubation temperature and several, mainly isolated from thermophiles, require higher temperatures. Most supplier restrictioe th f so n enzymes provid stocx 0 e1 k buffer r maximasfo l reactivitief so e productsth . Whe doublna e digestion with enzymes requiring different buffers i s necessary a mixtur, f equao e o buffertw l portioe s usualli sth f o ny satisfactory. Alternatively, DNA is first digested with an enzyme requiring low ionic strength buffer then followed by addition of appropriate amount of NaCI and a second enzyme and the incubation continued. It is also best to consult the information sheets from the manufacturer when establishing the optimum condition for double digestions.
Generally completa r ,fo e digestio DNA e fol n eighth n te df a n ,o o excest s digestion is recommended. Two to three units of the enzymes are used for each fjg of DNA and the diges incubates hoursi 4 t enzyme o t Th 2 . r addes emixturde i fo th calculatea o dt f eo d amount of water, 10 x buffer, and DNA and is well mixed in a microcentrifuge tube before incubation volumtypicaa A . n i f A 20//Ielo e reactioDN Th f . o g n// 1 comprise o t 2 0. f so reaction may be terminated by heating at 65°C for 10 minutes or adding EDTA to a final concentration of 10 mM.
AGAROS ELECTROPHORESIL EGE A DN F SO
Agarose gel electrophoresis is a standard method used to separate, identify and purify DNA fragments. The technique is simple, rapid to perform and capable of recovering fragment thaA t DN canno f so separatee b t d adequatel othey yb r procedures littls A s .e a 1 ng of the DNA in agarose gel can be located by staining with low concentration of
23 ethidium bromide and visualized by ultraviolet light. DMA from 0.2 kilobasepairs (kb) to approximatelseparatee b n ca agarosn b di k 0.6o 0 t 2 y e% 2 gel concentrationsf o s , respectively. Larger sizes of the DNA can be separated by pulsed-field gel electrophoresis.
Agaros lineaa s ei r polymer wit hbasia c structure comprising D-galactos 3,6d ean - anhydro L-galactose. Appropriate concentratio f agarosno meltes ei presenc e th dn i f eo desired buffer unti cleara l , transparent solutio achievedns i meltee Th . d agaros poures ei d int molo a allowe d dan hardeno dt agarose Th . e form matrisa x with density determined by the concentration. When an electric field is applied across the gel, DNA which is negatively charged at neutral pH, migrates toward the anode. The rate of migration is determined by a number of parameters such as the molecular sizes of DNA, agarose concentration, conformation of DNA, applied voltage, base composition and temperature, composition of electrophoresis buffer, etc.
Reagents
a. Electrophoresis buffer, Tris-acetate (TAE) x stoc 0 5 ,k solution (24 2Trig s base, 57. l glacia1m l aceti l 0.5c m acidM0 EDT10 , 8.0)H Ap . b. Gel loading solution, 6 x (0.25% bromophenol blue, 0.25% xylene cyanol FF, 30% glycero distillen i l d water), c. Ethidium bromide, 10 mg/ml stock solution.
Procedures
a. Sea opee lth n plasti e endth f s o celectrophoresi e trath f yo s apparatus with autoclave for o t mole horizonta a tapes mth molda a n t d o o ss Se . l sectio benche th f no , b. Prepare sufficient electrophoresis buffer (1 x TAE) to fill the electrophoresis tank and preparo t measurea gele d eth Ad . d amoun f moleculao t r biology grade agaroso et the buffer in a glass bottle with loose-fitting cap. Heat the mixture in a boiling water bath or a microwave oven at low setting until the agarose dissolved, . c Allo agarose wth e solutio cooo nt 60°Co t l . Positio abovm comm e e neth th 0 b1. tray and pour the agarose to 5 mm thickness, d. Allow the gel to set for 30 minutes before carefully removing the comb and the sealing tapes, e. Mount the tray in the electrophoresis chamber. Add the electrophoresis buffer to cover the gel to a depth of 1 mm. f. Mix the DNA samples with gel loading solution (5:1). Carefully load the mixture into l slotge se eacusinth f h o micropipetg a . sizA somo eT DN marker e e estimat n well. th a g unknowd e r sth sfo ad f eo n fragments of the samples. The markers can be generated from restriction endonuclease digestion of well-characterized plasmids or bacteriophages. An example of the marker Hine th ds si Ill-cut bacteriophage Lambd whicA aDN h gives eight fragments of 23.1, 9.4, 6.6, 4.4, 2.3, 2.0, 0.56 and 0.1 2 kb. h. After all the samples are loaded, close the lid of the gel tank and switch on the current applyin voltaga g 5 V/cmwilA f o elDN .migrat e towar e anodeth d . Electrophoresi carries i s t untidou l bromophenol blue (the first migrating dyes )ha migrated 75% across the gel. i. Remove the gel and stain for 30 minutes in 0.5/ug/ml ethidium bromide in distilled water before visualization of the DNA bands by ultraviolet light on a UV transluminator.
CAUTION: Ethidium bromide is a powerful carcinogen and is moderately toxic. Gloves shoul l timewore dal b t na . Decontaminatio usee th df n o solutio n suc treatmens ha t with powdered activated charcoal (100 mg per 100 ml) and filteration before being discarded dow designatena d sin recommendeds ki .
24 SOUTHERN BLOTTING
The ability to size-fractionate nucleic acids and to determine their complementary sequences to an array of DNA or RNA molecules is one of the most powerful tools of molecular biology. Southern blottin simpla s gi e method devise y Southerdb n (E.M. Southern, J. Mol. Biol. 1975; 98: 503) for transferring the size-fractionated DNA from a gel matrix to a solid support followed by hybridization to a labelled probe. The similar process for RNA is called Northern blotting. DNA is transferred from the agarose gel to a sheet of the solid support in such a way as to retain the original pattern. DNA can be transferred from agaros esolie th gel f severado o st suppor e on l y methodb t s sucs ha capillary, electrophoretic or vacuum transfer although the capillary transfer is the simplest and this procedure is given below:
High molecula r mor o t wite cu er h on s restrictioi weigh A DN t n enzymese Th . resultant fragment separatede sar , base thein do r sizes agarosy b , l electrophoresisege . The gel is then laid onto a solid support. A flow of an appropriate buffer is set up through the gel toward the membrane. This flow causes the DNA fragments to be carried out of the gel onto the filter, where they bind, thus a replica of the DNA fragments in the gel is created on the filter. A labelled probe, specific for the gene under study is then hybridized e filteth ro t (see below)e RNA b e prob n Th ,ca e. cDNAr o segmena A , DN f o t oligonucleotides containing the complementary sequence. A precise and reproducible pattern of bands representing the DNA fragment(s) that contains the gene under study can be detected using an appropriate detection system.
The nitrocellulose membran bees traditionae eha n th l transfemedie th r t amusfo rbu t be handled with great 3-diazobenzyloxymethycaree Th . l paper (DBM) paper, while sturdier, requires more elaborate preparation than nitrocellulos seldos i d eman used now. The nylon membranes, particularly the newer charged ones, are similar to the nitrocellulose except tha rehybridizee tb the n sturdiee ca yar d an rd several times without breakage.
ALKALIN ENYLO O BLOTTINT A N DN MEMBRAN F GO E
e followinTh g protocols describ e generath e l procedure r transfefo s f sizeo r - fractionate (0.1-2A agarosy db DN ) l electrophoresi0kb ege modifiea o st d charged nylon membrane (e.g., Hybond , GeneScreenPlus™+ N , ZetaProbe, etc.) recommendes i t I . d that the specific instructions from the manufacturers for the transfer of nucleic acids to their particular type of charged nylon membrane should be strictly followed for the best results.
Reagents
a. 0.25MHC1. . b Alkaline blotting buffer (0.4M NaOH). c. 20 x SSC solution (3M sodium chloride, 0.3M sodium citrate).
Procedures
a. After electrophoresis, tri agarose mth l containinege fractionatee gth sampleA dDN s desiree th o t d placsizd ean 0.25n ei unti 1 trackine Mth lHC g dyes change colour. Leave the gel in the 0.25M HCI solution for an additional 10 minutes (this step is not necessary if the DNA fragments are less than 10 kb in sizes). b. Remove the gel and rinse in distilled water and use in the alkaline blot set up below. c. Fill a tray or glass dish with alkaline blotting buffer. Make a platform by placing a glas scontainere platth f o e p acrosto . e sth . d Cove e platforth r m wit wicha k made from thre eWhatmaM sheet3M f o s n chromatographic paper saturated wit buffere hth .
25 e. Place the gel onto the paper and surround with a clear plastic wrap to prevent the blotting buffer being absorbed directly into the paper towels above. l . ge f e Placth f o nylo piece ea p th to f neo n membrano exacl e th ge o e t sizt th f ecu eo and then cover with three sheets of the 3MM paper cut to size and wetted with the buffer. Care is taken not to trap any air bubble between each layer. . g Plac stacea k (approximately 5-1f heighto 0m f c absorben o ) t paper towelp to n so paperM 3M .e oth f h. Place a glass plate on the absorbent paper followed by a 0.5-1 kg weight on top. . i Allo transfee wth proceeo rt 2-1r dfo 8 hours before carefully dismantlin set-upe gth . Mark the membrane for further identification of tracks. j. Rinse the membrane briefly by immersion in 2 x SSC solution (freshly made from stockx 0 2 ) with gentle agitation membrane Th . then subjectee eca nb e th o dt hybridization step withou fixatioy an t storer no sealiny dkepb d plastia an tgn g i cba at 4°C.
DNA LABELLING
RADIOACTIVE LABELLING
The currently available radioactive isotopes for DNA labelling are 32P, 125I and 35S. For most DNA hybridization work, 32P is the isotope of choice since it has high energy resulting shorten i detectionre timth r efo . Detectio radioactivele th f no y labelled don e probb en eca by autoradiograph r countinyo gamma n gi r scintillatioao n counter.
DNA labelling can be accomplished by one of several methods. DNA can be labelled inside the chain, at the 5' end as well as at the 3' end. Labelling inside the chain is usually made by incorporation of the alpha-32P-labelled form into DNA using one of the polymerase reactions. The label at 5' end which employs gamma-32P-labelled ATP is accomplished by a combinatio f enzymno e phosphatas polynucleotidd ean e kinased whilen labe' e 3 e th t a l of single or double-stranded DNA can be done by the enzyme terminal deoxynucleotidyl transferase and alpha-32P-3' deoxyadenosine 5' triphosphate or dideoxyadenosine triphosphate.
32P-labelling of DNA by nick translation
In nick translation, DNase I is used to create single-strand nicks in double-stranded DNA resulting in generations of free 3' hydroxy ends and 5'phosphate ends. Then E. coli polymerase I which has the 5' to 3'exonuclease and 5' to 3' polymerase actions is used removo t e stretche f single-strandeso startinA dDN g ' phosphat fro5 e mth nickd d een san replace them from the 3' hydroxy ends with new DNA strands. The labelled deoxynucleotides presen thee ar tn incorporated intnewle oth y synthesized DNAe Th . reactio utilizn alpha-y nca ean 32P-labelled deoxynucleotide finaa d l sspecifian c activitf yo e achievedb n ca abou 8 A .cpm/yu 10 tDN Reagen f o g t kitavailable ar s e from many manufacturers.
Reagents (BRL)
a. 10 x nick translation buffer (500 mM Tris-CI, pH 7.5, 100 mM MgCI2, 100 mM 2- mercaptoethanol, 100//g/ml nuclease free-bovine serum albumin) containinM m 2 g0. each of dCTP, dGTP, and dTTP. b. DNA polymerase l/DNase I solution {0.4 units///! DNA polymerase I, 40 pg///l DNase I, 50 mM Tris-CI, pH 7.5, 5 mM magnesium acetate, 1 mM 2-mercaptoethanol, glycerolv PMSFv/ M m % 1 50 ,, 0. 100jwg/ml bovine serum albumin).
. c Stop buffer (30 NaM 02m EDTA 8.0)H p , . d. Alpha-32P-dATP {aqueous solution, 3,000-7,000 Ci/mmole, 10 mCi/ml).
26 Procedure
nice th k p translatiou t Se a. n reactio microcentrifuga n i e tub followss ea :
10 x nick translation buffer with I // 5 dCTP, dGT dTTd Pan P
DNA (0.5-1 .Ofjg) x//l
\ u 0 1 32P-dATP(100//Ci)
Distilled water to total volume of 45 //I b. Add DNA polymerase l/DNase I solution {5//I). Mix the mixture gently and centrifuge second5 r fo microcentrifugea n si . . c Incubat tub e minutes0 et th 15°6 ea r Cfo , . d Monito incorporatioe th r radioactive th f no e nucleotid minut0 3 t ea e intervaly sb spotting 1 //I of the mixture onto 10% TCA presoaked GF/A filter. Wash the filter 3 time3 d san witl ethanoA m h coun5 TC d timescintillatioa % an l 5 n i tf so witl m h5 n counter. stod pAd mixturee ebuffe.th //Io 5 t )( r , . f Separat labellee e th fro A mdDN unincorporated radioactive nucleotide usin smalga l Sephadex G-50 column (e.g. siliconizea n ,i d Pasteur pipet) equilibrated wit SSCx h3 . The DNA is excluded from the matrix and elutes ahead of the unincorporated nucleotides. Collect 3-4 drop fractions from the column into microcentrifuge tubes and 1 fj\ samples are counted in a scintillation counter.
32 randoP-labelliny b A mDN oligonucleotidf go e primers
f randolabellinThiA o e sDN us m basegs e i sequenc th n do e hexanucleotide primso t e DNA synthesis on denatured template DNA. If the oligonucleotides are heterogeneous in sequence, they will form hybrid t mansa y position thao ss t almost every nucleotide th f eo template will be copied at equal frequency into the products. The Klenow fragment of DNA polymerase I is used in this polymerization reaction because its absence of the 5' to ' 3 exonuclease activity ensures thae labelleth t d nucleotides incorporatee th y b d polymeras t subsequentlno e ear y remove monophosphatess da labellinA e DN th . y gb random oligonucleotide primer advantagn a s sha thaen i t smal (25-5A l amountDN 0e th f so labellede b ngn carriee )ca b . n t usinSynthesi dalpha-ca ou e A gon DN 32 f sP-labelleo d dATP and three unlabelled dNTPs as precursor to yield the labelled probe with specific activity of 4 x 109 cpm/jjg DNA. This high specific activity can be achieved because of the high efficiency of incorporation of the radiolabelled precursor. Reagent kits are available from several manufacturers with detailed procedure labellinge th r sfo .
A DN f o d 32P-labellinen ' 5 e th f go
Labelling of the 5' end of DNA, which is more frequently employed than labelling at the 3' end, can be carried out by the bacteriophage T4 polynucleotide kinase. The transfer ' terminu5 catalyze e e b reactionso th n o tw st ca y P forwardob e 32 f Th . d reactioe th ns i transfer of gamma-32Pof the gamma-32P-ATPto a hydroxy group which is created by prior treatment of the DNA with alkaline phosphatases, whereas the exchange reaction involves e rephosphorylatioth d an d phosphat P en e ' AD th 5 f e o transfet o e nth th f o r dephosphorylate witA gamma-e hdth DN 32P. Reagent kitalse sar o available from several manufacturers for the labelling.
27 NON-RADIOACTIVE LABELLING OF DNA
recene Th t advance nuclein si c acid technology have resulte developmene th dn i f o t non-radioactive labelling for DNA. Presently, several methods of DNA labelling are available. Example incorporatiose areTh ) :1 f biotinylateno d nucleotides (e.g. bio-11 -dUTP) into the DNA by a standard technique such as nick translation. This biotin-labelled DNA is then used as the probe in the hybridization reaction. The biotinylated DNA is detected by incubation with avidi streptavidir no n whic bees hha n labelled wit enzymn ha e capable of catalyzin colorimetriga chemiluminescenr co t reaction (e.g., phosphatase, peroxidase, etc.), 2) The incorporation of hapten-labelled nucleotides (e.g., digoxigenin-dUTP) into the product detectethe DNAbe and s can d afte hybridizatiothe r n wit hspecifia c antibody linkeenzymn a o dt e capabl f catalyzineo reactione gth mentiones sa e dth above) 3 d an , direct linkage of the enzyme mentioned above or a chemical capable of creating chemiluminescence such as acridinium ester to the single-stranded DNA which can be used directl probee th s ya . Again finae th , l procedurestage th f e o developmene th s si e th f o t colorimetri chemiluminescenr co t reaction. Presently, many reagent kitavailable sar e from several manufacturers for the non-isotopic labelling and the detection and the manufacturers' instructions should be strictly followed for the optimum results.
DNA HYBRIDIZATION
INTRODUCTION
Nucleic acid hybridizatio invaluabln a ns i e techniqu r determininefo relationshie gth p between nucleotide sequence productsA genome RN th procedure n se i wel s th Th e.a s a l e involve kindo stw f nucleotidso e sequences labellee ,th d probe with defined specificitd yan with, probably knowe ,th n sequence targee th d t molecul,an whicen i complementare hth y sequenc beins ei g determined nucleie Th . c acid denaturede ar s t alreadno f i , y single- stranded, and then allowed to reassociate specifically to form the base-pair duplex structures. The reassociation can occur between DNA-DNA, DNA-RNA and RNA-RNA. reassociatioe ratth e f eTh o n depend concentratione s th mainl ) 1 n yo f cationso s which decreas e intermoleculath e r repulsio f o negativeln y charge A strandse th DN d ) 2 , reassociation temperature whic optimahs i t -25°a l C belo meltine wth g temperature (Tm) e duplexe nucleith th f ) o 3 ,c acid concentrations which determine frequence sth f o y intermolecula nucleie rsizth e collisionf th eo ) c 4 acid dsan fragments.
Nucleic acid hybridization can be carried out in solution (solution hybridization), on an inert support sucnitrocellulosa s ha nyloa r eo n membrane (filter hybridizationn i r o ) cells/tissue situn (i s hybridization) mose Th t. commonly employed formae filteth rs i t hybridizatio whicn i targee hth t molecule immobilizee sar d ont solie oth d suppor sucn i t h a way that self-annealing is prevented, yet the bound sequences are still available for hybridization wit addee hth d labelled probe. Immobilizatio nucleie th f no c acid onte oth made b filteSouthery n eb ca r n blotting (for DNA), Northern blotting (for RNA r simpl)o y as dot-blotting. Hybridization is then followed by extensive washing of the filter to remove unreactee th d probe. Detectio hybrie th f usuallns o di autoradiography b y 32e Pth - f i y labelled prob useds ei .
Filter hybridization has an advantage that replicate filters can be prepared thus allowing many filter bound sequence analysee b e sam o th t s t ea d t timebloDo t . hybridizatio particularlns i y practica r analysifo l f multiplso e sample whereas Southerd nan Northern hybridizatio usee b localizeo dn t nca particulada r sequenc mixtura e n ei th f eo nucleic acid fragments separated after electrophoresis. Additionally e samth , e filter, especiall nyloe yth n membrane reprobee b n ca , d oveoved an rr again with minimum loss of the signal.
28 SOUTHERN HYBRIDIZATION
Reagents
solutionC SS x .0 2 a. b. 10%SDS. Denhardt'x 50 . c s solutio Ficoll polyvinylpyrolidone% % 1 n ( 1 , Fractio% 1 , bovinn5 e serum albumin, sterilized by filtration and stored frozen at -20°C. mg/m0 1 l . sonicated denatured dan d salmon DNA. e. Prehybridization solution (5x SSC, 5x Denhardt's solution, 0.5% SDS, 100pg/ml sonicate denatured dan d distillesalmon i A ndDN water).
Procedure
a. Place the Southern blotted membrane (prepared in Section 5) into a heat scalable plastic bag cut to size leaving ample space at one end. b. Prepare a volume of the prehybridization solution (0.1 ml for each 1 cm2 of the membrane to be hybridized) by mixing the appropriate amounts of the stock solutions and distilled water. (The salmodenatures i A nDN heatiny db t 100°ga minute5 r Cfo s and chill in ice before adding to the prehybridization solution), prehybridizatioe th d Ad . c n solutio plastie th no t c bag. Expe trappey an l r bubbledai s
before sealing the bag and incubate for 1 hour at 60 to 65°C in a shaking water bath, . d Denatur nick-translatee eth P-labelled32 probA dDN e (genomi r clonec o wit A hdDN specific activity of 1-2 x 108 cpm/jtfg DNA) by heating at 100°C for 5 minutes and chill in ice until use. Add the probe to the prehybridization solution to a concentration cpm/ml6 ng/m0 o1 f10 r aboux o l 2 . 1- t e. Immediately reseal the bag and incubate for 12-18 hours in the shaking water bath as above, f. At the end of the incubation period, cut the bag at one end and discard the radioactive probe down a designated sink, g. Cut open the bag and wash the membrane twice in 200 ml of 2 x SSC, 0.1 % SDS t rooa m temperatur shakina n ei g water bath, moderatea r Fo . l h stringency wash, was membrane hth S SD e% twicSSCx 1 2 0. ,e n i at 60°C for 1 hour in a shaking water bath. For a higher stringency wash, treat the membrane for 1 -2 hours at 65°C in 0.1 x SSC, 0.1 % SDS. . i Blomembrane tth removeo t excese eth st allo liquidmembranno e wo th D . y dr eo t completely if it is to be re-washed or re-probed, radioactive Th . j e duple detectes xi exposiny db plastie gth c film wrapped membrane to an X rays film at room temperature or at - 70°C with light intensifying screens for a higher sensitivity, k. The membrane can be reprobed. The old probe is stripped off by heating the membrane twice in a large volume of 0.1 x SSC, 0.5% SDS at 100°Cfor 10 minutes. The membrane can be checked by autoradiography as above.
REFERENCES
[1 ] WATSON, J.D., TOOZE, J., KURTZ, D.T., Recombinant DNA: A Short Course, W.H. Freeman and Company, New York (1983). [2] LEWIN, B.M. Genes II. John Wiley & Sons, New York (1985). ] [3 PANYIM , WILAIRATS. , , YUTHAYONGP. , , ApplicatioY. , f Genetino c Engineering to Research on Tropical Disease Pathogens with Special Reference to Plasmodia. A Laboratory Manua f Selecteo l d Techniques. Proceedings fro Internationan ma l Workshop sponsored by the UNDP/World Bank/WHO Special Programme for Research and Trainin Tropicagn i l Disease Mahidod san l University, Bangkok (1985).
29 [4] GLOVER, D.M. DMA Cloning: A Practical Approach. Volume I. IRL Press, Oxford (1985). [5] DAVIS, L.G., DIBNER, M.D., BATTEY, J.F. Basic Methods in Molecular Biology. Elsevier Yorw kNe . (1986). [6] NAMES, B.D., HIGGINS, S.J. Nudeic Acid Hybridization: A Practical Approach, IRL Press, Oxford (1987). [7] BERGER, S.L., KIMMEL, A.R. Guide to Molecular Cloning Techniques, Academic Press, CA (1987). ] [8 SAMBROOK , FRITSCHJ. , , E.F., MANIATIS . T Molecula, r Cloning LaboratorA : y Manual, 2nd Ed., Volumes 1, 2 and 3, Cold Spring Harbor Laboratory, New York (1989).
30 DETECTION OF ENTEROINVASIVE Escherichia coll ON A COLONY BLOT FILTER PAPE HYBRIDIZATIOY RB N WITHA 17kb PROBE
Oralak SERICHANTALERGS*, Channarong SANGHIRAN**, Wipawee USAWATANAKUL***, Korbkit CHERDCHU** Department of Microbiology, Immunology and Molecular Genetics, Armed Force Research Institute of Medical Science Department of Tropical Radioisotope, Faculty of Tropical Medicine, Mahidol University Department of Microbiology and Immunology, Facult f Tropicayo l Medicine, Mahidol University Bangkok, Thailand
INTRODUCTION
Enteroinvasive Escherichia coli (EIEC) and Shigella cause dysentery by invading epithelial cells of the colon [2, 3, 5, 6]. EIEC are difficult to identify by normal biochemical test a routin n si e bacteriology laboratory genetice virulence Th . th f so f Shigellaeo d an EIEC are similar [4, 7, 8], Both contain plasmids of 120-140 megadalton (mDa) that are necessar r virulence EcoRyfo b k 7 1 I digestioA . A MD n0 fragmen 10014 R e pW th , f o t plasmid of S. flexneri 5 (M9OT), was shown to be specific in differentiating EIEC from non-ElEradiolabelleA . 9] , C[1 d easil e probb n ye ca prepare use specifid a ds an d a c probe to identify EIEC in either colony or stool blot sample by the hybridization assay.
Hybridization wit ha polynucleotid e prob r EIEfo e C consist f severao s l steps a s described below:
1. Plasmid purification of cloned DMA (pRM 17) that contains the 17 kb fragment. . Endonucleas2 e digestio f plasmino d DMA. . Spottin3 f bacteriago l colonies. l electrophoresiGe . fragmentb 4 k 7 1 elutio d e san .th f no . Preparatio5 nicy f a-b n o k 32A Ptranslatio labelleDM b k 7 d1 n method. 6. Hybridization assay. 7. Autoradiography.
PLASMID PURIFICATION OF PRM17
. 1 Gro brotwB L bacteria f ho overnighl m 0 l cell20 tn si wit h either rollin rotatoa n gi r t 37°a r shakinCo watea n gi r bath (100 ml/flask).
LB medium (Luria-Bertani medium)
To 950 ml of deionized H20 add: g 0 1 Bacto-Tryptone Bacto-Yeasg 5 t Extract g 0 1 NaCI
. 2 Shake unti e soluteth l s have dissolved 0 wit NaO7. N h 5 o t .H H Adjusp e th t (0.20 ml). Adjust the volume of the solution to 1 liter with deionized HO. Sterilize
by autoclaving for 20 minutes at 15 Ib/sq. in. 2
31 Isolation of plasmid DMA
1. Transfer bacterial cell suspension from broth to 1.5 ml microcentrifuge tubes (18 tubes).
seconds 5 . 1 2 r Spi2,001 fo t na m . 0rp
. 3 Aspirate supernatan resuspend an t d pelle 100//n i t I cold solutio n(seI e Appendir xfo solutions I, II, III).
4. Hold at 0°C in ice for 30 minutes.
200//d gently Ad b f solutio o Ix e. 5 Mi shaking . nII solutioe Th . n should become clear afte minute5 r t 0°Csa .
150//d Ad f colIo d. 6 solution III. Gently inver tubee tth . Chromosoma wilA l clumDN l p and precipitate.
7. Hold the tubes at 0°C in ice for at least 60 minutes.
minutes0 1 r fo .m rp 0 . 00 8 2 Spi1 t na
9. Transfer supernatant (approximately 400/t/l) to fresh tube.
10. Add 1 ml of cold ethanol (-20°C) and mix well.
11. Hold the tubes at -70°C for 30 minutes.
12. Spin at 12 000 rpm for 10 minutes.
13. Aspirate supernatant and resuspend pellet in 100//I of 0.1M NaOAc and 0.05M Tris HCI 8.0H ,p .
200//d Ad f col Io . d14 ethano lwellx (-20°Cmi .d an )
15. Hold the tubes at -70°C for 30 minutes or at -20°C overnight to precipitate the DNA. minutes0 1 r fo m . rp 0 00 . 2 Spi1 16 t na
17. Aspirate supernatant.
18. Air dry the tube.
19. Dissolve the DNA in 25 //I of TE buffer.
ENDONUCLEASE DIGESTIOA DN F NO
Reaction mixture
DDW 49 fj\ Plasmid DNA 25 fj\ I // 8 Reaction buffe 3 # r EcoRI \ enzymjj 8 Unit///l0 e(1 )
. t 37°hour2 1 a wate a r Incubat CA fo n si DN r bathe eth .
32 2. Store at 4°C overnight or until use.
SPOTTIN BACTERIF GO PLATN AO E
1. colone Picth p ku y from original plat spod MacConken ean o t y plat shows ea e th nn i figure.
2. Incubate at 37°C overnight.
Blottin Whatman go pape1 n54 r
. 1 After cell growth, mark Whatma pape1 nr orientatio54 fo r ovey la rd coloniesnan .
2. Gently apply pressure with glass spreader to remove any air bubbles.
3. Lift Whatman paper off the colonies.
4. Place the 541 paper on Whatman paper No. 3 in glass petri dish saturated with solution I.
5. Boil in microwave oven for 30 seconds.
6. Immerse in solution II for 4 minutes.
7. Air dry on paper towels with 2 changes.
. 8 Kee t roopa m temperature overnight.
FIG. 1.
33 GEL ELECTROPHORESI FRAGMENb k PLASMIELUTIO F D 7 SO 1 AN A L A F NDTO GE DM
Preparation
. 1 Prepare 0.7% agaros buffeB T t boilinn ei a r g temperature. . 2 Pou ware th r m aga minislan o r l platebge , leave until solidified. . 3 Remov f gelcome o eth t . bou
Sample preparation
1. Standard Standard 3 jj\ TE buffer 7 u\ Dye 10 (J\
2. PlasmiA dDN PlasmiA dDN 3 fj\ TE buffer 7 fj\ Dye 10 fJ\
3. Digested plasmid DNA Digested plasmid 81 fJ\ Dye 81 jj\
1. Apply each sample into the wells as shown in the figure below:
Samples 0.7% agarosl ege
Std i_
FIG. 2.
2. Run electrophoresis at 80 volts for 90 minutes.
. 3 Remov placd an distille n el i ege d water wit hdroa f ethidiupo m bromid leavd er an efo 10 minutes.
. 4 Remov l intege o distilled water.
34 banA usiny dDN b ultraviolet n ga Cu . 5 t transluminato takd ean r photograph.
banA dDN t intoCu fin e. 6 pieces.
7. Fill in the chamber of an Isco electrophoretic concentrator.
8. Add buffer into the chamber of the concentrator in following order:
75 ml of buffer III in compartment A at the same time with 90 ml of buffer III in compartment B.
90 ml of buffer II in compartment C at the same time with 75 ml of buffer III in compartmen. D t
9. After applying the electric current (1 Watt) for at least 4 hours, remove the buffer out of the wells and collect concentrated DNA (200 ju\) into 1.5 ml microcentrifuge tube.
10. Add cold 3M NaOAc pH 5.2 fj\ (0.1 % of DNA volume).
11. Add cold ethanol 440//I (2 x of total volume), gently mix.
. Kee12 t -20°pa C overnight.
l electrophoresiGe determino st concentratioA eDN n
Ru (10//Il e electrophoresi (9//Inge E Dy T determin o ywlt ) + 1 ) ( + ) A A DN eDN f so concentration and compare with the lambda DNA digested with Hind III.
PREPARATIO NICY a-B F NK O LABELLEA P TRANSLATIODN b k 7 D1 N METHOD 32
. 1 Reaction mixture
\ u 0 8. 0 2 H Nick translation buffer 5.0 jj\ Cold (A,G,T) 4.0 fj\ I // basK 5 7 e1 2. (0.1 yug/ml) Polymerase I 0.5 fj\ \ /j 0 3. DNasel* dCTP (a-32P) 7.0 jj\ Total volume 30.\ fj 0
* DNase I (sigma) stock solution = 10 mg/ml in 50% glycerol.
Make 1:1 dilutio0 ng///000 1 n= l
2. Incubate at 14°C for 90 minutes.
3. Stop reaction with 0.5M EDTA pH 8.0, 5 //I.
. 4 Incubat minutes 0 t 65°1 ea r Cfo .
t SephadeSe 5. x G-50 colum t roona m temperatur minutes0 3 r efo .
. 6 Remove cap centrifugd san minutes3 r t 200fo e a m 0.rp
35 7. Load DNA probe on surface of Sephadex G-50.
. 8 Centrifug minutes4 r t 200fo e a m 0.rp
9. Collect fraction of approximately 150 fj\.
10. Count radioactivity in 1 //I fraction.
11. Boil the rest for 10 minutes to denature, and store at -20°C.
Hybridization
Hybridiz n hybridizatioi e n solution with denatured prob t 2 hours42°a e r Cfo , (concentration of probe = 2 x 105 cpm/ml HB and 0.5 ml/filter).
Hybridization solution
Final concentration: 50% formamide/2x Denhardt's/4 x SET/0.4% SDS/20/yg/ml CTD/ 6% PEG-8000/ 500//g/ml heparin.
Stock 100ml
100% formamide 100% 50.0 100% Denhardt's 1000 2. % x 0 2 20.0 T SE % 20 1 mg/ml CTD (denatured) 2.0 40% PEG-8,000 40% 15.0 0 1. g m 0 5 mg/m0 5 l heparin
H2O 9.5
HYBRIDIZATION ASSAY Prehybridization
Soak Whatman paper in prehybridization buffer for 2 hours.
Prehybridization prob P buffe 2 3 r e fo r Final concentration = 10 x Denhardt's/4 x SET pH 8.0/0.5% SDS
/10/vg/ml CTD
50ml 100ml
100 x Denhardt's solution 5.00 10.00 T SE x 0 2 10.00 20.00 20% SDS 1.25 2.50 1 mg/ml CTD (denatured) 0.50 1.00
H2O 33.25 66.50
Note
shoulS addeSD e db % dpreveno 20 t afte1O .2 H r t precipitation. (calD f CT thymu . 2 s DNA) mus heatee tb boilindn i g wate r 5-1rfo 0 minute cooled san d before use.
36 Post-hybridization
1. Prepare washing solution 2000 ml/50 filters.
2. Wash the hybridized filters in 2 x SSC/0.2% SDS for 10 minutes at room temperature, repeat onc swirn eo l shaker.
3. Wash filters in 2 x SSC/0.2% SDS for 10 minutes at 65°C. Repeat the process twice.
4. Wash filter in 0.1 x SSC/0.1 % SDS for 15 minutes at 65°C. Repeat the process once.
5. Rinse filters in 2 x SSC at room temperature for 10 minutes.
6. Blot dry and air dry.
Washing solution
20%SD+ C O 2 FinaSS H x S + l 0 volum2 e ml ml ml 1. 2 x SSC/0.2% SDS =4000 ml 400 40 3560 2. 0.1% SSC/0.1 SDS = 2000ml 10 10 1980 - 190 0 10 0 2000m= l SSx 32 .C
AUTORADIOGRAPHY
. 1 Tape filter sheea n f spapeo o t r int filoa m holder. fily mdarbetweera n a i n X kI n roompapea e n. t th 2 pu intensifyin,e r sheeth d an t g screen. 3. Incubate at -70°C overnight. 4. Develop the film after 24 hour incubation.
APPENDIX
brotB L h (prepar . 1 e fresh daily)
. 2 Solutio nI (hol t 0°Cda )
M glucosm 0 5 e 10mM EDTA M 25Trim s0 HCI8. H p , 5 mg/ml Lysozyme
For 5 ml of working solution use:
250 jj\ of 1M glucose (sterilized by 0.45//m Millipore membrane) 50 //I of 1M EDTA (sterilized by autoclaving) 125 fj\ of 1M Tris HCI (sterilized by autoclaving) 0.025 g of lysozyme (kept at 4°C) W DD y b l m mak5 o et
3. Solution II
0.2N NaOH S SD % 1
37 Working solution
f 0.4o Nl m NaO2 H {sterilize autoclavingy db ) 2 ml of 2% SDS (sterilized by autoclaving) Store at room temperature (stable for approximately 1 week)
4. Solution III
3M NaOAc, pH 4.8
Dissolve anhydrous NaOAc in minimal volume DDW. Titrate to pH 4.8 with glacial acetic acid. Bring to full volume and store at 4°C.
. 5 IMTri 8.0H ) s(p
Dissolve 121.1 g Tris base in 800 ml of DDW. Adjust the pH to 8.0 by adding approximatel f concentrateo l m 2 y4 d HCI. Steriliz autoclavingy eb .
6. TE buffer (pH 8.0)
10mM Tris. HCI (pH 8.0) EDTM 18.0m H )A(p
7. 0.01 M EDTA (pH 8.0)
Add 3.722 g of EDTA.2H2O to 800 ml of DDW. Stir vigorously on a magnetic stirrer. wit0 8. h o t NaO AdjusH p He NaO(0.g th t 4 H pellets). Steriliz autoclavingy eb .
. 8 0.7% agarose
Boil 1.4 g agarose in 200 ml TE buffer with magnetic stirrer.
. 9 lOxTB
f TrismDissolvo g f 8 aborio f base10 eEDTg o c 5 g acid5 A, 3 disodiu9. , m saln i t brinlitred 1 an o g .t DDW 3 8. . o t AdjusH p e th t
. Ethidiu10 m bromid mg/ml0 e(1 )
f ethidiuo g 1 f DDW o m d l . m bromidAd magneti0 a Sti 10 n o r o et c stirre r severafo r l hours to ensure that the dye has dissolved. Wrap the container in aluminium foil or transfe dara o kt r bottl stord et an 4°Ce a .
11. Buffers for electrophoresis concentrator (10 x)
Buffer II 100mM Tris EDTM m A2 0. Adjust to pH 7.8
Buffe I II r Prepar sodiuM e3 m acetat dilutio2 1: n ei f buffen o . II r
12. 3M Sodium acetate pH 5.2
Dissolve 408.1 g of sodium acetate.3H2O in 800 ml of DDW. Adjust the pH to 5.2 with glacial acetic acid. Adjust the volume to 1 litre. Sterilize by autoclaving.
38 . Buffer13 colonr sfo y hybridization
Solution I 0.5M NaOH 1.5MNaCI Dissolve 20 g of NaOH and 87.75 g of NaCI in DDW.
Solution II 1 M Tris 2M NaCI Dissolve 121.1 g of Tris and 117 g of NaCI in DDW and adjust the pH to 7.0.
Buffers r preparatiofo prob) f nkb o P-labelle e7 (1 A dDN
32
14. 0.5M EDTA pH 8.0
Add 186. f EDTAf DDWo o 1l g m . . 0 2HSti80 r2 Oo t vigorousl magnetia n yo c stirrer. Adjust the pH to 8.0 with NaOH (20 g of NaOH pellets). Sterilize by autoclaving.
. Denhardt'15 s solution (10) 0x g 0 1 Ficoll Polyvinylpyrrolidong 0 1 e BSA (Pentax Fraction V) 10 g
H2O to 500 ml
Filter through a disposable Nalgene filter. Dispense into 25 ml aliquots and store at -20°C.
16. SET (20 x)
30 mM Tris, pH 8.0 150mM NaCI 1 mM EDTA
(sodiuS SD m% dodecy20 . 17 l sulfate)
Dissolve 200 g of electrophoresis grade SDS in 900 ml DDW. Heat to 68°C to assist dissolution addiny dropb w 2 fe f concentrateg7. sa o o .t AdjusH p e th t d HCI. Adjuse th t volume to 1 litre.
. 20xSS18 C
Dissolve 175. f NaC 88.o d 3 f sodiug o an f I 2DDW o g l mm .citrat0 Adjus80 n ei t solutioN drop0 witw 0 1 fe 7. f f NaOHhn so a o o t H .p Adjuse th volume th tlitre 1 eo .t
Sterilize by autoclaving.
REFERENCES
] [1 BOILEAU, C.R., D'HAUTEVILLE, H.M., SANSONETTI, P.J. hybridizatioA ,DN n techniques to detect Shigella species and enteroinvasive Escherichia coli, J. Clin. Microbiol. 20 (1 984) 959-961. [2] DUPONT, H.L., FORMAL, S.B., HORNICK, R.B., SNYDER, M.J., LIBONATI, J.P., SHEAHAN, D.G., LABREC, E.H., KALAS, J.P., Pathogenesi f Escherichiaso coli diarrhoea, N. Engl. J. Med. 285 (1971) 1-9.
39 ] [3 FORMAL, S.B., HORNICK, R.B., Invasive Escherichia coli, . InfectJ . Dis(19877 13 . ) 641-644. ] [4 HALE, T.L., SANSONETTI, P.J., SCHAD, D.A., AUSTIN , FORMALS. , , S.B., Characterization of virulence plasmids and plasmid-associated outer membrane proteins in Shigella flexneri, Shigella sonnet, and Escherichia coli, Infect. Immun. 40 (1993)340-350. [5] LABREC, E.H., SCHNEIDER , MAGNANIH. , , T.J., FORMAL, S.B., Epithelial cell penetratio essentian a ns i lpathogenesi e steth pn i f bacillarso y dysentery, J.Bacteriol. 88 (1964) 1510-1518. [6] LEVINE, M.M., KAPER, J.B., BLACK, R.E., CLEMENTS, M.L., New knowledge on pathogenesi f bacteriao s l enteric infection applies a s o vaccindt e development, Microbiol. Rev (19837 .4 ) 510-550. [7] SANSONETTI, P.J., KOPECKO, D.J., FORMAL, S.B., Involvement of a plasmid in the invasive ability of Shigella flexneri, Infect. Immun. 35 (1982) 852-860. [8] SANSONETTI, P.T., D'HAUTEVILLE, H., FORMAL, S.B., TAUCUS, M., Plasmid mediated invasiveness Shigella-like Escherichia coli, Ann. Microbiol. (Paris) 132A (1982)351-355. [9] SETHABUTR, O., ESCHEVERRIA, P., TAYLOR, D.N., PAL, T., ROWE, B., DNA Hybridizatio identificatioe th n i f enteroinvasivno e Escherichia shigellcolid an n ai children with dysentery n "Infectioui , s diarrhoe e youngth . Tsiporin i a(S " , Ed.), Elsevier (Biomedical Division), Amsterdam (1985) 350-356.
40 PATHOGEN DETECTION BY THE POLYMERASE CHAIN REACTION
Suwicha Tim CHITPATIMA*, D.R. DVORAK**, Dhana SETTACHAN*, Jaturaporn PORNSILPATIP*, Unchalee VISAWAPOKA*
* Molecular Biology Laboratory, Departmen f Biochemistryo t , Pramongkutklao College of Medicine, Bangkok, Thailand ** Amersham International Ltd, Singapore Branch, Singapore
INTRODUCTION In recent years, significant advancemaks it havd p knowledge u an th eA n si DM f eo developmene th le o dt powerfua f o t l technique called polymerase chain reaction {PCR). The term PCR can be defined as "a primer mediated enzymatic amplification of specific genomic or cloned sequence". Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems normally encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. Nowadays, PCR technology is fast becoming common place among molecular biology laboratories.
PCR can be considered as a second generation molecular biology technique with several inherent advantages technique Th . relativelfass ed i an t y eas performo yt e Th . virtue of the technique lies in its sensitivity and specificity. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. More recently, with advances in knowledge of genetic basis of disease pathogenesis, PCR has been utilized to study genetic predisposition and disease association. Genetic markers of diseases have been extensively studie identifiedd dan . Regulative gene expressiod nan disease associatio bees nha n elucidate severadn i l system mammalssn i recene Th . t utility of antisense RNA and DMA in regulating gene expression has been realized. PCR can be used as quantitative tools to measure the extent of gene expression as a function of regulative agents botvitron i vivhn d i .oan
The basis of PCR lies in our knowledge of DMA replication. With current knowledge technologyA DN f o sequencA ,DM e informatio availablw no ns i e through many databases. These databases can be accessed and sequence information of genes from a variety of organisms obtained. Utilizing Watson-Crick base complementary rules, a pair of synthetic DNA (so-called synthetic oligonucleotides) complementare b o t segmento yt A DN f so amplified can be custom synthesized. These synthetic primers can then serve in locating and selecting specific complementary sequenc amplifiede b o et .
characterizee b PCn Rca havins da distincg3 t processes:
. 1 Denaturation: This process involves separatio double-strandee th f no templatA dDN e by hea excesn i t f 90°Cs o denature e Th . strandA dtheDN e sar n readprimede b o yt .
. 2 Annealing: This step involves primers findin correce gth t complementary sequence and bindin o thesgt hydrogea evi n bonding. Thi s achievei s y lowerinb d e gth temperature to optimal annealing temperature which is based on sequence composition (G/C content duplexe th f o ) .
41 3. Extension: This step involves extension of both primers in 5' to 3' direction in a sequence specific manner.
Anothe e enzym th y componen polymeraseA s i ke r eR DN PC f n earlI R o t .PC y reaction where Klenow fragment of DNA polymerase was used, addition of the enzyme after each cycls requiredwa e . s Thinecessarwa s y becaus e enzymth e e woule db inactivated during the denaturation step. This practice proved to be cumbersome and contributed to high degree of false positive results. Recently Kary Mullis and coworkers announced a major breakthrough in PCR technology. By using a DNA polymerase prepared from a species of thermobacillus which thrived in hot springs, PCR can now enjoy uninterrupted amplification enzyme Th sinc.s eha e then been produce recombinany db t DNA technique. More recently, other thermostable enzymes fro ma numbe f o r thermobacilli have been isolated.
One important consideration for performing routine PCR is the issue of quality control. This is based on the fact that this powerful technique can offer both advantages and disadvantages. The advantages have been discussed above. The disadvantages involved fallacious laboratory practices inherene th t no , t proble technologye th f mo . s i Whil R ePC a very sensitive detection technique, careless handling of PCR protocols could lead to spurious results. Exogenous sources of contamination can easily be introduced into samples which otherwise would not be amplifiable. This could lead to difficulties in interpretatio f datano . Minute contaminatio f samplno reagentd ean targe y wilsb A l DN t be amplifie scored dan positives da . Several precautionary steps mus takee b t insurno t e fidelity of the assay.
The most commonly practiced PCR protocols involve amplification of target DNA or cDNA sequences and analysis of PCR product by electrophoresis. The product is normally further identified by hybridization with probes complementary to regions inside of both primers validatea , d detection technique. Another alternativ protocoR PC e l involves enhancing sensitivity and specificity by use of successive amplification, the so called "booster or nested PCR". While this practice is useful in enhancing sensitivity, the method t practicaye t i sno routinr fo l e diagnostic use, especially when performe inexperiencey db d or careless laboratory technicians procedure Th . e call r amplificatiosfo r f fo targen o A DN t cyclesw fe a , followe transferriny db greactioe th par f o t anotheo nt r tube containing "booste r internaro l primers". This however increase chance sth r crosefo s contamination of post-PCR product fro e firsmth t amplificatio o pre-PCnt R mixture seconth f o e d amplification. In addition, this procedure is a few times more costly than normal amplification in that the frequently used and accepted protocol calls for a two step amplificatio set4 f f primero sno successionn i s . Nested PCR's true potential lien i s research for it can amplify low abundant and rare target DNA for further analyses.
Other applications of PCR includes environmental monitoring for presence of pathogens, and genetic abnormalities. The potential of PCR in diagnosis of prenatal and perinatal genetic abnormalities suc Phenylketonurias ha , Duchene's Muscular Dystrophy, Sickle Cell Anemia, Thalassemia, etc. has been realized in clinical diagnostic research, and e decadeth n i e methoth , s expectedi o becomdt e common l placresearcal n i ed han diagnostic laboratories.
thi protocoln I R s papePC described e o detectioe sar rtw th r firse fo s f i tHIV-Th n. o 1 DN bloodAn i othee th ,r detectio fo r f rabieno brain si viruA n cellssRN .
DETECTIO POLYMERASE HIV-F NTH O Y 1B E CHAIN REACTION
In this protocol the positive control sample is obtained from a commercial supplier suc Cetus-Elmes ha t infectiouno r s i Corp d indicates sa an . supplier'e th n di s brochure which is paraphrased below.
42 Retroviruse clasa e f virusesar o s that packag thein i A r viraeRN l particles t oncbu , e in the cell, replicate through a DNA intermediate (Fig. 1). From the turn of the century, members of this class of viruses have been known to be associated with various diseases in animals (for example, Equine Infectious Anemia Virus [EIAV]). It was not until 1970that Drs Baltimore and Temin identified the viral enzyme that is necessary for making a DNA copy of the viral RNA genome upon entering a cell. This enzyme was termed reverse transcriptase (RT) because the reaction it catalyzed was the "reverse" or opposite in direction from that in which the transfer of molecular information was thought to exclusively occur, namely RNAo t , froA .m ExtensivDN e studie genomie th f so c structure, functions of viral proteins, and molecular pathogenesis of the animal retroviruses have been carrie t ove lasde ou rth t twenty years firse tTh . human retrovirus cel,T l lymphotropic virus (HTLV-I) was described in 1980. HTLV-I was identified as the pathogen that caused adult T cell leukemia. Subsequently, this same virus was linked to the development of a chronic progressive myelopathy. Not long after, a second related virus (HTLV-II) was identified but, to-date, has not been linked to any specific disease. It was within this scientific climate that Drs. Gallo, Montagnie theid an rr colleagues linke thire dth d human retrovirus e humath , n immunodeficiency virus (HIV-1) e diseaseth o t , , AIDS. More recently fourta , h human retrovirus (HIV-2 characterizes wa ) showd dan o alst n o cause AIDS.
The replication of the retroviruses within cells requires a specific structure of the viral genom intacn functionaa d d an t ean l reverse transcriptase gene indicates A . d abovee th , firs treplicatioe steth n pi f retroviruseno productioe th s i double-strandea f no d copf yo single-strandee th vira e cop genomeA th A f l ygenomo DN d RN e beeTh s . eha n termee dth provirus. The next step of the viral life cycle employs integration of the proviral DNA into
Budding Particle Double-stranded DNA Incomplete Capsld DNA • • • WSJOUBLKJta • • Reverse Transcription 70S tarna®imaaa RNA 35S 35S Translation *
Polymerasy e ! 35S RNA '
FIG. Replication1. retrovirusof RNA.
43 hose th t cellula t thia rss i DNAstag t I . e tha virae tth l genetic information lies dormand an t require e applicatioth s e polymerasth f o n e chain reactio s nunambiguouit (PCRr fo ) s detection^ The production of RNA viral genomes requires the recognition of the viral regulatory region, (the promoter) and because of its structure (see below), the long terminal repea tcellula a (LTR y b ) r enzyme (RNA polymerase initiato )t synthesie eth n a f so RNA copy of the viral genetic information. It is this RNA copy of the viral genome that is packaged corfirsa n ei t wit hviraa l protein calle nucleocapsie dth d protein (the product gene)g core ga thes Th i ee . onth f coated with another viral protein designatee dth envelope protein (the product of the env gene). Copies of the reverse transcriptase (a l gene alsproducpo e e ar o) th package viraf e founo corte e th th ar f l eo particlen d i dan . Without this reverse transcriptase the virus is unable to propagate itself since the host cell lacks this enzyme.
The virus is incapable of entering all cells. Before cell infection can occur, specific regions of the envelope protein bind to a protein (i.e. CD4) on the surface of a specific type of immune cell, a T4 or T helper cell. Cells without CD4 can not be infected with this virus. Although other types of cells contain the CD4 protein on their surface, most cells do not contain this protein. Naked DNA, by definition, lacks the envelope protein necessary to allow this specific recognition to occur and is therefore not considered to be infectious in the classic sense. Specifically, mere incubation of the DNA with target cells does not result in infection. Virologists have, however, over the years developed laboratory procedures that allow the entry of naked DNA into cells. The method most commonly used, the calcium phosphate transfection procedure, requires the exposure of nucleic acid to concentrations of calcium phosphate not typically found in nature before cell entry is accomplished. In fact, a vast excess of DNA (i.e. 5-10 x 10"6 grams) is require evedo t n transfect 10-20 celle th %sf o whil e extremely small amount virue th sf so with protein envelope (10"15 grams) can readily lead to infection of all of the cells. The first level of biosafety provided is the use ofnaked DNA rather than packaged virus particles.
Figur containe2 schematisa c representatio structure th f retrovirane o th f eo l genome andistributioe dth virae th f l no genes addition I .gene e th no st noted above, t thera e ear least anothe gene8 r s that pla regulatio rolythe a evirain the l nlifof e cycle productThe . s f theso e genes effect different aspect virue th f ss o lif e cycl intricatmakn d a ean p ed u ean complex regulatory pathway virae th lf I genom. rearranges ei d such tha e terminth t f o i the viral genome, the regions required for the production of the RNA viral genome, are presen tinterna n onla n yi l position, rather than being duplicate terminie th t da , replication
Tronsnctivaloiol „.,.„,,. HIV Expression Require Productior dfo n ol Inloclious Viiions ^ UpRegulales IUV Production
pol Function . Regulatory Sequences ^ Unk/icwn V ReplicatioV loHI r n Ptolease/ReverseTranccriptaso/ Envelope Proteins Down Rogulaliol no ReplicatioV HI n : Endonudeaso
FIG. 2. Schematic representation of the structure of the retroviral genome and the distribution of the viral genes.
44 of infectious viral RNA is prevented. The second level of biosafety is the use of a viral genome with rearranged termini. The rearrangement of the viral genome also included disruptio e verth y f no gen e essentia r virafo l l reproduction e revers th e gen r th , efo e transcriptase. The molecular severing of the reverse transcriptase gene serves as the third leve f biosafetyo l . Finally o furthet , r modify (linearize e plasmith ) d containine gth rearranged HIV-1 proviral genome cleaves circulae wa th ,A d witDN r endonucleasn ha e (Bgl 1). Should any of the control DNA get into cells, linearization of the DNA makes it susceptible to both endonuclease and exonuclease degradation. The molecular cutting of the plasmid DNA represents the fourth level of biosafety.
The extremely small amount of DNA provided in the HIV-1 positive sample (1.5 x 10~12 grams) (the fifth level of biosafety) coupled to the four levels of biosafety described above provides overwhelming confidence tha HIV-e th t 1 positive contro provideA DN l dn i commerciae th ldetectio e researcth r capablt fo t f HIV-no nh ki o s i 1f leadine o infectiongo t .
orden I empiricallo rt y evaluat infectivite eth HIV-e th 1f yo positive control DNAn a , experiment was carried out and described separately to confirm that this material is incapable , mosevee th n ti optimal case propagatinf o , g viru tissun si e culture levele Th . s of biosafety providee infectivitth d an d y study carrie t provideou d s overwhelmingly convincing evidenc biologicalles i tha t materiae ki th te th yn i l safe.
Sample preparation
(Adapted Protocols, fromPCR Innes,M. aAcademicet I., Press, Inc. (1990) with some modifications.)
All samples, including clinical specimen, must be handled and disposed as if they contain a transmittable infectious agent. Lab coats, masks, safety glasses and gloves must be worn. Wash hands thoroughly when wor completeds ki .
f wholo l . m e 1 0 blooCollec1 venipunctury o t db 5 t (aciD eithen edi AC citratn a r e dextrose r EDTo ) l l AwholEDTA) m tubvo 0 5 e ef (1 .bloodo l m 2 :
t advisabl no heparinize e s i us t I Noteo et :d tube because residual heparin will polymerasA inhibiDN q Ta t e activity.
2. Pipette 3 ml of Ficoll-Hypaque solution (12 vol of 9% Ficoll: 5 vol of 34% Hypaque) into a conical centrifuge. Carefully layer 5 ml of whole blood on top of the Ficoll-Hypaque.
. 3 Centrifug t rooea m temperatur swingina n i g minute0 3 0 g r bucke40 efo t sa t rotor (clinical centrifuge may be used). sterila e eUs transfe . 4 r pipett collecd e an mononucleae th t r cell fraction (opaque band locate gradiene th t da t interface l microcentrifugm )5 int1. oa e tube. Centrifugr efo second0 3 microfuga n si pelleeo t cellse th t .
phosphate-buffered Ad 5. gentlx dspiMi d salin. ynan ml sample e 5 (PBSth 1. o t o e)t microcentrifuga n i secon0 3 r efo pelleo d t cellse th t . Repeat this step twice.
extractee b t thi A n s ca point . dA 6 fro pelleteDN ,e mth d cells.
7. To use the cells immediately, resuspend the cells in 100 fj\ solution A, then add 100 jj\ solutio proceed nexan e nB th steto dn t i section p4 .
45 SolutionA
1 KC M 1 0. 10mMTris.HCI(pH8.3)
2.5 mM MgCI2
SolutionB
10mMTris.HC 8.3H (p I)
2.5 mM MgCI2 Twee1% 0 n2 1 % NP-40
DNA extraction
extractee b n ca dA froDN m either buffy coa r peripherao t l blood mononuclear cells (PBMC) as per above protocol. There are two other methods currently being used in our laboratory.
extractioA DN saltiny nb t gou
1. To a microcentrifuge containing buffy coat or PBMC, add 1 ml of ice-cold RCLB, mix by pipetting up and down IMMEDIATELY. Centrifuge 10 000 rpm for 30 seconds. Discard supernatant. Wash pellet twice with ice-cold RCLB.
Red cell lysing buffer (RCLB)
TOmMTri 7.6H s(p )
MgCIM 5m 2
2. Add 1 ml of ice-cold WCLB, mix IMMEDIATELY.
White cell lysing buffer (WCLB)
10mMTris (pH 7.6) 10mM EDT 8.0H A)(p witx mi h d automatian S SD c % pipette10 f o I .// 7 1 d Ad . 3
17/yd f Ad Proteinaso l . 4 solutioeK witx mg/ml0 mi hn (1 d automatian ) c pipette.
5. Incubate at 42°C for 2 hours or overnight.
6. Centrifuge 15 second in a microcentrifuge.
7. Add 370 fj\ of 6M NaCI, vortex immediately.
. 8 Centrifug above6 n i s e.a
9. Place supernatant in a fresh 5 ml plastic tube. Add 2.8 ml of 95% Ethanol. Mix by inversio strandA f tubeshoulnu o DN Yo e s. dimmediatelyse t thiA n .s ca poin u yo t t 4°Ca storA . eDN
a fres e h Us pipettA o strandtakt . DN d placep 10 ti ean s e thew n ne int a o microcentrifuge tube. Wash DNA strands with 1 ml of 70% ethanol twice.
46 11. Centrifuge @ 10 000 rpm for 30 seconds. Discard the supernatant. speedvaca n i A DM . y Dr . 12
bufferE T f o . I // 0 . 3 Dissolv 13 n i A eDN
TE buffer
10mMTris.HC 7.6H )(p I 1 mM EDTA (pH 8.0)
14. Store DNA at -20°C until use.
Rapid DNA extraction protocols
followine Th g procedur provides ei alternativn a s da e metho r extractindfo A gDN from biological materials suc whols ha e blood (fresh, refrigerate r frozendo blood an ) d stains. This method has been used with the AmpliTypeTM HLA DQ Kit by scientists at Cetus Corporation.
Chelex is a chelating resin with a high affinity for polyvalent metal ions. The Chelex resin is composed of styrene divinylbenzene copolymers containing paired Aminodiacetate ions, which act as chelating groups. It has been postulated that the presence of Chelex during boiling prevents the degradation of DNA by chelating metal ions that may act as catalyst breakdow e t higa th hA n si temperatureDN f no ioniw lo c n si strengt h solutions. The basic Chelex procedure consist f boilinso Chelesample % 5 gth a xn e i solution d an , then addin fractioga supernatane th f no MixR . tPC directl Notee th o :yt this Chelex procedure results in denaturation of the sample DNA.
1. int O l microfugH steriloa m f Pipett o 5 l e1. m e1 e tubef whol10//d o IAd . e blood. 2
2. Incubate at room temperature for 30 minutes. Mix occasionally by inversion or gentle vortexing.
. g 0 . 00 3 5 Spi1 o microcentrifugt n i g 0 minute3 00 o 0 t 1 2 t sr a efo
4. Remove supernatant (all but 20 to 30 //I) and discard.
5. Add 5% Chelex to a final volume of 200//I (Chelex 100 (100-200 mesh, sodium form, biotechnology grade, Bio-Rad)).
6. Incubate at 56°C for 30 minutes.
. 7 Vorte t higseconds0 xa 1 h o t spee 5 .r dfo
. 8 boilinBoia n i l g wate rminutes0 bat1 r hfo .
. 9 Vorte t higseconds0 xa 1 h o t spee 5 .r dfo
10. Spin in a microcentrifuge for 2 to 3 minutes. supernatane th f 20//d o PCe IAd th R . o t mix 11 .
Note: When pipetting Chelex stock solutions resie th , n beads mus distributee b t d evenly in solution; this can be achieved by gently mixing with a stir bar in a
47 beaker. Als pipettothe useetip d must hav relativela e y large pore-ml 1 Pipetman tips are adequate.
BASEA DN R DPC
DNA amplification
Each sample is initially analyzed with a primer pair that amplifies a region of human beta globi f sufficieno n s geni A determino et amplificationtDN R qualite PC th r f ei yfo . Samples are then amplified along with the HIV primer pair in the same reaction tube. The conditions recommended below were optimize e primeth r rdfo pair SK38/39. Each amplificatio performens i finaa dn i l volum f 50//Ieo .
1. Prepar emastee 40//th whicx f o Imi r h contains:
10 x buffer II (PCR core reagent)* 5 p\ ( 1 x )
10mMMgCI2 15 /J\ (3 mM) Primer SK 38 0.2 //I (0.1//M) SK39 0.2 fj\ (0.1//M) \ fj (0. 1 0. juM) G0 H2 \ fj (0.1//M 1 0. ) P4 C0 AmpliTagTM 0.2 jj\ ( 1 U }
Distilled H20 up to 40 //I
"PCR buffe I (GeneAmI r corR epPC reagent).
Tris-HCM 3 m KCL8. M 0 H m p I10 , 0 50
. 2 f Overlaminerao \ jj 0 y5 l oil. sampleA DN e .th f o \ fj 2 d Ad . 3
. second4 w Spife microcentrifugtubee a a n th r n i s sfo o brinet e e liquith gth o dt bottom.
. 5 Plac sample eth thermaA e tubeDN a l n si cycle r (Perkin-Elmer Cetusr Modeo 1 TC l TC 480). Perform the 'thermal-cycle' file as follows:
a. 'Hot start' at 80°C for 10 minutes. Add cold 8//I of 1.25 mM dNTPs (200//M). b. denature at 96°C for 1 minute; anneal at 55°C for 30 seconds; extend at 55°C to 96°C for 2 minutes; cycle counts = 50. c. final extending at 72°C for 10 minutes.
6. Stop reaction by chilling at 4°C.
Analysis of amplification product
portioA f 5-10//no I amplification produc electrophoreses i t agarosn di e gel. Stain l witge h e ethidiuth m bromid photographd an e amplificatioe Th . n product shoule db confirmed by either dot/slot or southern hybridization by a specific internal probe.
48 AGAROS ELECTROPHORESIL EGE S
Agaros l electrophoresiege s
Reagents
The most commonly used gel buffers are either TAE (Tris-Acetic acid-EDTA) or TBE (Tris-Borate-EDTA). In this exercise, TBE is used at final concentration of 0.5 x. buffeE TB rx (0.45 5Tri . M 1 s BorateEOM m T A0 )1 ,
Tris base 54.0 g Boric acid 27.5g EDTA disodium salt 1.86 g Distilled wate o t r 1000ml
2. Running buffer
l buffe liteThi1 ge distille n i preparerx s o i t r 5 f o d l dilutin y watedb m d 0 gan r10 adding 50//I ethidium bromide solution (10 mg/ml) to a final concentration of 0.5//g/ml.
. 3 Size marker
pBdigeste2 R32 d with Haelfl give goosa d rang f fragmenteo sizese th n si : 587, 540,504,458,464,267,234,213, 192,184, 124, 123, 104,89,80,64, 57, 51,21, 18, 11,8bp.
Many laboratories use in-house preparation of size markers, such as pBR322 digest with HinfI which gives fragments of 1631, 517, 510, 399, 344, 298, 220-221,154 and 75 bp long for use in PCR gels.
Note: On many PCR product analysis, a 1.2 to 1.5% agarose is used routinely. Nusiev1 3: f o e % agaros3 a Alternativel e r moreus fo n e ca qualitativ e yon e analysis with superior resolutio normano t l electrophoresis grade agarose.
4. Loading buffer (50% Glycerol and 0.25% Bromophenol blue).
5. Ethidium bromide solution (10 mg/ml).
Procedure
1. Place the casting tray on a level surface and keep the running plate inside the casting tray.
. 2 Preparagaros% 2 e eth e solution (this concentratio r separatiofo lesA s ni sDN f no than 500 bp).
Agarose (Molecular Biologyg grade2 ) l m 0 9 Distilled water 5 x gel buffer 10 ml
Melt agarose in microwave oven for 45 s using medium setting. Allow the gel to cool down to approximately 60°C before adding the ethidium bromide solution. Care should be taken so that the suspension does not boil over.
49 . 3 Pou agarose th r e only afte t cooli r s down 50°o st Cavoio t d damagin plastie gth c plates.
4. Place a comb across the rim of the casting tray to form sample wells. Adjust the heighteete th thao f hs o tt thel t leavyge bu f penetrat l o e ge aboum m e 1 eth t betwee runnine teetth e nd th hgan plate. t leasa minutes0 r 3 tfo t se . o . t 5 l Alloge e wth
6. Remove the comb carefully.
. 7 Lifrunnine th t castine l adherinth g ge f e o y platgth t an trapeeo d g et ou f yan of l underside of the plate. Transfer the plate and the gel to the main unit.
. 8 Fill each buffer chambe maie th nf o runi t with running buffer containin yu5 r gg0. pe ml of ethidium bromide until the buffer reaches the upper surface of the gel, but not completely drowning the gel itself. This offers the advantage in that when several gels are used in tandem, the load placed on a power supply is greatly reduced.
9. Prepare the DNA samples as follows:
8-10 fj\ of the DNA into an Eppendorf tube. Add 1-2//I of the loading buffer.
10. Load the samples carefully using a Gilson pipette.
. Electrophoresi11 t constansa t voltage (1-10 V/cm). Samples alway towarn sru e dth positive pole (red).
. Sto12 powee pth fron re l length whedy ge t f e reaco nth . 3 h2/
1 3. Visualize the gel pattern under UV-illumination. Photographic records may be made.
glovee Us Note handlo st : e gel r bufferso s containing ethidium bromide whica s hi powerful mutagen.
SOUTHERD AN T DO N HYBRIDIZATION
SOUTHERN BLOTTING
(Ftef. Southern Mo/.J. Bio/.EM, 1975, 98:503-517)
This procedure describe fragmentA e transfeth sDN f o r s from agarose gelo t s nitrocellulose filters producing a replica of the bands in the original gel and enabling the subsequent detectio fragmente th f no hybridizatioy sb n with specific probes methoe Th . d alkaliy b involve l ,ge neutralizatiodenaturatioe e sth th n i A alkale elutiod DN th f f nan io o n denaturee oth f fragmentA dDN y capillarsb y actio electrophoresisy b r no .
Transfer by capillary action
Procedure
. 1 After electrophoresiagarosphotographinn d a an n l o ege A DN usiny f gsb o g MP-4 Polaroi transilluminatorfild 7 man 66 n do 5-31 r 0 fo I , depurinat HC 0.2 n i N l 5 ge e eth
minutes. Rins(thiO H producoptiona s si R n e i PC f lesr o t size)fo ln i s thaB K . n1 2
50 shalloa n i . l 2 wPlacge trae eth y covered wit denaturine hth g solutio minute0 2 r nfo s with frequent gentle agitation.
Denaturation solution
0.5 M NaOH 1.5M NaCI
3. Decant the denaturing solution and rinse the gel with distilled water. neutralizine th d minuteAd 0 3 r g . fo solutio 4 l s wit ge soa d e hnan kth gentle agitation.
Neutralizing solution
0.5 M Tris.HCI (pH 7.0) 3M NaCI
. 5 During piecthia t sf nitrocellulose o timou t ecu e filter approximatele size th f th e o yo t gel and wet the filter in water then in 20 x SSC.
6. Set up a transfer apparatus as shown in Figure 3.
Care mus takee b t ensurno t e thabubbler ai t o thern se etrappear d betweel ge e nth annitrocellulose dth e filtealsd oan r betwee blottine th filtee d nth gan r sheets.
7. Leave overnight. Make sure there is sufficient buffer in the tray when you leave the laboratory.
8. Dissemble the blot and rinse the nitrocellulose filter with the contact face down for wit1C 5 hminuteSS gentl x 2 en si agitatio waso nt f exceshof s agarose.
9. Air dry the filter for 30 minutes. Make certain that the filter is absolutely dry.
10. Bake in vacuum oven at 80°C for 2 hours.
DOT BLOTTING
NaOsampleN A fina a 1 HDN o d t l o concentratioad ,T . 1 f 0.25Nno . Incubat t rooea m temperatur minutes0 1 r efo . Immediately plac icen eo .
equad Ad l volum . 2 f 0.2eo 5 SSCx .
(1-A . 3 DN 2Spo ywg/spote th t nitrocellulosn o ) t rooa ey m membrandr r ai d an e temperature for approximately 30 minutes. The total sample volume should not excee jj\d5 .
. 4 hourBak2 r t e80° fo svacuua a Cn i m oven.
ISOTOPI HYBRIDIZATIOA CDN N
Probe labelling
Methods for labelling with 32P are described in the preceding two papers by P. Tapchaisri and O. Werichantalergs et al. The procedure below uses the 5' end labelling.
51 TOP VIEW
Saran Wrap
20XSSC 20XSSC
SIDE VIEW
plate
f papeo ' i r
wet 3MM(20XSSC)
WICM M K3 — Gel (upsidecb^n)
2oxS5C
F/G. 3. Transfer apparatus for southern blotting.
A DN f o d 32P-labellinen ' 5 e th f go
labellind en ' 5 f restrictiogo n fragment polynucleotid4 T y sb e kinase usin requireP g32 s 5' OH ends. Oligonucleotides already possess free 5' OH group and need not by dephosphorylated prior to the labeling.
52 Procedure
. 1 Prepar l labelin totaea /v 0 5 l g mixtur followss ea : pmole0 (5 \ jj ) 5 A DN \ fj Kinasx 5 0 1 e buffer* Gamma-32PATP 50 pmole ~100;wCi Distilled water 34 //I T4 polynucleotide kinase 1 jj\ (20 units)
*10 x kinase buffer contains:
0.5M Tris-HCI (pH 7.5)
MgCIM 1 20. 50 mM DTT 1 mM Spermidine 1 mM EDTA centrifugatioy b x Mi . 2 n briefl incubatd yan minutes 0 t 37°e3 a r Cfo .
3. Stop reaction with 2 fj\ of 0.5 M EDTA pH 8.0.
4. Add 36 fj\ of 7.5M ammonium acetate and 216/;l of cold ethanol. To facilitate precipitatio recoverd nan f probeyo , yeast tRN addeAs i t 20//da f 100//g/mIo l stock solution.
incubatd an x eMi at-70° minutes 0 . 1 5 r Cfo .
. 6 Centrifug minutes0 1 r efo . Remov supernatante eth .
pellee speedvaca th y n i t Dr . 7
. 8 Redissolv pellee eth 20^n i t bufferE 1T .
Hybridization
(Post-PCR detection by oligonucleotide probes)
Reagent
SSPEx 0 3 :1. 265 g NaCI 41.4 g NaH2PO4 11.1 g EDTA
add distilled water to 800 ml and adjust pH to 7.4 with NaOH (~6.5 ml of 1ON solution). Adjust volume to 1 liter with distilled water and sterilize by autoclaving.
2. 50 x Denhardt's solution g 5 Ficoll Polyvinylpyrrolidone 5 g BSA (Fraction V) 5 g l m 0 50 Distilled water
Filter through Whatman No.1 paper and store at -20°C.
53 3. Hybridization solution:
6 x SSPE, 0.5% SDS, 5X Denhardt's, 100//g/ml salmon sperm DNA.
Procedure
. 1 Incubatl hybridizatiom 0 1 bloe eth n i t n solutio t leasa r hour2 ntfo t 55°sa a Cn i shaking waterbath.
2. Add the heated probe and hybridize for at least 2 hours at 55°C.
3. Wash the filter in 6 x SSPE for 5 min at room temperature, repeat this step twice.
4. Wash the filter in 1 x SSPE, 0.1 % SDS for 1 5 minutes at room temperature.
5. Wash the filter in 1 x SSPE, 0.1 % SDS for 1 5 minutes at 55°C. exposblod e th an autoradiograph to t y t ei dr r Ai . 6 yhour 1 fil r f thermI fo . stils ei a l high leve f backgroundo l , was filtee h th 0.1 n i r x SSPE 5 t 55°1 a ,r S C0.1fo SD % minutes. If the blot is to be stripped and reprobed, do not allow it to dry completely.
Autoradiograph
Place the filter inside a Kodak X ray film cassette (with the DNA side up) fitted with an intensifier screen.
1. Insid darea k room fily m,ra plac abovX n e filtea e clos d e th cassettee an r eth . . 2 Leav cassette eth t -70° dayea 1 r .Cfo . 3 Develo filme pth .
automatin a Alternativel e fily us mra n cprocessorX ca e yon .
NON-ISOTOPIC LABELLING AND DETECTION
Oligotailing and detection using ECL
The ECL 3' oligotailing system utilizes the enhanced chemiluminescence (ECL) (associated with horseradish peroxidase catalyzed oxidation of luminol) to detect the presence of oligonucleotides tailed at 3'end with f luorescein -dUTP (F-11 -dUTP), hybridized to target sequences on membrane. The labelling reaction (catalyzed by terminal deoxynucleotidyl transferase [TdT]) introduce tai sa f fluorescein-dUT o l d en P' 3 ont e oth nucleotidese oth f . Hybridized probe detectee sar two-staga dn i e process firse Th t. step is the development of the fluorescein horse-radish peroxidase (HRP) conjugate. The second stagdetectioe th s boune i th f no d peroxidas detectioL e usinEC e gth n reagents.
enzymatie Th c reductio f peroxidno couples ei oxidatioe th o dt f luminono e th n i l presence of an enhancer molecule. As the luminol breaks down it passes through an excited intermediate stage and as this returns to the base stage, light is emitted. This light outpu detectes i t blun do e light sensitive film providin permanentga , hard copy result. Oligonucleotides labeled with the f luorescein-dUTP 3' tail can be used to detect sequences in many standard Molecular Biology application fingerprintingA s sucDN s ha , Southern blots, in situ hybridization, colony and plaque hybridization, etc.
54 Oligonucleotide labelling
This protocol allows the labelling of single-stranded oligonucleotides bearing a 3'hydroxy group.
Reagents
1. Fluorescein-11 -dUTP. 2. Enzyme terminal transferase 2 U///I in a buffer solution pH 7. 3. 10 x Cacodylate buffer. 4. Water. 5. Control labeled and unlabeled probes. 6. Oligonucleotide probe.
Procedure
1. Place the required tubes from the labeling components, except the enzyme, on ice to thaw. microcentrifuga o T . 2 elabeline tubeth d icen ,o gad , component followine th sn i g order:
Oligonucleotide xjj\ (25-250 pmol) Fluorescein dUTP 10;ul Cacodylate buffer 16 jj\ Termina l I (2u//ultransferas// 6 1 ) e Wate o t r 160//I
The volumes corresponding to x and y should be adjusted so that the total reaction volume is 160//I.
3. Mix gently by pipetting up and down in a pipette tip.
. 4 Incubat reactioe eth t 37°na r 60-9Cfo 0 minutes.
. 5 Store labele r immediatdfo prob e placr ic o n e t -20°eeo a e us r lonCfo g term storage. t storD frost-frea ono n ei e freezer.
Rapid labelling protocol
The fluorescent properties of the hapten used in the ECL 3'- oligolabeling system can be exploite alloo dt direce wth t detectio a that o f possibllabeles ns i o e t i A , us dDN o e t rapid method to check whether a labeling reaction has been successful before continuing with the hybridization.
Procedure
1. Draw a grid on a sheet of DE 81 chromatography paper. A negative control consistin 1/1a f 6go fluorescein-11-dUTP shoul includee db confiro dt m thae th t washing stages are completed.
2. Apply 5 //I (2 x 2.5 jj\) each labeling reaction into the center of the appropriate square.
3. As soon as the samples are absorbed (approximately 1 minute), immerse the DE 81 sheet in prewarmed 2 x SSC, 0.1 % SDS. Incubate the blot at 60°C with gentle
55 agitatio r 15-2nfo 0allo T befory minutese papedr wNO th o et O r D immersio. n otherwise unincorporated nucleotide will then wash off very slowly.
4. Pour off the wash solution. Rinse the filter briefly with water (30 seconds), pour off and replace with ethanol.
5. Remove the DE 81 sheet with forceps and transfer to an absorbent surface to remove excess fluid.
transilluminatoV U . 6 uses ri visualizdo t fluorescein-labellee eth yellow/grees a A dDN n fluorescent spot.
Hybridizatio stringencd nan y washes
Reagent
1. Hybridization buffer
5 x SSC (w/v% 1 )0. hybridization buffer component 0.02% (w/v) SDS 0.5% (w/v) blocking agent (supplied)
hybridizatioe Th Note: n buffe blockind an r g buffe suppliee ar kitre th . n di Hea t these solutions to 50-60°C with stirring or frequent agitation, it normally takes up to minute0 3 dissolvo st componente eth .
. 2 Washing buffer
5 x SSC, with 0.1% SDS. both containin SDS% 1 g0. . 1 x SSC with 0.1% SDS.
. 3 Buffe liter1 ( 1 )r
NaCI 0.15 M (8.77 g) Tris Base 0.1 M (12.1 g) literwit5 1 7. makd o Adjush t . o t conean p eI u H p t HC .
4. Buffer 2 (1 liter)
NaCI 0.4M (23.4 g) Tris Base 0.1 M (12.1 g) Adjust pH to 7.5 with cone. HCI and make up the volume to 1 liter.
5. Bovine serum albumin (fraction V) (0.5%, w/v) in buffer 2 (100 ml).
Protocol
1. Place the blot into the hybridization buffer and prehybridize at 55°C for at least minutes0 3 shakina n i , g water bath. labelee th d dAd oligonucleotid . 2 e buffeprobe th eo t prehybridizatiore useth r dfo n step at a final concentration of 5-10 ng/ml.
56 . 3 Hybridiz hour2 - shakin t a 55°1 e a n sr i Cfo g water bath.
4. Remove the blot from the hybridization solution and place in a clean container. Cover wit exces n SDSSSChx a % 5 1 f s.0. ,o
5. Incubate at room temperature for 5 minutes with constant agitation.
6. Replace the wash buffer with fresh 5 x SSC, 0.1 % SDS and incubate for a further 5 minutes.
. 7 Discar wase dth h solution. Plac cleabloa e eth n i tn containe coved an r r witn ha excesSDSSSCx % 1 1 f 0. .,so Incubat t rooea m temperatur minutes5 1 r ed fo an , wash with 0.1 x SSC, 0.1 % SDS in the same manner. incubatd an S minute5 t 55°1 ea SD . r a SSC8 x C fo % Placn s1 i 1 blo0. e 0. , eth n i t shaking water bath.
. 9 Plac filtecleae a e th n i rn containe rinsd an re with minute 1 buffe r fo 1 r.
10. Discard the solution and replace with 0.5% blocking agent (supplied in the kit) in buffer 1. Incubate 30 minutes.
11. Rinse blot briefly (1 minute) in buffer 1.
12. Incubate the blot in the diluted antibody conjugate solution* for 30 minutes.
*Antifluorescein HRP conjugated.
Dilute antifluorescein HRP conjugate stock by a factor of 1000 in buffer 2 containing 0.5 bovinv %w/ e serum albumin (fractio. nV)
. Plac13 bloe eanotheth n i t r clean containe rinsd an re wit excesn ha f buffeso r fo 2 r 5 minutes.
14. Repeat 3 times to ensure complete removal of non-specifically bound antibody.
Signal generatio detectiod nan n
Reagent detection reagents 1 & 2
1. Mix detection solutions 1 and 2 to give sufficient reagent to cover the blot.
2. Drain the excess buffer from the blot and add the detection reagent directly to the side th bloe n containino t DMAe gth . [Dt allo omembranno e wth out.y dr ]o et
. 3 Incubat r preciselefo minuty1 t rooea m temperature.
4. Drain off the excess detection buffer and wrap the blot in Glad wrap. Gently smooth out air pockets.
5. Place the blot with DMA side up in the film cassette. Work as quickly as possible. Minimiz delae eth y between incubatin bloe gsubstratn th i t exposind ean g themo t film.
57 6. Autoradiograph the blot. One may use manual processing or use any automated X ray film processor.
EXTRACTION AND ANALYSIS OF RNA FROM ANIMAL TISSU TISSUD EAN E CULTURE FLUID
There are several methods for RNA extraction from a variety of tissues and tissue cultures. Sommose th f eto commonly employed methods involves separatio froA mRN f no proteinaceous substances by various means. Examples of these methodologies are:
1. Proteinase K digestion followed by ethanol precipitation. 2. Guanidinium extraction. 3. Urea-SDS extraction.
We will be extracting total cellular RNA from canine brain tissue and cytoplasmic RNA from cells grow tissun i e culture. Thes preparationA eRN s will the utilizee nb e th n di RNA-based PCR. mucs i A h RN morNotee: labile than DNA. Extra care suc s gooa h d laboratory handling of the samples is recommended. RNA is easily degraded by several factors, the most important of which is ribonuclease. There are a number of ways inactivate ribonuclease. One of the most commonly utilized practices is f (0.2%o e us ) e diethylpyro-carbonatth treao et l glasswaral t reagentd ean . f inhibitoro e Anotheus e s th suc s i rRNAs s ha e inhibitor from human placenta. Rat supernantant, vanadyl ribonucleoside and heparin are also used, although they may interfere with subsequent reactions.
TOTAL RNA ISOLATION BY UREA-SDS EXTRACTION
This is a simple procedure described by Gough [1 ] for preparing total RNA from tissue culture cell celr so l suspensions methoe Th .bee s dha n slightly modifeisolatioA RN r dnfo from canine brain tissue in our laboraties. It is simple, rapid and reliable in our hands. The procedure involves homogenization of the tissue or culture in 7M urea plus 1 % SDS combined with phenostee pon isolate s extractioni n i l A ethanoy RN d b e Th . l precipitation.
RNA extraction from canine brain tissue
Excise brain from the animal. The brain should be kept at -70°C until use. It is advisable to perform extraction as soon as possible and store the samples in RNA form.
Caution: When working with samples containing infectious agents, all protocols must be carried out in a biohazard hood and all utensils in contact with samples must be decontaminated.
Procedure
1. Grind 1 g of brain tissue in 2 ml of extraction buffer* with a hand homogenizer.
'Extraction buffer.
7 M Urea S SD % 1 0.3 NaC5M I 10mM EDTA 10mMTris-HCI (pH7.5)
58 . 2 Transfe homogenate th r cleaa additionao ed t n ad tube d an , l extraction buffeo t r make the total volume to 4 ml. f buffer-saturateo l m 4 d Ad d. vigorouslx 3 phenomi d an l y wit vorteha x mixer.
4. Centrifuge at 10 000 g for 5 min in a Sorvall RC5 centrifuge at 4°C.
. 5 Separat aqueoue eth s phase (top layer), discar phenoe dth l phase. Care shoule db disturtakeo t t interface nno b th e which contains proteins.
6. Reextract the aqueous phase with 4 ml of phenol:chloroform:isoamyl alcohol (50:50:1).
7. Centrifuge, recover the aqueous phase and reextract with phenol/ chloroform/isoamyl alcohol.
aqueoue th o T susin M phas. NaCI 1 M NaC8 gd 5 thoroughly0. x ead o mi ,t I d ad d an , volume5 2. f ice-colso d absolute ethanol. Stor t -20°ea C overnight.
min 5 . r 9 centrifugatio.y fo Collec b Was g pelle A A 0 hRN RN 00 t wit2 1 ht n a ice-col d ethano% collec70 d an l tmin 5 pelle r centrifugatiofo y . b tg 0 00 2 1 t na
10. Dry the RNA pellet in a vacuum centrifuge or a dessicator.
. Dissolv11 pellee eth 100//n i t I sterile water. Yield shoul aroune db d 2.0-4.0//g//wl.
RNA extraction from cells grow tissun i e culture
1. Dispers 6 cellse 10 200// n celli lysi)e x th 5 s( sf Io buffer .
Lysis buffer
Tris-HCM m 7.50 H (p I10 ) 0.1 5M NaCI
1.5mMMgCI2 0.65% NP-40
2. Discard the nuclei pellet by centrifugation at 800 g for 5 min.
3. To the supernatant, add 200//I of extraction buffer, mix well.
400//d Ad f phenol:chloroform:isoamyo I . 4 l alcohol (50:50:1) x vigorouslMi . a n i y vortex mixer.
5. Separate aqueous and organic phases by centrifugation at 10 000 g for 5 min.
6. Recover the aqueous phase and repeat the phenol extraction twice or until the interfac cleas ei f proteinaceouo r s substances.
. 7 Precipitat witA hRN ethano e eth l according protocoe th o t l described above.
Notes:
i. Wash the RNA pellet by ethanol in the same fashion as described for the whole tissue protocols.
59 extractee b o t s i dA froRN m f I tissu . eii culture media 200//e d us , f mediad o I d aan 200//I of extraction buffer. You may then proceed to extract RNA using the same protocol aboves sa .
RNA ISOLATIO GUANIDINIUY NB M EXTRACTION
Acid guanidiniumthiocyanate-phenol-chloroform extraction is an alternative method for RNA preparation. This protocol was described by Chomczynski and Sacchi [2] based combinatioa f o e guanidiniuus M 4 oe f nnth o m thiocyanat phenol/chloroford ean malloo t w a single step extraction.
. 1 Transfe f tissuo hana g o t de1 r homogenize d homogenizan r f o e l witm h2 solutio. nD
SolutionD
4M guanidinium thiocyanate 25mM sodium citrat 7.0H e(p ) 0.5% Lauryl sarcosyl 0.1M 2-mercaptoethanol
2. Transfer the homogenate to a clean test tube. Add 200 fj\ of 2M sodium acetate f phenol/chloroformo l (pm H 2 4.0 d }an , vortex vigorously.
. 3 Separat aqueout 4°Ce a e th n . mi s0 phas2 r centrifugatiofo y eb g 0 00 0 1 t na
. 4 Transfe aqueoue th r s f phasisopropano o tubea l witx o m et mi ,h1 placd an t l ea -20°C for 1 hour.
5. Collect the RNA precipitate by centrifugation at 10 000 g for 20 min.
6. Dissolve the precipitate in 0.5 ml of solution D and reprecipitate with equal volume of isopropanol at -20°C for 1 hour.
7. Collect the RNA precipitate by centrifugation at 10 OOOg for 10 min at 4°C.
. 8 Was e pelleth h t once with ethanolcol% 70 d , centrifuge dissolvd an y n i edr , 50-100yul water.
ANALYSIA RN F SO
The system most frequently used to analyze the RNAs on the basis of their molecular weight size and selectrophoresiis s agarosin s efro qualitgelsmRNA The .eac of y h preparatio alsn evaluatee nca ob thiy db s method puritA . analyzee YieldRN yar d san y db measurin absorbencyV U e gth .
Determination of RNA concentration
sampl fjA 5 \ . distille59 RN 1 f n ei Diluto \ jj d e 5 water .
spectrophotometerV U a n i . 2 m Measurn 0 28 absorbance d eth .an 0 26 t ea
A pure RNA sample should give a OD260/OD280 ratio of about 1.9-2.0. One A260 is equivalent to 40//g/ml RNA.
60 Electrophoresi througA RN l containinf sho ge g formaldehyde (denaturin gelA g)RN
Procedure
1. runninx Prepar 0 1 e ge th buffe r
runninx 0 1 g buffer
0.2M morpholinopropanesulfonic acid (MOPS 7.0H (p )} 50mM sodium acetate 10mMEDTA(pH 8.0)
2. Prepare the 0.8% gel by melting agarose in water, cool down to 60°C before adding runninx 0 1 g buffe formaldehyded an r .
0.8% agarosl em gel 0 ,10
agarose 8 g l m 2 7 water 10 x running buffer 10ml formaldehyde 18ml
. 3 Prepar sample eth followss ea :
RNA(5-10//g) 5.5/;l formamide 12.5 //I formaldehyde 4.5//I 10 x running buffer 2.5//I
Denature by incubation at 60°C for 15 min and immediately snap cool on ice.
f saturateo I // 2 d d bromophenoAd . 4 l blu wateren i sampleA . RN Loa e sd th ont e oth gel and electrophorese at constant voltage (5 V/cm) till dye migrate 2/3 of gel length.
5. Stop power. Immerse the gel in running buffer containing 0.5//g/ml ethidium bromide for 5-10 min.
6. Visualize the electrophoretic pattern under UV-illumination using UV transilluminator. Photographic mad e recorb describes y ea dma d earlier.
BASEA RN R DPC
AMPLIFICATION OF RNA BY THE POLYMERASE CHAIN REACTION
polymerase Amplificatioth y b A eRN chaif no n reaction involve ste2 sa p protocol. convertee b o t s complementaro dt ha A RN Firs e th (cDNAtA yDN ) usin e enzymegth , reverse transcriptase e cDN then Th . placee Aca b n d directly into reaction vessels reactioamplificatione A th d DN containinr an n x pe carries mi a R t . dou gWhilPC e thiy sma sound like a lot of tedious work, RNA PCR does offer several advantages over DNA PCR. Firsforemosd face an t th lookins i t activ n s thai e a t t on tga e system. SecondA RN , represents a "partially amplified" system in that there are more RNA copies than DNA to begin with. Another advantage is that one can actually quantitate gene activity by looking at copie f mRNso A produce responsn di physiologicao et l change r stimuliso .
61 It is advantageous to optimize the PCR for a given application (especially for diagnosis or analysis) in order to get 'clean' results. Basic methodologies and application of PCR are fully described elsewhere by a number of author [3-5]. A frequently faced problem in PCR amplification of gene sequences is the non-specific bands in gel pattern due to mispriming. Don et al. [6] proposed the 'touchdown' PCR to circumvent this problem. Using 'touchdown' PCR, we have successfully amplified 5 distinct rabies genes from complex genomes in extracts of canine brain tissue which will be used in the RNA based PCR model described below.
cDNA synthesis from RNA
First-strand cDNA may be acomplished by extension with random hexamer, downstream primer or ligo(dT). A 100 pmole random hexamer has been successfully used, as wel s 0.1-0.a l oligo(dT)g e efficientl2/y b buffeR n PC ca r. y use r reversfo d e transcription.
1. In 0.5 ml microtube prepare the reaction mixture by adding:
finaMgCIM M m m l 5 concentration)5 ( 2 2 4/v f o l * 2 fj\ of 10 x PCR buffer (1 x final concentration) finadGTM M m m l 1 Pconcentration( 0 1 f o \ fj 2 ) 2 fj\ of 10 mM dATP (1 mM final concentration) 2//I of 10 mM dTTP (1 mM final concentration) 2jj\ of 10 mM dCTP (1 mM final concentration) U///0 2 f Io RNasi \ 1jj n {1U/pl final concentration) U///0 5 f I o revers I 1// e transcriptase (2.5U//y| final concentration) 1 A/I of 10 pmole upstream primer (see Table I) 1 //I of 10 pmole downstream primer templatg /v 1 f o e \ fj (tota 1 l RNA) I // Wate0 2 o t r
*10 x PCR buffer contains:
0.1 MTris-HCI (pH 8.3) 0.5 M KCI.
. 2 Briefly spi microfugn i overlad ean y with 75//I light white mineral oil.
. 3 Incubat min 0 t 42°e3 a r .C fo Sto p reactio t 95°n a the d boilinCn i nan n gmi bat5 r hfo quick chil icen o l .
reduco T Notee :cros s contamination preparee b ,y maste assemblinma y db x rmi e gth reagen amound sten i tan p 1 f wate o t completo rt e total 20//I reaction volume.
PCR amplification
1. To the reverse transcription reaction, add:
4/wl of 25 mM MgCI2 (2 mM final concentration) 8 fj\ of 10 x PCR buffer (1X final concentration) 67.5//I of distilled water 0.5/vl of 5 U///I Taq DNA polymerase (2.5 U/100//I final concentration)
2. Briefly spin in microfuge.
62 TABLE I. PRIMERS AND PROBES FOR THE AMPLIFICATION AND DETECTION OF RABIES VIRUS
Rabies Oligonucleotide Expected genes designation Sequence (5'-3') fragment Position (orientation) size (bp)
N TC-7 ( + ) CAC.CTC.TAC.AAT.GGA.TGC.CG 462 61-80
TC-1 {-) GCT.CAA.CCT.ATA.CAG.ACT.CA 504-523
TC-2(-t-) CTT.GAT.CCT.GAC.GAT.GTA.TG 263-282
M1 TC-13) I+ ATC.CTA.'GCC.TCC.TGT.TCC 628 1776-1793
TC-14M CAA.GAT.GTA.TAG.CGA.TTC 2386-2404
TC-15(-( CAG.CGA.TCT.CAG.CCT.CCA.CT 2101-2120
M2 TC-) 1 <9 + ATG.ACG.ATG.ACT.TGT.GGC 598 2574-2593
TC-2) 0(- TGG.AGT.TGA.GCC.CAT.ATG 3155-3172
TC-21 (-) CCA.TAG.TTG.ACC.TGC.TCT.CG 3019-3038
G TC-9( + ) GAC.TCA.AGG.AAA.GAT.GGT.TCC 963 3305-3324
TC-3 (-) CTT.AAA.TGA.CTG.AGA.CGT.CTG 4248-4267
TC-4( + ) GCT.CCA.CTA.ACC.ACG.ATT.ACA 3879-3900
L TC-16{+) ' GTC.TAT.AGA.CCT.CGG.AGG 433 6989-7006
TC-17W TGA.GGT.CTG.ATC.TGT.CTG 7405-7422 TC-) (- 18 TGA.GTC.ATA.GTC.AGC.GCG.TC 7158-7177
. 3 Perfor followine mth g thermocycle profile (us "step-cyclee eth " program):
a. t 95°a Denaturn C mi 1 r efo anneal for 30 s at 65°C extend for 1 min at 72°C cycle counts = 2.
. t 95°b a Denaturn C mi 1 r efo t 55°a s C annea0 3 r fo l t 72°a n Cextenmi 1 r dfo cycle counts = 15.
c. Final extension for 7 min at 72°C.
. 4 Sto reactioe pth chilliny nb t 4°Cga . pmol0 1 Note f eaceo : h upstrea downstread man m primers shoul addee db d when using random hexame oligo(dTr ro extendinr )fo firsgn i t strand cDNA synthesis. The volume of water may be adjusted to make a total reaction volume of 80 jj\.
Analysis of amplification product
1. Remove the mineral oil by extraction with 200-300//I TE-saturated chloroform. Save aqueoue th s phase.
. 2 Load 5-10//I portio f aqueouno s phase onto 1.0-1.2% agaros Nusieve-% 3 r eo 1% seakem agarose gel in TBE buffer. Use 1 kb ladder as a size markers.
63 STOCK SOLUTION
(From Sambrook, Fritsch and Mania tis: Molecular Cloning, Cold Spring Harbor Laboratory Press, 1989, 2nd Edition.)
Thes commonle ear y used stock solutions which shoul preparee db r routindfo e molecular biology use.
1. 1M dithiothreitol
f 0.01o l m M0 Dissolv2 sodiun i T em DT 3.0 acetatf o 95.2)g H e(p . Sterilizy eb filtration. Dispense into 1-ml aliquots and store at -20°C. Do not autoclave DTT or solutions containing DTT.
2. 0.5M EDTA (pH 8.0)
Add 186.1 g of disodium ethylene diamine tetraacetate. 2H2O to 800 ml of H2O. Stir vigorousl magnetia n yo c stirrerwit0 8. h o .t NaOH AdjusH p e . th t Dispense into aliquots and sterilize by autoclaving.
. 3 Ethidium bromid mg/ml0 e(1 )
Add 1 g of ethidium bromide to 100 ml of H20. Stir on a magnetic stirrer for several hours to ensure that the dye has dissolved. Wrap the container in aluminum foil or transfe solutioe th r dara no kt bottl stord et an rooe a m temperature.
4. 1 M MgCI2
Dissolve 203.3 g of MgCI2.6H2O in 800 ml of H2O. Adjust to 1 liter with H2O. Dispense into aliquot sterilizd san autoclavingy eb .
. 5 Phenol ichloroform
Mix equal amounts of phenol and chloroform. Equilibrate the mixture by extracting several times with 0.1M Tris Cl (pH 7.6). Store the equilibrated mixture under an equal volum f 0.01edaro n i kC 7.6M H glas4° Tri(p t ) l a sC bottles.
. 6 Phosphate-buffered saline (PBS)
f KC1Dissolvo f NaCIg o ,2 g 1.4 0. ef ,8 Na o 4HP00.2 g d f KHo an ,PO 4 n i g 2 4 2 4
800 ml of distilled H2O. Adjust the pH to 7.4 with HCI. Add H2O to 1 liter. Dispense the solution into aliquots and sterilize by autoclaving. Store at room temperature.
7. 3M sodium acetate (pH 5.2 and pH 7.0)
Dissolve 408.1 g of sodium acetate 3H2O in 800 ml of H20. Adjust the pH to 5.2 with glacial acetic acid or adjust the pH to 7.0 with dilute acetic acid. Adjust the
volum lite1 ro e t with H0. Dispense into aliquot sterilizd san autoclavingy eb . 2
NaCM 5 I . 8
Dissolv f Ho 2l Oe m .292. Adjus0 f NaC o 80 volum e 2g n i th Itlite 1 ro e t with H2O. Dispense into aliquot sterilizd san autoclavingy eb .
64 9. 10% sodium dodecy sulfate (SDS)
f electrophoresis-gradDissolvo g f H Oo 0 .l m e10 Hea 0 68°o t 90 t n Co i t S eSD
assis2 t dissolution addiny dropb w 2 fe f concentrateg7. sa o o .t AdjusH p e tth d HCI.
Adjus volume th tlite 1 ro e t wit h H2O. Dispense into aliquots. Therneeo n o ds et i steriliz SDS% e.10
10. 20 x SSC
Dissolve 175.3 g of NaCI and 88.2 g of sodium citrate in 800 ml of H2O. Adjust the pH to 7.0 with a few drops of a 10 N solution of NaOH. Adjust the volume to 1 liter
with H20. Dispense into aliquots. Sterilize by autoclaving.
11. Trichloroacetic acid (TCA) resultin f e Ho 2 Ol Th . m 7 g solutio22 Td bottloa ad nA e wil containinTC f l o g 0 g50 contain 100% (w/v) TCA.
12. IMTris
Dissolve 121.1 g of Tris base in 800 ml of H20. Adjust the pH to the desired value by adding concentrated HCI.
Allo solutioe wth coono t rooo lt m temperature before making final adjustmene th o tt pH. Adjus volume solutioe tth th litef e1 o rno t with HO. Dispense into aliquotd san
steriliz autoclavingy eb . 2
REFERENCES
[1] GOUGH, N.M., Rapid and quantitative preparation of cytoplasmic RNA from small number f cellsso , Anal. Biochem (19873 17 .. 93 ) ] [2 CHOMCZYNSKI , SACCHIP. , , Single-steN. , p isolatioA methoRN y f acidb no d guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156. [3] ERLICH, H.A. (Ed.), PCR technology: Principle and applications for DNA amplifications . StocktoM , n Press Yorw kNe , (1989). [4] ERLICH, H.A., GIBBS, R., KAZAZIAN, H.H., Polymerase chain reaction, Cold Spring Harbor Laboratory Press Yorw kNe , (1989). ] [5 INNIS, M.A., GELFAND, D.H., SNINSKY, J.J., WHITE, T.J. protocols(Eds)R PC , : A guide to methods and applications, Academic Press, San Diego (1990). ] [6 DON, R.H., COX, P.T., WAINWRIGHT, B.J., BAKER , MATTICKK. , , J.S., Tochdown PC circumvenRo t t spurious priming during gene amplification, Nucleic Acids Res. 19 (1991)4008. Part II
APPLICATION MOLECULAF SO R TECHNIQUES IN VITRO APPLICATIONS OF RADIONUCLIDES IN COMMUNICABLE DISEASE S- A N OVERVIEW
I. NATH Department of Biotechnology, l IndiAl a Institut f Medicaeo l Sciences, New Delhi, India
Abstract
The diagnosis and understanding of the host response to infectious agents have relied heavily on radionuclide based techniques. Both the characterisation and identification of the pathogen as host-pathogenwellthe as interaction required betterare the for control communicableof diseases. This paper gives an overview of the recent concepts pertaining to the cellular and molecular aspects of immune responses and draws attention to newer radiolabelled techniques for evaluating the viability metabolicand properties 'difficultof grow'to bacteria. The role gamma/deltaof cells,T V0 usage, lymphokine network, TH1, TH2 cells and immunity to heatshock proteins are briefly discussed.
HOST PARASITE INTERACTION
Radiolabelled substrates have been used effectively to investigate the diverse communicable diseases both at the pathogen and host level. Our understanding of many of these processes have led to the development of diagnostic aids, some of which are well establishe mand dan y other undee sar r investigation. More significantl stude e yth th f yo natural course of disease and the immune responses to specific antigens are slowly paving the way for more rational vaccines. With increasing understanding of immunology and molecular biology, several useful techniques have emerged which have relevancr efo diagnosis as well as for basic research. Both the host and the parasite can now be investigated using radiolabelled compounds. This area has received further impetus with e developmenth f safeo t r radioisotopes growine Th . g lisf commerciallo t y available radioimmunoassay kits testify to not only these advances but also to the increasing needs of researcher cliniciansd san . This paper give overvien sa vitron i f wo applicationf so radionuclide investigatioe th sn i f infectiouno s diseases researc e botth t h diagnostia d han c level.
In general, when an infective agent enters the host, it is resisted by natural barriers such as the skin and also by chemical agents such as mucin, proteolytic enzymes and complement. When the pathogen overcomes these and survives for even a short time then hose th t developes specific immune mechanisms whic more har e powerfu held e pan lth bod o kilr t ycontaio l e invadernth . During this host parasite interactio traina f o l identifiable events occur which can be measured by specific tests. Some of these are very fingerprints a t specifi invadinac e th d f scan o g organism whereas some others provide circumstantial evidence. By investigating these processes, it is possible to differentiate phenomena that reflect protection from others that result from the distracting tactics of the pathogen eager to evade killing. This host parasite interaction is the subject of intense current research.
The host response is traditionally of two types, one, mediated by antibodies secreted by B cells which circulate in the various fluids of the body and thereby act over longer distances from their production siteseconde Th . , mediate cellT y sdb require closer interaction wit targee hth t organis celle th sr m o harbourin g them. These cells alst oac through secreted products such as cytokines or by transferring killer enzymes in performs across cell membranes of the target cell. Both these processes require intimate cell contact as their rang f actioeo ovens i r extremely short distances. Becaus f thise o circulatin e ,th g
69 lymphocytes are predominantly of T cell type and this form of immunity is designated as cellular immunity. There is however commonality in both these mechanisms in that, both are mediate y lymphocytedb s which have antigen specific receptors, similar signalling mechanisms and function through proteins. The differences lie in their mode of cellular differentiation, type of processing required for antigen recognition, regulatory influences that determine whether T or B cells are expanded, and the differing chemical nature of the final effector molecules that are produced to eliminate the pathogen. Many of the intriguing questions pertainin factore th o gt s influencin preferentiae gth l differentiatio mode on ef no of immune response ove othee t beeth rye rs n a havconclusivel t eno y answered.
T CELL RECEPTOR (TCR)
recenn I t years technologA DN , y based tools have helpeidentificatioe th n di d nan sequencing of the T cell receptor (1), immunoglobulin genes and genes coding for Major
Histocompatibility Complex. The techniques used for these have relied heavily on
125 35 radiolabel gelsD 2 s,n i I,usindiagona d Pg, an 32 S l geld othean s r electrophoretic procedures. The genes coding for the receptors have been sequenced (1). DNA sequencing commonly by dideoxy method uses 35S or 32P end-labelled oligonucleotides as primers. By performing 4 reactions containing single dideoxynucleotide, 4 sets of DNA fragments are obtained where a given set will terminate with the specific nucleotide. These fragments can be separated on polyacrylamide gels and autoradiographs generated. The sequence is then reay b dp froto shortes e me th th longes e t a th te o t fragmen l on t ge bottoe e th t th a tf m o
knowing the last labelled nucleotide. The aminoacid sequence can then be predicted from the nucleotide sequence. InitiallPy 32 wa s used for labelling but it began to be replaced by 35S whic highed hha r emissions, longer half life, gave sharpe fastes r bandr wa fo rd san autoradiographs. Recently 33P has been discovered which has intermediate properties. It i5 fols handlee db weaken ca d d routinelr an tha P n y without elaborate shielding 32 precautions highes ha , r emissions than 35S longea , r shelf lif needd e thaan sP n 32 shorte r exposure time r autoradiographsfo t maintainye d san s sharp bands.
With radiolabelled molecular probes as well as monoclonal antibodies it has been possible to characterise the TCR [1], T cells which predominantly bear alpha/beta heterodimer receptor majoe th e r ar scell s involverestricteC MH n di celdT l responses. There is a large variable gene segment diversity in these cells which would explain the recognition of diverse antigens. The selective usage of V/? genes by "super" antigens is of current interest [2]. These antigens consis f enterotoxino t s from streptococci, gram negative bacteri mycoplasmd aan wels aretroviraa s a l l coded antigens whic producee har d as a result of integrating into the host genome. Many of the enterotoxins produce fever and shock. These antigens are potent T cell stimulators and trigger T cells by linking MHC with particular V regions of the TCR. V/? usage differs in patients having endotoxin shock du grao et m negative bacteria. Autoimmune disorders have also been implicate havdo t e selective V/? usage [3]. Thus polymorphism of TCR genes may be exploitable for disease investigation.
Another set of T cells which emerge earlier in the individual bear gamma/delta receptors [4] with a limited TCR diversity and presumably recognise a smaller repertoire of antigens. The latter are seen in mucosal epithelia and may act as the first line of defence against pathogens. Interestingly, they have been seen als delayeon i d hypersensitivity sites of patients with mycobacterial diseases. Gamma/delta cells were foun predominato dt e in Mantoux positive sites and lesions of reactional leprosy [5]. It is thought that they probably recognise heatshock proteins. They may also have natural killer activity. VY9Vy2 TCR bearing cells are predominant amongst peripheral blood Y^T cells. They respond with high frequenc . tuberculosis,/W o t y w moleculalo r weight ligand f opportunistio s c mycobacteria . falciparumP , staphylococcad an l endotoxin [6]. s i ThuR stude sTC th f yo likely to lead to more information on the gene segments used for recognition of pathogens.
70 By mean hybridisatiof so n with radiolabelled nucleotide sequences determining these genes as well as with antibodies it is possible to study suspensions of cells as well as the in situ distributio f thesno celleT tissuen si lesionsd san .
LYMPHOKINE NETWORK
A major breakthroug celT n lhi studie bees identificatioe sha nth moleculad nan r characterisation of biologically active cytokines with diverse functions [7]. Some of the cytokine growte sar h factor cellssT whicn o , t e.ghac . Interleukin cells2(IL2B d , an )e.g. , IL4,IL5,IL6; some act on macrophages e.g. interferon gamma (IFNg) and neutrophils e.g.,
IL8 yet others eg IL10 inhibit the release of many lymphokines. Radioimmunoassays using
3 1 125 anHd are now available to assay these lymphokines in body fluids or after stimulation patiente oth f s lymphocyte specifiy sb c antigens. Even single releas f cytokineeo e b n sca measured by reverse plaque assays and ELISASPOTS. Thus it has been shown that lepromatous patients who have unresponsiveness to leprosy bacillus have defective production of IL2 and IFNg [8]. This has led to therapeutic trials whereby injection of genetically engineered IL2 and IFNg has shown early clearance of bacilli from the injected sites wels developmena ,s a l f cellulao t r reactions reminiscen f delayeo t d type reactions [9]. Identificatio f cytokinno e producin gsitee cell th f immun so n si e inflammationy b , meann situi f o shybridisatio n with specific radiolabelled primer d subsequenan s t autoradiograph helpfus yi understandinn i l g local immunity. This procedur earlies ewa r cumbersome due to the low copy number of the relevant sequence. In recent times polymerase chain reaction to amplify the copy number is making such analysis possible. In situ localisation has an advantage since the histology of the lesion can be studied.
CD4 SUBSETS
Interestingly, recent data suggests that CD4 cells can be categorised into TH1 and cell2 sTH patterbasee th n df o cytokinn o e secretion [10] formee Th . r producd an 2 eIL IFNg which typically help-in cell mediated reactions but not IL4 and IL5 which are needed cell selectivB d r san fo e productioIgEcelld 2 an .s TH G havIg reversf ena o e pattern. IFNg has an inhibitory effect on IL4 secretion. Since many of the chronic infections such as lepros d leishmaniasian y s show inverse relationship between cellula d humoraan r l immunity, a rational explanation for this may lie in the differential stimulation of TH1 and TH2 type cells. With increasing studies with polymerbase chain reaction based identificatio f mRNno r manAfo f thesyo e lymphokines, dat accumulatins ai indicato gt e that differential cytokine patterns exis mann i t y communicabl ewels diseasea s a ln ma n si in animals. Protection to Listeria, M. tuberculosis, M.leprae appear to be linked to TH1 cells. Susceptibility contrasn ,i t seemcell 2 linkee leprosyb n s i TH o sdt o t . Similarl protozoayn i ! diseases cause y Leishmania,db Plasmodia Toxoplasma,d an cell1 protectivee TH sar . However, pathology associated with cerebral malari TH1o t alss e ai .o du Helminthic infections in man have shown a selective TH2 type of differentiation in the patients who have raised level f IgE so factore .Th s repertoir2 leadinTH r selectioo o a gt 1 n ei TH f no given disease are not as yet clear. The type of antigen, antigen processing cells, cytokine regulatio factorsome e b th f y eo sn ma influencin preferentiae gth l selectio f thesno e cells.
The functional abilitt onl cellT no y f yo so recognist also t t o eproliferatbu orden ei r to reach critical levels is central to the development of effective immunity or delayed hypersensitivit pathogensmane o yt th f yo . Such function testee b n vitrodn si ca using radiolabelled markers. Of common usage is the lymphoproliferative assay which quantifies
the DNA synthesis occurring in lymphocytes exposed to antigens. Cultures are pulsed at appropriate th e times with thymidine precurso,a labelleA DN f do rsynthesi witA hDN 3H s is expresse cpmss da after liquid scintillation counting. Thi appliee sb login dcca with innumerable variations to address many questions where the end point is proliferation. Other metabolic events preceding DNA synthesis viz. protein synthesis, RNA increase etc
71 have also been monitored usin methionineS g35 leucinuraciC H 3 , 14 d l ean respectively n I . addition, signal transduction event celd lsan recepto r turnove ligane th n ri d stimulated cells have been investigated with 14C or 3H labelled markers.
Cytotoxi cellcT s emerge durin immune gth e respons somo et e infectious agentsn I . mycobacterial infections such cells have been shown to kill macrophages harbouring the pathogens [11]. Once released these pathogens may be ingested by other more metabolically active young macrophage monocytesd san . This becomes important when s realisei t i d that pathogen harbouring aged macrophage e granulomath n i s lese ar ss susceptibl activatino et g lymphokines suc IFNgs h a addition,th n I . e released pathogens now become susceptible to the action of antibodies and complement which they are able to evade while residing inside cells. Cytotoxic activity by cells is quantifiable with 51Cr. Targe labellee t b celln sca d with 51 mixeCd ran d wit relevane hth t effectors, sucT s ha cells, at an appropriate ratio. Since dead and dying cells release 51Cr over a 4 hour period, the supernant fluid would have radioactivity. The degree of lysis can then be evaluated. By varying pathogens, cell types and time of infection, valuable information can be obtained regarding the main immunological process involved in protection against pathogens. Thus both CD4 + and CDS + cells have been shown to mediate cytoxicity, the difference co-recognitioe lyinth n gi antigee clasC th f n1 so MH n d claswitC an hs2 MH present on the target cell respectively.
ANTIBODY RESPONSES
Humoral immune response also developes in infections. Most of the time it may preced developmene eth celT f lfirse o t immunityth t s i antibod M Ig . appeao yt d an r therefore is a marker of active infection. IgG occurs later and lasts longer and indicates t alwayno exposur y sma reflec t ebu t active disease sees i E allergien i Ig . helminthid san c infections. IgA is a predominant mucosal defender and is important for gastrointestinal
infections. All these can be measured using simple immunodiffusion techniques.However
3 when specific antibodies are to be measured then radioimmunoassays usinI ang125 Hd are needed. Such assays are even more necessary when small amounts of circulating antigens, harbingers of early infection, are to be identified. Sometimes when antibody levels have been high, the antigen may become complexed and would not be detectable in circulation. Such complexes need to be precipitated and redissolved to estimate the antigen. Detection of immunecomplexes is also necessary in diseases caused by their deposition in vessels of skin, glomeruli and choroid plexuses. Distinguishing glomerulonephritis cause streptococcay db l infectio opposes na othero dt s requires such identification. Though radioimmunoassaye manth f yo beine sar g replace enzymy db e based ELISA, the variables that exist due to the added extra step needed to produce a colour product and cost of the conjugate makes radioimmunoassay relatively simpler.
INFECTIO AUTOIMMUNITD NAN Y
Recognitio f selno f antigen immune th y sb e syste mthoughs i grouleao a t o dt f po organ and nonorgan associated disorders. In recent times, attention has been drawn to the presence in such disorders of antibodies and T cells which recognise heat shock proteins (Hsps) of bacteria and protozoa [12]. Hsps are produced by many living species on encounter with stress. They are coded by genes which show high conservation. There is more thasequenc% n50 e identity between mammalia bacteriad nan l hsps. Immunity mycobacteriao t l Hsp6 associate5s i d with arthritis, hsp7 hsp9d 0an 0 with systemic lupus erythematosis possibls i t I . e that immune cells recognisin hspe g th f infectiv so e agents attack host cells through self hsps or some other self antigens in an hitherto unknown manner time th e t A autoimmunit. y develope identifiable pathogenb e t sth no y n ei sma large numbers.
72 PATHOGEN CHARACTERISATION
The recognition of multiple epitopes of the pathogen and the identification of the ones responsible for protection or immunopathology are central to the need for appropriate methods. In addition some pathogens such as M.leprae are difficult to grow in vitro and pose a problem for evaluating drug efficacy and drug resistance. Others such as tuberculosis. M take 9-12 week groo st conventionay wb l means. Even where bacteria grow the quantification of living units by the colony forming units is fraught with variables. To address these problem vitrosn i methodologies have been developeC 14 dd usinan gH 3 labelled precursors of DMA synthesis or metabolites. Our laboratory developed a macrophage based radiometric assa evaluatinr yfo . lepraegM viability usin thymidinegH 3 , 3H adenosine and 3H hypoxanthine [13]. These assays compare well with the traditional mouse foot pad assay as evaluated in 2 blind trials conducted between us and 3 other laboratories. They have been able to detect drug resistance, check newer antileprosy drug monitod san effectivite th r f multidruo y g therapy use Indian di n districts. Similar radiolabels have been used by other investigators on bacilli in suspension [14]. 3H uracil is very effective in rapid monitoring of the viability of M. tuberculosis and B.abortus.
DNA technology has made possible the identification of proteins of various pathogens. It has proved particularly valuable for M. leprae which cannot be grown in the laboratory techniquee Th . r thisfo s rely heavil radionuclidesn yo establishee W . e dth uniqueness of a recombinant clone of M.leprae identified by us, by showing that the 32P labelled DNA from this clone did not hybridise with other reported clones using Southern blot techniques. The DNA sequence of this clone was also established using 35S labelled universal and custom made primers. The 10 kd protein expressed by this clone has been stronshowa e b celgT no t l antigen [15]. Preliminary data also indicate provy s thama e t i t to be a good marker of Type 2 reactions in leprosy.
s alsi t oI possibl o studt e e metabolith y c event n pathogeni s y followinb s g
radiolabelled precursor incorporation into metabolites as well as by pulse chase experimentsC. 14 palmitate has been shown to be incorporated in the phenolic glycolipid of M.leprae. Such studie providine ar s g valuable information whic s beinhi g useo dt synthesise drugs that would target to the essential metabolic pathways of the organisms.
Finally, the multiple epitopes of pathogens are being slowly unravelled for many pathogens usin l electrophoresigge s followe autoradiographsy db approachee Th . r sfo many of these are similar, the information that is obtained is dependant on the clever use of specific protocol reagentd san addreso st givesa n questio givea r nnfo pathogen. Such approaches at molecular and genetic level are required for understanding the nature of the pathoge therebd nan y designing better strategie controls it r sfo . Communicable diseases provid challengea e conqueree whicb n hca usiny db holistiga c approach base hosn do t parasite interaction.
REFERENCES
[1 ] HEDRICK, S.M., COHEN, D.I., NIELSES, E.A., DAVIS, M.M., Isolatio f cDNno A clones encoding Tcell specific membrane associated proteins, Natur (19848 e30 ) 149. ] [2 PALIARD, , WESTX. , S.G., LAFFERTY, J.A., CLEMENTS, J.R., KAPPLER, J.W., MARRACK, P., KOTZIN, B.L., Evidence of the effects of a superantigen in rheumatoid arthritis. Scienc (19913 e25 ) 325. ] [3 PAUL , MOSSA. , , WILLIAMH. , , ROSENBERGM. , , BELLC. , , J.I.humae Th , celnT l recepto healtn i r diseased han . Annu. Rev. Immunol (19920 1 . ) 71-96. ] [4 PORCELLI , BRENNERS. , , M.B., BAND , Biolog H. ,humae th f yo n gamma delt celaT l receptor. Immunol. Rev (19910 .12 ) 140-183. [5] MODLIN, R.L., PIRMEZ, C., HOFMAN, P.M., TORIGIAN, V., UYEMURA, K., REA,
73 T.H., BLOOM, B.R., BRENNER, M.B., Lymphocytes bearing antigen specific gamma delt celaT l receptors accumulat human ei n infectious lesions. Natur 9 (1989e33 ) 544-548. ] [6 HACKER , KROMERG. , , HEEGS. , , IVANYIK. , , WAGNERJ. , , PFEFFERH. , , K. , Opportunistic mycobacteria express ligands that stimulate production of human V 92 T lymphocytes. Infection and 60(7} 2753-2757. ] [7 BALKWILL, F.R., BURKEcytokine Th , F. , e network. Immunology Today 10(9 9891 ( ) ) 299-304. [8] NATH, I., SATHISH, M., JAYARAMAN, T., BHUTANI, L.K., SHARMA, A.K., Evidence presence foth r . lepraeM f eo reactiv celleT patientn si s with lepromatous leprosy, Clin. Exp. Immunol. 58(3) (1984) 522-530. ] [9 KAPLAN,G., MATHUR, N.K., JOB, C.K., NATH,!., COHN, Z.A., Effect f multiplso e interferon gamma injections on the disposal of Mycobacterium leprae, Proc. Natl Acad. Sci. (USA) 86 (1989) 8073-8077. [10] MOSMANN, T.R., COFFMAN, R.L., Th1 and Th2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7 (1989) 145-73. [11] KAUFMANN, S.H.E., CHIPLUNKER , FLESCHS. , , S.C., LOBERO, G.D., Possible role of helpe cytolitid an r cellcT mycobacterian si l infections, Lepr. Revie 7 (1986w5 ) 101-111. [12] COHEN, I.R., YOUNG, D.B., Autoimmunity, microbial immunity and the immunological homonculus, Immunol (19914 . TodaNo ) 2 105-110y1 . [13] NATH , PRASADI. , , H.K., SATHISH , DESIKAM. , , K.V., SESHADRI, P.S., IYER, C.G.S., A rapid radiolabelled macrophage culture method for the detection of dapsone resistant M.leprae, Antimicrob. Agents Chemother. 21(1) (1982) 26-32. [14] WHEELER, P.R., Metabolism in Mycobacterium leprae: its relationship to other researc M.lepraen ho o aspect t d an f metabolis o s mothen i r mycobacteriud man intracellular parasites, Int . Lepr.J (19842 5 . ) 208-230. [15] LAAL , SHARMAS. , , Y.D., PRASAD, H.K., TANGRI , MURTAZAS. , , SINGHA. , , S. , MISRA, R.S., NATH, I., A novel recombinant protein identified by lepromatous sera mimics native M. leprae in T cell responses across the leprosy spectrum, Proc. Natl Acad. Sci. (USA (19918 8 ) ) 1045-1058.
74 DETECTIO IDENTIFICATIOD NAN F NO INFECTIOUS ORGANISMS: APPLICATIOF NO MOLECULAR PROBE TECHNOLOGY
P S.FYA . Departmen f Pathologyo t , Universit f Malayayo , Kuala Lumpur, Malaysia
Abstract
Development in molecular biology and biotechnology has provided clinical laboratories with study diagnosisthe tools and new for humanof diseases including genetic diseases, chronic disorders, malignant diseases infectiousand diseases. basis The molecularof diagnosisthe is identification of nucleic sequences that are informative in a disease and the detection of these sequences by specific nucleic acid probes. The most widely applied molecular technique for the detection pathogenicof organisms clinicalin specimens hybridizationis analysis. thisIn assay system, nucleic acid of defined specificity is used to "probe " for the presence ofgenomic sequences targetof organisms. This technology been has detection usedthe varietya for of pathogensof including viruses, bacteria and parasites in tissues, blood, stools, urine and a variety of body secretions. applicationsThe hybridizationof analysis diagnosticthe in laboratory includethe (I) rapid detection of pathogens directly in clinical specimens and (ii) the identification of pathogens isolated culture.in practical molecularof The use probes detectto pathogens directly clinicalin specimens requires that target sequences amplified,be either vitroculturein by by amplification,or prior hybridizationto analysis. coupling vitroThe in of amplification nucleicand acid hybridization renders the technique highly sensitive and specific. In the case of organisms that are slow to grow culture,in this strategy provides addedthe advantage speed.of Therefore, molecular based diagnosis would be particularly useful in instances where the pathogenic organism is difficult to culture or grows slowly in culture and where rapid diagnosis is life-saving, as in the case of infections opportunisticby organisms immunosuppressedin patients.
INTRODUCTION
Traditional approaches for the detection of infectious organisms in clinical specimens such as direct microscopy, in vitro culture and serological studies possess inherent limitations. Direct microscopy is often insensitive while culture of organisms sometimes take lono sto yielo g t clinicallda y useful answer. Some organism f clinicao s l importance rotaviruse sucth s ha , hepatitivirusesB d an ,sA Epstein-Barr virus, Mycobacterium leprae and Treponema pallidum cannot be cultured in artificial medium. In addition, in vitro culture techniques do not always distinguish virulent from non-virulent strains, for example, e enterotoxith n producing, froe non-enterotoximth n producing Escherichia coli. Immunoassays have been widely used ove pase rth decade 2 t diagnosie th r sbroafo a f so d range of infectious diseases. While undoubtedly an invaluable adjunct to diagnosis, they havo to limitatioea f moleculaf sensitivityno o e us e r Th probe. nucleid san c acid (NA) hybridization analysis may serve to overcome at least some of these diagnostic limitations.
NUCLEIC ACID HYBRIDIZATION
Under appropriate conditions of pH, temperature and ionic strength, single-stranded (ss) NA molecules will hydrogen bond (hybridize) with ss NA fragments that carry complementary sequences. This ability of ss NAs to detect and to bind complementary sequence f nucleotideo s s form e inherene basith sth f o s t specificit f hybridizatioo y n reactions. Furthermore, hybridizatio a kineticall s i n y efficient reaction allowine gth detectio f minutno eshora quantitien i ts timeNA f .so These features have been gainfully employe desigo dt n hybridization-based assays tharapide ar t , sensitiv specificd ean .
75 hybridizationn I assay systems moleculA N a , f defineeo d specificity (probe uses i ) d to detect the presence/absence of NAs with complementary sequences (target). Molecular probes may be hybridized with the sample NA in solution, on a solid support or in cells/tissues mose Th .t commonly employed forma filtes i t r hybridization although more recently, solution hybridization systems have become increasingly popular. Advancen si molecular technology havappearance th eo t als d ole f varioueo s novel assay formats such as sandwich assays and capture "polymerase chain reaction" (PCR) hybridization assays. lattee th n rI case, target molecule amplifiee sar vitron di prio hybridizatioo t r n analysis. This combination of in vitro NA amplification with hybridization analysis constitute perhaps e mosth t significan f moleculao e f advanceo us t e r th technique n i s r diagnostifo s c purposes.
MOLECULAR PROBES
deriveProbee b n sca d from genomic materia synthesizee b cloniny n b l ca r go e dd novo. Ove pase rth t several f yearssynthetio e us , c oligonucleotide probe increaseds sha . The reasons for this trend include (i) simplicity of production, (ii) stability of the probes and (iii) potentia allels a e specifius l c probes. Many currently available commercial kits utilize oligonucleotide probes. Another advanc probn ei e technolog emergence th s yi s s f eo RNA probes (riboprobes) whic synthesizee har vitron i y db transcriptio f double-strandeno d templateA (dsDN ) s (cloned int transcriptiooa n vector bacteriophagy b ) e DNA-dependent RNA polymerases advantagee Th . f riboprobeso s are bot) :(i h sens d anti-sensean e probes ca preparede nb , (iiabilite )th hybridizo yt targetsA eDN witd , han (iii botA ) stabilithRN y of the hybrid duplexes, (iv) unhybridized probes can be eliminated by treatment with RNA-as hig) (v hd specifiean c activity synthesizeprobee b n sca d relatively inexpensively.
Bindin s proba targeit f go o s et detectabl i t y severab e l means detectoe Th . r molecule can be attached or incorporated into the NA structure of the probe. For instance, digoxigenin-labelled d-UT r radiolabellePo d nucleotides suc 32s hP-dATa 32r Po d-CT n Pca be inserted. Alternatively, enzymes such as horseradish peroxidase (HRP) or alkaline phosphatas elinkeprob e e linker(ALPa b th n a do et vi ca ). Anothef o r approace us e th hs i e biotin-avidith n syste mwhicn i h bioti s incorporateni d inte prob reactedod th an e , post-hybridization, with labelled avidin. With the use of radiolabeled probes, the reaction is detected by autoradiography or liquid scintillation counting. With non-isotopic probes, colorimetryy detectiob e b y nma , luminimetr fluorometryr yo .
USE OF NUCLEIC ACID HYBRIDIZATION IN CLINICAL DIAGNOSIS
recenn I t years, ther bees eha graduan a problA shifN f eo t technology froe mth research laboratory to the clinical laboratory. Implementation of this technology offers the diagnostic laboratory with the means to extend its repertoire of tests and provide a rapid service usefulnese Th . f probso e diagnostic investigatioe th n si f infectiouno s diseasee sli in its potential for (i) detection of pathogens directly in clinical specimens, (ii) detection of difficul o culturt t r non-culturableo e microorganism (iiid an s) rapid confirmatiof no identity of pathogens grown in vitro. The use of probes for the direct detection of microorganism clinican si l specimen bees sha n reporte r hepatitidfo virusB s (HBV), human papilloma virus (HPV), Chlamydia trachomatis, Neisseria gonorrhoeas, Mycoplasma pneumonia, Haemophilus influenzae and Legionella spp. However, information on its clinical utility awaits further studies. Nevertheless, the potential for extending the repertoir f organismeo s that laboratorie identifyn sca particulan i , r thos et gro thano wo td wel culturen i l , remains f probeo e r confirminsUs fo . identite gth f organismyo s grown i vitro suc Mycobacteriums ha tuberculosis, Campylobacter jejuni Legionellad an species provide mucsa h quicker means than conventional biochemical method f identificationso . The usefulnes f thiso s strategy depend clinicae th n so l situatio whicno t s appliedi ht i r ;fo instance, rapid identificatio isolatn immunocompromisen a a f no n i e d individuaf o s i l
76 unquestionable value for the timely institution of appropriate therapy. Finally, molecular probes have been successfully applied to histologic sections for the detection of infectious agents. This approach offers the advantage of allowing correlation between the pathology of a disease and its associated aetiologic agent. This approach has been reported for the rapid diagnosi f infectioso opportunistiy nb c organism immunosuppressen si d patients.
Molecular applie e probeb y "singldn i sma e prob ea batter" tests n i f r probeyo "o s test". Specimens thabesn examinee ca tb t d usin batterga f probeyo s include stoold san respiratory secretions. The rationale of this approach is that certain specimens tend to harbou distincw fe a r t pathogens, e eacth f facwhicf n hi o detecteo e n b te hca on y db probes included in a cocktail of probes. However, data on the use of this strategy is still forthcoming. Single probe tests are currently available for a wide range of bacterial and viral agents. Probes have bee ndetectioe useth r . dco//harbourinfo £ f no enterotoxie gth n gene, thus providing the laboratory with a means of determining virulence in isolates. Though promising, this applicatio diagnostie th n i c laboratory awaits clinical evaluation. Other enteric pathogen whicso t probeA hN s have been applied include Salmonella, Shigella and Campylobacter spp, enteroinvasive and enterohaemorrhagic E. co//, rotavirus and enteric adenoviruses. Similarly, probes are available for several respiratory pathogens including the cytomegalovirus (CMV), Epstein-Barr virus (EBV), Mycoplasma, Legionella and Mycobacteria. Agents of sexually-transmitted diseases (STD) for which probes are availabl . gonorrhoeae,N e ar e . trachomatis,C herpes simplex virus (HSV), human immunodeficiency virus (HIV HBVd f theso an )e . eus Reporte probee th th r f fo so s detection and identification of the various pathogens listed above appear promising. However, it is prudent to note that in many instances, further refinement and optimization is necessar rendeo yt r this diagnostic tool feasibl routine th n ei e laboratory.
One of the concerns faced by the laboratory regarding the introduction of molecular probes as an alternative to traditional diagnostic methods is the need for anti-microbial sensitivity testing time eTh . require sensitivite th r dfo y testing offset advantage sth f eo rapid diagnosis offere proby db e diagnosis alternativn A . overcomo et e this limitations i secona f o e d us probe th identifo et anti-microbiae yth l resistance gene most likele b o yt present in a particular organism. This was tested on N. gonorrhoeae using a probe directed agains TEM-type th t e beta-lactamase gene presen mosn i t t penicillin resistant strains. Other organism/resistance gene combinations that have been teste Staphylococcuse dar aureus/mec gene influenzaelb\a^H , gen Enterococcusd ean fecafis/van geneA . While
theoretically sound, this strategM y is not devoid of problems. Most significant is the fact that the presence of a gene is not necessarily equivalent to expression of the gene. Secondly, many commensal organisms do carry resistance genes similar to that carried by pathogens, thereb ysampleo t limitine us ss g it thafre e f normaear to l flora.
INVESTIGATIO MICROBIAF NO L EPIDEMIOLOGY
Applicatio f moleculano r technique onlt no ys providesha meanda rapir sfo d diagnosis of infectious diseases but has also improved the accuracy in epidemiologic studies of microorganisms. The key requirement in both instances is the ability to identify the responsible agent and, where necessary, to distinguish it from a background of non-pathogenic/non-epidemic strains. Identification and typing of microbial isolates to determine their epidemiologic relationship can be carried out by a number of different methods including phenotypi genotypid can c studies.
Conventional methods of typing have included serotyping, bacteriophage susceptibility typing, antimicrobial agent susceptibility typin bacteriocid gan n typingl Al . these methods suffer from limitations of poor sensitivity and reproducibility, lack of standardization and instability of patterns. Over the past decade, bacterial fingerprinting, a method e bandinbaseth n o d g patterns produce y electrophoretib d c separatiof o n
77 bacterial proteins or DNA, has become standard. Phenotypic analysis are subject to the problem of variation in gene expression due for instance to repression. Genotypic studies are less subjec thio t t s variation thin I .s latteorganise th f r o approach mA s i DN e th , subjected to restriction endonuclease digestion followed by Southern blot hybridization analysis using specific gene probes. Both plasmid and chromosomal DNA profiling are used, the latter being preferred. The problems related to plasmid fingerprinting are: (i) plasmids can be gained or lost and (ii) some strains do not carry plasmids. However, it is also noted A recombinatiothaDN t n system r transposablo s e element n causca s e chromosomal mixin rearrangementd gan s resultin unstablgn i sequencesA eDN . Therefore, successful clone identification for epidemiological studies requires knowledge of the genetic stabilit selective wels th ya s a l e pressur environmente th f eo .
SUMMARY
Probe technolog nucleid yan c acid hybridization analysis provid clinicae eth l laboratory with an additional and powerful tool for the diagnosis and study of infectious diseases. With the continuing effort expended in the improvement of existing hybridization methodologies, probe preparation and labelling techniques and detection systems, a wider application of molecular hybridization in diagnostic microbiology can become a reality.
BIBLIOGRAPHY
LOWE, J.B., Clinical applications of gene probes in human genetic disease, malignancy, and infectious disease, Clin. Chim. Act(19867 a15 ) 1-32.
KULSKI, J.K., NORVAL, M., Nucleic acid probes in diagnosis of viral diseases of man, Arch. Virol (1985)3-153 8 . .
TENOVER, F.C., Diagnostic nucleic acid probes for infectious diseases, Clin. Microbiol. Review (1988)82-101s1 .
EISENSTEIN ,molecula B.I.w Ne , r technique r microbiasfo l epidemiolog diagnosie th d yan s of infectious diseases, J. Infect. Dis. 161 (1990) 595-602.
TENOVER, F.C., Studies of antimicrobial resistance genes using DNA probes, Antimicrob. Agents Chemother. 29 (1986) 721-725.
MIFFLI applicationd N an T.E. e Us , f nucleiso c acid probe clinicae th n si l laboratory, Clin. Chem (19895 3 . ) 1819-1825.
CHAR, S., FARTHING, M.J.G., DNA probes for diagnosis of intestinal infection, Gut 32 (1991) 1-3.
78 APPLICATION OF THE POLYMERASE CHAIN REACTION AND MOLECULAR PROBE TECHNOLOGY FODIAGNOSIE RTH TUBERCULOSIF SO S
S.F. YAP, Y.C. CHEN, P.W. WONG, T.S. SOO-HOO Departments of Pathology and Microbiology, Universit f Malayayo , Kuala Lumpur, Malaysia
Abstract
Conventional methods for the diagnosis of tuberculosis based on microscopic examination and vitroin culture bothis time consuming tedious.and Molecular methods diagnosisof have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determine the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. aliquotAn eachof specimen were kept analysis for vitro in by amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. specimensAll were analysed quintriplicate,in with samples2 unspiked samples3 and spiked with tuberculosis.M. Appropriate positive negativeand controls were included assays.all in Following amplification, the specimens were analysed by agarose gel efectrophoresis (AGE). All specimens were further subject hybridizationto studies using specifica radiolabelledprobe. sensitivityThe of the amplification assay coupled with visualisation amplifiedthe of targets using ethidium bromide staining was found to be about 1 fg ofDNA. A total of 40 smear positive specimens were analysed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive PCR/hybridizationby analysis.
INTRODUCTION
Laboratory diagnosis of mycobacterial infections is traditionally dependent on the isolatio pathogee th f no culturen ni . Cultur solin eo d medium generally4 takeo t p su weeks or more. With the introduction of the "Bactec system" which is based on the measurement of radiolabelled C0 released by the bacteria during growth, this period has
been reduced to about 2 weeks. Mor2 e recently, there have been several reports on the use ovitron i f even a amplificatior n fo mor ] [1 e R rapi f PC mycobacteriano d e th y b A DN l detectio e pathoge bees th f ha no n R usen PC o [2-8]amplif dt e Th .y mycobacterial sequences codin variour gfo s heaantigena kD t shoc5 6 s] e 7 suck th , antige5 s h a , 3 , n[2 the MPB64 antigen [9] and the 38 kDa protein antigen b (Pab) [6]. This technique has also been applied for the amplification of repetitive sequences including IS 6110 [10] and IS f ribosomao d [12]an A , thi] n I 1 .RN l s f [1 primer papero 6 e repor98 e us w s, e specifith t c insertioe foth r namplifo t elemen 6 98 y S mycobacteriaI t extracteA DN l d directly from clinical specimens and its subsequent detection by hybridization studies.
MATERIALS AND METHODS
REAGENTS
l reagentAl s used were molecular grade polymerasq Ta . s purchaseewa d from Stratagene primere Th . s were custom mad y Clonteceb h Laboratories. Primers were 20mers and specific for the insertion sequence IS 986. They span nucleotides 105 to 645 of this sequence.
79 CLINICAL SPECIMENS
Clinical specimens sent to the laboratory for investigation of suspected tuberculous infection were studied. All specimens were screened by microscopy and classified as smear positive or negative. The smear positive specimens were then decontaminated [13] and used for culture as well as for in vitro amplification. Briefly, the decontamination process involves treating the samples with 0.25M NaOH, 25mM Na-citrate, 15mM N-acetyl-cystein r 20-2fo e 5 minute t rooa s m temperature samplee Th . s were then centrifuge pellee th d t dresuspendean 20mn di M Tris/HCI 8.3H p , .
SAMPLE PREPARATION
The decontaminated samples were treated with tween 20 and proteinase K (final concentration of 0.5% and 1mg/ml respectively) at 60°C for 1 hour. Proteinase K was then inactivated by heating at 100°C for 1 5 minutes. The samples were then stored at 4°C or analysed immediately. Each specimen was divided into 5 aliquot, 3 of which were spiked wit . tuberculosishM . Anotheconcentrationd ml r en t pe a 2 r 10 d f 10an so ,10 5 4 3 aliquot were unspiked. Positive controls consiste f buffedo r spiked wit . tuberculosishM at the same end concentrations.
AMPLIFICATION
The reaction mixture contained 2.0mM MgCI2, 0.2mM of each dNTP, 0.4//M of each volumd e e sampleen th th e f f eo o primer polymeras Th q \ .u Ta 0 uni 0 f 1. 1 ,o t d ean mixture was 50/j\. Amplification was performed in a thermal cycler (Hybaid) for 40 cycles. The cycling parameters were: denaturation at 94°C for 1.5 minutes, annealing at 65°C for 2 minutes and extension at 72°C for 3 minutes.
DETECTIO AMPLIFIEF NO D TARGET SEQUENCES
A 10 u\ aliquot of each of the amplified samples were loaded onto 2% agarose gel and electrophoresed fractionatee Th . werA deDN then stained with ethidium bromidd ean
visualised by using a UV transilluminator. The amplified samples were also analysed by standard filter hybridization usinP-labelled/digoxigenin-labelle32 ga d probe specifie th r cfo target sequence. The probe was prepared in a PCR reaction.
RESULTS
Forty microscopy-positive (Ziehl-Neelsen stain) specimens which include3 3 d sputum, 3 broncho-alveolar lavages (BAL), 1 tracheal secretion, 1 gastric lavage and 2 pus specimens were analysed. Positive control sampled san s produce singlda e ban f ~541bpdo . The negative control produced no visible band on the gel. The sensitivity using ethidium bromide to visualise the amplified samples was about 1fg DNA.
Twenty-nin specimenf eo s were culture positive; 24/29 (82.8%) produce 541b~ da p d 28/2an 9E (96.6%AG ban n o d ) gave positive signal n filteo s r hybridizatione Th . PCR/hybridization resul positivs wa t r 9/1efo 1 (81.8% culture th f o )e negative samples. These results are summarised in Table I.
80 TABLE I. RESULTS OF ANALYSIS OF SPECIMENS POSITIVE FOR MYCOBACTERIA BY MICROSCOPY
Specimen Culture result AGE/EtB+ r PCR/HYB +
Sputum + 27 22 26 6 4 5 BAL + 1 1 1 2 2 2 Pus + 0 . . 2 2 2 Gastric + 0 . _ Lavage 1 0 1 Trachea! + 1 1 1 0 - - Total 40 32 37
DISCUSSION
Conventional method r diagnosifo s f mycobacteriao s i infection will remaie th n mainsta clinicae th f yo l laboratory. However, rapid diagnostic tests thasensitive ar t d ean specific will greatly enhanc routine eth e service. Rapid diagnosi f particulao s i r valun ei extrapulmonary tuberculosis where in vitro culture often produce negative results or cause an unacceptable delay in diagnosis. In immunocompromised patients, a rapid diagnosis and differentiation between M. tuberculosis and other mycobacteriai infections are important r earl appropriatd fo yan e treatmen f patientso t .
The results of this study have shown that it is possible for a laboratory with standard facilitie thermaa d san l cycle provido t r servicea r rapiefo d detectio f mycobacteriano . Amplification of the gene sequences within the repetitive element IS 986 has been shown to be specific for the M. tuberculosis complex. The primers selected for this study (Pt8 & Pt9) allowed specific amplificatio f mycobacteriano i sequences sensitivite Th . goos yi t da ~1pg. Althoug l specimenhal s studied were positiv microscopyn eo , only 72.5% were confirmed by culture. Using PCR coupled with hybridization analysis, the positivity rate increased to 92.5%. Out of the 3 specimens that were negative by PCR/hybridization analysis wer2 , e also culture negative thire dTh . specime facn i s t culturnwa e positivet i ; is postulated thae organismth t atypican a se b grow y l mycobacterianma . However, serological results were not available for this specimen.
Contamination problems will remain a major obstacle to the implementation of in vitro amplificatio routinnfor e diagnostic service experiencOur . e with this procedur thaeis t meticulous laboratory technique plays a major role in minimising contamination. Other useful aids include the use of plugged pipette tips, proper decontamination and disposal procedures and the employment of post-PCR sterilization.
ACKNOWLEDGEMENTS
This study is part of a co-ordinated programme on the "Diagnosis of Tuberculosis using Nucleic Acid Probes" funded by the International Atomic Energy Agency (Contract 6810/RB) thane . A.H.JW . kDr . Kolk fro Royae mth l Tropical Institute, Amsterdamr fo , expert technical advice.
81 REFERENCES
] [I MULLIS, K.B., FALOONA, F.A., Specifia n ci vitroa vi synthesiA DN f o s polymerase-catalyzed chain reaction, Methods Enzymol. 155 (1987) 335-351. [2] BRISSON-NOEL, A., GICQUEL, B., LECOSSIER, D., LEVY-FREBAULT, V., NASSIF, X., HANCE, A.J., Rapid diagnosis of tuberculosis by amplification of mycobacterial DNA in clinical samples, Lancet 2 (1989) 1069-1071. ] [3 HANCE, A.J., GRANDCHAMP , LEVY-FREBAULTB. , , LECOSSIERB. , , RAUZIERD. , , J., BOCART, D., GICQUEL, B., Detection and identification of mycobacteria by amplification of mycobacterial DNA, Mol. Microbiol. 3 (1989) 843-849. ] [4 HERMANS, P.W.M., SCHUITEMA, A.R.J. SOOLINGENN VA , , VERSTYNEND. , , C.P.H.J., BIK, E.M., THOLE, J.E.R., KOLK, A.H.J., VAN EMBDEN, J.D.A., Specific detection of Mycobacterial tuberculosis strains by polymerase chain reaction, J. Clin. Microbiol. 28 (1990) 1204-1213. [5] PAO, C.C., YEN, T.S.B., YOU, J.B., MAA, J.S., FISS, E.H., CHANG, C.H., Detection and identification of Mycobacterium tuberculosis by DNA amplification, J. Clin. Microbiol. 28(1990)1877-1880. [6] SJOBRING, U., MECKLENBURG, M., ANDERSEN, A.B., MIORNER, H., Polymerase chain reaction for detection of Mycobacterium tuberculosis, J. Clin. Microbiol. 28 (1990)2200-2204. [7] FRIES, J.W.U., PATEL, R.J., PIESSENS, W.F., WIRTH, D.F., Detection of untreated mycobacteria by using polymerase chain reaction and specific DNA probes, J. Clin. Microbiol (19919 2 . ) 1744-1747. [8] COUSINS, D.V., WILTON, S.D., FRANCIS, B.R., GOW, B.L., Use of polymerase chain reactio r rapinfo d diagnosi f tuberculosisso . ClinJ , . Microbiol 9921 ( 0 )3 .255-258 . [9] MAJUNATH, N., SHANKAR, P., ROGAN, L, BHARGAVA, A., SHIRINWAS, S.S., Evaluation of a polymerase chain reaction for the diagnosis of tuberculosis, Tubercle 72 (1991)21-27. [10] THIERRY, D., BRISSON-NOEL, A., VINCENT, LEVY-FREBAULT, V., NGUYEN, S., GUESDON, J.L., GICQUEL , CharacterizatioB. , Mycobacteriuma f no tuberculosis insertion sequence, IS6110 applicatios it d ,an diagnosisn i . ClinJ , . Microbiol8 2 . (1990)2668-2673. [II] HERMANS, P.W.M., VAN SOOLINGEN, D., DALE, J.W., SCHUITEMA, A.R.J., MCADAM, R.A., CATTY, D., VAN EMBDEN, J.D.A., Insertion element IS986 from Mycobacterium tuberculosis: a useful tool for diagnosis and epidemiology of tuberculosis . ClinJ , . Microbiol (19908 2 . ) 2051-2058. [12] BODDINGHAUS, B., ROGALL, T., FLOHR, T., BLOCKER, H., BOTTGER, E.G., Detection and identification of mycobacteria by amplification of rRNA, J. Clin. Microbiol. 28 (1990) 1751-1759. [13] KUBICA, G.P., DYE, W.E., COHN, M.L., MIDDLEBROOK , SputuG. , m digestiod nan decontamination with N-acetyl-L-cysteine, sodium hydroxide for culture of mycobacteria, Amer. Rev. Resp. Dis. 87 (1963) 775-779.
82 DETECTIO MycobacteriumF NO tuberculosis CLINICAN I L SAMPLES USING THE POLYMERASE CHAIN REACTION: AVOIDING AMPLICON CONTAMINATION
. KOLK*A , LINDA KOX* , Dhanid** - a RIENTHONG***, A. MEDO MIRANDA , Nibondh UDOMSANTISUK , + + + K. ELLIS*, J. VAN LEEUWEN*, SJOUKJE KUIJPER*
* N.H. Swellengrebel Laboratory of Tropical Hygiene, Royal Tropical Institute, Amsterdam, Netherlands * * Divisio f Pulmonarno y Diseases, Academic Medical Centre, Amsterdam, Netherlands *** Tuberculosis Division, Ministr f Healthyo , Bangkok, Thailand * Institute Dr. Ricardo Jorge, Porto, Portugal + + Department of Microbiology, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand
Abstract
testA polymerasebasedthe on chain reaction (PCR) developed was detection the the for of Mycobacterium tuberculosis-complex in clinical samples. In this test a 541-bp sequence of the insertion element IS986 amplifiedwas detectedand agaroseby electrophoresisgel presencethe in of ethidium bromide and by Southern blot and dot blot hybridisation using a radioactive or a biotin labelled oligonucleotide probe.
Contamination caused by DNA fragments from previous PCR experiments was prevented by dUTPof use insteadthe dTTP of uracil-DNA-glycosylase. and Part eachof sample spikedwas with tuberculosisM. controlto loss for mycobacteriaDNA of interferenceor with PCR,the causing false negative results and to provide a semiquantitative assay. If significant interference was found, the DNApurifiedwas combinationsby differentof treatments, such proteinaseas "Minithe K, Bead Beater" disruptor, and the guanidinium thiocyanate diatom purification method.
We have tested clinical specimens from 123 patients suspected of having tuberculosis. The sources samplesthe of included sputum (92), cerebro-spinal fluid (7), pleural fluid (2), broncho- alveolar lavage (5), blood (4), one pus, one fluid from chest wall fistula and tissue biopsies (11). The sputum92 samples were first decontaminated purifiedwas cases treatment72 by in DNA and with guanidinium thiocyanate diatoms.and remainingThe samples20 were treated freezingby and thawing. In both groups 3 samples gave interference in PCR. PCR was positive in: 35 of 37 culture and Ziehl-Neelsen (ZN) positive culture15 samples; of positive 12 negative ZN in and samples;in 2 culture negative and ZN positive samples and in 12 culture negative and ZN negative samples. The use of the Mini Bead beater for disruption of clinical samples was restricted to biopsies. When the Mini Bead Beaterpurification usedDNA was a stepneeded.was
INTRODUCTION
Tuberculosis (TB stil)s i majoa l r health proble mmann i y world parte humath e f so .Th n immunodeficiency virus (HIV) epidemi havins ci profounga d impactuberculosie th n o t s proble mbotn i h industrialize developind dan g countries improved an , d dase detection would be a key factor for better control of mycobacterial diseases.
83 The diagnosis of extra pulmonary TB and tuberculoid meningitis is difficult and definitive diagnosis depends on culture of the mycobacteria, which is time consuming and not always successful. The diagnosis of both pulmonary and non-pulmonary tuberculosis and the outcome for the patient could be improved if simple and reliable tests would be developed.
We and others have recently reported the use of the polymerase chain reaction (PCR) for the detection and identification of Mycobacterium tuberculosis complex [1 -9]. In this study, we report methods for the treatment of clinical samples to liberate DNA effectively prio PCRo alsrt e W o. describe mean preveno st t contamination cause amplifiey db A dDN f frodUTo uracid mglycosylase A Pan us previouDN l e testth R r uracil-Ny b sPC (o e - glycosylase, UNG) [10].
MATERIAL METHODD SAN S
CLINICAL SAMPLES
Ninety-two sputum samples from patients suspected of TB were obtained from the Tuberculosis Division, Bangkok, Thailand. Samples were transported at -20°C by air. Other clinical samples included cerebro-spinal fluid (CSF), broncho-alveolar lavage fluid (BAD, blood, pus from abscesses and from a wound, fluid from a fistula and tissue biopsies. These were obtained from patients suspected of having tuberculosis with a variety of underlying conditions such as lung diseases, AIDS or cancer. The samples were sent from various hospitals in the Netherlands.
DNA PURIFICATION FROM CLINICAL SAMPLES
Guanidinium thiocyanat diatomd ean s wer esmale useth r l dfo scal e purificatiof no DNA from clinical samples [11, 12], with minor modification tha usee w t d 20//I diatom suspension instea f 40//Ido .
TREATMENT OF CLINICAL SAMPLES FOR PCR
Clinical samples which contained visible trace f bloodso instancr ,fo e pleural fluid dan lymphocyte fraction from blood, were treated with lysis buffer consisting of 1 % triton Tris-HCM m 0 8.3H X-102 p I n i .0 Lysis buffe sampladdee s th wa r o dt e unti totaa l l reacheds wa l samplee m volum Th .5 1. f se o wer d 200e1 an t centrifugeg a 0 x n mi 5 r dfo procedure th repeates ewa d once. (This treatmen names i t d sampleTT.e Th ) s were further treated with proteinase K solution as previously described [4]. (This treatment is named pro) K. t
PREPARATION OF SPUTUM SPECIMENS FOR PCR
The sputum was decontaminated by incubation with NaOH-sodium citrate - N-acetyl- [4]n cysteinmi . 0 2 r efo
TREATMEN BIOPSIEF TO S
Biopsy samples (100^/1) were treated by proteinase K treatment as described above and incubatet 60°Ca h 1 , r followedfo treatmeny db t with lysis buffesample th f i r e con- tained trace f bloodso biopse Th . y materia furthes wa l r disrupte6 L I addiny // db 0 g90 buffer [11] and 400//I zirconium beads (0.1 mm). The mixture was shaken in the Mini Bead (thig 0 s metho00 2 1 t centrifugenamed s i a an n n mi d \ Beate5 mi MBB) u r 6 d0 fo r 2 . fo r of diatom suspension was added to the supernatant and the DNA was further purified [11]. (This method is named Boom.)
84 In case of soft biopsy tissue, proteinase K treatment alone or in combination with Boo adequatemwas .
. tuberculosisM SUSPENSION SPIKINE TH CLINICAR F GO S FO L SAMPLES
We used an M. tuberculosis strain for spiking and sensitivity determination that has eight copieinsertioe th f so n element IS986 [4],
POLYMERASE CHAIN REACTION
The PCR was performed as previously described using the primers Pt8 (5'- GTGCGGATGGTCGCAGAGAT-3' 9 (5'-CTCGATGCCCTCACGGTTCA-3'Pt d an ) ) which correspond respectively to base pairs (bp) 105 to 124 and 626 to 645 of the IS986 insertion element.
s performewa R ThPC ed wit e heat-stablhth e DNA-polymerase from Thermus aquaticus (Taq polymerase, Perkin Elmer Cetus, Norwalk, Conn. USA). The final composition of the PCR reaction mix was 10 mM Tris-HCI, pH 8.3, 50 mM NaCI, 2.0 mM
Mg CI2, 0.0 (w/v1% f )eac o gelatine hM dNTm 2 P,0. (dATP, dCTP, dGT dUTP)d Pan 2 0. , //M of each primer, 1 unit Taq polymerase and 0.2 units uracil-DNA-glycosylase (UNG), (Gibco BRL, Gaithersburgs \ reactiowa u , USA0 x 5 MD mi ,r nR )pe volumePC e Th . aliquote finaa dn i l volum f 40//eo reactior Ipe n storeviad an l t -20°da C until use. When a performedtess wa t reactioe ,th n vials were removed fro freezee eaco mt th d h an viar l 50ywl minera l (Sigmoi l . LouisaSt , USA addes )wa d befor e 10yt/eth l sampl places ewa d l pipettingl al layer oi under e Fo .th r , positive displacement pipette tips were used (Microman, Gilson, France). The PCR was performed in a thermocycler (Bio-med 60 processor, Theres, Germany). The PCR incubations were 5 min at 50°C {to break down amplicon UNG)y sb ,denaturatio n followemi cycle0 5 4 1. y df b s o t 94°C nanneaa n mi ,2 - primen mi 3 r d extensioan C ° 5 t 72°Cn6 lina t ga .
DETECTION OF AMPLIFIED DNA
Each sampl testes ewa d after different treatment triplicatespikesn s i wa e d witOn . h M. tuberculosis DNA (10" g DNA/reaction) and two were non-spiked. The reaction was u negative if the non-spiked samples were negative and the spiked samples positive. If all three reactions were negative then ther interferencs ewa product R samplee th PC en i e s.Th were analyze agarosy db l electrophoresiege s [4].
OLIGONUCLEOTIDE LABELING BIOTIWITR O P HN32
The oligonucleotide Pt10 (5'-AGCACGATTCGGAGTGGGCA-3)', whic situates hi d within the 541 bp fragment and corresponds to bp 133-152 of the insertion sequence IS986 from M. tuberculosis, was tail labelled with either 32P dTTP (Amersham )or biotin- dUTP according to the protocol of Schmitz et al. [13].
DOT BLOT HYBRIDIZATION AND DETECTION
Dot blot hybridization was performed essentially as previously described [4] but Duralose membranes (Stratagene) were used. The membranes were cut in pieces of 8 x 12 cm and presoaked for 10 minutes in Milli Q water and then 10 minutes in 10 x SSC 0.1= C NaCI(15M xSS , 0.01 Na-citrate5M amplifie 7.0)R H p ; PC .f Sampleo d \ u 5 f so DNA wer efinaa mado t l volump eu f 50//eo Milln i I wate Q idenature d an r boiliny db r gfo 5 minute subsequend san t coolin icen go . Afte additioe rth ice-col 50//f n o a f Io d solution SSCx 0 omixturee 2 f ,th s were spotted ont presoakeoa d Duralose membrane usint do ga blot apparatus (Schleicher-Schull), and a vacuum of 60 cm Hg was applied. The spots were
85 membrane fixes th wa o d t A 5 bakiny eDN SSCx b 1 washe e r 10 gfo f .Th o d\ jj wit0 h20
minutes at 1 2OC or by UV irradiation at 312 nm for 2 minutes at 8 mW/cm2 (Vilber Lourmat TFX-20M). The membrane was sealed in a plastic bag with 20 ml of 5 x SSC, 1 % (w/v) blocking agent (Boehringer Mannheim), 0.1 % (w/v) Na-laurylsarcosine, 0.02% (w/v) SDprehybridized San minutes 5 t 50°1 da r Cfo . AfteP 32 additioe e th rpmo0 th 1 f f o nlo dTT r biotin-dUTPo P tailed oligonucleotide probe prehybridizatioe Pt1th 0o t n mixe ,th membrane was incubated at 50°C for another 2 hours. The membrane was washed twice at 50°C for 5 minutes in 50 m! of 2 x SSC with 0.1 % (w/v) SDS and then rinsed briefly in f buffeo l m (0.1 r 0 Tris-HCL5 1M , 0.1 NaCL5M 7.5)H p , . Whe dTTP n32 P labelled oligonucleotid uses membrane ewa d th incubates ewa d developedfil d y witmra an hX n I . the cas f biotieo n labelled oligonucleotide membrane th , blockes minute0 ewa 3 r dfo n si 100 ml buffer 2 (1 % (w/v) blocking agent (Boehringer Mannheim) in buffer 1) and rinsed briefly in 50 ml of buffer 1 . Then the membrane was incubated for 1 hour in 5 ml buffer 100a f o 0whicI o 1t Units/m// 5 h0. l alkaline phosphatase conjugated streptavidin solution (Boehringer Mannheim) was added. Unbound conjugate was removed by washing twice minute5 fo1 r membrane buffen si Th . 1 equilibrates r ewa minute2 r dfo buffen si 3 r
(0. Tris-HCL1M , 0.1 MgCI NaCL5M M performanc e m 9.5)th H 0 2r p ,5 , Fo . coloue th f eo r reactio membrane nth seales f freshlo plasti el a wa m witn d g i y 0 chba prepare1 d alkaline phosphatase substrate solution (0.45//g/ml NBT and 0.175//g/ml X-phosphate in buffer 3) and incubated for 3 to 1 6 hours.
RESULTS
SPECIFICIT SENSITIVITD YAN Y
Specificity and sensitivity of the PCR using the primers Pt8 and Pt9 was the same as for the INS1 and INS2 primers [4].
DETECTIO . tuberculosisM F NO CLINICAN I L SPECIMENS clinicae Mosth f o t l samples were subjecte simplo dt e pretreatment with proteinase K and detergent. For new DNA purification techniques a portion of each sample from each patient was spiked with M. tuberculosis bacilli to detect any false negative results caused y los b f mycobacteriao s r componento A DN l s which interfere with PCR. When spiking showed that interference was present (spiked samples negative or weaker than the control samples), we proceeded to the DNA purification method [1 2]. CSF usually did not contain interfering substances. Interference was a particular problem with pus, tissue biopsies (Table 1) and 20% of the sputum samples. PCR results improved after DNA purification (Tables 1 and 2). Some clinical samples which interfere werR ePC truln di y positive purificationafteA DN r , e.g. fros mpu , woun , pericardia94 1 09 ds 1 Tablpu , elTabl. ; 1 flui 64 85 , sputuded 1 2 an 8 m3 Other samples were truly negative, e.g. Tabl , live esynovia1 d r biopsan 2 9 l y1 flui d 200; differenc o . TherTabln 0 s 1 result e , sputu, e2 wa th 99 n e i , s m wit53 h sputum whee nth DNA was purified directly after the decontamination step (2.4) or after the proteinase K treatment (2.5).
BIOPSY SAMPLES
For 5 jum cryosections of tissue samples we used proteinase K treatment. In some cases it was necessary due to interference to purify the DNA [1 1 ]. Larger fragments of skin biopsy material were sometimes difficul homogenizeo t t thesr Fo . e material usee sw e dth Mini Bead Beater to disrupt the material (Table 3).
In all samples treated with the Mini Bead Beater, it was necessary to purify the DNA [1 1 ]. In some cases interference was difficult to remove. In sample 285 we could interpret resulte th s only after treatment with proteinas purificationA DN d , MBBeK an T .T ,
86 TABLE 1. INFLUENCE OF SAMPLE TREATMENT AND DNA EXTRACTION
PCR results after treatmeny b t Metho d1 Method2 Sample 0 1 100 0 1 a0 100 a0
pus from abscess 194 + 2 + 2 + 2 pus from wound 109 2+ 2+ 2 + pericardia! fluid 199 + 2 + + pericardia! fluid 185 - + 2+ + + + liver biopsy + 2 - - 192 + 2 + blood culture 201 ... + 2 + + synovial fluid 200 + 2 +
Water control 2 + 2 +
Abbreviations used: The results of the PCR are expressed as follows: -, no band on agarose gel; ±, faint band; +, moderate band; 2 +, strong band. Method 1, proteinase K Tween treatment. Metho , proteinasd2 TweeeK n treatment, followepurificatioA DN y db n [11). 'Samples were spiked after decontaminatio tha o treatens e 10//n i t th f Io d sample M.tuberculosis0,100 10 r ,o bacilli are present. Water control, water sample spiked with M.tuberculosis bacilli and treated as indicated.
TABLE 2. INFLUENCE OF SAMPLE TREATMENT AND DNA EXTRACTION PROCEDURE ON PCR OF SPUTUM SAMPLES
Sputum PCR results after treatment by sample Method 3a Methoa d4 Method 5a 0 10 100" 0 10 100b 0 10 100"
Sp38 ± 2 + 2 + 2 + 2 + 2 + 2 + + + Sp54 2 + 2 + 2 + 2 + 2 + 2 + + 2 2 + + Sp 53 - - + - + 2 + - + + Sp99 - ± + - + 2 + - + + Sp 10 - + - + 2 + - + + Sp64 ± ± + 2 + 2 + 2 + + + 22 + Sp 100 •- - 2 + - + 2 + - + 2 +
The results of the PCR are expressed as follows: -, no band on agarose gel; ±, faint band; +, moderate band; stron, 2+ g band. * Method 3, decontamination, proteinase K. Method 4, decontamination, followed by DNA purification [111. Method 5, decontamination, proteinase K, followed by DNA purification (111. " Samples were spiked after decontamination so that in 10 jul of the decontaminated sample 0, 10, or 10O M. tuberculosis bacilli were present.
The results of the agarose gel electrophoresis were confirmed by dot blot hybridisati- o nlabelleP usin32 e r biotigdth o n labelled probe resulte Th . s wit probe hth e were similar to the results with the 188 bp labelled fragment, which we have used previously [4].
PRE-PCR STERILISATION
We used dUT Po brea t insteaG k UN f dowdTTd o d e dUTPnan th P containing amplicon sPCRe prio founth e o .W rt d tha incubation a t n timminute5 f eo t 50°sa s Cwa more effectiv et roo a tha ' mn 10 temperature necessaramounG e Th .UN f o t breao yt k down contaminating amplicons was investigated by amplification of amplicons in the presence of different amounts of UNG (Fig. 1). UNG (0.02 units) could break down 150 pg f ampliconso normae Th . l leve f contaminatioo l 6 less10 .ns i
87 TABLE 3. INFLUENCE OF SAMPLE TREATMENT AND DNA PURIFICATION METHODS
Sample Treatment Result
203 MiniBeadBeater interference 203 MiniBeadBeater and Boom positive 57.17 MiniBeadBeate Bood an rm negative 57.19 MiniBeadBeate Bood an r m negative 285 MiniBeadBeater and prot K interference 285 MiniBeadBeater proand K t TT , interference 285 prot K, MiniBeadBeater and Boom interference 285 prot K, MiniBeadBeater, TT and Boom negative
Abbreviations used: pro , proteinasK t , TritoTT ; nK e x10 0Trin i s buffer; Boom, guanidinium thiocyantd ean diatoms purification method Boo t al.me , [11].
12 3 45 6 7 8 9 10 11 12 13 14
(A)
(B)
breakto FIG.Ability 1. downUNG of dUTP-containing amplicons without changing efficiencythe PCR.of dUTP containing amplicons . tuberculosiM d an wereA absence e sDN presenced th used f UNG. an n o f i 0.02 template) s o U a R ) (A (B PC n i 106, Lane3 to , times6 1010" s , dilutedand 10 ng/rfa15 10" , amplicon solution; lane 8-11,fg 1 1000, and 100,10 M. tuberculosis DNA: lane 7 and 12, water controls; lane 1 and 13, respectively 800 and 400 ng Haelll digested &X174 DNA (RF) as molecular size marker: lane 14, 541 bp fragment as molecular size marker. Amplification products were detected by agarose electrophoresis.gel
88 PCR RESULTS COMPARED WITH CULTUR ZIEHL-NEELSED EAN N
We have tested clinical specimens from 123 patients suspected of having tuberculo- sis. Specimens were obtained from a wide variety of sources (Table 4).
TABLE 4. COMPARISON OF THE PCR RESULTS OF CLINICAL SAMPLES FROM PATIENTS SUSPECTE WITB T F HDO CULTURE, ZIEHL-NEELSEN STAINING
Culture results
PCR result positive negative Total ZN+ ZN- ZN+ ZN- tested
Sputum samples3 Positive 31 4 2 11 48 negative 2 - - 19 21
Sputum samples'5 1 - 8 4 Positive 13 negative - 3 - 1 4
cerebro spinal fluid0 1 - Positive 1 6 - - - Negative 6
pleural fluid" Positive - 1 1 Negative - - - 1 1
Broncho alveolar lavaged Positive 22 4 Negative - - - 1 1
Blood, lymphocyte fraction8 Positive - - 1 1 3 - - - Negative 3
Pusd 1 - Positive 1 Negative - - - -
Fistula" Positive - - - 1 1 Negative - - - -
Tissue biopsy' Positive 1 1 1 1 4 Negative 7 7
a Samples were decontaminated with NaOH-N-acetylcysteine and DNA was purified [12]. "Samples were decontaminated with NaOH-N-acetylcysteine and DNA and frozen at -70°C and thawed by exposure to 95°C for 5'. Samples were proteinas treatedeK .
0 Samples were proteinas purifieds wa A treate.eK DN d dan d 6 Lymfocytes were isolate Lymphoprey db p isolation (Nyegaard purifieds ,wa OslA o. DN Norway) d an T T ' Samples were treated with purifiedMiniBeadBeates wa A . DN d an r
89 Th sputu2 e9 m samples were first decontaminate purifies wa case 2 A 7 dn i s DN d dan by treatment with guanidinium thiocyanate and diatoms. The remaining 20 samples were treated by freezing and thawing. In both groups 3 samples gave interference in PCR (4% and 15% respectively). PCR was positive in: 35 of 37 culture and ZN positive samples; in cultur5 1 f o e2 positivnegativ1 N Z d ean e samples cultur2 n ;i e negativ positivN Z d eean samples and in 12 culture negative and ZN negative samples.
DISCUSSION
have s W a e9 investigatePt usind R an gPC 8 prime e potentiae Pt th d t th f o se r e us l a tool in the early and sensitive diagnosis of paucibacillary tuberculosis.
Proteinase K treatment was used for the isolation of DNA from a variety of clinical samples purificatioe .Th n method describe Booy db m prove valuable b do t caseen i s where problema s wa interferencR . PC e th f eo
To prepare sputum samples for PCR we used a decontamination method with NaOH and N-acetyl cysteine advantage Th . f thieo combinese b metho n ca R thas di witPC t h routine culture procedures. Interference of the PCR could be reduced from 15% to 4% purificatioA wheDN na n steuseds pwa .
Our results wit sputue hth m samples from Thailand show that, when necessarr yfo confirmation of the clinical diagnosis, frozen sputum samples can be successfully examined in PCR, without deteriorating in the time needed for transport to a well-equipped reference centre for mycobacteria. This is a promising development since at this stage of the technology, PCR is too expensive to permit regular use in routine TB laboratories. One centr developina n ei g country could functio referenca s na e laboratory where clinical samples can be tested in PCR for the diagnosis of difficult cases of tuberculosis.
patientn I s witinfectionV hHI , immunosuppressecancere ar thosn i o r o ,e wh d dan whon i m ongointhern a s ei g lung process differentiae th , l diagnosis includet bu , sTB diagnosi hamperee b y sma df sputui m productio f eithe o flui L e absentns r i d BA o rus e Th . induced sputum together with PCR allows rapid diagnosis.
Two major problems with PCR methods for the detection of M. tuberculosis are interferenc whic R givy e PC falshewitma a e heth negative reactio contaminatiod nan n caused by amplicons which gives a false positive result. We spiked part of all the clinical sample deteco st t interference. Spikinadditionae th s gha l advantage contron sca thae l on t for efficiency of the DNA isolation and obtain semi-quantitative data regarding the amount of M. tuberculosis in the clinical test sample. If we found significant interference then the DNpurifies A. wa 2] 1 d[
Contaminatio f sampleno occuy sma r after some tim thosen i e laboratories routinely using PCR [14]. We proved that contamination was due to the presence of amplicons rather tha . tuberculosis-complexnM [4]A hav e bacillW .DN e r successfullo i y introduced f dUTo e Pus insteae th f dTTPtdo o mak amplicone eth s degradablf o e UNGy eus b e .Th enougs wa G breao ht . unit2 UN f amplico0. bp ko f so dowg 1 p 54 0 nf 4 no
methoe PCth Rs i f choicddiagnosie o th r efo f paucibacillarso y tuberculosis providing reliable, rapid and accurate results and for difficult cases, e.g. cancer patients and patients with HIV where the clinical signs of AIDS and tuberculosis have much in common. Moreover patients with HIV infection have a higher incidence of serious side effects with anti-tuberculous therapy [15, 16]. Accurat definitivd ean e diagnosis woulwitR hPC d reduc numbere eth treatef patientse o ar o d s solelwh basie th f clinicasn o y o l suspiciod nan
90 are unnecessarily exposed to these potentially toxic drugs. Diagnosis is rapid and can be made f receip withisampleo e h th f 8 no t4 .
Clearly refinements of the technique and reduction in the costs will allow more extensive applicatio future th rapir nn ei fo d diagnosi difficule th f so t case locan si l centres.
ACKNOWLEDGEMENTS
L.K was supported by a grant from the Amsterdam Society and Research Fund for Preventio Curd nf Tuberculosisan e o . This stud supportes y wa Commissioe th y db e th f no European Communities Directorat Sciencr efo Developmentd ean , project number TS3d ,an e UNDP/Worlth d Bank/WHO Special Progra r Researcmfo d Traininan h n Tropicai g l Diseases.
REFERENCES
[I] EISENACH, K.D., SIFFORD, M.K., CAVE, M.D., BATES, J.H., CRAWFORD, J.T., Detectio f Mycobacteriumno tuberculosis sputun i m samples usin polymerasga e chain reaction, Am. Rev. Respir. Dis. 144 (1991) 1160-1163.
[2] HERMANS, P.W.M., SCHUITEMA, A.R.J., VAN SOOLINGEN, D.f VERSTIJNEN, C.P.H.J., BIK, E.M., THOLE, J.E.R., KOLK, A.H.J., VAN EMBDEN, J.D.A., Specific detection of Mycobacterium tuberculosis complex strains by polymerase chain reaction, J. Clin. Microbiol. 28 (1990) 1204-1213. [3] HERMANS, P.W.M., VAN SOOLINGEN, D., DALE, J.W., SCHUITEMA, A.R.J., MCADAM, R.A., CATTYEMBDENN VA , D , , J.D.A., Insertion element IS986 from Mycobacterium tuberculosis: a usefu l toor diagnosifo l d epidemiologan s f o y tuberculosis, J. Clin. Microbiol. 28 (1990) 2051-2058. [4] KOLK, A.H.J., SCHUITEMA, A.R.J., KUIJPER, S., LEEUWEN, J. VAN, HERMANS, P.W.M., VAN EMBDEN, J.D.A., HARTSKEERL, R.A., Detection of Mycobacterium tuberculosis clinican i l samples using polymerase chain reactio nonradioactiva d nan e detection system, J. Clin. Microbiol. 30 (1992) 2567-2575. ] [5 PAO, C.C., BENEDICT YEN, T.S, JINN-BANG YOU, JUEHN-SHIN MAA, FISS, E.H., CHAU-HSIUNG CHANG, Detection and identification of Mycobacterium tuberculosis by DNA amplification, J. Clin. Microbiol. 28 (1990) 1877-1880. [6] SHANKAR, P., MANJUNATH, N., LAKSHMI, R., ADITI, B., SETH, P., Identification of Mycobacterium tuberculosis by polymerase chain reaction, Lancet 335 (1990) 423. ] [7 SJOBRING , MECKLENBURGU. , , ANDERSENM. , , A.B., MI6RNER , PolymerasH. , e chain reaction for the detection of Mycobacterium tuberculosis, J. Clin. Microbiol. 28 (1990)220-2204. ] [8 THIERRY , BRISSON-NOEL,D. , LEVY-FREBAULT,A. , NGUYEN,V. GUESDON, S. , , ,J. GICQUEL, B., Characterisation of a Mycobacterium tuberculosis insertion sequence, IS6110 applicatios it d ,an diagnosisn i . ClinJ , . Microbiol (19908 2 . ) 2668-2673. ] [9 THIERRY , CAVED. , , M.D., EISENACH, K.D., CRAWFORD, J.T., BATES, J.H., GIC- QUEL, B., GUESDON, J.L., IS6110, an IS-like element of Mycobacterium tuberculosis complex, Nucl. Acids Res (19908 .1 ) 188. [10] LONGO, M.C., BERNINGER, M.S., HARTLEY f uraci,glycosylas o A J.L. e DN l Us , o et control carry-over contamination in polymerase chain reactions, Gene 93 (1990) 125-128. [II] BOOM, R., SOL, C.J.A., SALIMANS, M.M.M., JANSEN, C.L, WERTHEIM-VAN DILLEN, P.M.E., VAN DER NOORDAA, J., Rapid and simple methods for purification of nucleic acids, J. Clin. Microbiol. 28 (1990) 495-503.
91 [12] BOOM. R., SOL, C.J.A., HEIJTINK, R., WERTHEIM-VAN DILLEN, P.M.E., VAN DER NOORDAA, J., Rapid purification of hepatitis B virus DNA from serum, J. Clin. Microbiol (19919 2 . ) 1804-1811. [13] SCHMITZ, G.G., WALTER, T., SEIBL, R., KESSLER, C., Nonradioactive labelling of oligonucleotide n vitri s o wite haptehth n digoxigeni y tailinb n g with terminal transferase. Anal. Biochem (19902 19 . ) 222-231. [14] PERSING, D.H., Polymerase chain reaction: trenche bencheso st . ClinJ , . Microbiol. 29 (1991) 1281-1285. [1 5] NUNN, P., KIBUGA, D., GATHUA, S., BRINDLE, R., IMALINGAT, A., WASUNNA, K., LUCAS , GILKSS. , , OMWEGAC. , , WEREM. , , MCADAMJ. , , CutaneouK. , s hypersensitivity reaction thiacetazono t e sdu HIV-n ei 1 seropositive patients treated for tuberculosis, Lance (19917 33 t ) 627-630. [16] WORLD HEALTH ORGANIZATION, Severe hypersensitivity reactions among HIV- seropositive patients with tuberculosis treated with thioacetazone, Weekly Epidemiological Recor (19927 d6 ) 1/2.
92 A STUDY OF THE FREQUENCY OF INFECTION OF PERIPHERAL BLOOD MONONUCLEAR CELLS OF CHRONIC HEPATITIS B VIRUS CARRIERS USING THE POLYMERASE CHAIN REACTION AND HYBRIDIZATION ANALYSIS
S.F. YAP, P.W. WONG, K.L. GOH, N.W. WONG Departments of Pathology and Department of Medicine, University of Malaya, Kuala Lumpur, Malaysia
Abstract
Peripheral blood mononuclear cells (PBMCs) fromconsecutive100 chronic carriersthe of Hepatitis B virus (HBV) were analysed to determine the frequency of infection of the PBMCs. Cells were isolated using ficolla extracted gradientDNA phenoland by following overnightan incubation with proteinase tween-20.and K Target nucleic acid were amplified primers of using set a spanning the S region of the viral genome between nucleotides 79 and 761. Following amplification, the samples were electrophoresedgel fragmentsthe and visualised ethidiumby bromide staining.The presence of a fragment of about 720 bp was taken as indicative of specific amplification of the HBV nucleic acid sequences. Specificity amplificationof confirmedwas hybridizationby analysis using virus specific probes. Thirty-six put of 41 (87,8%) HBeAg seropositive cases and 15/54 (27.8%) anti-HBe positivedetectable DNA electrophoresis. gel casesHBV by had Following hybridizationall carriers were found to harbour the virus in their mononuclear cells. The sensitivity using ethidium bromide staining visualiseto amplifiedthe sequences about Withpg. was 1 hybridization analysis, sensitivity was increased about 10s-fold.
INTRODUCTION
Infectio f peripherano l blood mononuclear leucocytes (PBMCs) have been reportedn i both acut chronid ean c hepatiti [1-3]s B vira e Th l. genom PBMCn ei detectabls si y eb Southern blot analysis [4, 5], in situ hybridization [6] and more recently, by in vitro amplification usin polymerase gth e chain reactio techniqueR . nUsin 8] PC (PCR , e [7 gth ) , HBV genomic sequences have been demonstrated in the PBMCs of a significant proportion of patients with acute hepatitis B and most cases of chronic hepatitis B [8]. Infection of PBMCs was shown to be persistent in a study involving patients who have undergone orthotoptic liver transplantation [9]. The significance of this observation is speculative. There is the possibility that PBMCs in patients with hepatitis B infection may be a source of viral replication in addition to the liver. This is suggested by the finding of HBV-specific mRNA sequence PBMCn si f chroniso c hepatiti patientsB s [TO] employee R W , PC e dth technique to examine PBMCs in asymptomatic HBV carriers to determine the frequency of infectio f PBMCno thin si s grou f individualpo ascertaio t d san f ntherassociatioi n a s ei n between infection of PBMCs and viral replicative activity.
MATERIAL METHODD SAN S
PATIENT SAMPLES
Asymptomatic HBV carriers routinely followed up in the outpatient department of the University of Malaya Teaching Hospital were studied. Blood samples were taken from consecutive patient serologicar sfo l studies, biochemical analysi molecular fo d san r studies. Serological determinations, including hepatitis B surface antigen and antibody (HBsAg and anti-HBs), hepatitis B e antigen and antibody (HBeAg and anti-HBe) were performed using standard radioimmunoassay techniques (Abbott laboratories, North Chicago, II). Biochemical investigations included the liver profile.
93 HBV-DNA EXTRACTION FROM PBMCS
buffe Th y coat fro f mEDTo abous Ami bloo5 t d were harveste subjected dan o dt Ficoll separation mononucleae Th . r cells recovered were washeS PB n i d x gentl 5 r yfo before bein extractionA g DN useextractio A r dfo DM .s performe nwa d using phenol following overnight incubatio t 37°na C with proteinas tweed . an ExtracteenK 20 A dDN was store t -20°da ethanos Ca l precipitate until analysis.s Priowa analysiso A t r DN e th , precipitated and reconstituted in 50//I of TE buffer.
AMPLIFICATIOA DN N USINR GPC
Primers used for the reaction were 20mers spanning a 722 bp region of the S region virae oth f l genome between nucleotide primer761e d Th an . 9 s7 were selecte covedo t r a region of the S gene that is conserved among the various major HBV subtypes. Primer sequences were derived from published HBV DNA sequences [11] and were custom-made by Clontech Laboratories Inc.
In all amplification assays, reagent blanks, and negative and positive controls were included. All reagents used were molecular grade, and the Taq polymerase was purchased from Stratagene. The PCR mix were stored in aliquots at -20°C for no longer than containinx mi R PC ge 1.5mth f o l M ju f addeextractes o 0 weeks4 4 \ wa p o dt A 0 1 .d DN MgCI, 0.01 % gelatin, 0.2mM of each of the dNTPs, 0.4ywM of each of the primers and
1.5//I2 / 50 fj\ of Taq polymerase in 10mM tris/HCI, 50mM NaCI. The cycling parameters were: 90°C x 1 min denaturation, 55°C x 2 min primer annealing and 72°C x 3 min primer extension. The reactions were performed for 30 cycles in a programmable thermocycler (Hybaid).
ANALYSIS OF AMPLIFIED SAMPLES
A 20 fj\ portion of the reaction mixture were gel electrophoresed and viewed by UV fluorescence after staining with ethidium bromide specificite Th . amplifiee th f yo d samples were determine filtey db r hybridization usin radiolabellega d probe.
RESULTS
Specimens fro0 consecutivm10 carrierV eHB s were analysed. Their serological status and HBV DNA results are summarised in Table 1. The amplified HBV DNA has a size correspondin (Figp aboub . o gMajoritt 1) .0 HBeAe 72 tth f yo g seropositive subjects and 15 out of 54 anti-HBe positive subjects had detectable HBV DNA in their PBMCs using ethidium bromid visualiseo t e nucleieth c acidlimie f detectioo Th t. n using this approach DNAV HB is .f abouo Followin g 1p t g hybridization l carrier,al s were foun harboudo t r viral nucleic acid, in their cells. The sensitivity of PCR coupled with hybridization analysis was foun10e b 5-folo dt d greate t O.OIfa r DNAV gHB .
TABL . SEROLOGICAE1 L STATURESULTA DN PBMD V SAN CHRONI N SCI HB V CHB CARRIERS
HBeAG/anti No. of AGE/EtBr Filter Hybridization HBe patients + ve + + + +
+ /- 41 36 5 36 -/ + 54 15 39 15 -/- 5 2 3 2
94 PRIMERS
Span a 722, bp fragment of the S gene Between nucleotides 79 and 761
Conserved amon majosubtypee V gth HB r s
Sequence: 5' 3' GCT GOT GGC TCC AGT TCC CG A C A AG T TG T TG A AC CTG TCA ' 5 3'
DNA. FIG.Primers1. HBV for
DISCUSSION
The result f thiso s study indicate universal infectio f PBMCno s among chroniV cHB carriers irrespective of their serological status. The variability in the reported frequency of infection of mononuclear cells is due mainly to the difference in the sensitivity of the assay t surprisings no used s i t I . , therefore case0 studie10 e sw e th ,f dthao l usinal t e gth highly sensitive PCR/hybridization assays tested positive for viral nucleic acid in their mononuclear cellsimplicatioe Th . f thino s observatio s ni dependen role(se th f n o o )t infection of PBMCs in the pathogenesis and transmission of the infection. There appear correlatioa e b o t n between viral replicative extene activitth d f infectioo t yan e th f no PBMCs. The significance of this observation is unclear. There has been a report of correlation of the state of the virus of the HBV in the mononuclear cells with HBeAg/anti-HBe status [12]. The present data do not provide information on the state of cells e virue th th n .si Southern hybridization analysis, amplification studies employing multiple primer sets spanning different f regionrevers o vira e e th f lus s egenomo e th d ean transcriptio looo t r specifiR kfo nPC c transcript provy sma e usefu thin i l s regard.
ACKNOWLEDGEMENT
This study is part of the research programme "Studies in Chronic Hepatitis B" funded Ministre byth f Scienceyo , Technolog Environmend yan f Malaysiao t .
REFERENCES
] [1 LIE-INJO, L.E., BALASEGARAN , LOPEZ,M. , C.G., HERRERA, A.R., Hepatiti virusB s DN blooliveAn d i an rd cell f patientso s with hepatoma (19832 A )DN , 301-308. [2] PASQUINELLI, C., LAURE, F., CHATENOUD, et al., Hepatitis B virus DNA in mononuclear blood cells: a frequent event in hepatitis B surface antigen positive and negative patients with acut chronid ean c liver disease . HepatolJ , (1986.3 ) 95-103.
95 ] [3 LAI, M.E., FARCI FIGUS, presenc e t al.P. , e Th , ,A. f nucleotideo e sequencee th f so hepatiti virusB peripheran si l blood lymphocyte f patientso s with acute hepatiti. sB Minerva Med (1989)335-3390 8 . . ] [4 BOUFFARD , LAMELINP. , , J.P., ZOIIM t al.e , DifferenF. , t form f hepatitiso virusB s (HBV) DNA and expression of HBV antigens in peripheral blood mononuclear cells in chronic hepatitis B, J. Med. Virol. 31 (1990) 312-317. ] [5 LAMELIN, J.P., e hepatitiTREPO Th e periphera th , viruC. B d s, an s l blood mononuclear cells briea : f review . HepatolJ , (19900 1 . ) 120-124. ] [6 HADCHOUEL , PASQUINELLIM. , , FOURNIERC. , , J.G. t al.e , , Detectiof o n mononuclear cells expressing hepatitis B virus in peripheral blood from HBsAg positive and negative patients by in situ hybridization, J. Med. Virol. 24 (1988) 27-32. [7] PASQUINELLI, C., MELEGARI, M., VILLA, E., et al., Hepatitis B virus infection of peripheral blood mononuclear cells is common in acute and chronic hepatitis, J. Med. Virol (19901 3 . ) 135-140. [8] SCAGLIONI, P.P., MELEGARI, M., MAO, G., PASQUINELLI, C., HBV DNA in mononuclear cells of peripheral blood in acute hepatitis B: a comparative analysis of Southern blot and polymerase chain reaction (PCR), Medicina (Firenze) 10 (1990) 32-34. ] [9 FERAY , ZIGNEGO,C. , A.L., SAMUEL t al.e ,, Persisten,D. t hepatiti virusB s infection of mononuclear blood cells without concomitant liver infection e liveTh r: transplantation model, Transplantation 49 (1990) 1155-1158. [10] BAGINSKI, I., CHERMIN, I., BOUFFARD, P., et al., Detection of polyadenylated RNA hepatitin i virus-infectesB d peripheral blood mononuclear cell polymerasy sb e chain reaction, J. Infect. Dis. 163 (1990) 996-1000. [11] OKAMOTO, H., IMAI, M., SHIMOZAKI, M., et al., Nucleotide sequence of a cloned hepatitis B virus genome, subtype ayr: Comparison with genomes of the other three subtypes. J. Gen. Virol. 67 (1986) 2305-2314. [12] PONTISSO , POONP. , , M.C., TIOLLAIS , BRECHOTP. , . DetectioC , f hepatitino sB mononuclean i viruA sDN r blood cells, Brit . (19848 Med28 . .J ) 1563-1566.
96 EXPRESSION-PCR: A RAPID METHOD FOR VITRN I O EXPRESSIO PRODUCTR PC F NO S
. KAIN*KC . , P.A** - . ORLANDI**, D.E. LANAR**
* Tropical Disease Unit, Division of Infectious Diseases, Toronto Hospital, Toronto, Canada * Departmen f Immunologyo t , Walter Reed Army Institute of Research, Washington, D.C., United States of America
Abstract
We present rapid a simple and method called Expression-PCR (E-PCR) vitroin for synthesis proteinof from genomic, plasmid reverseor transcribed DNA. Expression-PCR procedurea is for installing transcription and translation signals to genes of interest allowing their efficient expression in vitro. These signals are contained in an in vitro expression cassette (EC) containing an untranslated leader sequence from alfalfa mosaic virus (AMV-UTL) directly downstream fromthe T7 bacteriophage promoter site. When this EC is spliced to a PCR product, it produces a suitable template for direct in vitro transcription and translation. This methodology permits the rapid analysis geneof products without need the cloning for vivoin or expression. E-PCR representsa significant improvement over current in vitro expression systems, most notably in time-savings, versatility of gene expression and compatibility with rapid PCR-based site-directed mutagenesis procedures.
INTRODUCTION
In vitro transcription and translation are powerful analytical tools to examine genes anstructure-functioe dth n relationship proteine th f so s they encode. Standard methods fovitron i r transcriptio translatiod nan limitee nar theiy db r requirement r cloninsfo d gan subcloning into specialized vectors, bacterial amplification, plasmid purification, and restriction enzyme digestion t woulI .greaf o e db t advantag expreseo t s functional protein f intereso froA mDN t without these constraints.
The polymerase chain reaction (PCR) has greatly facilitated the ability to generate, manipulat . Numerou2] , mutat[1 d eA an se DN protocol s describ alteratioe eth R PC f no primers in order to incorporate sequence changes, additions or mutations in the final amplifie productR primerdesignee R dPC b PC n . sca d with restriction enzyme sites [3], translation initiation and termination signals [4], or altered coding sequences for site- directed mutagenesis [5]. We recently extended this approach by incorporating transcription and translation initiation signals into an "in vitro expression cassette" (EC) that can be linked to any amplified gene or gene segment [6]. This method, called expression-PCR (E-PCR), eliminate e laboriouth s s handling required n vitroi prio o t r transcription and translation and permits the generation of functional protein from DNA or littls RN eigha s ea An i t hours.
MATERIALS AND METHODS
DESCRIPTION OF EXPRESSION-PCR
schematiA expression-PCf co Rshows i Fign n . i E-PC 1 . procedura Rs i installinr efo g transcription and translation signals to genes of interest, allowing their efficient expression in vitro. These signals are encoded on the in vitro expression cassette (EC) which is a synthetic oligonucleotide whic polymerashA containRN 7 T a se promote- r5' site e th ,
97 Sense primer Antisensc primer Overlap region
Gene of Interest
Primary PCR
ATC
Add in vitro expression cassette
7 RNAT P AMV-UTL —— Tgi — -[ . / ^______In vitro expression cassette "^T^^^^ Overlap region
Overlap extension
T7RNAP RBS ATG
EXPRESSAMd Ad P universa prime7 T l r 1 & antisense primer
. ',.,., T7 RNAP RBS ATG KXTRKSSAMT universa 7 T l ——•————.^_———> primer _ -^———— - - -
Antisense primer 1SecondarR yPC
G AT RNA7 S T RB P
—— dT-conraininA gDN . - • JU-containing DNA In vitro transcription/translation
FIG. 1. Schematic of expression-PCR. T7 RNAP: T7 RNA polymerase promoter site; AMV-UTL: untranslated leader sequence from alfalfa mosaic virus; RBS: ribosome binding site; ExpressAmp universal T7 primer is the 5' oligomer containing dil for UDG cloning of recombinant DNA templates.
untranslated leader sequence of the coat protein mRNA from alfalfa mosaic virus (AMV- initiation a UTL) d an ,n codon (ATG) AMV-UTe Th . L contain ribosomsa e binding site which has been shown to stimulate translation efficiency by up to 35 fold [7]. This EC is spliced to any gene of interest during thermal cycling, resulting in PCR products which can be used directly for in vitro transcription followed by in vitro translation. In order to express the desired gene fragment, it must first be joined to the EC in a PCR-based reaction analogous splicino t overlay gb p extension [8-10] gene f interesTh eo . firss i t t amplifieR PC y db using gene-specific sens antisensd ean e primers sense Th . e primer contain bas2 1 esa sequence at its 5'-end (overlap region; Fig. 1), than it homologous to the 3'-end of the in amplifiee th d an vitro n i d C e genE Th vitroe. segmenEC thee ar tn mixe re-amplifiedd dan , generating a recombinant DNA template that can be used directly for in vitro transcription.
98 Transcript n situ,i susee b r produce fo dy northerma d southery n thii dan nwa s n hybridizations, transcription mapping and RNA processing studies [11]. In addition, they may be added directly to cell-free translation systems to produce pure radiolabelled protein in sufficient quantity for analysis. Proteins generated by E-PCR have been shown to retain full activity [6, 12, 13].
IN VITRO EXPRESSION CASSETTE (EC)
Expression-PC recentls Rha y been license o Gibc dt LifL eo BR Technologie s Inc., Gaithersburg, Maryland. The in vitro expression cassette can be purchased as the ExpressAm syste7 pT m (Gibc CataloguL oBR 8445SA)e# e . b Alternativel n ca C E e yth synthesized either as a ssDNA fragment or by designing overlapping oligos with complimentary 3'-ends encompassing the length of the EC as described in the original pape roriginae [6]Th . n vitroi l expression cassette (Fig , A.12 . ) 7 consisteT e th f do promoter site, the AMV-UTL and the 9 base pair overlap region at the 3'-end coding for the amino acids methionine, alanin leucined ean . This origina bas9 l e pair overlap regios nwa chosen so that polypeptides generated by E-PCR could be labelled with 35[S]-methionine and/or 3[H]-leucine. It has recently been modified to end at the initiation codon so that generatee proteib y nma d without extraneous amino acid incorporation [Fig , A.2]2 n I . , addition, the in vitro expression cassette has also been designed so that expression PCR products can be rapidly purified using polyhistidine-metal chelation chromatography [14] or cloned, if desired, using the Uracil DNA glycosylase (UDG) methodology [15, 16]. All of these expression cassettes function with equal efficacy.
OLIGONUCLEOTIDES FOR EXPRESSION PCR
In expressede ordeb o t r gene th ,f intereseo firss i t t amplified wit hsensa d ean antisense gene-specific primers. The sense primer is designed to include the 12-base 5'-ends it remaindet e a Th .G olige th AT of o C rshoul AC sequencgeneC e db TC -T eAC specifi readinn i d can g fram codonG e12-base witAT Th e . hth e 5'-en e pairth t sa d permit overlap extension with the in vitro expression cassette. The anti-sense primer may be entirel t it'a s yU 5'-en gene-specifiAG U modifiede (Figb AC n U . ca includdo r t CG c o G eAC , B.3)2 . This 12-base pair sequence include 5'-ene anti-sense th th t f da do e primer will facilitate rapiefficiend dan t cloning wit Uracie glycosylasA hth DN l e system ([15,16];
A: In vitro Expression Cassettes (EC) Hind I II A/co/ 1. CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTTCAAATACTTCCACC ATG GCA CTG 7 RNAT u PLe a Al t Me AMV-UTL
2. CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTTCAAATACTTCCACC ATG 7 RNAT P t Me AMV-UTL
. CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTTCAAATACTTCCACCAT3 CACCACCATCATCACCAC GGC C 7 RNAT P a Al t Me His8 AMV-UTL
B: Primers } (5'3' -
. H3T1 7 S'-CCAAGCTTCTAATACGACTCACTATAGGG-3' RNA7 T P
Afcol Bal II . 2 5'-AUGGAGAUCUCU CCAAGCTTC TAATACGACTCAC-3' RNA7 T P dU-Cloning
Mlu I SoeI 3. 5'-ACGCGUACUAGU...... -3' dU-Cloning , gene-specific
FIG.2.
99 CloneAmp system, Gibco BRL catalogue # 8381SA). The primary amplification reaction contains 1 x PCR buffer, 50 /jM dNTP's (nucleotide concentration lowered to enhance
fidelity [17, 18] pmo0 5 ) f eaco l h primer (sens antisensed ean MgCIM m improv o 1 (t 2) e primin 100//n i f targe go A specificityg n IDM tvolume 0 1 d an ). Reactio layeres ni d with mineral oil, denatured at 95°C for 5 minutes then lowered to 80°C and "hot-started" by adding 2.5 units of taq DMA polymerase (Parker-Elmer Cetus). This cycling profile is generally 10-25 cycles of 94°C for 30 seconds, 50°C for 30 seconds and 72°C for 1 -6 minutes depending on the gene segment to be amplified. The primary PCR product is then separated on a 2% NuSieve (FMC Bioproducts, Rockland ME) agarose gel and the DMA band excised and either purified (Gene Clean; Bio1O1, CA) or used directly in subsequent reactions.
INSTALLATION OF THE IN VITRO EXPRESSION CASSETTE
expressioe Th n cassett splice w gene no th f interess eeo i o d t two-stea y b t R pPC which include initian sa l overlap extension program followe secondara y db reactioR yPC n overlae th n I p (Fig. extensio1) . n approximateld program an vitron i C e E fmo 0 th 3 ,f o l y 1-10 ng of the primary PCR product are added to 100//I reaction containing 1 x PCR
buffer, 50//M dNTPs and 1 mM MgCI2, 2.5 U Taq DNA polymerase and denatured at 94°C fo minute5 r s followe 5 cycle2- seconds 0 y t 94°d3 b sa r Cfo ,second 0 25°3 r Cd fo san 72°C for 1 -6 minutes. This is then linked to a soak file at 80°C. When the temperature has equilibrate 80°Cdo t H3T e pmo0 th 5 , f 7o l prime primer ro (Fig2 , complimentarB. r .2) y to the 5'-end of the in vitro EC, and 50 pmol of the antisense gene-specific primer are added. The reaction is then denatured as 94°C for 5 minutes, followed by 20 cycles at 94°C for 30 seconds, 50°C for 30 seconds and 72°C for 1-6 minutes. The final PCR product is the recombinant DNA template containing the in vitro EC spliced in frame to the gene or gene segment of interest. This final E-PCR template is extracted with chloroform, precipitated with ethano resuspended an l 15/vn di f RNase-freo le b n ca w e wateno d an r used for in vitro transcription.
IN VITRO TRANSCRIPTION AND TRANSLATION
DNA templates produced by E-PCR are added to a 50 jj\ transcription reaction
containin Tris-HCIM m 0 MgCI g8.0spermidine4 M H M p ,m m ; M 8 2NaCI2 ; M m m 0 1 ;0 1 ; dithiothreitol (DTT) unit0 5 ; f RNasiso n (Promega, Madison eacM , // Wl)f ATPho 0 50 ;, CTP, GTP and DTP; and 25 units of T7 RNA polymerase (Promega). The reaction is incubated at 37°C for 60 minutes. The DNA template is then digested with 1 unit of RQ1 DNase (Promega) at 37°C for 10 minutes followed by chloroform extraction, ethanol precipitation, resuspension in 10 fj\ of RNase-free water. Alternatively approximately 5//I of the transcription reaction may be added directly to the translation reaction.
Several in vitro translation products and protocols are available. We generally use Promeg r Gibca producto L oBR follod san protocoe wth l provide manufacturere th y db n I . initially settin n vitroi p gu translation importans i t i , o optimizt t concentratioe eth f no mRNA, potassium and magnesium in order to achieve efficient translation. mRNA produced by in vitro transcription is uncapped, however, capping is rarely required for efficient translation. Protein synthesized in vitro may be radiolabelled by the addition of 35[S]-methionin r 3[H]-leucineo translatioe th o et n reaction efficience Th . f proteio y n synthesis can be measured by analyzing 2jj\ samples of the reaction for trichloroacetic acid- (TCA) precipitable radioactivity, as measured by liquid scintillation counting or by analysis with SDS-polyacrylamid electrophoresisl ege . Synthesized protein frequentln sca usee yb d without additional purification. Translation reaction products shoul storee db t -20°da C after analysis.
100 DISCUSSION
E-PCR is a rapid, simple method for in vitro production of proteins from genes without cloning. It eliminates the need for laborious procedures and permits the researcher to obtain experimental results in a matter of days. In its simplest format, E-PCR allows the rapid production of radiolabelled, biotinylated, or enzyme-linked transcripts from genomic, plasmid or reverse transcribed DNA for use as probes in Northern, Southern and in situ hybridizations and in RNA processing and RNase mapping studies. Because transcripts mad E-PCy eb R sequenccontaiL UT n na e that enhances translation efficiency, they also functio efficiens na t template vitron i r s fo translation. Entir eexpressee geneb y sma r do alternatively, because the initiation codon is contained within the expression cassette, specific domains within genes can be expressed. The initiation and termination of translatio determinee b n ca n y operatodb r design, rathe e ravailabilit th tha y b n f o y restriction enzyme sites. Regions that may present difficulties with subsequent protein characterization such as hydrophobic signal peptides may be easily excluded without additional gene manipulation resultine Th . g radiochemically pure protein extremele sar y useful for a variety of purposes that include studies on the subunit structure of proteins, epitope mappin mutagenesid gan s studies.
An advantage of in vitro transcription and translation is the ability to produce mutant protei template A alteriny nb DN e gth . Historically, site-directed mutagenesis requireda significant inpu f timo t createo t serieea f mutantsso , clone the thed mnan e selecth r fo t desired mutants prio characterizationo rt . This approach often takes day weeko st s before individual mutants are defined. By incorporating expression-PCR with the site-directed mutagenesis procedure of Higuchi et al. [5] it is possible to generate mutants in one day that can be screened the next. With the use of UDG cloning, the products can be rapidly and efficiently cloned and only interesting mutants need be pursued.
E-PCR synthesized proteins can often be used directly in biologic assays. However, the addition of a tag, such as polyhistidines to the expression cassette, allows synthesized proteins to be purified by commercially available nickel columns [14] if desired.
Conformation and post-translational modification of proteins are frequently important for their biologic activit d recognitioan y y monoclonab n l antibodies. Maintaining conformatio recombinann i t protein problematice b n sca , particularly those producey db bacteri yeastr ao vitron I . translatio eukaryotia ns i c system which when combined with pancreatic microsomes performs many post-translational modifications of proteins, including signal peptidase activity, core glycosylation, phosphorylation and disulfide bond formation. Disulfide bond formation may be further enhanced in vitro by the addition of oxidized glutathione co-translationally [19, 20] or the use of protein disulfide isomerase (Takata, Japan).
In summary, using E-PCR it is possible to move from PCR product to functional translated protei unden i r eight hours approace Th . h offers significant advantager sfo researchers performing domain-mapping, epitope-mapping and site-directed mutagenesis since this system offers the potential to rapidly identify biologically important domains and constructs for further analysis.
REFERENCES
[1] SAIKI, R.K., SCHARF, S., FALOONA, F., MULLIS, K.B., HORN, G.T., ERLICH, H.A., ARNHEIN, N., Enzymatic amplification of /?-globin genomic sequences and restriction site analysi r diagnosisfo f sicklso e cell anemia, Scienc (19859 23 e ) 1350-1354. [2] ERLICH, H.A., GELFAND, D., SNINSKY, J.J., Recent advances in the polymerase chain reaction, Science 252 (1991) 1643-1651.
101 [3] SCHARF, S.J., HORN, G.T., ERLICH, H.A., Direct cloning and sequence analysis of enzymatically amplified genomic sequence, Science 233 (1986) 1076-1078. ] [4 MACFERRIN, K.D., TERRANOVA, M.P., SCHREIBER, S.L., VERDINE, G.L., Overproductio dissectiod nan f proteinn o expression-cassette th y sb e polymerase chain reaction, Proc. Natl Acad. Sci (19907 .8 ) 1937-1941. [5] HIGUCHI, R., DRUMMEL, B., SAIKI, R.K., A general method of in vitro preparation and specific mutagenesis of DNA fragments: Study of protein DMA interactions, Nucl. Acids Res (19886 1 . ) 7351-7367. [6] KAIN, K.C., ORLANDI, P.A., LANAR, D.E., Universal promoter for gene expression without cloning: Expression-PCR, Bio-techniques 10 (1991) 366-373. ] [7 JOBLING, S.A., GEHRKE , EnhanceL , d translatio f chimaerino c messenger RNAs containing a plant viral untranslated leader sequence, Nature 325 (1 987) 622-625. , S.N.HO , HUNT ] [8 , H.,D., HORTON, R.M., PULLEN, J.K., PEASE, L.R., Site-directed mutagenesi f overlao s p extension usin e polymerasgth e chain reaction, Gen7 7 e (1989) 51-59. [9] HORTON, R.M., HUNT, H.D., HO, S.N., PULLEN, J.K., PEASE, L.R., Engineering hybrid genes without the use of restriction enzymes: Gene splicing by overlap extension, Gene 77 (1989) 61-68. [10] SHULDINER, A.R., SCOTT, L.A., ROTH , PCR-induceJ. , d (Ligase-Free) subcloning: A rapid reliable method to subclone polymerase chain reaction (PCR) products, Nuc. Acids Res. 18 (1990) 1920. [11] MELTON, D.A., KRIEG, P.A., REBAGLIATI, M.R., MANIATIS, T., ZINN, K., GREEN, M.R., Efficien vitron i t synthesi f biologicallso hybridizatioA RN d y an activ A n eRN probes from plasmids containin bacteriophagga promoter6 eSP , Nuc. Acids Res2 1 . (1984)7035-7056. [1 2] THORNTON, C.G., RASHTCHIAN, A., Focus. 14 (1 992) 86. [13] BURCH, H.B., NAGY, E.V., KAIN, K.C., LANAR, D.E., CARR, F.E., WARTOFSKY, L., BURMAN, K.D., Expression polymerase chain vitron reactioi e th synthesi r nfo d san epitope mappin f autoantigengo . Applicatio e humath o nt n thyrotropin receptor utilizing expression-PCR . ImmunolJ , . Meth (19938 15 . ) 123-130. [14] HOCHULI, E., DOBELI, H., SCHACHER, A., New metal chelate adsorbent selective for proteins and peptides containing neighbouring histidine residues, J. Chromatog. (19871 41 ) 177-184. [15] NISSON, P.E., RASHTCHIAN , WATKINS,A. , P.C., Rapi efficiend dan t clonin f alugo - PCR products using uraci glycosylaseA DN l MethodR PC Application,d san (1991s1 ) 120-123. [16] BUCHMAN, G.W., RASHTCHIAN, A., Focus 14 (1992) 41. [17] INNIS, M.A., GELFAND, D.H., SNINSKY, J.J., WHITE, T.J. (Eds), PCR Protocols, A Guide to Methods and Applications, Academic Press, San Diego (1990). [18] PETRUSKA , GOODMAN,J. , M.F., BOOSALIS, M.S., SOWERS, L.C., CHAEJOON, C. , INOCO, I., Comparison between DNA melting thermodynamics and DNA polymerase fidelity. Proc. Natl. Acad. Sci, USA. 85 (1988) 6252. [19] BULLEID, N.J., FREEDMAN, R.B., Defective co-translational formatio f disulphidno e bonds in protein disulphide isomerase-deficient microsomes, Nature 335 (1988) 649-651. [20] SCHEELE, G., JACOBY, R., Conformational changes associated with proteolytic processing of presecretory proteins allow glutathione-catalyzed formation of native disulfide bonds . BiolJ , . Chem (19827 25 . ) 12277-12282.
102 A COMPARATIVE STUDY OF USING DNA PROBE (pPF14) MICROSCOPD AN DIAGNOSIYN I FALCIPARUF SO M MALARIA
Jianliang YANG*, Yongqi RONG**, Cunxing YANG*, Huiming LU** * Jiangsu Institut f Parasitieo c Diseases, Wuxi, China ** Suzhou Medical College, Suzhou, China
Abstract
probeDNA A (pPF14) which specifically recognizes Plasmodium falciparumtestedwas DNA bloodwith192 samples from malaria patients Hainanin results Islandthe and compared with microscopy. In 94.79 % of the samples, the DNA probe and microscopy gave the same result. In 5.21% of the samples the results of the two techniques were different. Using microscopy as a standard, hybridizationDNA gave 3.66% false positives 1.55%and false negatives (low parasitemia). The DNA probe method can detect parasite densities lower than 0.003%. No visible cross hybridization with vivaxobserved.P. was
INTRODUCTION
Barker and his co-workers reported the isolation of a DNA sequence (pPF 14) which specifically recognizes Plasmodium falciparum developed an simplda e methous s it r dfo [1, 2]. Blood samples are spotted onto filtration membranes directly after lysis and do not require additional sample manipulation. Thus a single technician can process thousands of sample dayr sensitivite spe Th . specificitd yan f thiyo s probe metho bees dha n shown to be comparable with conventional microscopic examination of blood films. The objective tes o r probt stude fielos th a tou f n eydwa i situatio Chinan i .
MATERIALS AND METHODS
PATIENTS
One hundred and ninety two patients presenting themselves at local malaria clinics Hainan i n island, China, were use thidn i distributio e s studyag e 2-6s Th . nwa 5 years.
SAMPLE COLLECTION
35 u\ blood samples obtained from the earlobe were transferred to microtiter plates containing 200//I lysis buffer (50mM EDTA, 10mMTris-Clp Trito% 1 n0. X-100, H10 0 ,20 //g/ml proteinase K). Samples were incubated for 2 h at 42°C before being transferred to Genescreen Plus filtration membrane (Dupon ResearcW NE t h Products). Filters were then air-drie t leasa min0 r filter3 y tdfo Dr . s were place envelopen di broughd e san th o t t laboratory.
LABORATORY DNA PROBE
The DNA probe was labelled with 32P-dATP by nick-translation (200 ng/1 2 u\ probe DNA, 2 u\ 10 x NT, 0.6//I 2 mM dCTP dGTP dTTP each, 40 uCP-dAT\32 P (Amersham), 1 u\ DNase I (1 jug/ml, 1/yl DNA polymerase I. incubation 1 h). The radiolabelled DNA was separated from free nucleotides by 'spin column'.
103 HYBRIDIZATION
Sample DNA was denatured for 10 min by placing nylon filters into 0.5 M NaOH and 1.5 M NaCI. Filters were neutralized twice (10 min each) in 1M Tris-MCI pH 8.0. The filters were then prehybridized for 2 h at 42°C in prehybridization solution (50% Formamide SSCx x Denhardt'5 , 5 , s solution SDS% 1 , , 100//g/ml denatured herring sperm DNA) and hybridized with radiolabelled pPF14 DNA at 42°C overnight. The filters were then washed 2 times for 5 min each at RT in 2 x SSC, 2 times for 30 min each at 65°C in 2 x SSC, 1 % SDS and finally for 30 min at RT in 0.1 x SSC. Genescreen filters wer t drieeno d before exposur filmy ra . X o et
HYBRIDIZATION CONTROL STRIPS
Positive controls were included in the hybridization experiment. These consisted of two-fold dilution f synchronizeso d ring stag strai 2 . falciparumeP W f no parasites.
MICROSCOPY
A thick and thin smear slide was prepared from each patient. Slides were stained with Giemsa. Microscopic examinatio performes nwa y experdb t microscopistr ou n si college.
RESULTS
comparisoA n between expert microscop hybridizatioA DN d yan showns i Tablnn i . e1 samples2 19 e Oth f , 37.50% were positiv . falciparumP r efo infectio boty nb h methods and 57.29% were negativprobA microscopd DN e an y eb y examination. Thus 94.79n ,i % of the samples, DNA probe and expert microscopy gave the same result. In 5.21 % of the samples, the results by the two methods were different. Using microscopy as a standard, the DNA probe yielded 3.65% false positives and 1.56% false negatives.
A hybridization control strip prepared from dilution f synchronizeso d culture ring stages showed that 0.003% parasitaemia can be detected by using this technique, the intensit hybridizatioe th f yo n being proportiona numbee th o t lf parasite o r samplee th n si .
TABL . COMPARISOE1 RESULTF NO S FROM MICROSCOP HYBRIDIZATIOA DN D YAN N
Microscopy + Total
DNA probe + 72(37.50%) 7(3.65%) 78(41.15%) 3(1.56%) 110(57.29%) 113(58.85%)
Total 75(39.06%) 117(60.94%) 192(100%)
In the 192 samples, the microscopist also identified P. vivax infections in 33 samples. The PF 14 DNA probe hybridized with 8 of these samples. Seven of which were mixed P. vfvax-P. falciparum infections. The results are summarized in Table 2.
104 PROBTABLA DN . E2 HYBRIDIZATION WIT . HV/VAXP INFECTION
P. vivax Mixe . vivaxdP Infection P. falciparum Total infection
DNA probe + 1 7 8 - 25 0 25 Total 26 7 33
DISCUSSION
The purpose of this study was to compare the sensitivity and specificity of the P. falciparum specific DNA probe pPF14 with that of microscopy for diagnosis of P. falciparum malaria in China. The results showed that in 94.79% samples, the DNA prob microscopd ean y gav same eth e results.
Using microscopy as the standard, the DNA probe gave a false positive rate of 3.65% and a false negative rate of 1.56%. The false positives could theoretically be due to non- specifi probA c DN blooo et bindin e dth f componentsgo otheo t , r infectious organisms found in the blood, or to residual P. falciparum DNA remaining after parasites had been cleared from the patient's blood. Had the blood samples been treated with proteinase K and Triton X-100havy ema t completeli , y eliminated thi alternatn sA proble . 3] e , m[1 explanation for the false positives could be the presence of low level infections undetected by the microscopists.
Base hybridization do n with purifie probfalciparum. A dP DN e 4 coul1 F dDNApP e th , f DNAo g p ,detec correspondin0 1 < t genome th o gt e equivalen parasite0 10 , 4 f o , t s[1 5]. In this study, the lowest number of parasites detected in a 50 u\ sample of infected blood was approximately 4000. Clearly it should be possible to increase sensitivity by extractin fro A samplee mgth DN s before applying Genescreee theth mo t n filters. This i impractica fiel r where lfo d us objectiv e eth minimizo t es i e equipmen sampld tan e handling. In addition, the added steps necessary for extraction of DNA would limit the number of samples processewhice b n hca d simultaneously majoe th f forfeid ro advantagee an , on t s of the DNA hybridization approach. examines wa A casen di DN Th4 1 se F wherspecificitpP e th microscopist f yo s identifie . vivaxdP prob. vivax4 1 P infections3 F e3 caseshybridizepP e A th f DN ,O . do t samples8 f whico 7 , h wer mixeea . vivax-P.dP falciparum infection, onl samply1 d eha only P. vivax. The latter film was not re-examined because the thick smear had peeled off. According to Barker [1, 2], this probe hybridizes with P. falciparum specifically. It is possible tha above th t e mentioned sampl alss mixeoea wa d infection plae obtaiW no .t n some P. vivax samples in pure P. vivax endemic area to verify the specificity of pPF14 DNA probe.
ACKNOWLEDGEMENTS
We acknowledg probfro4 A 1 . R.H mF Dr eDN . pP gifBarkere f eth o t , Jr., Harvard School of Public Health, Boston, M.A. 02115, USA.
105 REFERENCES
[1 ] BARKER, R.H. Jr., SUEBSAENG, L, RODNEY, W., et al.; Specific DNA probe for the diagnosis of Plasmodium falciparum malaria, Science 231 (1986) 1434-1436. ] [2 BARKER, R.H. Jr., SUEBSAENG , ROONEYL. , t al.e , DetectioW. , f Plasmodiumno falciparum infectio human i n patients comparisoprobA A : DN e e methoth f no o dt microscopic diagnosis. Am. J. Trop. Med. Hyg. 41 (1989) 266-272. ] [3 BITTNER , KUFFERERM. , , MORRISP. , , C.F. t al.e , , Electrophoretic transfef o r proteins and nucleic acids from slab gels to diazobenzyloxymethyl cellulose or nitrocellulose sheets, Anal. Biochem. 102 (1980)459-471. [4] GOMAN, M., LANGSLEY, G., HYDE, J.E., et al., The establishment of genomic DNA libraries for the human malaria parasite Plasmodium falciparum and identification of individual clone hybridizationsby , Mol. Biochem. Parasitol (19825 . ) 391-400. [5] POLLACK, Y., The genome of Plasmodium falciparum I: DNA base composition, Nucleic Acids Res (19820 1 . ) 539-546.
106 APPLICATIO MOLECULAF NO R PROBESN I HISTOPATHOLOG COMMUNICABLF YO E DISEASES
. LOOI LM CHEAL P. , H Departmen f Pathologyo t , Facult f Medicineyo , University of Malaya, Kuala Lumpur, Malaysia
Abstract
The use of molecular probes in histopathology is based on the hybridisation of labelled DNA and RNA probes with nucleic acid sequences in samples of diseased tissues. The main techniques situin are (1) hybridisation (ISH), where labelled probes used are detect to complementaryor DNA RNA in histological sections, and (2) examination by Southern or other blotting techniques of nucleic acids extracted from homogenised biopsy material. Of these ISH enjoys better rapport with histopathologists because similarityits of immunohistochemistry.to uniquethe has advantage It over other molecular biology techniques of allowing localisation and visualisation of target nucleic
acid sequences within morphologically identifiable cells or cellular structures.
32 3S Probes for ISH may bear radioactive or non-radioactive labels. Isotopic probes H,(P,3 S, 14C, 125 generallyI)are more sensitive than non-isotopic ones, although they lessare stableand require longer processing times. Numerous non-isotopic labels have been explored; of these biotin and digoxigenin are the reporters of choice. In ISH, finding the optimal balance between good morphological preservation of cells (which is dependent on tissue fixation) and strong hybridisation signals, crucial.is Tissue fixation retentionand cytoskeletalof structures, unfortunately, impede diffusion probesof into tissues. sensitivityISH alsois influenced inherentby properties probethe of and hybridisation conditions.
Although ISH is largely a research tool in histopathology, it is already making strong inroads into diagnostic histopathology. beenhas It applieddetection the for CMV,of HPV, HIV, virus,JC B19 parvovirus, HSV-1, EBV, HBV, hepatitis delta virus, Chlamydia trachomatis, salmonella and mycoplasma etc. applicationIts includes localisation sitesof infection,of elucidation mechanismsof virusof transmission disseminationand investigationand linkthe betweenof virus infectionsand cancer. Demonstration of mRNA transcripts in cells by ISH is a useful adjunct in elucidating the pathophysiology disease.of
INTRODUCTION Until recently, most histopathologists were satisfied with leaving routine virological diagnosis to virologists as they had no specific and readily available means of identifying viruses in tissue sections and smears, apart from the infrequent recognition of fairly non-specific cytopathic viral effects advene Th . f recombinano t technologA tDN y heralded a major breakthrough by providing highly specific nucleic acid probes with which to elucidat e aetiologicaeth pathophysiologicad an l l role f viruseo se causatio th n i s f no disease.
The use of molecular probes in anatomic pathology (encompassing histopathology, cytopathology and electron microscopy) is based on the hybridisation of labelled DNA and RNA probes with nucleic acid sequence n samplei s f diseaseo s d tissues e maiTh .n techniques are (1) in situ hybridisation (ISH), where labelled probes are used to detect complementar tissun i A e RN section r o A smearsr ysexaminatioDN ) o (2 d ,an Southery nb n or other blotting technique f nucleiso c acids extracted from homogenised biopsy material. Of these ISH enjoys better rapport with histopathologists because of its similarity to immunohistochemistry. It has the unique advantage over other molecular biology technique allowinf so g localisatio visualisatiod nan targef no t nucleic acid sequences within morphologically identifiable cell r cellulaso r structure heterogenoua n si s cell population. This paper wil uniqus i l concentratt i s anatomieo t a H IS n ceo patholog alsd yoan because blottine th g technique discussee sar othey db r paper thin si s Seminar.
107 SITUN I HYBRIDIZATION
The techniqu situn i f e o hybridisatio s it t n bu (ISH firs] s -3 )twa 1 [ describe 9 96 1 n di developmental phase was largely in the 1980s when recombinant DNA technology was applie overcomdo t earliee eth r problem probf so e preparation applicatioe th y B . f labelleno d probes on intact cells and tissue sections, ISH allows the actual localisation of the target sequence (e.g vira.a l genome particulae th n i ) r cell whic himmediatels i harbour t i d an t si y obvious why this molecular technique has appealed to the morphologist. Such specific localisation also has a marked advantage over older molecular methods of viral genomic identification where detection fro mtissua e homogenate which contain multitudsa f eo cells, precludes identification of the actual affected cell, appreciation of cellular detail and relation subsequend san t reconstructive interpretation findingse th f o . Fro practicae mth l view point mose th , t crucia histopathologisle advantageth o t H IS f so t runnin servicga e laboratory are (1) the simplicity of its methodology which is just minimally more involved than immunohistochemical staining, (2) the specificity of results obtained, (3) ease in interpretatio s applicabilitit ) f o findingn(4 d n tissuo an ys e sections (frozer o n formalin-fixed, paraffin-embedded smeard an ) s withou e nee r th speciat dfo l specimen collection or processing. We believe that ISH is a technique that will soon be regarded as "routine mosn i " t laboratorie performins a s immunohistochemican ga l stain, especially when nucleic acid probes become commercially availabl techniqued ean r detectiosfo n i formalin-fixed and paraffin-embedded tissue are perfected.
PROBES AND LABELS
Probes currently available for ISH include double-stranded DNA (dsDNA), single-stranded synthetic oligonucleotides, single-strande A (ssDNADN d d an ) single-stranded complementary RNA (sscRNA). In vitro labelling methods are usually used such as nick translation, random priming, end labelling and in vitro transcription. Labelling of the probe can be: (1) direct, with attachment of a reporter molecule directly to the DNA or RNA probe, so that formed hybrids can be visualised immediately after probe-target hybridisatio n- radioactiv e label fluorochromed san suitable sar e label r thisfo s metho, d- or (2) indirect, with attachment of a reporter molecule - usually a hapten (e.g. biotin or digoxigenin probe subsequenth d o ean t - ) t detectio reportee th specifif a n o y b r c antibody olabellea r d binding protein (e.g. avidin).
Reporter molecules can be radioactive or non-radioactive. Radioactive reporters include 3H, 32P,35 S,14 C and 125I. Of these, 3H is the most well established for ISH work. Becaus shors it f eo t track lengt photographin hi c emulsions t allowi , s precise localisation of signals to cellular details and produces high resolution autoradiographs. However, its low beta energy dictates long exposure times. In recent times, 35S has emerged as a good alternative readila s i P y.32 availabl penetratino to e s i labe t bu r lgoo resultsgfo H dIS .
The most frequently used non-isotopic reporters are biotin (vitamin H of B2 complex) and more recently, digoxigenin (aglycone derivative of digoxin) [4]. Radioactive probes are generally more sensitive than non-radioactive ones, although they are less stable, require longer processing time mord san e stringent waste disposal procedures (Tabl . Markee1) d improvement in the sensitivity of non-radioactive probes have been achieved in recent times and their use is gaining popularity in histopathology [4, 5]. Nonetheless, radioactive probes are the more widely used ones in research and development work because of the distinct advantages that (1) the efficiency of probe synthesis can be better monitored, (2) radioisotope e readilb n yca s incorporated into synthesise d RNAan d A ,an DN d (3) autoradiography is a more sensitive detection system than immunoenzyme systems. generaln I , with radioactive labels, about 2-1f probo requiree g 0ar n e r sectiodpe n
108 whereas wit biotie hth n label r examplefo , , about f prob10-2o requiree g n ear 0 r dpe section [6]. Radioactive labels are still the reporters of choice for detection of low-copy-number sequence particularld san case th f cRN eo n y i A probedetectioe th r sfo n of low-copy-number mRNA.
TABL . COMPARISOE1 RADIOACTIVF NO NON-RADIOACTIVD EAN E PROBES
Radioactive Non-radioactive
Stability: Weeks Months-years
Exposure: Days-weeks Hours
Sensitivity + + + + +
Resolution + + + + +
Washing procedure: Hours Minutes
Waste disposal Stringent Simple
PROBLEMS UNIQUH IS O ET
In ISH, findin optimae gth l balance between good morphological preservatio f cellno s and strong hybridisation signals, is crucial. This poses a problem unique to ISH. Because celleved san n cellular structures hav remaio et n intac identifiabld an t e morphologically, tissue preservation, usualla fixativ f o y ee througus suc s formalie a hth h r o n paraformaldehyde necessarys i , . Fixation however impedes diffusio f probeno s into cells and causes cross-linkages among nucleic acidd proteinsan s , effectively reducing accessibilit f f probfrozeyo o e targeto et nus sectione Th . s obviate neee sth r fixatio dfo n t compromisebu s morphological clarity. Notwithstandin probleme gth s pose fixationy db , the mere retention of cell membranes and cytoskeletal structures already impede diffusion of probes into tissues, so that the preservation of cellular integrity is a factor directly opposed to hybridisation efficiency. To promote penetration of tissues, short probes (e.g. 0 bases 30 more ar o abou)t e 0 suitabl5 t e [6] .ISHn I , pretreatmen f tissueo t s with detergent or proteinase is also a standard procedure to unmask DNA/RNA and improve probe penetration.
In practice, formalin fixation and paraffin embedding will allow the detection of DNA and mRN higAn i h copy number thid suitabls si an mosr efo t clinical specimens. However, detectioe th f mRNno A would require that tissu fixee eb frozer do soos na n after excision as possible since mRNmora n i e As i dynami c physiologica lsteadils i stat d ean ythaA nDN synthesised and degraded more readily. The preferred probe for localising mRNA is an "antisense" cRNA because of the high thermal stability of RNA-RNA hybrids. In addition, background reactio readile b n ynca reduce RNAasy db e digestio f unhybridiseno d probes. labellea f o e Finallyd us "sense e ,th " strand provide negativsa e control system.
ISH sensitivity is also influenced by inherent properties of the probe and hybridisation conditions. Properties of probes to consider are: (1) probe construct: oligonucleotide probes are better than traditional probes base clonen o dsegmentA DN d s becaus f higo e h specificity, single-strandednes shord san t probe length (10-50nucleotides) Efficiency) ,(2 of labelling: labelling by random priming has been reported to be more efficient than nick translation percentage) (3 , baseC G f pairs:o highee th contene pairsrth C higheG e f ,th to r
109 the Tm, (4) RNA versus DNA probes: the strength of the probe-target bond decreases in ordee th f RNA-RNAo r , DNA-RNA, DNA-DNA probe) (5 , length: shortee th probee th r e th , better its penetration into cells, (6) signal detection systems: autoradiography for radioactive labels is reputed to be more sensitive than the immuoenzyme systems. Hybridisation reactions are influenced primarily by the following conditions: (1) pH, (2) temperature sal) (3 , t concentration concentratio) (4 , f formamideno stringenc) (4 d ,an f yo washes.
ISH TECHNIQUE
The technique of ISH is well documented in the scientific literature [4, 6, 7] and readers are referred to them for details. Only the general principles will be considered here.
. Pretreatmen1 t
Tissue sections must adhere well to specially treated glass slides to avoid loss of tissue during the hybridisation process. Various "adhesives" are available including poly-L-lysine, gelatin chrome alum aminopropyltriethoxysiland an , e (TESPA). Following adhesion of the tissue section on to the slide, the target nucleic acid sequence must be made accessibl moleculae th o et r probe, this procedure being especially important with paraffin sections. "Unmasking" requires dewaxing the section and treatment with various enzyme detergentsd san potence Th . f differenyo t enzymes varies from typ typo et d ean manufacturer to manufacturer for a single enzyme. Hence the enzyme dilution must be individually optimise experimentay an r dfo l system r laborator ou hydrochlorie n I .us e yw c acid, Triton X-100 and proteinase K to increase probe accessibility and penetration while acetic aci mainls di y use decreaso dt e background staining [8].
2. Hybridisation
Molecular hybridisatio procese th ns i s whereb single-strandeya d target sequencs ei anneale complementara do t y single-stranded prob foreo t m double-strandea d hybrid. Prior to hybridisation, both the target and the probe, if DNA, must be denatured to render them single-stranded and this can be achieved by heat or alkali treatment. Following denaturation, the single-stranded target and probe sequences are incubated in a hybridisation mixture, which provide n optimaa s l environmen r re-annealinfo t f o g single-stranded sequences.
generaln I , reaction temperaturew s lo carrie presence t a th t n i higd a ou d f heo san salt and low formamide content of the hybridisation mixture result in low specificity. At low stringency conditions, a probe may bind to a target sequence with only 70-90% homology and this results in non-specific hybridisation signals. The manipulation of salt and formamide concentration has a predictable effect on hybridisation of closely homologous viral sequences and optimal stringency for a particular sytem should be determined by experiment.
Specificity control is achieved by varying the conditions under which hybridisation is carried out additionn .I followine th , g checkcarriee b n dsca out:
1. Running the procedure without the labelled probe to check for non-specific reactions.
. 2 Hybridisatio f probt nbloo do textracteo e a t system n i A dRN . r defineo A dDN
3. Hybridisation of probe to positive control sections or cells (e.g. HeLa cells for HPV18, CaSki cell r HPV16sfo , Raji cell r EBVsfo ) should yield positive results.
110 4. Prehybridisation ("preabsorption") of probes with specific cDNA or cRNA should yield negative results.
. 5 Hybridisatio f sectiono n s with sensshoulA RN e d yield negative resulte th n i s detectio f mRNAno .
. 6 Pretreatmen sectionf to s with DNAas RNAaser eo , whicheve relevants ri , should yield negative results with the DNA or RNA probe respectively.
7. Hybridisation of the section with non-specific vector sequences and irrelevant probes should yield negative results.
3. Post-hybridisation washes
Stringency washes after hybridisation aim t decreasina s g non-specific binding. However preferabls i t i , hybridiso et e stringently rather than wash stringently.
4. Detection
Various methods are available for visualisation of the hybridisation reaction depending on the type of probe label used.
Reactions using radioactive labelled probe detectee sar autoradiographyy db . This i based on the emission of fast-electrons or beta particles from the probe. Beta particles release a large amount of energy when they collide with atoms of an emulsion added to the section on the slide. The excessive energy released reduces ionic silver present in the emulsion to metallic silver. When this happens, a faithful record of the location of the collision between an electron and the silver ions in the emulsion is produced in the form of a latent image. This image, when visualised is the indicator of the probe location in the tissu r celleo .
In practice e slidth , e (bearin e probeth g d tissue section s dippei ) r coatedo n i d photographic emulsion (e.g. llford G5, K5,14 or Kodak NTB2), an emulsion thickness of less than 5 //m being best for good cellular resolution. The slide is stored in the dark for an optimal period of time to allow the formation of a latent image, which is then developed and fixe normay db l photographic procedures.
Biotin-labelled detecteprobee b avidin-base ) n (1 sca y db d systems which exploie th t natural affinity of avidin for biotin or (2) specific antibodies to biotin. An antibody to digoxin is use detecdo t t digoxigenin-labeled probes basecrosse th n do - reaction between antibodies to digoxin and digoxigenin. Single- step and amplification systems are available for detection of the final product. In single-step detection, an indicator enzyme (such as alkaline phosphatase or horseradish peroxidase) is linked directly to the primary antibody or avidin and reacted against its substrate (nitroblue tetrazolium (NBT)/ 5-bromo-4- chloro-3-indolyl phosphate (BCIP) for alkaline phosphatase and diaminobenzidine for horseradish peroxidase} resulting in a coloured product. A variety of reactions can be used to amplify signals and will detailee b t no d here.
APPLICATIONS
Although ISH is largely a research tool in histopathology, it is already making strong inroads into the routine histopathology laboratory, especially in the diagnosis of viral diseases. It has been applied for the detection of cytomegalovirus, human papilloma virus, human immunodeficiency virus virusC parvovirus9 J , B1 , , HSV-1, Epstein-Barr virus, hepatiti virussB , hepatitis delta virus, measles virus, Chlamydia trachomatis, salmonelld aan
111 mycoplasma alss ha o t beeI . n applie o karyotypdt e preparation o studst y chromosomal changes in tumours and viral infections. Demonstration of mRNA transcripts in cells is indicativ f activeo e synthesi usefua s i d l adjuncsan elucidatinn i t pathophysiologe gth f yo disease. In general, the applications of ISH in the histopathology of infective diseases can be categorised as follows:
. 1 DIAGNOSIS (DETERMINATION INFECTIVF O ) E AGENT
This is a straight-forward concept, based on the detection of the infective agent's genome in the tissues or cells studied. Besides the facilitation of clinical diagnosis, specific typing of infective agents also have important implications for epidemiological surveys and outbreak investigations [9].
2. LOCALISATION OF ACTIVE INFECTION
The actual cell or cell structures harbouring the infective genome can be elucidated by ISH e.g. HBV in hepatocytes, parvovirus in cells of the lung [10]. Furthermore, the mode of viral replication and pathophysiology of disease can be studied, (such as with the use of RNA probes against specific early regions of viruses). Tissue trophism exhibited by specific viruses can also be appreciated e.g. HBV for hepatocytes, measles virus for neurons.
. 3 ELUCIDATIO MECHANISF NO VIRUF MO S DISSEMINATIO TRANSMISSIOD NAN N
Natural horizontal and vertical transmission routes of viruses can be studied. For example, the presence of EBV in epithelial cells of the oropharynx provides a means for transmissio e viruth sf no throug hbees salivaha n H useIS . o elucidatdt e modeth f eo transmissio froV mCM celf no cello t l , disseminatio viruC J f sn o from somatic e cellth o st brain [10 disseminatiod ]an f Varicellno a Zoster virus throug centrae hth l nervous system [11].
. 4 LOCALISATIO PERSISTENF NO T VIRUS INFECTION
Examples are the persistence of JC virus in oligodendrocytes in progressive multifocal leukoencephalopathy and measles virus in neurons and glia cells in SSPE [12,13].
. 5 LINK BETWEEN VIRUS INFECTION CARCINOGENESID SAN S
This is a widely expanding area of active research and clinical interest. Of note are the role of EBV in nasopharyngeal carcinoma and B cell lymphomas [14], HBV in hepatocellular carcinoma and HPV in cervical carcinoma [15].
REFERENCES
] [1 BUONGIORNO-NARDELLI , AMALDIM. , , AutoradiographiF. , c detectio f moleculano r hybrids betwee tissun i A ne DN rRNsections d Aan , Natur 5 (1969e22 ) 946-947. ] [2 GALL , PARDUEG. , , M.L., Formatio detectiod nan f RNA-DNno A hybrid moleculen si cytological preparations, Proc. Natl Acad. Sci. 63 (1 969) 378-381. [3] JOHN, H.L., BIRNSTIEL, M.L., JONES, K.W., RNA-DNA hybrids at the cytological level, 9691 Natur( )3 912-913e22 . [4] MORRIS, R.G., ARENDS, M.J., BISHOP, P.E., SIZER, K, DUVALL, BIRD, C.C., Sensitivity of digoxigenin and biotin labelled probes for detection of viral genomes, J. Clin. Pathol (19903 4 . ) 800-805. [5] SYRJANEN, S., PARTANEN, P., MANTYJARVI, R., SYRJANEN, K., Sensitivity of in-situ hybridization techniques using biotin and S-labelled human papillomavirus 35 probesA (HPVDN . Virol) J , . Method (19889 s1 ) 225-238.
112 [6] POLAK, J.M., McGEE, J.O'.D. (Eds), In situ hybridization: Principles and Practice, Oxford: Blackwell Scientific (1990). [7] WARFORD, A., In situ hybridisation: a new tool in pathology, Med. Lab. Sci. 45 (1988) 381-394. [8] CHEAH, P.L., LOOI, L.M., TAN, K.L., Non-isotopic in situ DMA hybridisation technique for detection of human papillomavirus. TMS-5, Technical Aid Report of the IRPA Tumour Marker Studies Project 3/31/01, University of Malaya (1991). [9] TOMPKINS, L.S., Use of molecular methods in infectious diseases, N. Engl. J. Med. (19927 32 ) 1290-1297. [10] MOREY, A.L., PORTER, H.J., KEELING, J.W., FLEMING, K.A., Non-isotopic in situ hybridisation and immunophenotyping of infected cells in the investigation of human fetal parvovirus infection, J. Clin. Pathol. 45 (1992) 673-678. [11] ROSTAD, S.W., OLSON, K., McDOUGALL, J., SHAW, C.M., ALVORD, E.G., Transsynaptic spread of Varicella Zoster virus through the visual system: a mechanism of viral dessimination in the central nervous system, Hum. Pathol. 20 (1989) 174-179. [12] IRONSIDE, J.W., LEWIS, F.A., BLYTHE , WAKEFIELDD. , , E.A. identificatioe Th , f no cells containing JC papovavirus DNA in progressive multifocal leukoencephalopathy by combined in situ hybridization and immunocytochemistry, J. Pathol. 157 (1989) 291-297. [13] SHARPSAK t al.e , , SearcP. , virur hfo s nucleic acid sequence postmorten si m human brain tissue usin sitgn i u hybridisation technology with cloned probes: some solutions and result progressivn so e multifocal leukoencephalopath subacutd yan e sclerosing panencephalitis tissue, J. Neurosci. Res. 16 (1986) 281-301. [14] WEISS, L.M., MOVAHED, sitL.A.n I u, demonstratio f Epstein-Barno r viral genomen si viral-associate celdB l lymphoproliferations . PatholJ . (19894 ,Am 13 . ) 651-659. [15] STOLER, M.H., RHODES, C.R., WHITBECK, A., WOLINSKY, S.M., CHOW, L.T., BROKER, T.R., Human papillomavirus type 16 and 18 gene expression in cervical neoplasias, Hum. Pathol (19923 2 . ) 117-128.
Next page(s) left blank EPSTEIN-BARR VIRUS [EBV] GENE EXPRESSION IN HIV-ASSOCIATED ORAL HAIRY LEUKOPLAKIA
R. PAT ATN M H. GILLIGAN** MA AN* K , , L. RESNICK***, N. RAAB-TRAUB** * Departmen f Pathologyo t , Facult f Medicineyo , University of Malaya, Kuala Lumpur, Malaysia ** Department of Microbiology and Immunology, Lineberger Cancer Research Center, University of North Carolina-at-Chapel Hill, Chapel Hill, North Carolina, United States of America *** Mount Sinai Medical Center, Miami Beach, Florida, United States of America
Abstract
Epstein-Bar Virus etio/ogicthe [EBV]is agent oralof hairy leukoplakia (HLP), conditiona unique to patients infected with the human immunodeficiency virus (HIV). A study of the terminal restriction enzyme fragments showed EBV permissivea of is thatHLP epithelial cell infection, without a predominant detectable population of EBV episomal DNA. Northern blotting and in situ hybridization revealed expression early,of immediate-early messageslateRNA and EBV of replication. In contrast, 2 small Pol III transcripts, EBER 1 & 2, expressed to high levels in latent infections were detected.not concludeWe predominantlyis thatHLP lytica lesion suggestand that the EBERs may be important in maintaining latency and can be considered useful markers for latent EBV infection.
INTRODUCTION
The Epstein-Barr virus, typically a lymphotropic herpesvirus, is the etiologic agent of HLP, a newly recognised mucocutaneous lesion unique to patients infected with HIV [1 ]. Acyclovir inhibits the replication of this virus, and induces clinical remission [2]. In EBV infected cells mose ,th t abundantly expressed viral transcript nonpolyadenylateo tw e sar d Po I transcriptII l s EBER EBERd 1an 2 (EBV-encoded small nuclear RNA) [3]. Despite their abundance, the function of EBERS is still unknown. The detection of masses of viral particle infecten si d cells without cytopathic effec hosa r o t inflammatory responsa s ei situation uniqu infectionbiologe V th EB eo t f present d yo ,an uniqusa e opportunite th r yfo study of viral replication and determination of the viral termini structure by enzyme restrictio ndeterminatior fragmenfo d an A genpattere V t th DN analysi f eEB nV o f no EB f so transcription by RNA hybridization techniques.
METHODS
TISSUE SAMPLES
Tissue specimens consisted of lingual biopsies of HLP lesions. Cell cultures included in the study consisted of lymphoblastoid B-cell lines B95-8, AG876, Raji, Louckes and CB4 grown at 37°C in RPMI 1640 WITH 10% (v/v) fetal calf serum and antibiotics. Controls included NPC-KT and C15, an undifferentiated nasopharyngeal carcinoma (NPC) cell lines propagate nudn di e mice.
115 PREPARATION OF RADIOACTIVE GENE PROBES
Single-stranded RNA probes were synthesised from EBV fragments cloned into pGEM
vecto rpolymerase A (PromegaRN 7 fragmentT V r usiny o b 6 )EB . gSP s use identifdo t e yth terminal fragments wer EcoRIe eth I portio f BamHno I NJhet, adjacen lefe th t terminao t t l repeat (TRs), the Xho/1.9-kb fragments representing unique DNA adjacent to the right TRs. RNA probes were synthesise dfragmentL fro d BamHIe man th H , identifo st ,Z y replicative mRNAs1.9-ko Xh be fragmen,th fragmenJ identifo l t R mRNAP o y IM froEc d t e man , th identifo t y EBER RNAs EBERe Th . 1- specifi c prob 1.45-ka s ei b SauSA subfragmenf o t EcoRI J fragment (bases 5418-6794).
DNA BLOTTING AND IN SITU HYBRIDIZATION
Cell linelinguad san l biopsies were studie genstructurr V A viradfo eEB DN l d ean expression by nucleic acid and in situ hybridization by methods described previously by us [4].
RESULTS
STRUCTUR TERMINV P EB HL F EO N I I
Terminal restriction enzyme fragment f lineaso heterogenoue r ar virio A nDN sizn si e and var incrementy reflectinyb p b 0 50 f gso differing number f copieso f direcso t tandem repeats of =500 bp at each terminus (TR). Fused terminal fragments are formed after infection through the joining of the ends of the linear DNA to form intracellular, episomal form f EBVfuseso e Th .d terminal fragment distinguishede b n ca s fro e terminamth l fragments of linear genomes because they will hybridize to DNA probes of unique DNA froR adjacenT m e botth ho t linea e endth f sro genome [5]. This typ f analysieo s revealed a single band representing fused termini in NPC, an EBV-associated epithelial malignancy, as monoclonaweln i s a l l lymphomas detectioe Th . f homogenousno , clona genomeV EB l s indicated, extensiony b , cellular clonality. Southern blots prepared extractefroA mDN d from tissue biopsies for HLP hybridized to probes representing unique DNA from the left or righ t linea e genomendV th contrasn f EB I rso pattere . eth adjacenTR o t t ne th o t t observed in NPC and lymphomas and B-cell lines, in HLP abundant ladder arrays representing either termini were detected without evidenc predominanf eo t fused fragments . (Fig1) .
ANALYSIS OF EBV GENE TRANSCRIPTION IN HLP
Northern blotting analysis of total RNA extracted from HLP biopsies showed abundant presence of late mRNAs encoding viral glycoproteins (BamHI L) as well as immediate-early (BamHI Z) and early replicative mRNAs (BamHI H).
ANALYSIS OF EBV TRANSCRIPTION BY IN SITU HYBRIDIZATION
In situ hybridization revealed expression of latent membrane protein (LMP) [a latent message expressed to greater levels during replication] throughout the layers of the epithelium, with particular strong expression in the cytoplasm of the koilocytoid cells in the upper epitheliulayere th f so m (Fig . Hybridizatio2) . n wit hsingle-strandea probA dRN e synthesized rightwar orientatiop ma dn i n fro BamHe mth revealeIZ d abundant hybridization in the nuclei of koilocytoid cells (Fig. 3). In contrast, 2 small Pol III transcripts, EBER 1 & 2, expressed to high levels in latent infections were not detected (Fig. 4).
116 FIG. 1.
FIG. 2. Figure captions on p. 119.
117 FIG. 4.
FIG. 3.
118 CONCLUSIONS
These results indicat predominantls ei thaP HL t lytiya c lesio f linguano buccad an l l epithelium, with numerous linear EBV virion particles detected on termini analysis. Northern blottin situn i d hybridizatiogan n confirm abundance sth f immediateo e early, early and late replicativ messagesV eEB almose Th . t complete absenc f EBEeo R expression i HLP, a predominantly replicative EB viral infection suggest that these RNAs are not essential for replication and are important in maintaining latency as well as can be considered a useful marker for latent EBV infection.
REFERENCES
[1] GREENSPAN, J.S., et al., Replication of Epstein-Barr virus within epithelial cells of oral "hairy" leukoplakia-an AIDS-associated lesion" . EnglN , . MedJ . 3 (1985.31 ) 1564-1571. [2] FRIEDMAN-KIEN, A.E., "Viral origin of hairy leukoplakia", Lancet 2 (1986) 694-695. [3] ARRAND, J.R., RYMO, L., "Characterization of the major Epstein-Barr specific RNAs in Burkitt lymphoma-derived cells", J. Virol. 41 (1982) 376-389. ] [4 GILLIGAN t al.e , , "Epstein-Barr virus small nuclea t rexpresse no RNA e ar s n i d permissively infected cell AIDS-associaten si d leukoplakia", Proc. Natl Acad. Sci.7 8 , (1990)8790-8794. [5] RAAB-TRAUB, N., FLYNN, K., "The structure of the termini of the Epstein-Barr Virus a markesa f clonao r l cellular proliferation", Cell (19867 4 . ) 883-889.
FIGURES
FIG. 1. EBV termini in HLP. Duplicate blots of DNA extracts from 5 HLP lesions were digested with
BamHI and hybridized to SP6 generated RNA probes representing the EcoRII portion of the BamHI fragmentKb 1.9 NJhet,representingXho the adjacent(lanes leftand TRs the L) uniqueto DNA adjacent to the right TRs (lanes R).
situFIG.In 2. hybridization with probe LMP,to ant/sense orientation (400x). Abundant grainsare seen in the superficial layers, layer of koilocytoid cells and the filiform papillae of the HLP lesion.
FIG. 3. In situ hybridization with riboprobe to BamHI Z, antisense orientation (1000x). Positive hybridization signals over the nuclei of koilocytoid cells is evident.
FIG. 4. In situ hybridization with riboprobe to EBER1, antisense orientation (1 OOOxl. Lack of hybridization signal, showing absence EBERsof HLP.in
Next page(s9 1 )\ left blank LIST OF PARTICIPANTS
Regional Training Cours Application eo f Recenno t Nuclear Techniques in the Diagnosis of Communicable Diseases Bangkok, Thailand September-1 2 9 October 1992
BANGLADESH
Afroz, Shahana Institute of Nuclear Medicine, Bangladesh Atomic Energy Commission, 158x P.OBo . , Ramna, Dhaka
CHINA
Liang. G , Institut f Radiatioeo n Medicine, CAMS, Tianjin, P.O. Box 71, 300192, Tianjing
Mou, Yanglong Shanghai Second Medical University, Sout0 28 h Chongqing Road, 200025 Shanghai
INDIA
Damle, A.A. Radiation Medicine Centre (BARC), c/o T.M.C., Annexe Building, Jerbai Wadia Road, Parel, Bomba2 01 0 y40
INDONESIA
Widyaharsana, J.K. Departmen f Clinicao t l Pathology, Medical Faculty, University of Indonesia, Jl. Bukit Hijau 2 No. 12, Jakarta 12310
MALAYSIA
Gill, Harvindar Kaur Immunology Division, Institute for Medical Research Jalan Pahang, 50588 Kuala Lumpur
Saat, Zainah Division of Virology, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur
Yap, S.F. Departmen f Pathologyo t , Facult f Medicineyo , (Lecturer) University of Malaya, 59100 Kuala Lumpur
MONGOLIA
Yondonsambuu, B. Central Infectious Hospital, Ulaanbaatar
PAKISTAN
Bashir, T. Institute of Nuclear Medicine and Oncology (INMOL), . 10068No GPx O,Bo Wahdat Road, Lahore
121 PHILIPPINES
Cruz, A.M. Santo Tomas University Hospital, 1118 Craig Street, Sampaloc, Manila
Natera, E.S. Philippine Nuclear Research Institute, Commonwealth Avenue, P.O 213x .Bo , Diliman 213, Diliman 3004, Quezon City
I LANKSR A
Nagendran, K. Institut f Fundamentaeo l Studies, Hantana Road, Kandy
Perera, A.J. Department of Microbiology, Facult f Medicine,Universityo f Colomboyo , , P.O27 x .Bo Colombo
THAILAND
Areekul, Suvit Faculty of Medicine, Mahidol University, (Lecturer) 420/6 Rajvithi Road, Bangkok 10400
Chitpatima, S.T. Molecular Biology Laboratory, (Lecturer) Pramongkutklao College of Medicine, 315, Rajvithee Road, Bangkok 10400
Echeverria. P , Bacteriology, Immunolog Moleculad yan r Genetics, (Lecturer) Armed Forces Research Institut f Medicaeo l Sciences, Bangkok 10400
Khusmith, S. Departmen f Microbiologo t Immunologyd yan , (Lecturer) Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Packsanont, S. Department of Tropical Radioisotopes, Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bankgok 10400
Panyim, Sakol Centr r Moleculaefo r Genetics, Mahidol University, (Lecturer) 420/6 Rajvithi Road, Bangkok 10400
Patarapotikul. J , Facult f Medicineyo , Mahidol University, (Lecturer) 420/6 Rajvithi Road, Bangkok 10400
Tharavanij, S. Departmen f Microbiologyo t , Facult f Tropicayo l Medicine, (Lecturer) Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Wanitjiewaphan, K. Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002
122 UNITED STATE AMERICF SO A
Yorw kNe University MedicaZavalal Centre . F , , (Lecturer) Schoo f Medicineo l Firs0 55 ,t Avenue, New York 10016
VIEM TNA
Tran, C.V. Occupational Healt Communicabld han e Diseases Certe, 59 Ly Thuong Kiet, Hanoi
INTERNATIONAL ATOMIC ENERGY AGENCY
Castelino, J.B. Divisio f Humano n Health, (Lecturer) International Atomic Energy Agency, 100x P.OBo ,. A-1400 Vienna
123 Seminar for Asia and the Pacific on Immunoassay Methods and Labelle Probe A Diagnosie dDN th n si f Communicablso e Diseases Bangkok, Thailand 23-27 November 1992
AUSTRALIA
Upcroft. P , Tropical Health Programme, The Bancroft Centre Universite Th , f Queenslandyo , 300 Herston Road, Brisbane
BANGLADESH
Abu Md. Ishaque Nuclear Medicine Centre, Bangladesh Atomicm Energy Commission, , Ramna158 , Dhaka
CANADA
Kain, K. Tropical Diseases Unit, Toronto Hospital, Elizabet0 20 h St., Toronto,4 OntariC G oM5
CHINA
Rong, Yongqi Departmen f Parasitologyo t , Suzhou Medical College, Suzhou 215007
Chert, Shi Shu Departmen f Biochemistryo t , Laboratory Molecular Biology, Shanghai Second Medical University, 280 Chongqin Road , Shanghai 200025
Van, Huiping Beijing You An Hospital, 8 Xitoutiao, Youanmen Wai, Beijing 100054
INDIA
Hazra, O.K. Nuclear Medicine and Radioimmunoassay, S.N. Medical College and Hospital, Agra
Kadival, G.V. Radiation Medicine Centre, Bhabha Atomic Research Centre, c/o Tata Memorail Hospital Annexe, Jerbai Wadia Road, Parel, Bombay 400 012
Kumar. R , Departmen f Microbiologyo t , l IndiAl a Institut f Medicaeo l Sciences, Ansari, Nagar, New Delhi 110029
Nath, I. Departmen f Biotechnologyo t , All India Institute of Medical Sciences, Ansar9 i Najar 02 Delh w 0 Ne ,11 i
124 INDIA (cont.)
Seth, P. Department of Microbiology, l IndiAl a Institut f Medicaeo l Sciences, Ansari Nagar, New Delhi 110 029
INDONESIA
Amiruddin, M.D. Department of Dermato-Venereology, Medical Faculty, Hasanuddin University, Kampus Tamalanrea (90245), Ujung Pandang, South Sulawesi
Sudarmono. P , Department of Microbiology, Medical Faculty, Universit f Indonesiayo . PegangsaaJl , n Timu, 16 r Jakarta 10320
JAPAN
Abe, C. Research Institute of Tuberculosis Anti-Tuberculosis Association, Matsuyama 3-1-24, Liyose-shi, Tokyo 204
Shibaro, T. Research Institute of Tuberculosis, (Observer) Anti-Tuberculosis Association, Matsuyama 3-1-24, Liyose-shi
Shimojima. H , Department of Biochemistry, Nippon Veterinary and Animal, Science University, 1-7-1, Kyonan-cho, Mushashino-shi, Toky0 o10
KOREA, Rep. of
Cho Sang-Nae Department of Microbiology, Yonsei University, College of Medicine, C.P.O. Box 8044, Seoul 120-752
MALAYSIA
Balasubramaniam. ,V Division of Virology, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur
Cardosa. N , University Sains Malaysia, Penang
Looi, Lai Meng Departmen f Pathologyo t , Facult f Medicineyo , Universit f Malayayo , 59100 Kuala Lumpur
Rajadurai. P , Departmen f Pathologyo t , Facult f Medicineyo , University of Malaya, 59100 Kuala Lumpur
Yap, S.-F. Department of Pathology, Faculty of Medicine, Universit f Malayayo , 59100 Kuala Lumpur
125 NETHERLANDS
Kolk. A , Department of Tropical Hygiene, N.H. Swellengrebel, Laboratory of Tropical Hygiene, 39 Meibergdreef, NL-1105 AZ Amsterdam
NORWAY
Krefting, C.E. Myrabakken 1 2, N-6400 Molde (Observer)
PHILIPPINES
Dizon, F.C. Research Institute for Tropical Medicine, Alabang, Muntinlupa, Metro Manila
SINGAPORE
Elias, E.W. Nuclear Medicine Department, Singapore General Hospital, Outram Road, Singapore 0316
Kumarasinghe. G , Microbiology Division, Department of Laboratory Medicine, National University Hospital, Singapore
SRI LANKA
De Zoysa, N.S. Central Blood Bank, National Blood Transfusion Service, General Hospital, Colombo
Perera, A.J. Departmen f Microbiologyo t , Facult f Medicineyo , P.O.Box 271, Colombo
THAILAND
Anantavara, S. Faculty of Science, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Areekul, S. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Asavanich. A , Department of Medical Entomology, Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Chantachum, Y. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Chantarachada, S. Pramongkutklao Colleg f Medicineeo , 315 Rajvithi Road, Bangkok 10400
Chanyasanha. C , Faculty of Public Health, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
126 THAILAND (cont.)
Charoenlarp. P , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Cheeramaka, C. Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Chintana, T. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Chitpatima. S , Molecular Biology Laboratory, Department of Biochemistry, Pramongkutklao Colleg f Medicineeo , 315 Rajvithi Road, Bangkok 10400
Chittasobhon. N , Facult f Medicineyo , Chiangmai University, P.O.Box 80 CMU, Chiang Mai 50002
ChuChotthavorn, D. Department of Tuberculosis Control, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Churdchu. K , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Deekamyoi, P. Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Desakorn, V. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Dhamsri. P , Pramongkutklao Colleg f Medicineeo , 315 Rajvithi Road, Bangkok 10400
Hemachudha, T. Red Cross at the Queen Saovabha Memorial Institute, 1871 Rama IVth Road, Bangkok
Hrimpeng. K , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Impand, P. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Janecharut, T. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Jayanetra. P , Divisio f Clinicano l Microbiology, Departmen f Pathologyo t , Faculty of Medicine, Ramathibodi Hospital, Ram Roada6 , Bangkok 10400
Kalumbaheti. T , Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
127 THAILAND (cont.)
Kampirapap. K , Communicable Disease Control, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Kasemsuth. R , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Khusmith, S. Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Kiatfuengfoo, R. Faculty of Medical Technology, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Kitikoon V. Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Klongkamnuankarn, K. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Kongcharoensuntorn. W , Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Kullaprawithaya. U , Offic f Atomieo c Energ r Peaceyfo , Vibhavadee Rangsit Road, Chatuchak, Bangkok 10900
Kunakorn. M , Faculty of Medicine, Ramathibodi Hospital, Ram Roada6 , Bangkok 10400
Leemongsawat. S , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Luksamijarulkul, P. Faculty of Public Health, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
Migasena. P , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Naigowit. P , Department of Medical Sciences, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Naigowit. P , Immunology Section, Division of Clinical Pathology, National Institut f Healtheo , Tivanon Road, Nonthaburi 11000
Ngamying. M , Communicable Disease Control, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Nitatpatana, K. Faculty of Public Health, Mahidol University, 420/6 Rajvithi Road, Bangkok 10400
128 THAILAND (cont.)
Nivat, M. Laboratoire Servier, 1 Silom Road, Bangkok 10500
Noonai, A. Pramongkutklao College of Medicine, Rajvith5 31 i Road, Bangkok 10400
Packsanont, S. Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Pholpota. T , Faculty of Tropical Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Pirantanapak. A , Burapha University, Bang-San, Chonburi 2000
Prasertsiriro], V. Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Pungpak. S , Facult f Tropicayo l Medicine, Mahidol University, 420/6 Rajvithi Road, Bangkok 104000
Ratchtrachenchai, O. Departmen f Medicao t l Sciences, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Reinprayoon, S. Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Rienthong, D. Department of Tuberculosis Control, Ministry of Public Health, Devavesm Palace, Bangkok 10200
Rikanti. M , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Sabchareon. A , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Saiyudthong. S , Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Samrajrongr, P. Pramongkutklao Colleg f Medicineeo , Rajvith5 31 i Road, Bangkok 10400
Sanghirum, C. Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Sippisonbut, N. Departmen f Microbiologyo t , Chiangmai University, P.O.Bo CMU0 x8 , Chian i 5000gMa 2
Sucharit, S. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
129 THAILAND (cont.)
Sukontpradit. W , Offic f Atomieo c Energ r Peaceyfo , Vibhavadee Rangsit Road, Chatuchak, Bangkok 10900 Supanaranond. W , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Supavej, S. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Sura, T. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Suthienkul. O , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Tantichanich, S. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Tapchaisri. P , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Thammapalerd. N , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Thanomsak. W , Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Tharavanij, S. Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Thawaranantha, D. Departmen f Medicao t l Sciences, Ministr f Publiyo c Health, Devavesm Palace, Bangkok 10200
Thongrungkiat. S , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Tumwasorn, S. Departmen f Microbiologyo t , Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Usawattanakul. W , Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Vanijanonta. S , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Vasuvat, C. Facult f Medicineyo , Chulalongkorn University, Bangkok 10330
Vilasdechanon, N. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Visawapoka. A , Pramongkutklao College of Medicine, Rajvith5 31 i Road, Bangkok 10400
130 THAILAND (cont.)
Vongsthongsri. U , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Vutikes, S. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Waikagul, J. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Wilairatana, P. Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Wiwat. C , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Wonglumsom. ,W Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Wongsriraksa, A. Departmen f Medicao t l Sciences, Ministry of Public Health, Devavesm Palace, Bangkok 10200
Wuthi-Udomlert. M , Faculty of Medicine, Chulalongkorn University, Bangkok 10330
Yamarat. P , Faculty of Medicine, Chulalongkorn University Bangkok 10330
UNITED ARAB EMIRATES
Baiyoumi, R. Departmen f Biochemistryo t , Facult f Medicineyo , U.A.E. University, P.O.Box 17666, EI-Ain
UNITED KINGDOM
Braun. G , Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge, CB 1QP
UNITED STATES OF AMERICA
Krogstad, D.J. Departmen f Tropicao t l Medicine, Schoo f Publio l c Healt Tropicad han l Medicine, Tulane University, Medical Center, 1501 Canal Street, 5th floor, New Orleans, LA 70112-2824
INTERNATIONAL ATOMIC ENERGY AGENCY
Castelino, J.B. Divisio f Humano n Health, (Scientific Secretary) International Atomic Energy Agency, Wagramerstrasse 5, P.O. Box 100, A-1400 Vienna, Austria
131