Lh14e's Effects Are Mediated Through P21 and Related

Home , Retinoblastoma protein

LH14E’S EFFECTS ARE MEDIATED THROUGH P21 AND RELATED PROTEINS ______

A Thesis

Presented to the

Faculty of

California State University, Fullerton ______

In Partial Fulfillment

of the Requirements for the Degree

Master of Science

Biology ______

Sarah Daoudi

Thesis Committee Approval:

Nilay V. Patel, Department of Biological Science, Chair Merri-Lynn Casem, Department of Biological Science Catherine Brennan, Department of Biological Science

Summer, 2018

ABSTRACT

A small library of compounds synthesized at California State University,

Fullerton, were screened for their anti-proliferative activity in three human cell lines:

HeLa, HUTU80, and MG63. CyQUANT cell proliferation assay also showed some cell line specificity of best performing compounds. This project focuses on identification of the effects of the compound, LH14E, on p21, a cell cycle regulatory protein. Expression of CDKN1A (p21 gene) is regulated by p53 and KLF6, both of which attenuate cell proliferation. Our results show that LH14E increases expression of CDKN1A and the amount of p21 protein. Luciferase reporter gene assay revealed an increase in the transcriptional activity of the p21 promoter upon treatment with LH14E. Western Blot reveals p53 protein levels are not affected by treatment with LH14E, but KLF6 protein increases upon treatment with LH14E. These results suggest that LH14E activates KLF6 expression, and subsequently increases p21 expression, which together may cause cell cycle arrest. These analyses will help identify mechanism of action for the hit compounds in this library of compounds.

TABLE OF CONTENTS

ABSTRACT ...... ii

LIST OF TABLES ...... v

LIST OF FIGURES ...... vi

ACKNOWLEDGMENTS ...... vii

Chapter 1. INTRODUCTION ...... 1

The Cell Cycle ...... 1 The Role of p21 in the Cell Cycle ...... 3 The Role of p53 in the Cell Cycle ...... 4 Downstream Targets of p53 ...... 5 The Interactions Between p21 and p53 ...... 9 Role of KLF6 in Cell Cycle ...... 9 The Compounds and Cancer ...... 10 Niclosamide as a Control ...... 11 Camptothecin as a Control ...... 12 Research Design and Project Aim ...... 13

2. METHODS ...... 14

Cell Culture and Drug Treatment ...... 14 Compounds ...... 15 CyQUANT Cell Proliferation Assay ...... 17 MitoTracker Staining ...... 17 Immunocytochemistry ...... 17 RIPA Protein Isolation and BCA Protein Assay ...... 18 Western Blot ...... 18 NEON Transfection ...... 21 Luciferase Reporter Assay ...... 21 RNA Isolation and cDNA Synthesis ...... 22 Quantitative Polymerase Chain Reaction (qPCR) and Primer Design ...... 22

iii 3. RESULTS ...... 24

Effects Under Investigation ...... 24 Effect on Cellular Proliferation...... 25 Effects on Mitochondrial Membrane ...... 25 Effect on Chromatin Condensation and Mitotic Phase of the Cell Cycle ...... 26 qPCR Analysis of Effects on p53 Target Gene Expression...... 30 qPCR Analysis of Effects on p21 Related Gene Expression ...... 34 Effect on CDKN1A Transcription ...... 36 Effect on p53 Transcription Activity ...... 38 Effects on Protein Levels using Western Blot Analysis ...... 40 Effect on Protein Localization ...... 44

4. DISCUSSION ...... 46

The Cell Cycle and LH14E ...... 46 LH14E Reduces Cell Proliferation through Interactions with the Cell Cycle ...... 46 Comparison of LH1E with Niclosamide and Camptothecin ...... 51 Proposed Mechanism of LH14E ...... 51 Drug Discovery and LH14E ...... 53

APPENDICES ...... 54

A. SUPPLEMENTARY CYQUANT FIGURE ...... 54 B. SUPPLEMENTARY CYQUANT ASSAY DATA TABLES ...... 55

REFERENCES ...... 63

LIST OF TABLES

Table Page

1. Compounds Used ...... 18

2. Antibodies Used ...... 20

3. qPCR Primers Used ...... 23

4. Summary of Results ...... 50

LIST OF FIGURES

Figure Page

1. p21 inhibition in varying phases of the cell cycle ...... 6

2. Activation of p53 under stress conditions ...... 8

3. Chemical structure of Niclosamide ...... 12

4. Compounds decrease cell proliferation ...... 27

5. LH14E reduces mitochondrial activity in HUTU80 cells but not HeLa and MG63 cells ...... 28

6. Niclosamide and JF19 reduce phosphor-H3 pSer10 levels relative to DMSO ... 29

7. mRNA expression is impacted for cell-cycle related genes ...... 33

8. mRNA expression is impacted for p21 related genes ...... 35

9. LH14E and Niclosamide increase transcription activity of CDKN1A after treatment ...... 37

10. LH14E increase transcription activity of p53 after treatment ...... 39

11. p21 protein levels upon treatment with compounds and Niclosamide ...... 41

12. p53 protein levels upon treatment with compounds and Niclosamide ...... 42

13. KLF6 protein levels upon treatment with compounds and Niclosamide ...... 43

14. Camptothecin, LH14E, Niclosamide, JF19, MEY26, KN19 and AV9 increase p21 levels relative to DMSO ...... 45

15. Proposed mechanism of LH14E ...... 52

ACKNOWLEDGMENTS

I would like to especially acknowledge my thesis adviser, Dr. Nilay Patel, for his guidance and patience as well as my other committee members Dr. Casem and Dr.

Brennan. I would like to extend my gratitude to Jocelyn Leon, Gustavo Chacon, Lauren

Adkins, and Stephanie Youn for their aid with data collection. In addition, I would like to thank the Patel lab for their support and optimism over the course of this project, especially Chiaokai Wen, Nhi Ha, and Logan Kasper. Lastly, this would not have been possible without the support and encouragement of my mother and brother. Many thanks to all these individuals for their support and guidance.

vii 1

CHAPTER 1

INTRODUCTION

A successful anti-cancer agent should induce cell cycle arrest in cancerous cells and have potential as a therapeutic. This study explores a series of compounds that have been developed as anti-proliferative agents by the de Lijser lab at California State

University, Fullerton. Preliminary results show that some of these compounds inhibited cell proliferation comparable to leading therapeutic agents. Some of these compounds may also have cell type-specific effects. Our findings indicate that a specific compound known as LH14E affects the cell cycle. This study investigates the role of p21 after treatment with LH14E and the other compounds. Treating cancer cells with the compounds may block cell proliferation through activation of p53, or KLF6, inducing the activation of p21 and resulting in cell cycle arrest. The goal of this thesis is to determine whether proteins p21, p53 and KLF6 contribute to these anti-proliferative effects.

The Cell Cycle

The cell cycle is a series of steps that gives rise to two daughter cells. The cycle includes the cell growth, maintenance, DNA replication, confirmation of genomic stability and mitosis. Regulators of the cell cycle include cycle dependent serine/threonine kinases (CDKs), CDK inhibitors, cyclins, and tumor suppressor genes

(Heuvel & Harlow, 1993). Various combinations of cyclins and CDKs bind to form kinase complexes that activate at distinct points in the cell cycle through phosphorylation

2 of proteins, which allow for progression to the next stage of the cell cycle (Albrecht,

Meyer, & Hu, 1997).

CDKs such as CDK2, CDK4, and CDK6 activate during the cell cycle upon exposure to growth stimuli. When growth factors induce entry into the G1 phase, the synthesis of cyclin D-CDK4/6 is promoted (Gerard & Goldbeter, 2009). When cyclin D-

CDK4/6 complex forms, the transcription factor, E2F, evokes the synthesis of cyclin E-

CDK2 and cyclin A-CDK2 (Gérard & Goldbeter, 2012). Cyclin D-CDK4/6 and cyclin E-

CDK2 control progression in the G1 and the G1/S transition through phosphorylation and inhibition of the retinoblastoma protein (pRB) (Karimian, Ahmadi, & Yousefi, 2016;

Weinberg, 1999); pRB is a nuclear phosphoprotein and tumor suppressor that plays a role in the regulation of cell growth and differentiation (Weinberg, 1999).

Synthesis of cyclin A-CDK2 allows for progression in S and G2 (Gerard &

Goldbeter, 2009). During G2, cyclin A-CDK2 will activate the synthesis of cyclin B-

CDK1, permitting cyclin B-CDK1 to enter the G2/M transition (Gérard & Goldbeter,

2012). During mitosis, the protein Cdc20 will phosphorylate cyclin B-CDK1 (Gerard &

Goldbeter, 2009). This creates a negative feedback loop in the activity of cyclin A-CDK2 and cyclin B-CDK1 through the promotion of degrading of the complexes (Gerard &

Goldbeter, 2009). Cdc20 allows the cells to complete mitosis, however, when Cdc20 is activated, cyclin A and B will be degraded (Gérard, Gonze, & Goldbeter, 2012). Another protein, Cdh1, is inhibited by cyclin A-CDK2, which degrades cyclin B (Gérard &

Goldbeter, 2012). The interactions and degradation mechanisms of cyclins A and B create a negative feedback loop in the cell cycle (Gerard & Goldbeter, 2009). Thus, proteins that regulate activity of cyclin-CDK complexes, can also regulate cell cycle.

The Role of p21 in the Cell Cycle

p21Waf1/Cip1/Sdi1 is a cyclin-dependent kinase inhibitor that can inhibit certain cyclin/CDK complexes (Besson, Dowdy, & Roberts, 2008). The p21 protein is encoded by the CDKN1A gene, located on chromosome 6 (6p21.2) in humans (El-Deiry et al.,

1993). p53 activity targets p21 protein and is linked to DNA damage and cell cycle arrest

(Karimian et al., 2016). p21 is a negative regulator that maintains cells in multiple phases of the cycle under conditions of stress (Li et al., 1994).

The primary mode by which p21 inhibits cell cycle is through its interactions with

PCNA and CDKs. PCNA (proliferating cell nuclear antigen) is a DNA polymerase accessory factor. It forms a ring-shaped trimeric complex, also referred to as a “clamp”, around DNA polymerase (polδ) and replication factor C during DNA replication (Abbas

& Dutta, 2009; Ando et al., 2001; Karimian et al., 2016). The carboxyl-terminal of p21 can bind to PCNA and inhibit DNA synthesis in the S phase of the cell cycle (Abbas &

Dutta, 2009) (Chen et al., 1995).

The amino-terminal of the p21 protein binds to CDK-cyclin complexes and inhibits their phosphorylation (Abbas & Dutta, 2009; Besson et al., 2008; Bonelli,

Tuccillo, Borrelli, Schiattarella, & Buonaguro, 2014; Harper et al., 1995). p21 inhibits

CDK activity indirectly by interfering with the activating phosphorylation of CDK1 and

CDK2 by an unidentified mechanism (Abbas & Dutta, 2009; Abbas, Jha, Sherman, &

Dutta, 2007). p21 binds the cyclin subunit through a conserved Cy1 motif in the N- terminal half and through Cy2 motif in the C-terminal (Chen, Saha, Kornbluth, Dynlacht,

& Dutta, 1996; Mandal, Bandyopadhyay, Goepfert, & Kumar, 1998). p21 interacts with the CDK subunit through a separate CDK-binding site in the N-terminal half (Chen et al.,

1996). Through its Cy motifs, p21 disrupts the interaction between CDK and substrates that bind to CDK.

Some of p21’s effects may be partially mediated through RB. RB is inactivated in proliferating cells through phosphorylation by CDK2 and CDK4/6. Since both CDK2 and

CDK4/6 are inhibited by p21, RB is not phosphorylated and maintained in its active state, which would induce cell cycle arrest in G1 phase (Broude et al., 2007).

The Role of p53 in the Cell Cycle

One of the most researched proteins in the cell cycle is p53. p53 is a multifunctional protein that acts as a transcription factor for certain cell cycle genes

(O’Connor, 2014). p53 controls DNA repair, growth arrest, and apoptosis (T. Li et al.,

2012; Weinberg, 1999). In normal conditions, inactive p53 is localized in the cytoplasm and enters the nucleus during the G1/S transition in cells. In response to DNA damage, p53 accumulates in the nucleus (Wang et al., 2013). p53 is maintained at low protein levels during homeostasis. p53 is regulated by Mdm2 through the ubiquitin-proteasome pathway, where Mdm2 represses p53 protein levels through ubiquitination and degradation (Levine & Oren, 2009). p53 phosphorylation on multiple serine/threonine residues increases the transcriptional activity of p53 by enhancing p53 stability (Karimian et al., 2016). In stressful conditions or DNA damage, the C-terminal of p53 is phosphorylated by ATM and acetylated by p300. p53 will bind to the DNA and temporarily halt the cell cycle. Active p53 will induce cell cycle arrest to repair the DNA through various processes including expression of CDKN1A (p21) gene and apoptosis through BAX. P53 also inhibits expression of certain gene, but interestingly these effects are mediated by p21; i.e., without p21, p53 can only activate gene expression and not

5 inhibit expression of its target genes (Löhr, Möritz, Contente, & Dobbelstein, 2003).

Once DNA damage has been repaired, p53 is inactivated by deacetylation activity and normal regulation resumes. Mdm2 will bind to and block the N-terminal trans-activation domain of p53, limiting p53’s growth-suppressive function (Levine & Oren, 2009).

Many cancer cells have mutations in both p53 alleles (O’Connor, 2014). In some cases, the mutations block p53’s ability to bind to DNA and promote repair of the damaged regions. While other p53 mutations cannot attenuate cell cycle even when DNA damage is present because the mutated p53 does not receive signals of DNA damage. As a result of these mutations, p53 is not able to undergo phosphorylation or acetylation and cannot be regulated by Mdm2, resulting in the continuation of cell cycle (Levine & Oren,

2009).

Downstream Targets of p53

BAX is an apoptosis regulator and a member of the Bcl-2 family (Gil-Gómez,

Berns, & Brady, 1998; Wei et al., 2006). The expression of BAX has been shown to be regulated by p53 and is involved in p53-mediated apoptosis (Chipuk et al., 2004). When activated BAX inserts into the outer membrane of the mitochondria, permeabilizes the mitochondria, and leads to loss of mitochondrial membrane potential (Lalier et al., 2007).

Cyclin D G1 p21 CDK4/6

B Cyclin E

p21 CDK2

G1/S

Cyclin A

p21 CDK 1/2

C Cyclin B1 G2/M p21 CDK 1

Figure 1. p21 inhibition in varying phases of the cell cycle. (A) p21 inhibits the kinase activity of CDK4 or CDK6 in complex with cyclin D, inhibiting progression through G1 (B) p21 inhibits CDK2–cyclin E, with inhibition of CDK2. p21 also inhibits the kinase activity of CDK2–cyclin A and CDK1–cyclin A, progression through S phase and into G2 respectively. (C) p21 inhibits the kinase activity of CDK1–cyclin B1, thus inhibiting progression through G2 and G2/M. Figure is adapted from Abbas, T., & Dutta, A. (2009).

In the cell cycle, cyclin-dependent kinase proteins are regulated by cyclins and

CDK inhibitors (Bonelli et al., 2014; Heuvel & Harlow, 1993). Cyclin-G2 is transcriptionally regulated by p53 and increased expression of cyclin-G2 occurs when

DNA damage is present, specifically in the S phase of the cell cycle (Naito et al., 2013;

Wei et al., 2006). Cyclin-G2 belongs to the family of cyclins homologous to CCNG1 and regulates the cell cycle as a tumor suppressor gene, unlike other cyclins (Shinichiro

Hasegawa et al., 2015). Decreased expression of cyclin-G2 has been associated with malignant phenotypes in different cancers (S. Hasegawa et al., 2014; Kasukabe, Okabe-

Kado, & Honma, 2008; Naito et al., 2013).

The only other known cyclin that is regulated by p53 is cyclin B1, which is a regulatory protein in mitosis (Pfaff & King, 2013). The activity of cyclin B1 is regulated by its synthesis, mainly at a transcription level (Brandeis & Hunt, 1996). During mitosis,

Cyclin B1 is associated with centrosomes, mitotic spindles, and chromosomes (Pfaff &

King, 2013). Activation of p53 reduces cyclin B1 mRNA expression, but this appears to be an indirect mechanism as the promoter region for cyclin B1 does not have a consensus sequence for p53 (Krause et al., 2000). How p53 regulates cyclin B1 remains to be determined.

MDM2

ATM p300

Ser15 p

p53 SIRT1 Lys 370-373, 381, a d 382 K382

p21 BAX 14-3-3α PUMA

GADD45 NOXA

Cell Cycle Arrest Apoptosis

Figure 2. The activation of p53 under stress conditions. When DNA damage occurs or in stressful conditions, p53 is activated by phosphorylation by ATM at Ser15 and p300 at different Lys sites. Depending on the severity of condition, p53 activates will activate different cell cycle arrest related proteins or induce apoptosis.

The Interaction Between p21 and p53

p53 is the primary transcriptional regulator p21. p21 contains two conserved p53 responsive elements (p53RE) in its promoter (Karimian et al., 2016). Different stresses such as DNA damage or oxidative stress upregulate p53, resulting in p21 expression

(Jung, Qian, & Chen, 2010). Cellular stress signals activate Pin1 (peptidylprolyl cis/trans isomerase, NIMA-interacting 1), which modifies serine and threonine residues on p53, and p53’s structure and activity. Pin1 also indirectly promotes phosphorylation of p53 at

Ser33 and Ser46, which increases the transcriptional activity of p53 towards its target genes, such as p21 (Yousefi, Rahmati, & Ahmadi, 2014). These alterations in p53 structure also promote HIPK2 (homeodomain-interacting protein kinase-2)-mediated phosphorylation of p53, and reactivation of p53 and induction of tumor cell apoptosis through Pin1-p53 mediated mitochondria-dependent and transcription-independent apoptosis (G Sorrentino, M Mioni, C Giorgi, N Ruggeri, P Pinton, U Moll, F Mantovani

& G Del Sal. Cell Death and Differentiation 20: 198–208 (2013)) (Yousefi et al., 2014).

Role of KLF6 in Cell Cycle

A key mediator of the WNT/β-catenin pathway is glycogen synthesis kinase 3

(GSK3). GSK3 is known for the maintenance and degradation of β-catenin by affecting phosphorylation sites (Clevers, 2006). GSK3 is also involved in several other pathways

(Meijer et al. 2013 review). GSK3 has been shown to phosphorylate KLF6 protein at amino acids 143, 147, 151, 155, leading to the accumulation of KLF6 protein and KLF6- mediated growth suppression through p21 (Lang et al., 2013).

An alternative pathway exists that can increase p21 protein levels independent of p53. Krüppel-like transcription factors (Klf) are key transcriptional regulators of

10 proliferation and differentiation (Abbas & Dutta, 2009). These Klf factors have been shown to regulate CDKN1A transcription (Black, Black, & Azizkhan-Clifford, 2001).

The KLF transcription factors bind to GC boxes and upregulate or downregulate target genes. Specifically, KLF6 is inactivated in human tumors (Narla et al., 2001). When activated, KLF6 binds to two GC boxes located upstream of CDKN1A and cooperates with p300-CREBBP to initiate CDKN1A transcription (D. Li et al., 2005). The KLF6 protein can also dissociate cyclin D1-CDK2 complex, and allow the inhibitory interaction between CDK2 and p21 (Benzeno 2004). The cyclin D1-CDK4 complex would be inhibited by p21 and prevent the interaction with CDK4. As a result, pRB phosphorylation at Ser79 would decrease, (Lang et al., 2013). KLF6 can also interact with c-Jun proto-oncogene and block cell proliferation (Slavin et al., 2004). Thus, LH14E may be activating p21 mRNA expression through KLF6, and together KLF6 and p21 could lead to cell cycle arrest.

The Compounds and Cancer

The cell cycle is involved in the regulation and proliferation of mammalian cells.

In cancer, continued proliferation of cancer cells due to the mutation of cell-cycle related genes, leads to dysregulation of the cell cycle. Identifying key regulatory steps in the cell cycle that could be blocked my small molecules can facilitate development of anti-cancer treatment. Cell-cycle related genes, CDKN1A and GADD45A, induce cell cycle arrest

(Bonelli et al., 2014; Claassen & Hann, 2000). Other genes such as the proto-oncogene, c-myc, has been implicated in activating the cyclin D and CDK4 complex (Mateyak,

Obaya, & Sedivy, 1999). c-myc increases CDK4 mRNA levels by binding to the CDK4 promoter (Hermeking et al., 2000). Studies have found elevated levels of p21 are

11 associated with decreased cancer cell proliferation (Han et al., 2002). Previous studies and preliminary results have found changes in gene expression of c-myc and CDKN1A after treatment with the compounds, especially the compound LH14E (Adkins, 2017).

Knowing that the compounds activate the transcriptional activity of p21 and c-myc regulates CDK4, is important in providing insight to the attenuation of proliferation by these compounds. In theory when these compounds are added they activate regulatory cell cycle genes and proteins, and as a result, decrease cell proliferation.

Niclosamide as a Control

Niclosamide was initially discovered as a treatment against tapeworm infestations

(Imperi et al., 2013). According to the World Health Organization, it is one of the most effective and safe medicines (Pearsons et al., 1985; Li et al., 2014; World Health

Organization, 2015). Recently research on this compound has shifted to cancer treatment

(Imperi et al., 2013; Ye et al., 2014; Yo et al., 2012). The mechanism of this compound for cancer treatment has been shown to be involved with the Wnt/β-catenin, mTORC1,

STAT3, NF-κB, and Notch signaling pathways (Imperi et al., 2013; Y. Li et al., 2014).

Due to a lack of research when niclosamide was first synthesized, key mechanisms of the compound are not fully understood. Niclosamide may provide insight into the mechanism of LH14E, a lead compound synthesized by the de Lijser lab, and is used as a control in this study. Both LH14E and Niclosamide have similarities in their chemical structure and cellular effects upon treatment of the compounds. Niclosamide is a mitochondria uncoupler and reduces ATP levels and mitochondrial membrane potential in cells (Y. Li et al., 2014; Park, Shin, Kang, Hwang, & Cho, 2011). LH14E may have similar impacts on reducing cell proliferation and mitochondrial activity in cancer cells. By studying

12 niclosamide alongside LH14E, niclosamide may reveal details of LH14E’s mechanism and the other compounds that are similar to LH14E.

Figure 3. Chemical structure of Niclosamide. The compounds used in this study have similar chemical structures to Niclosamide, including similar cellular effects upon treatment.

Camptothecin as a Control

In 1966, the compound Camptothecin (CPT) was discovered while screening for anti-cancer drugs (Wall et al., 1966; Sriram et al., 2005). The compound is an extract from the Chinese plant Camptotheca acuminata. CPT has shown significant antitumor activity to lung, ovarian, breast, pancreas and stomach cancers. The mechanism of the compound has been shown to inhibit the DNA topoisomerase I (topo I). CPT will bind to topo I and the DNA complex, resulting in the prevention of DNA re-ligating, causing

DNA damage, and induction of apoptosis (Pommier et al., 2003). Recently, CPT has been shown to induce apoptosis by activating the p53 and p21 pathway, resulting in high levels of p21 protein in cancer cells after treatment (Han et al., 2002). It was shown that low doses of CPT induce cell cycle arrest and high doses induce apoptosis (Morris & Geller,

1996). LH14E may have a similar impact as CPT by inducing cell cycle arrest through p53 and p21 activation. Since the mechanism of CPT has been discovered, studying CPT

13 alongside the compounds can provide insight into whether LH14E and related compounds are activating p21 through the same mechanism.

Research Design and Project Aim

The purpose of this study is to determine the mechanism of how this group of

Niclosamide-like compounds synthesized by the de Lijser lab, attenuate cell proliferation.

Whether p21 is affected pre- or post-translationally is studied. The effect on cell proliferation and mitochondrial membrane potential are studied. The data generated in this research can offer insight into compounds that attenuate cell proliferation compared to chemotherapy drugs, such as CPT and Niclosamide.

Results suggest the compounds significantly decrease cell proliferation rates and increase p21 levels at both mRNA and protein levels. This study is based on the hypothesis that LH14E and related compounds target the G1 phase of the cell cycle. The experiments designed in this study were used to show LH14E can inhibit key regulatory steps in the cell cycle and determine whether p21 is important for LH14E’s anti- proliferative effects.

CHAPTER 2

METHODS

HeLa cells were used to study the effect of these compounds on cell cycle associated genes and proteins, in addition to downstream cell cycle genes. HeLa,

HUTU80 and MG63 cells were used to study the effects of these compounds on cell proliferation rates, cell integrity, and mitochondrial activity in the cells. Cell proliferation levels were measured using a CyQUANT proliferation assay. Mitochondrial activity was determined using MitoTracker staining. To characterize the molecular mechanisms associated with the compounds, changes in gene expression among different treatments were monitored via quantitative polymerase chain reactions (qPCRs) and luciferase reporter assays. Protein levels from the pathways were monitored using immunocytochemistry (ICC) and Western blots.

Cell Culture and Drug Treatment

HUTU80, MG63, and HeLa cell lines (Invitrogen) were maintained in

MEM/EBSS and DMEM, respectively, and supplemented with 10% bovine growth serum (BGS, Hyclone), Glutamax, penicillin/streptomycin (100 units/mL penicillin, 100

µg/mL streptomycin), and non-essential amino acids (Life Technologies). Cell cultures were passaged once 80% confluency was reached. Cells were washed with 1X PBS

(phosphate-buffered saline), then incubated with 0.25% Trypsin/EDTA (Gibco) for three minutes at room temperature to detach cells from plate. Trypsin was quenched with HeLa

15 growth medium (1:1), then cells were spun down at 300xg for five minutes. The majority of trypsin was aspirated and cells were seeded at a confluency of 10%, and maintained in a humidiﬁed incubator at 37°C with 5% CO2.

Drug treatment was performed by plating 10,000 cells in each well of a 96-well plate, 50,000 for a 24-well, 100,000 for a 12-well, and 300,000 for a 6-well using a zEPI

Moxi Flow Cytometer (Orflo Technologies) to count cells. Cells were allowed to adhere for 24 hours. A 24-hour drug treatment was performed in Opti-MEM (Life

Technologies). The final concentration of the drug was 10 µM (0.01% DMSO).

Camptothecin and Niclosamide were used as a positive control for drug toxicity, while

0.01% DMSO was used as the vehicle control.

Compounds

Compounds were diluted using a 100 mM DMSO stock with a final concentration in OptiMEM of 10 µM. All compounds used in this study are listed in Table 1.

Table 1. Compounds Used

Compound Supplier and Catalog Number Treatment Concentration Camptothecin Fisher Scientific ICN15973280 1.0 µM Niclosamide Fisher Scientific NC0754158 0.3 µM Mitomycin C VWR GR311-0010 10 µM SB216763 Caymen Chemical Company 10010246 3.0 µM AMJ2 Dr. de Lijser Lab 10 µM AMJ3 Dr. de Lijser Labser Lab 10 µM AS47 Dr. de Lijser Lab 10 M AS67 Dr. de Lijser Lab 10 M AS76 Dr. de Lijser Lab 10 µM AV9 Dr. de Lijser Lab 10 µM LH14E Dr. de Lijser Lab 10 µM JF17 Dr. de Lijser Lab 10 M JF18 Dr. de Lijser Lab 10 M JF19 Dr. de Lijser Lab 10 µM KC26-1 Dr. de Lijser Lab 10 µM KN14 Dr. de Lijser Lab 10 µM KN19 Dr. de Lijser Lab 10 µM KN31 Dr. de Lijser Lab 10 µM KPB15 Dr. de Lijser Lab 10 µM MEY08 Dr. de Lijser Lab 10 µM MEY26 Dr. de Lijser Lab 10 µM SK14 Dr. de Lijser Lab 10 µM TK51 Dr. de Lijser Lab 10 µM TK75 Dr. de Lijser Lab 10 µM

CyQUANT Cell Proliferation Assay

To monitor effects on proliferation, 10,000 cells per well in a clear-flat bottom

96-well plate were plated and allowed to attach for 24 hours. Cells were treated for 24 hours with appropriate compounds in Opti-MEM. The CyQUANT Direct Cell

Proliferation 1 Kit (Life Technologies C35011) was performed. The fluorescent level in each well were detected by the Synergy 2 Multi-Mode Microplate Reader (excitation

485/emission: 528 nm) and analyzed with Gen5 software.

MitoTracker Staining

MitoTracker staining was used to visualize mitochondrial membrane potential.

Cells were seeded at a concentration of 50,000 per well in a 24-well plate with coverslips coated with Poly-D-lysine. After 24 hours, Opti-MEM was aspirated and MitoTracker

Red CMXRos was diluted 1:100 in OptiMEM. The cells were incubated for 30 minutes at 37°C. Nuclei were stained using DAPI and coverslips were mounted using ProLong

Gold Antifade (Life Technologies). Coverslips were analyzed using an Olympus IX51 fluorescent microscope.

Immunocytochemistry

Immunocytochemistry was used to visualize protein localization. Cells were seeded at a concentration 50,000 cells to each well of 24-well plates containing 35 mm coverslips coated with Poly-D-lysine. Cells were fixed using 4% paraformaldehyde

(PFA). Primary antibodies (Table 2), were introduced into cells for overnight incubation.

Secondary antibodies were the following day. Nuclei were stained using DAPI and coverslips were mounted using ProLong Gold Antifade (Life Technologies). Coverslips were analyzed using an Olympus IX51 fluorescent microscope.

RIPA Protein Isolation and BCA Protein Assay

Drug-treated cell culture were lysed in RIPA buffer and proteins were quantified using a BCA protein assay. Cells were plated at 300,000 cells in a 6-well plate and after a

24-hour drug treatment, cells were washed twice with 1X PBS. A 100 µL mixture of 1%

Protease Inhibitor, 0.4% Nuclease, and 98.6% RIPA Buffer (Fisher Scientific), was added to each well and left the plate on ice for two minutes. A cell scraper was used to remove cells from the plate and transferred to a chilled 1.5 mL Eppendorf tube, before vortexing for 15 seconds. Tubes were then vortexed for 30 seconds in 15-minute intervals over a period of one hour. Tubes were spun down as 16,000xg for 15 minutes. The supernatant was collected and protein samples were stored at -80°C. Proteins concentrations were quantified by Pierce BCA Protein Assay Kit (Thermo Fisher 23227) according to kit instructions and read using Synergy 2 plate reader (Bio-Tek).

Western Blot

Western blotting was used to quantify protein. Using 15 µg of whole cell protein samples in 1X NuPAGE LDS Sample Buffer (Life Technologies) and 1X NuPAGE

Sample Reducing Agent (Life Technologies), samples were loaded into a NuPAGE 4-

12% Bis-Tris Gel (Life Technologies). The gel was run at 190 V for 50 minutes at 4°C in

1X NuPAGE MOPS SDS (Life Technologies) running buffer with NuPAGE Antioxidant

(Life Technologies) added to the middle anode chamber. MagicMark XP (Life

Technologies) and Novex Sharp Pre-Stained (Life Technologies) protein ladders were used in combination and run alongside samples. Following SDS-PAGE, the gel was briefly rinsed in transfer buffer with 20mM Tris/150mM Glycine and 20% methanol. The proteins were transferred from gel to PVDF membrane and were run at 350 mA for 43

19 minutes at 4°C using a wet transfer technique. After the transfer, the PVDF membrane was blocked in Tris-Buffered Saline supplemented with 1% Tween-20 and 10% goat serum for 3 hours at room temperature. Blocking solution was replaced with fresh blocking solution supplemented with primary antibodies at 4°C for 12 hours. The membrane was washed with TBST (3 x 5 minutes) and the secondary antibody was diluted in fresh TBST and incubated on the membrane for 1 hour at room temperature.

Bands were visualized with SuperSignal Pico Chemiluminescent Substrate solution (Life

Technologies) by combining Luminol/Enhancer solution and Stable Peroxide in a 1:1 ratio and imaged with Omega Lum C (Aplegen). Band densities were quantified using

Image J.

Table 2. Antibodies Used

Supplier and Catalog Antibody Number Purpose Western and ICC; To p21 Monoclonal Antibody Life Technologies determine effect on p21 (R.229.6) MA514949 levels p53 Monoclonal Antibody Thermo Fisher MA5- Western; To determine (DO-7) 12557 effect on p53 levels Santa Cruz Western; To determine KLF6 Antibody (E-10) Biotechnology SC- effect on KLF6 levels 365633 Western and ICC; To Phospho-Histone H3 pSer10 Invitrogen determine effect on G /M Polyclonal Antibody PIPA517869 2 of cell cycle Anti-VINC Rabbit Polyclonal VWR 89357-436 Western; Loading Control Antibody Goat anti-Rabbit IgG (H+L) Fisher Scientific Secondary Antibody, Alex ICC; Secondary A11008 Fluor 488 Goat anti-Mouse IgG (H+L) Fisher Scientific Oligoclonal Secondary Western; Secondary PIA28177 Antibody, HRP Goat anti-Rabbit IgG (H+L) Fisher Scientific Oligoclonal Secondary Western; Secondary PIA27036 Antibody, HRP

NEON Transfection

NEON transfection was used to introduce luciferase plasmids into cells. Endofree

Plasmid Maxi Kit (Qiagen) was used to maxiprep plasmids, according to kit instruction.

All electroporations were performed using the NEON Transfection System (Life

Technologies) using optimized protocols based on manufacturer’s recommendations.

Two plasmids were introduced into separate sets of HeLa cells using 10 µL NEON tips containing 5 x 105 cells set to 1005 V, 35 ms pulse width, and two pulses. Cells were not transfected using a negative control. 40,000 of these cells were plated into each well of a

96 well plate (Costar 3610). These transfected cell samples were then treated with compounds for a period of 24 hours. 10 µM DMSO treatment was used as the vehicle control.

Luciferase Reporter Assay

A luciferase reporter assay was used to study gene expression at a transcriptional level of p21 and p53. HeLa cells were NEON transfected with pGL2-p21 promoter-Luc plasmid (Addgene 33021) or PG13-luc (wt p53 binding sites) plasmid (Addgene 16442) and Renilla plasmid (Addgene 12457). To determine the effect of GSK3β on p21 transcriptional activity, HA-GSK3β (Addgene 49491) and HA-GSK3β-S9A (Addgene

49492) were co-transfected with the pGL2-p21 promoter-Luc plasmid. pmaxFP-Green-N

(GFP) (Addgene VDF-1012) was used to visually observable control for success of transfection. Transfected cells were plated in quadruplicate on a 96 well plate (Costar

3610). After a 24-hour drug treatment, Opti-MEM was aspirated and 20 µL of 1X passive lysis buffer (Promega) was added to the wells of the 96 well plate. The plate was left to incubate on a shaker for 20 minutes at room temperature. To perform the assay, Renilla

22 buffer was prepared by adding luciferase inhibitor and CTZ. Both Renilla and Firefly buffers were vortexed before use. Buffers were added using dual injectors of a GloMax

96 Microplate Luminometer, which was used to quantify luciferase luminescence produced in each well.

RNA Isolation and cDNA Synthesis RNA Isolation was performed using the Quick-RNA MiniPrep kit (Zymo R1055) according to manufacturer specifications. cDNA synthesis was executed according to the

Superscript III First-Strand Synthesis System manual (Life Technologies 18080-051).

Quantitative Polymerase Chain Reaction (qPCR) and Primer Design

All primers for qPCR were purchased from DNA Integrated Technologies. NCBI was used to design sequences and were designed to bind closely to the 3’UTR portion of cDNA and overlap an intron-exon junction. qPCR reactions were performed using

SensiMix SYBR No-ROX Kit (Bioline). The assay consisted of a 10-minute denaturing period, followed by 45 separate 15 second cycles, at 95°C. This was followed by a 15 second at 60°C, then 15 seconds at 72°C. Triplicates of 10 ng cDNA and 250 nM primers were used. TBP and RPLO were used as reference genes for all experiments. The reaction will be conducted on the CFX96 Touch Real-Time PCR Detection Systems

(BIO-RAD) and analyzed with qbase+ data-analysis software (Biogazelle).

Table 3. qPCR Primers Used

Gene Target Forward Primer Reverse Primer

BAX CCTGTGCACCAAGGTGCCGGAACT CCACCCTGGTCTTGGATCCAGCCC

CCNG2 CATTCCAAGATTAATGACACTGAG GTTTGCAACATTCAGGAGAAG

CDK1 CAGTCTTCAGGATGTGCTTATG CTGACCCACAGCAGAAGA

CDKN1A CCAGCATGACAGATTTC AGGCAGAAGATGTAGAG

GADD45A GGTGACGAATCCACATT ACCGTTCAGGGAGATTA

PCNA CCATCCTCAAGAAGGTGTTGG GTGTCCCATATCCGCAATTTTAT

PIG6 CCATCCTCAAGAAGGTGTTGG GTGTCCCATATCCGCAATTTTAT

SNK (PLK2) TGGCACCTTTCAGGTGAATTT TGATGAACAGCCAGACATCAG

TNFRSF10B AAGACCCTTGTGCTCGTTGT AGGTGGACACAATCCCTCTG

P53 AACGGTACTCCGCCACC CGTGTCACCGTCGTGGA

RPLPO GAAACTCTGCATTCTCGCTTC GGTGTAATCCGTCTCCACAG

TBP CCCAGAATTGTTCTCCTTAT GTCTTCCTGAATCCCTTTAG

CHAPTER 3

RESULTS

Effects Under Investigation

The compounds used in this study were synthesized by the de Lijser lab

(Department of Chemistry and Biochemistry, California State University, Fullerton).

Over 400 compounds from this library were screened using CyQUANT proliferation assay. Twenty compounds that yielded the lowest cell proliferation rates in the

CyQUANT assay were dubbed “top 20,” and were selected for use in this study. These compounds are listed in Table 1. From these 20 compounds, eight were used for Western

Blots, ICC, and qPCR. Four compounds were also tested on mitochondrial membrane potential. The effects of these compounds on the cells differed widely, including different effects on cell cycle-related genes in qPCR and cell cycle-related protein levels. Previous studies have identified one of these “top 20” compounds, known as LH14E, as a compound of interest. These compounds are not thought to induce apoptosis, suggesting that the effects may be mediated by inhibition of cell cycle (Wen, 2016). LH14E treatment increased p21 protein as detected by Western blotting. Immunocytochemistry showed that the p21 protein was present in the nucleus. However, p53 protein levels were not affected, indicating the activation of KLF6 may be regulating p21 activation. These studies may suggest the cell cycle’s involvement in LH14E’s ability to reduce

CyQUANT values. For these reasons, LH14E will be the focus of this thesis.

Effect on Cellular Proliferation

Screening of the 423 compounds’ effects on cell proliferation rate was performed using a CyQUANT assay (Appendix A). Mitomycin C and Niclosamide were used as positive controls. All values were normalized to DMSO. The compounds that had the most reduction in cell proliferation are shown in Figure 4A. JF19, JF18, AMJ2, MEY26,

JF17, AMJ3, AV9, KN19, LH14E, and TK51 fell within the lowest 10 values, producing more than a 40% reduction in total cell counts. JF19, MEY26, AV9, KN19 and LH14E were selected from the lowest eight of these values, for use in qPCR, Western blotting, and ICC with Niclosamide as a control.

Some of these compounds have also been shown to have different effects in

HUTU80 and MG63 cell lines (Figure 4B). AV9, JF17, JF18, JF19, KN19, LH14E, and

MEY26 show no effect on cell proliferation with the MG63 cell line but a decrease of over 30% in the HUTU80 and HeLa cell lines.

Effect on Mitochondrial Membrane

HeLa, MG63, and HUTU80 cells were treated with DMSO, LH14E, Niclosamide, and JF19 for 24 hours and analyzed using a dye known as MitoTracker. MitoTracker is an orange fluorescent dye that diffuses across the plasma membrane and accumulates in active mitochondria. HeLa cells treated with LH14E had a slight reduction in

MitoTracker signal to DMSO (Figure 5D). Comparatively, Niclosamide and JF19 showed a greater reduction in MitoTracker staining compared to DMSO treated cells

(Figure 5F, H). Mitotracker signal in MG63 cells is much lower, but it does not seem that any of the compounds affect mitochondrial activity in this cell line. JF19 seems to cause

26 alteration in location of mitochondria in MG63 cells. In contrast, all three compounds reduced mitochondrial signal in HUTU80 cells.

Effect on Chromatin Condensation and Mitotic Phase of the Cell Cycle

To determine if the compounds were affecting a specific phase of the cell cycle, a phospho-histone 3(H3) Ser 10 antibody was used. HeLa cells were treated with LH14E,

Niclosamide, JF19, MEY26, KN19, and AV9 for 24 hours and then analyzed using immunocytochemistry. The nucleosome is made up of eight core histone proteins that are the primary building block of chromatin. Phosphorylation at Ser10, Ser28, and Thr11 of the histone H3 is tightly correlated with chromosome condensation during mitosis

(Prigent, 2003). If there is a fluorescent signal for Ser10 on H3, the cell has entered the mitosis phase of the cell cycle.

The fluorescent signal of phospho-H3 Ser10, relative to DAPI, is present in approximately 10% of the cells. Relative to DMSO, phospho-H3 Ser10 signal fluoresces in approximately 5% of cells upon treatment with LH14E, JF19, and MEY26 (Figure 6B,

D, E). When treated with KN19 and AV9, the percentage of phosphor-H3 Ser10 signal did not alter. However, upon treatment with niclosamide, phospho-H3 Ser10 signal was not present. This may indicate Niclosamide does not allow the cell to progress to the mitotic phase of the cell cycle.

1 A 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1

CyQUANT Values Normalized to DMSO to Normalized Values CyQUANT 0

1.2 B

0.8

0.6 HeLa HUTU80 0.4 MG63

0.2 CyQUANT Value Normalized to to DMSO Normalized Value CyQUANT 0

Figure 4. Compounds decrease cell proliferation. Primary screening was performed to determine drug effects on cell proliferation after a 24-hour drug treatment. (A) HeLa cells were reduced after drug treatment with lead compounds. The lowest 20 cell proliferation values with standard deviation values with less than 20% out of 423 compounds were screened (n = 3). (B) Comparison of effects of some compounds on HeLa, HUTU80 and MG63 cell lines (n = 3).

DMSO LH14E Niclosamide JF19 . HeLa

DAPI

A C E G

MitoTracker B D F H

MG63

DAPI

I K M O

MitoTracker J L N P

HUTU8

DAPI

Q S U W

MitoTracker R T V X

Figure 5. LH14E reduces mitochondrial activity in HUTU80 cells but not HeLa and MG63 cells. HeLa, MG63, and HUTU80 cells were treated with 0.01% DMSO (A,B,I,J,Q,R), 10 M LH14E (C,D,K,L,S,T), 0.3 M Niclosamide (E,F,M,N,U,V) and 10 M JF19 (G,H,O,P,W,X) for 24 hours. After drug treatment, cells were fixed using 4% paraformaldehyde solution and incubated at 37°C with MitoTracker Orange. Each coverslip was incubated in DAPI (A,C,E,G,I,K,M,O,Q,S,U,W).

29 DMSO LH14E C E

pH3 pSer10 pH3 pSer10 A E

A D B F

Niclosamide JF19

M C D KN19 AV9 MEY26

M N

E F G N

Figure 6. Niclosamide and JF19 reduce phospho-H3 pSer10 levels relative to DMSO. HeLa cells were treated with 0.01% DMSO (A,) and 10 µM LH14E (B), 0.3 µM Niclosamide (C), and 10 µM JF19 (D), MEY26 (E), KN19 (F), and AV9 (G) for 24 hours. After drug treatment, cells were fixed using 4% paraformaldehyde and permeabilized with 0.5% Triton-X-100. Phospho-H3 pSer10 primary antibody (A, B, C, D, E, F, G) were introduced to cells and incubated at 4°C overnight. On the next day, primary antibody was washed away and Alexa Flour® 488 conjugated secondary antibody was added and incubated for an hour at room temperature. After secondary incubation, each coverslip was incubated in DAPI (A, B, C, D, E, F, G) and placed on a microscope slide with ProLong Gold Antifade Mountant (Thermo) for imaging at 20X magnification. (n = 3).

qPCR Analysis of Effects on p53 Target Gene Expression

To monitor mRNA expression, HeLa cells were treated for 24 hours with DMSO,

LH14E, Niclosamide, JF19, MEY26, KN19 and AV9 (Figure 7). All values were normalized to DMSO. Similar to previous data, CDKN1A mRNA expression levels increased after treatment with LH14E (Adkins, 2017).

Expression of BAX was investigated because of its apoptotic role in the cell cycle.

BAX mRNA expression, relative to DMSO, was reduced with niclosamide (0.39), JF19

(0.68), MEY26 (0.85), KN19 (0.91), and AV9 (0.45) (Figure 7A). However, treatment with LH14E increased BAX mRNA expression by 1.39. These effects provide support for

BAX playing a role in mitochondrial membrane potential after treatment with LH14E.

Previous data has shown the compounds, including LH14E, do not induce caspase 3/7 activation (Wen, 2016). Therefore, BAX mRNA expression may indicate LH14E may play a role in mitochondrial membrane potential.

Expression of CCNG2 or cyclin-G2 was investigated because in the cell cycle, cyclin-G2 governs the cell into entering the S phase of the cycle. In qPCR, CCNG2 expression was not affected after treatment with LH14E (1.02), Niclosamide (0.97), JF19

(0.95), and MEY26 (0.91) (Figure 7B). KN19 (1.21) and AV9 (1.26) slightly increased expression of CCNG2. Lack of change in CCNG2 mRNA expression after treatment with certain compounds, specifically LH14E, may indicate the S phase of the cell cycle is not being affected.

CDKN1A encodes for the protein p21, which when targeted by p53 induces cell cycle arrest (Löhr et al., 2003). Consistent with previous data, examination of CDKN1A revealed an increase in mRNA expression after treatment with LH14E (1.98) (Adkins,

2017; Wen, 2016). CDKN1A levels were modestly increased upon treatment with

Niclosamide (1.13), MEY26 (1.61), KN19 (1.24), and AV9 (1.23). JF19 (0.81), however, decreased CDKN1A expression (Figure 7C), suggesting an alternative mechanism to attenuate cell proliferation. Since the compounds and niclosamide increased CDKN1A mRNA expression, this may increase p21 protein levels.

Expression of GADD45A was investigated because transcript levels of the gene increase during growth arrest conditions and upon treatment with DNA-damaging agents

(Sun, Tang, & Xiao, 2015). GADD45A mRNA expression levels were increased by niclosamide (1.43), JF19 (1.64), MEY26 (1.52), and AV9 (1.53). This suggests that these compounds share some characteristics with other growth arrest conditions. Interestingly,

LH14E decreased GADD45A (0.78) (Figure 7D), suggesting that LH14E attenuates cell proliferation through an alternative mechanism.

The p53 target gene proline dehydrogenase 1 (PIG6) encode factors that induce intracellular accumulation of reactive oxygen species (ROS), which stress cells and induce apoptosis (Rivera & Maxwell, 2005). PIG6 mRNA expression increased upon treatment with LH14E (1.94), Niclosamide (1.62), JF19 (1.62) and MEY26 (1.61). KN19

(1.01) did not affect PIG6 expression and there was a slight reduction upon treatment with AV9 (0.86) (Figure 7E). An increase in PIG6 mRNA expression correlates to a decrease in mitochondrial membrane potential upon treatment with LH14E and

Niclosamide, indicating that these compounds increasing PIG6 expression is affecting the mitochondria.

TNFRSF10B is a cell surface receptor of the TNF-receptor superfamily that binds to TRAIL and mediates apoptosis. The TNFRSF10B protein contains a intracellular death

32 domain and is activated by tumor necrosis related apoptosis (Chaudhary et al., 1997).

TNFRSF10B mRNA expression was not altered much. LH14E (0.93) and MEY26 (1.05) did not have an effect, while the greatest upregulation was with JF19 (1.11). Niclosamide

(0.89), KN19 (0.78), and AV9 (0.84) had the greatest reduction of TNFRSF10B mRNA expression (Figure 7F). The expression levels of TNFRSF10B upon treatment with the compounds may indicate that apoptosis is not occurring via the TNF family.

Although mRNA levels were shown to be affected upon treatment with the compounds, the transcriptional activity may not correlate to protein levels. There may be discrepancies between the mRNA and protein levels due to post-translational modifications. For the purposes of this study, qPCR will help identify proteins of interest to investigate later by Western blotting or immunocytochemistry.

Overall, the qPCR findings demonstrated the compounds affect cell-cycle related genes. The data suggests that LH14E increased BAX, CDKN1A, and PIG6 expression. No change was seen with CCNG2 and TNFRSF10B and a slight decrease in GADD45A. This data suggests that LH14E is affecting direct targets of p53 and the cell cycle.

2.5 A 2.5 D BAX GADD45A 2 2

1.5 1.5

1 1

0.5 0.5

Normalized DMSO to 0

0 Normalized DMSO to Fold Change mRNA in Expression Fold Change mRNA in Expression

2.5 PIG6 B E 2.5 CCNG2 2.0 2 1.5 1.5 1 1.0 0.5 0.5

0 Normalized DMSO to 0.0 Fold Change mRNA in Expression Normalized DMSO to Fold Changes mRNA in Expression

2.5 CDKN1A C 3.00TNFRSF10B F 2 2.50 2.00 1.5 1.50 1 1.00 0.5 0.50 Normalized DMSO to 0 Fold Changes mRNA in 0.00 Expression Normalized DMSO to Fold Change mRNA in Expression

Figure 7. mRNA expression is impacted for cell-cycle related genes (A-F). Values normalized to DMSO for HeLa cells treated with either 0.3 µM Niclosamide or 10 µM of each drug for 24 hours (n = 3).

qPCR Analysis of Effects on p21 Related Gene Expression

Based on previous data (Figure 7), LH14E increased CDKN1A mRNA expression the most compared to other cell cycle related gene expression. To monitor downstream

CDKN1A target gene expression, HeLa cells were treated for 24 hours with DMSO,

LH14E, Niclosamide, JF19, MEY26, KN19 and AV9 (Figure 8). All values were normalized to DMSO. It was shown that p21 inhibits kinase activity of CDK1 and induces arrest in the G2 of the cycle (Ando et al., 2001). The gene CDC2 encodes for the

CDK1 protein. Phosphorylation of CDK1 leads to cell cycle progression; therefore, inhibition of CDK1 in cancer would lead to cell cycle arrest. CDC2 mRNA expression reduction was found upon treatment with all compounds. CDC2 mRNA levels were dramatically reduced upon treatment with JF19 (0.32), AV9 (0.19), and MEY26 (0.39)

(Figure 8A). LH14E (0.60), Niclosamide (0.51), and KN19 (0.43) also reduced CDC2 gene expression. Thus, all of these compounds may be inducing cell cycle arrest in part through inhibition of CDC2 expression.

p21 blocks PCNA and consequently reduces DNA polymerase’s (polδ) processivity, leading to S phase cell cycle arrest. Increased expression of PCNA was seen in MEY26 (1.21) and KN19 (1.12). However, LH14E (0.63), Niclosamide (0.80), JF19

(0.74), and AV9 (0.84) decreased PCNA mRNA expression.

p21 is a direct target of p53. p53 mRNA expression levels was upregulated by

Niclosamide (1.32), MEY26 (1.13), and KN19 (1.52). Interestingly, LH14E (0.83), JF19

(0.69), and AV9 (0.76) decreased p53 gene expression. However, due to large variances in error, additional trials are needed for confirmation.

2.5 CDC2 2

1.5

0.5

0 Fold Change in mRNAin Change Fold B Expression Normalized to DMSO to Normalized Expression B 2.5 PCNA 2 1.5

0.5

Normalized to DMSO to Normalized 0 Fold Change in mRNA Expression Expression mRNAin Change Fold

2.5 p53 2 1.5 1

0.5

Normalized to DMSO to Normalized -0.5

Fold Chnge in mRNA Expression Expression mRNAinChnge Fold

Figure 8. mRNA expression is impacted for p21 related genes (A-C). Values normalized to DMSO for HeLa cells treated with either 0.3 µM Niclosamide or 10 µM of each drug for 24 hours (n = 2).

Effect on CDKN1A Transcription

To verify the p21 was being affected at a transcription level, examination of the transcriptional activity of CDKN1A was done using a pGL2-p21-promoter luciferase plasmid (Rivera & Maxwell, 2005). To determine if GSK3β would affect LH14E, HeLa cells were co-transfected with a HA-GSK3β overexpression plasmid and a constitutively active HA-GSK3β-S9A plasmid (Lang et al., 2013). HeLa cells were transfected with a plasmid encoding Renilla luciferase driven by the constitutively active SV40 promoter and used as control for cell number alongside the pGL2-p21-promoter luciferase plasmid.

Cells were then treated with 1 µM CPT, 3 µM SB216763 (a GSK3β inhibitor), 10 M

LH14E, JF19, KN19, AV9, and 0.3 M Niclosamide for 24 hours. The cells were then lysed and Renilla and Firefly buffers were added to measure light intensity. All reporter activity was normalized to Renilla and then normalized to DMSO.

An increase of p21 transcription activity was detected after treatment with LH14E

(1.99) and CPT (1.47) relative to DMSO. Treatment with Niclosamide (1.0) and KN19

(1.1) did not affect p21 transcription activity (Figure 9). JF19 (0.36) and AV9 (0.43) reduced the transcription activity of p21 compared to DMSO. This data correlates to the qPCR data collected (Figure 7C).

Co-transfection of pGL2-p21-promoter with HA-GSK3β and HA-GSK3β-S9A, increased p21 transcription activity after treatment with LH14E (1.48, 1.82 respectively).

However, all the de Lijser compounds, including SB216763 and Niclosamide decreased p21 transcription activity. This data indicates that LH14E may be impacting the transcription activity of p21 through a GSK3β mechanism.

3.50

3.00

2.50

2.00

1.50 No GSK3β HA-GSK3β 1.00 HA-GSK3β-S9A 0.50 Light Intensity Relative to DMSO to Relative IntensityLight 0.00

Figure 9. LH14E increases transcription activity of CDKN1A after treatment. (A) Full p21 promoter luciferase plasmid and Renilla control vector were introduced into HeLa cells via transfection. HA-GSK3β and HA-GSK3β-S9A were co-transfected with p21 promoter luciferase plasmid and Renilla control vector. Cells were treated for 24 hours with DMSO, LH14E, Niclosamide, JF19, CPT, KN19, and AV9. Luciferase activity was normalized to Renilla. Results are shown in quadruplicate means (n = 3).

Effect on p53 Transcription Activity

To evaluate p53’s transcriptional activity, HeLa cells were transfected with PG13- luc plasmid, which drives Firefly luciferase expression under the control of 13 p53 response elements (El-Deiry et al., 1993). HeLa cells were co-transfected with a plasmid encoding Renilla luciferase as control for cell number (along with PG13-luc plasmid).

Cells were then treated with 1 µM CPT, 10 M LH14E, JF19, MEY26, KN19, AV9, and

0.3 M Niclosamide for 24 hours. The cells were then lysed and Renilla and Firefly buffers were added to measure light intensity. All reporter activity was normalized to

Renilla and then normalized to DMSO.

CPT (1.30), LH14E (1.80), Niclosamide (1.71) and KN19 (1.76) increased the transcription activity of p53 upon treatment (Figure 10). JF19 (0.31) and AV9 (0.69) increased the transcriptional activity of p53, however, MEY26 (1.11) had minimal effects. This data indicates that LH14E is activating p53 and promoting expression of p53 target genes.

3.00

2.50

2.00

1.50

1.00

0.50

Light Intensity Relative to DMSO to Relative IntensityLight 0.00

Figure 10. LH14E increase transcription activity of p53 after treatment. (A) Full p53 promoter luciferase plasmid and Renilla control vector were introduced into HeLa cells via transfection. Cells were treated for 24 hours with DMSO, CPT, LH14E, Niclosamide, JF19, MEY26, KN19, and AV9. Luciferase activity was normalized to Renilla. Results are shown in quadruplicate means (n = 3).

Effects on Protein Levels using Western Blot Analysis

To investigate if proteins associated with the cell cycle were affected, Western blotting was completed. HeLa cells were treated with 1.0 M Campthothecin, 10 M

LH14E, JF19, MEY26, KN19, AV9, and 0.3 M Niclosamide for 24 hours for p53 and p21 protein expression. Results suggest LH14E, JF19, MEY26, and AV9 increase p21 protein levels after treatment (Figure 11A). Quantification of Western blot bands confirmed an increased level of p21 in cells treated with compounds (Figure 11B).

Upon treatment, p53 protein level results suggest the de Lijser compounds and niclosamide did not affect p53 (Figure 12A). Quantification of Western blot bands confirmed the positive control of camptothecin but not upon treatment with the other compounds (Figure 12B).

To determine if p21 was being activated in a p53 independent manner, a Western blot was performed to determine if KLF6 protein levels were affected upon treatment with LH14E. HeLa cells were transfected with a Flag-hKLF6 plasmid and verified using an anti-KLF6 antibody. Cells were then treatment with 1.0 µM Camptothecin (CPT), 3.0

µM of SB216763, 10 µM LH14E, JF19, KN19, AV9 and 0.3 µM Niclosamide for 24 hours. Results suggest LH14E, SB216769, Niclosamide, KN19 and AV9 increase KLF6 protein levels increase after treatment (Figure 13A). Quantification of Western blot bands confirmed an increased level of KLF6 in cells treatment with compounds (Figure 13B).

p21

Vinculin

p21

2 Vinculin

Biological Replicates p21

3 Vinculin B

18 16 14 12 10 8 6 to DMSO to 4 2 0 -2 Fold Change in Band Density Relative Relative Density Bandin Fold Change

Figure 11. p21 protein levels presence of compounds and Niclosamide. (A) Following a 24-hour treatment, HeLa cells were lysed to collect protein. Antibodies against vinculin, as the loading control, and p21, as the protein of interest, were used for Western blotting. (B) Measurement of band intensity and normalized to intensity of DMSO value (n = 3).

p53

Vinculin

p53

2 Vinculin

Biological Replicates p53

Vinculin

3.5 3

2.5

2 1.5

1 to DMSO to

0.5 0

Relative Density Bandin Fold Change

Figure 12. p53 protein levels presence of compounds and Niclosamide. (A) Following a 24-hour treatment, HeLa cells were lysed to collect protein. Antibodies against vinculin, as the loading control, and p53, as a protein of interest, were used for Western blotting. (B) Measurement of band intensity and normalized to intensity of DMSO value (n = 3).

KLF6

Vinculin

KLF6

2 Vinculin

Biological Replicates KLF6

Vinculin

6 B

DMSO 2

to Relative Intensity Bandin Fold Change

Figure 13. KLF6 protein levels presence of compounds and Niclosamide. (A) Following a 24-hour treatment, HeLa cells were lysed to collect protein. Antibodies against vinculin, as the loading control, and KLF6, as a protein of interest, were used for Western blotting. (B) Measurement of band intensity and normalized to intensity of DMSO value (n = 3).

Effect on Protein Localization

HeLa cells were treated with DMSO, Camptothecin, LH14E, Niclosamide, JF19,

MEY26, KN19, and AV9 for 24 hours then analyzed using immunocytochemistry (ICC).

Camptothecin was used as a control since previous data indicates an increase of p21 levels upon treatment. p21 localization was revealed to be in the nucleus of cells (Figure

14). An overall increase in nuclear p21 is seen upon all treatments (Figure 14 D, F, H, J,

L, N, P) when compared to DMSO (Figure 14B). It has been shown that nuclear p21 is present upon exposure to DNA damage (Abella et al., 2010). Also, it was found that nuclear p21 inhibits but cytoplasmic p21 promotes cell migration and invasion abilities

(Huang et al., 2014). The nuclei of camptothecin, niclosamide, and JF19-treated cells became misshapen and more globular, and possibly damaged, relative to DMSO (Figure

14 C, G, J). Camptothecin has been shown to induce apoptosis, but similar morphology of DAPI upon treatment with JF19 may indicate potential apoptosis (Pommier et al.,

2003; Toné et al., 2007).

DMSO Camptothecin LH14E Niclosamide

A C E G

DAPI G B D F H

p21

B D F H JF19 MEY26 KN19 AV9 JF19 MEY26 KN19 I K M O

DAPI

I J L N P O

p21

Figure 14. Camptothecin,J LH14E, Niclosamide,L JF19, MEY26, KN19, and AV9 P increased p21 levels relative to DMSO. HeLa cells were treated with 0.01% DMSO (A,B), 10 M LH14E (E,F), JF19 (I,J), MEY26 (K,L), KN19 (M,N), AV9 (O,P) 1.0 M Camptothecin (C,D,) and 0.3 M Niclosamide (G,H) for 24 hours. After drug treatment, cells were fixed using 4% paraformaldehyde P21 primary antibody (B,D,F,H,J,L,N,P) were introduced to cells On the next day, primary antibody was washed away and Alexa Flour® 488 conjugated secondary antibody was added and incubated for an hour at room temperature. After secondary incubation, each coverslip was incubated in DAPI (A,C,E,G,I,K,M,O) and placed on a microscope slide with ProLong Gold Antifade Mountant (Thermo) for imaging at 40X magnification. (n = 2).

CHAPTER 4

DISCUSSION

The Cell Cycle and LH14E

The aim of this project was to identify if any of the compounds developed by the de Lijser lab can induce cell cycle arrest by decreasing cell proliferation and to reveal the mechanism of their action. Cancer can occur when proteins regulating the cell cycle become mutated, causing dysregulation of the cycle with proteins in a constant state of activation. Other mutated proteins can also prevent the activation of key proteins, leading to dysregulation of the cycle. Therefore, blocking the cell cycle helps identify potential targets for therapy. It was hypothesized that the selected eight compounds, including

LH14E, would interact with a target protein associated with the cell cycle to activate p21 levels and induce cell cycle arrest. This study determined that CDKN1A (p21) expression may be increased by LH14E treatment due to increased p53 transcriptional activity and

KLF6 stability. All three of these proteins are known inhibitors of cell cycle, and thus are the likely candidates mediating LH14E’s anti-proliferative effects.

LH14E Reduces Cell Proliferation through Interaction with the Cell Cycle

Initial screenings for the effect of de Lijser compounds on cell growth included

CyQUANT cell proliferation assays. CyQUANT assay results indicated that certain compounds, including LH14E, reduced cell proliferation in cells after a 24-hour treatment (Figure 4A) and some compounds have cell type specificity (Figure 4B). This

47 data suggests that the compounds affect cell cycle regulation in HeLa cells and a specific kinase or protein present in both HeLa and HUTU80 may be a direct target. The absence of an effect in MG63 cell line suggests that cell cycle genes expressed in HeLa and

HUTU80 cell lines, but not expressed in MG63 cell line, are important in mediating these anti-proliferative effects. However, previous data indicates that MG63 inhibitors usually induce apoptosis or the G2/M phase of the cell cycle (Kumar et al., 2018). Specific inhibitors of the G1/S phase of the cell cycle inhibit of cell cycle progression through action on p27, not p21 (Ryhänen et al, 2003). In the future, comparison of HeLa and

MG63 using microarray or sequencing following treatment could reveal different expression patterns between cell types.

Mitochondrial staining was shown change in signal upon treatment with LH14E in HUTU80, but not in HeLa and MG63 cells (Figure 5). The similarity in Mitotracker signal between DMSO and LH14E may indicate that the mitochondria are not affected.

Niclosamide decreases mitochondrial activity in HeLa and HUTU80 cell lines.

Mitochondrial metabolism seems to be active in these two cell lines, but is mutated in

MG63 cell line. It is possible that MG63 cell line is utilizes the Warburg effect to upregulate aerobic glycolysis and shunting of lactic acid and reduced mitochondrial activity (Antico Arciuch, Elguero, Poderoso, & Carreras, 2012). It is not determined that the inhibitory effects on mitochondria are occurring during the cell cycle, however, induction of cell cycle arrest could lead to a reduction of mitochondrial activity as a secondary effect. Future studies should investigate whether the compounds are directly targeting the mitochondria, specifically upon treatment with niclosamide and JF19.

When a cell enters the mitotic phase of the cell cycle, the protein histone 3 is phosphorylated at the Ser10 site, making it an indicator of cells dividing in the cell cycle.

The lack of change of phospho-histone 3 pSer10 levels indicates that some of the compounds reduce the cells’ ability to enter the mitotic phase of the cell cycle (Figure 6), suggesting that the cells may be arresting in the G1/S/G2 phase of the cell cycle. To confirm this effect, flow cytometry using propidium iodide or BrDU staining may indicate which specific stage of the cell cycle is being targeted.

Well studied cell-cycle related genes were measured to determine which proteins in the cell cycle may be affected. With LH14E treatment, there was in increase in BAX,

CDKN1A, and PIG6 expression while GADD45A and TNFRSF10B expression decreased

(Figure 7). All the effected genes are known to be target genes for p53, a major regulator of p21 and the most studied protein in the cell cycle. It appears that p53 activity may be upregulated after treatment with LH14E based on the results that many of the p53 target genes and p53 transcriptional activity reporter gene were increased (Figure 10).

CDKN1A has been shown to induce cell cycle arrest when upregulated by being translated to the p21 protein, which inhibits CDK/cyclin complexes resulting in cell cycle arrest (Löhr et al., 2003). Since CDKN1A yielded the highest fold change, p21 downstream genes were measured and found LH14E decreased both CDC2 and PCNA expression. (Figure 8). Verification that p21 was transcriptionally active was shown through a luciferase assay where surprisingly niclosamide increased the transcriptional activity of p21 along with LH14E (Figure 9).

To determine if GSK3β may be phosphorylating KLF6 and activating the transcription of p21, co-transfection with overexpressed GSK3β and constitutively active

GSK3β-S9A both increased p21 transcriptional activity upon treatment with LH14E. This activation may indicate that GSK3β is phosphorylating and activating as well as stabilizing KLF6, leading to an increase in the expression on a transcriptional level of p21.

Using Western blots and ICC, it was possible to show that p21 protein levels increased after treatment with LH14E and AV9 relative to DMSO (Figure 11 and 14). If p21 protein levels had decreased, this would have been an indication that the cells are affecting a different protein in the cell cycle to reduce cell proliferation rates. Other proteins that could act to induce cell cycle arrest would have been 14-3-3α or PUMA (Lu et al., 2017; Nakano et al., 2001; Shu, Li, & Wu, 2007). However, this effect has not yet been tested. Protein levels of p53 increased slightly after treatment with LH14E, but not a significant amount. In contrast, levels of exogenously expressed KLF6 protein increased significantly upon treatment with LH14E and Niclosamide (Figure 13). This indicates that LH14E and niclosamide may indirectly increase expression of CDKN1A gene and an abundance of p21 protein, which contribute to the anti-proliferative effects of these compounds.

Table 4. Summary of Results

LH14E Niclosamide JF19 MEY26 KN19 AV9 BAX 1.39 0.39 0.68 0.85 0.91 0.45 CCNG2 1.02 0.97 0.95 0.91 1.21 1.26 CDKN1A 1.98 1.14 0.81 1.61 1.24 1.23 CDK1 0.60 0.51 0.32 0.39 0.43 0.19 qPCR GADD45A 0.78 1.44 1.64 1.53 0.91 1.53 PCNA 0.63 0.80 0.74 1.27 1.12 0.84 PIG6 1.94 1.62 1.62 1.61 1.01 0.86 p53 0.83 1.32 0.69 1.13 1.52 0.76 TNFRSF10B 0.93 0.89 1.11 1.05 0.78 0.84 HeLa 0.51 0.38 0.35 0.43 0.50 0.48 CyQUANT HUTU80 0.71 0.44 0.66 0.49 0.72 0.61 MG63 0.95 0.65 0.97 0.97 0.96 0.98 p21 3.41 1.30 3.50 3.44 1.94 4.65 Western p53 1.26 1.44 1.48 1.06 1.11 1.17 Blot KLF6 2.20 3.87 1.10 − 1.54 1.33 phospho-H3 ICC Ser 10 ↓ ↓ NC ↓ ↓ NC p21 ↑ NC ↑ NC ↑ ↑ HeLa ↓ ↓ ↓ − − − Mitotracker HUTU80 ↓ ↓ NC − − − MG63 ↓ NC ↓ − − − p21 1.99 1.00 0.36 1.05 1.10 0.43 GSK3β-S9A Luciferase +p21 1.82 0.56 0.21 - 0.45 0.34 Assay GSK3β + p21 1.48 0.70 0.34 - 0.45 0.31 p53 1.80 1.71 0.31 1.11 1.76 0.69

Comparison of LH14E with Niclosamide and Camptothecin

Both LH14E and Niclosamide decreased CyQUANT and increase the transcriptional activity of p21, however, the mechanism of action of niclosamide has not yet to be determined. Niclosamide has not been shown to impact p21 post-translationally.

Niclosamide has also been shown to be nonspecific and target many different pathways in the cell (Y. Li et al., 2014) and previous studies have shown niclosamide to induce apoptosis (Park et al., 2011; Ye et al., 2014). However, previous studies in this lab suggest LH14E does not promote apoptosis (Wen, 2016). Niclosamide caused morphologic changes to nuclei of cells whereas LH14E did not. Niclosamide significantly increased KLF6 protein levels, indicating potential cell cycle arrest via

KLF6.

Camptothecin has been shown to promote of apoptosis, but it also results in a significant increase p21 levels as shown via Western blots and ICC (Pommier et al.,

2003). In comparison, LH14E did not increase p21 protein signal as high as

Camptothecin, but surprisingly AV9 increased p21 protein levels higher than LH14E

(Figure 11).

Proposed Mechanism of LH14E

LH14E has been shown to decrease cell proliferation rates, have potential cell-line specificity, and decrease mitochondrial activity. In the cell cycle, LH14E may induce cell cycle arrest by preventing the cell from entering the mitotic phase of the cell cycle. ICC and Western blotting revealed that there is an increase in p21 and KLF6 protein levels and qPCR indicated an upregulation of CDKN1A. Despite the decrease of PCNA mRNA levels, these results indicate that cell cycle arrest was not caused by p21 targeting PCNA.

The decrease in CDC2 expression may induce inhibition of cell proliferation. Based on qPCR results, LH14E may be working by upregulating p53 activity, which then activates p21. However, p53 protein levels were not observed to be affected, indicating that

CDKN1A gene expression and protein production is activated by the phosphorylation of

KLF6 by GSK3β. Through the activation of p21, the CDK complex of cyclin D1 and

CDK4 can form leading to cell cycle arrest.

LH14E

GSK3β ↓ β-catenin

KLF6

Decrease in Cell Proliferation

↑ CDKN1A

Cyclin D

p21 p21 CDK4

Figure 15. Proposed mechanism of LH14E. LH14E targets the kinase GSK3β, resulting in the phosphorylation of KLF6 and degradation of β-catenin. Downstream effect is the transactivation of CDKN1A. Due to the activation of p21, the CDK complex of cyclin D1 and CDK4 form and induce cell cycle arrest.

Drug Discovery and LH14E

Mutations in cell cycle related genes often lead uncontrolled cell proliferation and inhibition of cell cycle arrest inducers such as p21, which is associated with any different types of cancers. P21 activation may lead to activation of cell cycle arrest. Previous studies have shown LH14E does not cause apoptosis or necrosis. This study has shown that LH14E increases p53 target genes, p21 and KLF6 proteins, induces cell cycle arrest, and may potentially have cell line-preferred manners. Findings like these may guide future studies in increasing overall efficacy of drug discovery and uncover mechanisms of other anti-cancer compounds. Due to potential cell-line specificity, LH14E may hold advantage over other current chemotherapeutic drugs if it does not cause permanent damage to patient’s non-cancerous cells during treatment. Identification of compounds that induce cell cycle arrest and reduce tumor progression have potential as treatments for cancer.

APPENDIX A

SUPPLEMENTARY CYQUANT FIGURE

45000

40000

35000 30000 25000 DMSO 20000 SB216 15000 LH14E 10000 5000 Niclosamide

CyQUANTFlourescent Values 0 CPT

Supplementary Figure 1. Increased KLF6 expression decreases proliferation to levels comparable to treatment with untransfected cells. Cells were transfected with overexpression plasmids Flag-KLF6, HA-GSK3β and HA-GSK3β-S9A plasmids using NEON transfection. Cells were treated with SB216763, LH14E, Niclosamide, and Camptothecin (CPT) for 24 hours before monitoring cell proliferation using CyQUANT (n = 1).

APPENDIX B

SUPPLEMENTARY CYQUANT ASSAY TABLE

Supplementary Table 1. Full List of CyQUANT Assay Results

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD AA30X 1.13 0.95 0.86 0.98 0.14 KC4-2 1.36 1.27 1.32 0.06 AA30XE 0.97 1.28 1.19 1.15 0.16 KC42-1 1.11 0.98 1.04 0.09 AA40X 0.87 0.94 0.91 0.05 KC43-2 0.91 0.82 0.87 0.06 AA40XE 1.10 1.21 1.16 0.08 KC46 1.11 0.92 0.87 0.97 0.13 AC110 0.92 1.05 0.99 0.10 KC47 0.78 0.78 0.78 0.00 AC111 0.83 0.83 0.83 0.00 KC48 1.68 1.15 1.03 1.29 0.35 AC112 1.00 1.20 1.10 0.14 KC49 0.87 1.16 1.07 1.03 0.15 AC113 0.90 1.37 1.14 0.33 KC50 0.89 1.07 0.98 0.13 AC114 0.81 1.17 0.99 0.25 KC-5-1 0.82 0.98 0.90 0.11 AC115 0.84 1.26 1.05 0.30 KC5-2 0.97 1.02 0.99 0.04 AC116 0.94 1.03 0.99 0.07 KC56 1.27 0.86 1.07 1.07 0.21 AC117 0.91 1.17 1.04 0.19 KC57 1.02 0.72 0.55 0.76 0.24 AC118 1.00 1.22 1.11 0.16 KC58 1.04 1.13 1.08 0.07 AC119 0.93 0.96 0.95 0.02 KC59 1.19 0.91 0.84 0.98 0.18 AC120 0.84 1.28 1.06 0.31 KC6-1 1.16 0.77 0.82 0.92 0.21 AC121 0.83 1.02 0.93 0.14 KC62 0.83 1.03 0.77 0.88 0.14

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD AMJ2 0.57 0.39 0.33 0.43 0.13 KC63 1.19 0.69 0.89 0.92 0.26 AMJ20 0.84 0.51 0.68 0.68 0.16 KC64 1.26 0.88 0.90 1.02 0.21 AMJ3 0.50 0.39 0.44 0.07 KJ65 0.87 1.12 0.88 0.96 0.14 AMJ4 0.94 0.91 0.92 0.02 KJ67 1.10 0.92 1.01 0.13 AMJ5 1.19 1.14 1.17 0.03 KJ68 1.00 0.84 0.58 0.81 0.21 AMJ6 1.06 1.04 1.05 0.01 KJ69 1.06 0.93 1.00 0.09 AMJ7 1.02 0.66 1.07 0.92 0.22 KJ71 0.53 0.79 0.98 0.77 0.22 AMJ9 0.86 0.68 0.71 0.75 0.10 KJB01 1.13 1.02 1.07 0.08 AS36 1.20 0.82 0.98 1.00 0.19 KJB03 0.68 0.93 1.02 0.88 0.18 AS37 1.08 0.88 1.03 1.00 0.10 KJB05 1.11 0.97 1.04 0.10 AS38 1.08 0.74 1.13 0.99 0.21 KJB07 0.76 1.05 0.93 0.91 0.14 AS39 1.16 0.78 0.99 0.98 0.19 KJB15 0.80 1.16 0.79 0.92 0.21 AS40 1.10 0.75 0.85 0.90 0.18 KM68 0.96 0.53 1.03 0.84 0.27 AS41 1.19 0.53 0.85 0.86 0.33 KM69 0.85 0.78 0.82 0.05 AS42 0.95 0.53 0.86 0.78 0.22 KM70 1.17 0.71 0.84 0.91 0.23 AS43 0.79 0.85 0.82 0.04 KM71 1.05 0.76 1.04 0.95 0.16 AS44 0.72 0.90 0.97 0.86 0.13 KM72 1.03 0.92 0.98 0.08 AS46 0.95 1.22 0.96 1.04 0.15 KM73 1.19 0.93 0.76 0.96 0.22 AS47 0.89 0.32 0.37 0.53 0.31 KM74 1.04 1.00 1.02 0.03 AS48 1.06 1.06 1.06 0.00 KM75 0.97 1.09 1.03 0.08 AS49 0.99 0.78 0.89 0.15 KM76 1.02 1.03 1.03 0.01 AS50 0.98 0.88 0.93 0.07 KN11 0.79 0.66 0.72 0.09 AS51 0.92 0.64 0.78 0.20 KN14 0.62 0.69 0.66 0.05 AS52 1.09 0.81 0.95 0.20 KN16 0.82 0.70 0.76 0.09 AS53 1.02 0.77 0.90 0.18 KN19 0.45 0.73 0.33 0.50 0.20 AS54 0.82 1.00 0.91 0.12 KN23 0.81 0.54 0.68 0.19 AS55 0.95 1.09 1.02 0.10 KN25 0.91 0.68 0.79 0.16 AS56 0.92 1.21 1.18 1.10 0.16 KN31 0.79 0.64 0.72 0.11

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD AS57 1.01 1.05 1.03 0.02 KN35 0.92 0.87 0.90 0.03 AS58 0.95 1.19 1.00 1.04 0.13 KN37 0.94 0.63 0.79 0.22 AS59 0.88 0.98 0.93 0.07 KN7 0.44 0.66 0.76 0.62 0.17 AS60 1.03 1.08 1.05 0.03 KN8 0.94 1.03 0.99 0.06 AS61 0.79 0.93 0.86 0.10 KPB03 1.22 0.90 1.06 0.23 AS62 0.92 1.05 0.99 0.09 KPB10 0.91 0.88 0.89 0.02 AS63 0.96 1.01 0.99 0.04 KPB13 0.78 1.45 0.79 1.01 0.39 AS64 1.03 0.63 0.59 0.75 0.24 KPB15 0.65 0.70 0.68 0.04 AS67 0.70 0.56 0.37 0.54 0.16 KPB21 0.98 0.72 0.63 0.78 0.18 AS76 0.60 0.68 0.43 0.57 0.13 KPB23 0.55 1.25 0.70 0.83 0.37 AS81 0.71 0.56 0.31 0.52 0.20 LEH61 0.71 0.97 0.81 0.83 0.13 AV11 1.05 0.83 0.88 0.92 0.12 LEH68 0.99 0.58 0.54 0.70 0.25 AV14 0.94 0.64 0.92 0.83 0.17 LEH69 1.31 0.68 1.11 1.04 0.32 AV16 1.05 0.97 1.01 0.06 LEH70 0.88 0.75 0.82 0.10 AV17 1.11 0.68 0.99 0.93 0.22 LEH71 0.86 0.77 0.81 0.06 AV18 1.05 0.75 1.14 0.98 0.20 LEH72 0.69 0.90 0.94 0.84 0.14 AV20 1.17 0.81 0.64 0.89 0.22 LEH85 0.84 0.70 0.77 0.09 AV21 1.08 0.78 0.92 0.93 0.15 LH13A 1.20 0.78 0.76 0.91 0.25 AV3 0.85 0.97 0.76 0.86 0.10 LH13E 0.83 0.43 0.79 0.69 0.22 AV4 0.94 0.63 0.78 0.78 0.15 LH14A 0.99 1.00 0.99 0.00 AV5 0.84 0.47 0.74 0.68 0.20 LH14E 0.40 0.55 0.57 0.51 0.09 AV6 0.80 0.55 1.02 0.79 0.24 MA06 1.22 0.71 0.86 0.93 0.26 AV8 0.83 0.45 0.72 0.67 0.20 MA12 1.05 0.75 0.62 0.81 0.22 AV9 0.66 0.30 0.48 0.48 0.18 MA18 0.88 1.02 0.95 0.10 BH03 1.02 0.93 0.98 0.06 MA22 0.91 1.05 0.96 0.98 0.07 BH04 0.97 1.02 1.00 0.03 MEY03 1.11 0.85 0.80 0.92 0.17 BH06 1.01 0.94 0.98 0.05 MEY08 0.74 0.69 0.72 0.03 BH07 0.97 1.00 0.98 0.03 MEY09 0.85 0.71 0.78 0.10

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD BH11 0.80 0.87 0.83 0.05 MEY10 0.89 0.90 0.90 0.01 BH14 0.89 0.95 0.92 0.04 MEY11 0.97 0.66 0.75 0.79 0.16 BH32 0.93 0.96 0.94 0.02 MEY12 0.94 0.86 0.90 0.05 BH33 1.12 0.96 1.04 0.11 MEY13 0.88 1.07 0.97 0.14 BH34 Blue 0.75 0.79 0.77 0.03 MEY14 1.01 0.93 1.02 0.99 0.05 BH34 Clear 0.87 1.09 0.77 0.91 0.16 MEY17 1.07 0.94 1.01 0.09 BH35 1.03 1.07 1.05 0.03 MEY18 0.73 0.87 0.80 0.10 BH36 0.92 1.03 0.98 0.08 MEY19 0.62 0.84 0.84 0.77 0.13 BH37 0.70 0.85 0.77 0.11 MEY20 1.11 1.03 1.07 0.06 BH40 0.92 0.86 0.92 0.90 0.03 MEY21 1.11 0.69 1.06 0.95 0.23 BH41 0.58 0.87 0.71 0.72 0.14 MEY22 1.12 0.81 0.84 0.92 0.17 BH42 1.02 0.97 1.00 0.04 MEY23 0.82 0.63 0.72 0.14 BH44-Clear 1.06 1.04 1.05 0.01 MEY24 0.83 0.63 0.73 0.14 BH44-Yellow 1.00 0.97 0.99 0.02 MEY26 0.34 0.52 0.43 0.12 BH45 0.92 0.85 0.88 0.05 MMC 0.70 0.40 0.55 0.21 BH46-Clear 1.07 0.71 0.88 0.89 0.18 MP100 0.77 0.67 0.81 0.75 0.08 BH46-Pink 0.96 0.99 0.97 0.03 MS05 1.00 1.28 0.71 1.00 0.28 BH47 0.73 0.90 0.81 0.12 MS43 0.99 1.09 1.04 0.07 BH48 0.92 0.99 0.95 0.05 MS46 0.93 1.09 1.01 0.11 BH50-Clear 1.08 1.06 1.07 0.01 MS51 1.10 1.03 1.07 0.05 BH50-Yellow 1.05 0.90 0.97 0.11 MS52 1.07 1.02 1.04 0.04 BH51-Clear 0.99 0.71 0.85 0.85 0.14 MY03 1.02 1.05 1.03 0.02 BH51-Green 0.98 0.83 0.90 0.10 MY05 0.80 1.06 0.88 0.91 0.13 BH52A 0.99 0.73 0.93 0.88 0.14 MY07 0.88 0.92 0.90 0.03 BH52B 0.83 1.13 0.86 0.94 0.16 MY09 0.77 0.93 0.85 0.11 BH54-Clear 0.87 0.84 0.85 0.02 MY11 0.90 1.17 1.43 1.17 0.26 BH55 0.94 0.96 0.95 0.02 MY21 0.83 0.83 0.83 0.00 BH56 0.90 0.97 0.93 0.05 MY25 0.88 1.25 0.62 0.92 0.32

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD BH57 0.87 0.89 0.88 0.01 MY29 0.77 1.53 0.85 1.05 0.42 BH58 0.99 1.01 1.00 0.01 MY31 0.81 0.92 0.86 0.07 BT004 1.01 0.94 0.98 0.05 MY33 0.83 1.09 0.90 0.94 0.13 CB2 0.84 0.87 0.85 0.02 MY35 1.17 0.92 0.75 0.95 0.21 DF03 1.04 0.90 0.97 0.10 MY37 1.04 0.87 0.95 0.12 DF13 1.03 1.02 1.02 0.01 MY39 0.77 1.30 0.75 0.94 0.31 DF15 0.98 0.98 0.98 0.00 NA62 0.96 0.51 0.53 0.67 0.25 DF17 1.16 0.94 1.07 1.06 0.11 NA76 0.96 0.72 0.58 0.75 0.19 DF23 1.02 1.03 1.03 0.01 NA82 0.90 0.65 0.63 0.73 0.15 DF27 1.02 1.07 1.04 0.03 NA86 0.80 0.72 0.76 0.06 DF31 0.99 1.06 1.02 0.05 NIC 0.1 0.38 1.04 0.94 0.78 0.36 DF33 1.09 1.23 1.16 0.10 NIC 0.3 0.70 0.92 1.05 0.89 0.18 DK61 0.71 0.76 0.74 0.04 NIC 1 0.40 0.84 0.82 0.69 0.25 DK67 1.01 0.91 0.96 0.07 NIC 10 0.18 0.53 0.42 0.38 0.18 DK71 0.00 1.01 1.10 0.70 0.61 NIC 3 0.35 0.35 0.45 0.38 0.06 DK73 1.04 0.99 1.01 0.04 NT 1.02 1.04 1.03 0.01 DP101 0.79 1.21 0.95 0.98 0.21 PLD001 0.70 0.59 0.87 0.75 0.13 DP102 0.95 0.83 0.89 0.09 PLD002 0.81 0.57 0.54 0.71 0.18 DP103 1.04 1.12 1.08 0.05 QT101 0.46 0.90 0.90 0.75 0.25 DP104 1.10 1.07 1.09 0.02 QT105 0.67 1.01 0.89 0.85 0.17 DP105 1.07 0.93 1.00 0.10 QT107 0.38 0.78 0.58 0.28 EL106 0.51 0.87 0.57 0.65 0.19 QT109 1.19 0.86 0.96 0.99 0.14 EL119 0.71 1.00 1.06 0.92 0.19 QT111 1.58 1.06 0.96 1.14 0.30 EL120 0.80 1.02 0.86 0.89 0.11 QT113 1.63 0.80 0.83 1.09 0.47 EL122 1.06 1.02 1.04 0.03 QT115 1.62 0.82 0.75 1.06 0.48 EL124 0.92 0.91 0.91 0.00 QT117 1.48 0.90 1.02 1.13 0.31 EL125 0.99 1.10 1.05 0.08 QT119 1.46 0.89 0.97 1.10 0.31 EL128 0.84 0.90 0.87 0.05 QT125 1.09 1.13 1.11 0.03

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD ES14 0.96 1.11 1.03 0.11 QT127 0.96 0.74 1.00 0.93 0.13 ES16 1.01 0.79 0.73 0.85 0.15 QT159AE 0.90 0.82 0.86 0.06 ES6 0.68 0.80 0.74 0.09 QT159MA 1.02 0.93 0.98 0.06 ES8 0.73 0.81 0.77 0.05 QT165 0.82 0.60 0.93 0.78 0.14 FM10 1.06 0.98 1.02 0.06 QT167 1.08 0.87 0.87 0.94 0.12 FM11 0.82 0.95 0.89 0.09 QT169 0.52 0.83 0.74 0.70 0.16 FM14 0.89 0.98 0.94 0.07 QT171 0.81 0.91 0.86 0.07 FM16 0.61 0.92 0.71 0.75 0.16 QT173 0.94 0.69 0.89 0.84 0.13 FM22 0.94 0.91 0.92 0.02 QT175 0.75 0.94 0.91 0.87 0.10 FM24 0.83 0.72 0.78 0.08 QT179 0.79 1.04 1.06 0.92 0.14 FM28 0.89 0.93 0.91 0.03 QT185 0.74 0.97 1.04 0.95 0.14 FM30 0.94 0.94 0.94 0.00 QT61 0.82 0.91 0.87 0.07 FM32 1.03 0.90 0.97 0.09 QT65 0.77 0.75 0.76 0.02 FM36 0.94 0.95 0.95 0.00 QT67 0.68 0.90 0.91 0.83 0.13 FM38 0.92 0.89 0.91 0.02 QT69 0.93 0.85 0.89 0.06 FM44 1.32 0.92 0.84 1.03 0.26 QT73 0.78 0.97 0.94 0.89 0.08 FM48 1.31 0.91 0.97 1.06 0.22 QT77-C 0.86 0.85 0.85 0.00 HP15 0.96 0.96 0.96 0.00 QT77-Y 0.87 1.00 0.81 0.89 0.10 HP16 1.18 0.89 0.97 1.01 0.15 QT81 0.95 0.87 0.91 0.06 HP19 1.37 1.13 0.98 1.16 0.20 QT83 1.01 0.98 1.00 0.03 HP20 1.00 0.86 0.93 0.10 QT85 0.98 0.98 0.98 0.00 HP21 0.81 1.04 0.67 0.84 0.19 QT87 0.98 1.02 1.00 0.02 HP22 1.03 0.92 0.98 0.08 QT89 0.69 0.90 0.90 0.83 0.12 HP23 1.04 0.91 0.97 0.09 QT91 0.90 0.74 1.01 0.88 0.14 HP24 0.98 0.87 0.92 0.08 QT93 0.91 0.84 0.87 0.05 HP25 0.86 1.09 0.99 0.98 0.11 QT99 0.81 1.00 0.91 0.91 0.09 HP26 0.96 1.00 0.98 0.03 RV01 0.86 0.99 0.93 0.09 JD1 1.03 1.18 0.85 1.02 0.17 RV03 0.79 1.00 0.89 0.15

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD JF15 1.26 0.82 0.75 0.94 0.28 RV05 0.84 1.03 1.09 0.99 0.13 JF16 1.00 0.94 0.93 0.96 0.04 SK01 1.02 0.69 0.75 0.82 0.17 JF17 0.49 0.50 0.34 0.44 0.09 SK10 0.62 0.86 0.79 0.76 0.12 JF18 0.40 0.55 0.32 0.42 0.12 SK14 0.80 0.54 0.72 0.69 0.14 JF19 0.35 0.39 0.31 0.35 0.04 SK19 1.09 1.05 1.07 0.03 JF20 0.55 0.76 0.35 0.55 0.20 SK26 0.98 0.66 0.84 0.83 0.16 JF21 0.85 0.90 0.88 0.04 SK28 1.20 0.82 0.99 1.00 0.19 JF25 0.99 0.96 0.97 0.02 SK32 1.18 0.90 0.89 0.99 0.16 JK17 0.76 0.81 0.79 0.04 SK33 0.85 1.08 0.82 0.92 0.14 KA05 0.93 1.03 0.98 0.07 SM03 0.74 1.17 0.93 0.95 0.22 KA06 0.69 1.12 0.69 0.83 0.25 SM04 0.77 0.93 0.85 0.11 KA09 0.72 0.85 0.78 0.09 SM05 0.96 0.85 0.91 0.08 KA12 0.89 0.80 0.85 0.07 SM07 0.85 0.96 0.91 0.08 KA13 0.66 1.41 0.83 0.97 0.40 SM08 0.59 0.80 0.88 0.76 0.15 KA15 0.67 0.89 0.93 0.83 0.14 SM09 0.80 1.05 0.95 0.93 0.13 KA16 0.69 0.95 0.98 0.88 0.16 SM10 1.11 1.12 1.11 0.00 KA25 0.74 1.33 0.86 0.98 0.31 SM11 0.78 0.84 0.81 0.04 KA29 0.90 1.02 0.96 0.09 SM12 1.09 0.85 0.93 0.96 0.13 KA32 1.08 0.91 1.00 0.12 SN03 1.10 0.72 0.72 0.85 0.22 KA35 1.28 1.08 0.99 1.12 0.15 SN13 0.91 0.90 0.90 0.01 KA58 1.00 0.80 1.08 0.96 0.15 SN14 0.89 0.84 0.86 0.04 KA59 0.87 1.63 1.02 1.17 0.40 SN16 0.93 0.89 0.91 0.03 KA72 1.07 0.94 1.02 1.01 0.07 SN17 0.94 0.56 0.47 0.66 0.25 KC08 0.99 0.39 1.06 0.81 0.37 TK51 0.54 0.52 0.53 0.01 KC09 1.14 0.57 1.01 0.91 0.30 TK53 0.82 0.90 0.86 0.05 KC10 0.91 0.92 0.92 0.01 TK67 0.85 0.75 0.80 0.07 KC13 1.01 1.54 0.94 1.16 0.33 TK75 0.42 0.68 0.61 0.57 0.14 KC15 1.05 1.47 1.13 1.22 0.22 TSC41 0.92 1.04 0.98 0.08

Drug Name Trial 1 Trial 2 Trial 3 AVE STD Drug Name Trial 1 Trial 2 Trial 3 AVE STD KC18 0.81 0.88 0.84 0.05 TSC63 0.57 1.08 0.87 0.84 0.26 KC19 0.85 1.00 1.08 0.98 0.12 TT01 0.89 0.74 0.68 0.80 0.11 KC20 1.20 0.90 0.94 1.01 0.16 TT03 0.82 0.77 0.80 0.04 KC2-1 1.01 1.43 0.82 1.09 0.31 TT05 0.93 0.62 0.66 0.74 0.17 KC21-1 0.60 0.95 0.71 0.75 0.18 TT07 1.06 1.07 1.07 0.01 KC21-2 1.20 0.70 1.00 0.96 0.25 TT13 0.85 1.05 0.97 0.95 0.10 KC2-2 1.21 0.70 1.49 1.13 0.40 TT17 0.94 0.72 0.77 0.81 0.12 KC22-2 1.31 0.99 1.15 0.22 TT19 0.87 0.91 0.89 0.03 KC23-1 0.97 1.10 1.04 0.10 TT21 0.67 0.46 0.62 0.58 0.11 KC23-2 0.79 0.82 0.81 0.02 TT23 1.01 1.02 1.02 0.01 KC24 0.99 1.14 1.07 0.11 TT31 0.85 0.76 0.81 0.06 KC25-2 1.26 0.81 1.31 1.13 0.28 TT35 0.70 0.90 0.72 0.77 0.11 KC26-1 0.62 0.71 0.66 0.06 TT39 0.97 0.80 0.88 0.12 KC28 0.72 0.97 0.85 0.18 TT41 0.94 1.49 0.88 1.10 0.34 KC29 0.86 1.11 0.84 0.94 0.15 TT43 1.01 0.80 0.71 0.86 0.13 KC30 0.90 1.01 0.95 0.07 TT45 0.95 0.87 0.91 0.05 KC31 0.86 0.99 0.93 0.09 TT47 0.91 0.87 0.89 0.03 KC3-2 0.94 0.87 0.90 0.05 TT49 0.95 0.83 0.89 0.09 KC40-2 0.82 0.92 0.87 0.07 TT51 0.89 0.88 0.88 0.01 KC4-1 1.02 0.96 0.99 0.05 TT53 0.91 0.94 0.93 0.02

REFERENCES

Abbas, T., & Dutta, A. (2009). p21 in cancer: intricate networks and multiple activities. Nature Reviews. Cancer, 9(6), 400–414. https://doi.org/10.1038/nrc2657.p21 Abbas, T., Jha, S., Sherman, N. E., & Dutta, A. (2007). Autocatalytic phosphorylation of CDK2 at the activating Thr160. Cell Cycle, 6(7), 843–852. https://doi.org/10.4161/cc.6.7.4000 Abella, N., Brun, S., Calvo, M., Tapia, O., Weber, J. D., Berciano, M. T., … Agell, N. (2010). Nucleolar Disruption Ensures Nuclear Accumulation of p21 upon DNA Damage. Traffic, 11(6), 743–755. https://doi.org/10.1111/j.1600-0854.2010.01063.x Adkins, L. (2017). LH14E’s effects are mediated through the Wnt pathway. Unpublished Manuscript. California State University, Fullerton. Albrecht, J. H., Meyer, A. H., & Hu, M. Y. (1997). Regulation of cyclin-dependent kinase inhibitor p21(WAF1/Cip1/Sdi1) gene expression in hepatic regeneration. Hepatology (Baltimore, Md.), 1–7. https://doi.org/S0270913997001171 [pii]\r10.1002/hep.510250311 Ando, T., Kawabe, T., Ohara, H., Ducommun, B., Itoh, M., & Okamoto, T. (2001). Involvement of the Interaction between p21 and Proliferating Cell Nuclear Antigen for the Maintenance of G2/M Arrest after DNA Damage. Journal of Biological Chemistry, 276(46), 42971–42977. https://doi.org/10.1074/jbc.M106460200 Antico Arciuch, V. G., Elguero, M. E., Poderoso, J. J., & Carreras, M. C. (2012). Mitochondrial Regulation of Cell Cycle and Proliferation. Antioxidants & Redox Signaling, 16(10), 1150–1180. https://doi.org/10.1089/ars.2011.4085 Bai, Y. Q., Miyake, S., Iwai, T., & Yuasa, Y. (2003). CDX2, a homeobox transcription factor, upregulates transcription of the p21/WAF1/CIP1 gene. Oncogene, 22(39), 7942–7949. https://doi.org/10.1038/sj.onc.1206634 Besson, A., Dowdy, S. F., & Roberts, J. M. (2008). CDK Inhibitors: Cell Cycle Regulators and Beyond. Developmental Cell, 14(2), 159–169. https://doi.org/10.1016/j.devcel.2008.01.013 Black, A. R., Black, J. D., & Azizkhan‐Clifford, J. (2001). Sp1 and krüppel‐like factor family of transcription factors in cell growth regulation and cancer. Journal of cellular physiology, 188(2), 143-160.

Bonelli, P., Tuccillo, F. M., Borrelli, A., Schiattarella, A., & Buonaguro, F. M. (2014). CDK/CCN and CDKI alterations for cancer prognosis and therapeutic predictivity. BioMed Research International, 2014. https://doi.org/10.1155/2014/361020 Brandeis, M., & Hunt, T. (1996). The proteolysis of mitotic cyclins in mammalian cells persists from the end of mitosis until the onset of S phase. The EMBO Journal, 15(19), 5280–5289. Broude, E. V., Swift, M. E., Vivo, C., Chang, B. D., Davis, B. M., Kalurupalle, S., … Roninson, I. B. (2007). p21Waf1/Cip1/Sdi1 mediates retinoblastoma protein degradation. Oncogene, 26(48), 6954–6958. https://doi.org/10.1038/sj.onc.1210516 Chaudhary, P. M., Eby, M., Jasmin, A., Bookwalter, A., Murray, J., & Hood, L. (1997). Death Receptor 5, a New Member of the TNFR Family, and DR4 Induce FADD- Dependent Apoptosis and Activate the NF-κB Pathway. Immunity, 7(6), 821–830. https://doi.org/10.1016/S1074-7613(00)80400-8 Chen, J., Jackson, P. K., Kirschner, M. W., & Dutta, A. (1995). Separate domains of p21 involved in the inhibition of Cdk kinase and PCNA. Nature, 374(6520), 386-388. Chen, J., Saha, P., Kornbluth, S., Dynlacht, B. D., & Dutta, A. (1996). Cyclin-binding motifs are essential for the function of p21CIP1. Molecular and Cellular Biology, 16(9), 4673–4682. https://doi.org/10.1128/MCB.16.9.4673 Chipuk, J. E., Kuwana, T., Bouchier-Hayes, L., Droin, N. M., Newmeyer, D. D., Schuler, M., & Green, D. R. (2004). Direct activation of Bax by p53~{m}ediates mitochondrial membrane permeabilization and apoptosis. Science, 303(5660), 1010– 1014. https://doi.org/10.1126/science.1092734 Claassen, G. F., & Hann, S. R. (2000). A role for transcriptional repression of p21CIP1 by c-Myc in overcoming transforming growth factor beta -induced cell-cycle arrest. Proceedings of the National Academy of Sciences of the United States of America, 97(17), 9498–9503. https://doi.org/10.1073/pnas.150006697 Clevers, H. (2006). Wnt/??-Catenin Signaling in Development and Disease. Cell, 127(3), 469–480. https://doi.org/10.1016/j.cell.2006.10.018 El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., … Vogelstein ’, B. (1993). WAF1, a Potential Mediator of p53 Tumor Suppression. Cell, 75, 817–825. Gerard, C., & Goldbeter, A. (2009). Temporal self-organization of the cyclin/Cdk network driving the mammalian cell cycle. Proceedings of the National Academy of Sciences, 106(51), 21643–21648. https://doi.org/10.1073/pnas.0903827106 Gérard, C., & Goldbeter, A. (2012). From quiescence to proliferation: Cdk oscillations drive the mammalian cell cycle. Frontiers in Physiology, 3 NOV(November), 1–18. https://doi.org/10.3389/fphys.2012.00413

Gérard, C., Gonze, D., & Goldbeter, A. (2012). Effect of positive feedback loops on the robustness of oscillations in the network of cyclin-dependent kinases driving the mammalian cell cycle. FEBS Journal, 279(18), 3411–3431. https://doi.org/10.1111/j.1742-4658.2012.08585.x Gil-Gómez, G., Berns, A., & Brady, H. J. M. (1998). A link between cell cycle and cell death: Bax and Bcl-2 modulate Cdk2 activation during thymocyte apoptosis. EMBO Journal, 17(24), 7209–7218. https://doi.org/10.1093/emboj/17.24.7209 Han, Z., Wei, W., Dunaway, S., Darnowski, J. W., Calabresi, P., Sedivy, J., … Wyche, J. H. (2002). Role of p21 in Apoptosis and Senescence of Human Colon Cancer Cells Treated with Camptothecin. Journal of Biological Chemistry, 277(19), 17154– 17160. https://doi.org/10.1074/jbc.M112401200 Harper, J. W., Elledge, S. J., Keyomarsi, K., Dynlacht, B., Tsai, L. H., Zhang, P., … Swindell, E. (1995). Inhibition of cyclin-dependent kinases by p21. Molecular Biology of the Cell, 6(4), 387–400. https://doi.org/10.1111/j.1365- 2184.2009.00584.x Hasegawa, S., Eguchi, H., Nagano, H., Konno, M., Tomimaru, Y., Wada, H., … Ishii, H. (2014). MicroRNA-1246 expression associated with CCNG2-mediated chemoresistance and stemness in pancreatic cancer. British Journal of Cancer, 111(8), 1572–1580. https://doi.org/10.1038/bjc.2014.454 Hasegawa, S., Nagano, H., Konno, M., Eguchi, H., Tomokuni, A., Tomimaru, Y., … Ishii, H. (2015). Cyclin G2: A novel independent prognostic marker in pancreatic cancer. Oncology Letters, 10(5), 2986–2990. https://doi.org/10.3892/ol.2015.3667 Hermeking, H., Rago, C., Schuhmacher, M., Li, Q., Barrett, J. F., Obaya, A. J., … Kinzler, K. W. (2000). Identification of CDK4 as a target of c-MYC. Proceedings of the National Academy of Sciences of the United States of America, 97(5), 2229–34. https://doi.org/10.1073/pnas.050586197 Heuvel, S. Van Den, & Harlow, E. (1993). Distinct Roles for Cyclin-Dependent Kinases in Cell Cycle, 262(5142), 2050–2054. Huang, Y., Wang, W., Chen, Y., Huang, Y., Zhang, J., He, S., ... & Wang, S. (2014). The opposite prognostic significance of nuclear and cytoplasmic p21 expression in resectable gastric cancer patients. Journal of gastroenterology, 49(11), 1441-1452. Imperi, F., Massai, F., Pillai, C. R., Longo, F., Zennaro, E., Rampioni, G., … Leoni, L. (2013). New life for an old Drug: The anthelmintic drug niclosamide inhibits pseudomonas aeruginosa quorum sensing. Antimicrobial Agents and Chemotherapy, 57(2), 996–1005. https://doi.org/10.1128/AAC.01952-12 Jung, Y. S., Qian, Y., & Chen, X. (2010). Examination of the expanding pathways for the regulation of p21 expression and activity. Cellular Signalling, 22(7), 1003–1012. https://doi.org/10.1016/j.cellsig.2010.01.013

Karimian, A., Ahmadi, Y., & Yousefi, B. (2016). Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair, 42, 63–71. https://doi.org/10.1016/j.dnarep.2016.04.008 Kasukabe, T., Okabe-Kado, J., & Honma, Y. (2008). Cotylenin A, a new differentiation inducer, and rapamycin cooperatively inhibit growth of cancer cells through induction of cyclin G2. Cancer Science, 99(8), 1693–1698. https://doi.org/10.1111/j.1349-7006.2008.00867.x Kumar, C., Sharma, R., Das, T., Korde, A., Sarma, H. D., Banerjee, S., & Dash, A. (2018). 177Lu‐DOTMP induces G2/M cell cycle arrest and apoptosis in MG63 cell line. Journal of Labelled Compounds and Radiopharmaceuticals. Krause, K., Wasner, M., Reinhard, W., Haugwitz, U., Dohna, C. L., Mössner, J., & Engeland, K. (2000). The tumour suppressor protein p53 can repress transcription of cyclin B. Nucleic Acids Research, 28(22), 4410–8. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11071927%5Cnhttp://www.pubmedcentral.ni h.gov/articlerender.fcgi?artid = PMC113869 Lalier, L., Cartron, P. F., Juin, P., Nedelkina, S., Manon, S., Bechinger, B., & Vallette, F. M. (2007). Bax activation and mitochondrial insertion during apoptosis. Apoptosis, 12(5), 887–896. https://doi.org/10.1007/s10495-007-0749-1 Lang, U. E., Kocabayoglu, P., Cheng, G. Z., Ghiassi-Nejad, Z., Muñoz, U., Vetter, D., … Friedman, S. L. (2013). GSK3β phosphorylation of the KLF6 tumor suppressor promotes its transactivation of p21. Oncogene, 32(38), 4557–4564. https://doi.org/10.1038/onc.2012.457 Levine, A. J., & Oren, M. (2009). The first 30 years of p53: growing ever more complex. Nature Reviews. Cancer, 9(10), 749–58. https://doi.org/10.1038/nrc2723 Li, D., Yea, S., Dolios, G., Martignetti, J. A., Narla, G., Wang, R., … Friedman, S. L. (2005). Regulation of Kruppel-like factor 6 tumor suppressor activity by acetylation. Cancer Research, 65(20), 9216–25. https://doi.org/10.1158/0008-5472.CAN-05- 1040 Li, T., Kon, N., Jiang, L., Tan, M., Ludwig, T., Zhao, Y., … Gu, W. (2012). Tumor suppression in the absence of p53-mediated cell-cycle arrest, apoptosis, and senescence. Cell, 149(6), 1269–1283. https://doi.org/10.1016/j.cell.2012.04.026 Li, Y., Li, P. K., Roberts, M. J., Arend, R. C., Samant, R. S., & Buchsbaum, D. J. (2014). Multi-targeted therapy of cancer by niclosamide: A new application for an old drug. Cancer Letters, 349(1), 8–14. https://doi.org/10.1016/j.canlet.2014.04.003 Li, Y., Jenkins, C. W., Nichols, M. A., & Xiong, Y. (1994). Cell cycle expression and p53 regulation of the cyclin-dependent kinase inhibitor p21. Oncogene, 9(8), 2261- 2268.

Löhr, K., Möritz, C., Contente, A., & Dobbelstein, M. (2003). p21/CDKN1A mediates negative regulation of transcription by p53. Journal of Biological Chemistry, 278(35), 32507–32516. https://doi.org/10.1074/jbc.M212517200 Lu, K., Rui, G., Liu, F., Yang, L., Deng, X., Shi, S., & Li, Q. (2017). 14-3-3ε is a nuclear matrix protein, and its altered expression and localization are associated with curcumin-induced apoptosis of MG‑63 cells. Oncology Letters, 338–346. https://doi.org/10.3892/ol.2017.7283 Mandal, M., Bandyopadhyay, D., Goepfert, T. M., & Kumar, R. (1998). Interferon- induces expression of cyclin-dependent kinase-inhibitors p21(WAF1) and p27(Kip1) that prevent activation of cyclin-dependent kinase by CDK-activating kinase (CAK). Oncogene, 16(2), 217–225. https://doi.org/10.1038/sj.onc.1201529 Mateyak, M. K., Obaya, A. J., & Sedivy, J. M. (1999). c-Myc Regulates Cyclin D-Cdk4 and -Cdk6 Activity but Affects Cell Cycle Progression at Multiple Independent Points c-Myc Regulates Cyclin D-Cdk4 and -Cdk6 Activity but Affects Cell Cycle Progression at Multiple Independent Points, 19(7), 4672–4683. Morris, E. J., & Geller, H. (1996). Topoisomerase-I : Evidence for Cell Cycle- independent Toxicity. Journal of Cell Biology, 134(3), 757–770. Naito, Y., Yabuta, N., Sato, J., Ohno, S., Sakata, M., Kasama, T., … Nojima, H. (2013). Recruitment of cyclin G2 to promyelocytic leukemia nuclear bodies promotes dephosphorylation of γh2AX following treatment with ionizing radiation. Cell Cycle, 12(11), 1773–1784. https://doi.org/10.4161/cc.24878 Nakano, K., Vousden, K. H., Ashcroft, M., Taya, Y., Vousden, K. H., Ashkenazi, A., … Vogelstein, B. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Molecular Cell, 7(3), 683–94. https://doi.org/10.1016/S1097-2765(01)00214-3 Narla, G., Heath, K. E., Reeves, H. L., Li, D., Giono, L. E., Kimmelman, a C., … Friedman, S. L. (2001). KLF6, a candidate tumor suppressor gene mutated in prostate cancer. Science (New York, N.Y.), 294(5551), 2563–6. https://doi.org/10.1126/science.1066326 O’Connor, C. (2014). Essentials of Cell Biology. Retrieved from https://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/122997842 Park, S. J., Shin, J. H., Kang, H., Hwang, J. J., & Cho, D. H. (2011). Niclosamide induces mitochondria fragmentation and promotes both apoptotic and autophagic cell death. BMB Reports, 44(8), 517–522. https://doi.org/10.5483/BMBRep.2011.44.8.517 Pearson, R. D., & Hewlett, E. L. (1985). Niclosamide therapy for tapeworm infections. Annals of internal medicine, 102(4), 550-551.

Pfaff, K. L., & King, R. W. (2013). Determinants of Human Cyclin B1 Association with Mitotic Chromosomes. PLoS ONE, 8(3). https://doi.org/10.1371/journal.pone.0059169 Pommier, Y., Redon, C., Rao, V. A., Seiler, J. a., Sordet, O., Takemura, H., … Kohn, K. W. (2003). Repair of and checkpoint response to topoisomerase I-mediated DNA damage. Mutation Research - Fundamental and Molecular Mechanisms of Mutagenesis, 532(1–2), 173–203. https://doi.org/10.1016/j.mrfmmm.2003.08.016 Prigent, C. (2003). Phosphorylation of serine 10 in histone H3, what for? Journal of Cell Science, 116(18), 3677–3685. https://doi.org/10.1242/jcs.00735 Ryhänen, S., Jääskeläinen, T., Mahonen, A., & Mäenpää, P. H. (2003). Inhibition of MG- 63 cell cycle progression by synthetic vitamin D3 analogs mediated by p27, Cdk2, cyclin E, and the retinoblastoma protein. Biochemical Pharmacology, 66(3), 495- 504. Rivera, A., & Maxwell, S. A. (2005). The p53-induced gene-6 (proline oxidase) mediates apoptosis through a calcineurin-dependent pathway. Journal of Biological Chemistry, 280(32), 29346–29354. https://doi.org/10.1074/jbc.M504852200 Sánchez-Martínez, C., Gelbert, L. M., Lallena, M. J., & de Dios, A. (2015). Cyclin dependent kinase (CDK) inhibitors as anticancer drugs. Bioorganic & Medicinal Chemistry Letters, 25(17), 3420-3435. Shangguan, W. J., Li, H., & Zhang, Y. H. (2014). Induction of G2/M phase cell cycle arrest and apoptosis by ginsenoside Rf in human osteosarcoma MG‑63 cells through the mitochondrial pathway. Oncology Reports, 31(1), 305-313. Sherr, C. J. (1994). G1 phase progression: cycling on cue. Cell, 79(4), 551-555.

Shu, K. X., Li, B., & Wu, L. X. (2007). The p53 network: p53 and its downstream genes. Colloids and Surfaces B: Biointerfaces, 55(1), 10–18. https://doi.org/10.1016/j.colsurfb.2006.11.003 Slavin, D. A., Koritschoner, N. P., Prieto, C. C., López-Díaz, F. J., Chatton, B., & Bocco, J. L. (2004). A new role for the Krüppel-like transcription factor KLF6 as an inhibitor of c-Jun proto-oncoprotein function. Oncogene, 23(50), 8196–8205. https://doi.org/10.1038/sj.onc.1208020 Sriram, D., Yogeeswari, P., Thirumurugan, R., & Ratan Bal, T. (2005). Camptothecin and its analogues: a review on their chemotherapeutic potential. Natural Product Research, 19(4), 393-412. Sun, Y., Tang, S., & Xiao, X. (2015). The Effect of GADD45a on Furazolidone‐Induced S‐Phase Cell‐Cycle Arrest in Human Hepatoma G2 Cells. Journal of biochemical and molecular toxicology, 29(10), 489-495.

Toné, S., Sugimoto, K., Tanda, K., Suda, T., Uehira, K., Kanouchi, H., . . . Earnshaw, W. C. (2007). Three distinct stages of apoptotic nuclear condensation revealed by time- lapse imaging, biochemical and electron microscopy analysis of cell-free apoptosis. Experimental Cell Research, 313(16), 3635–3644. https://doi.org/10.1016/j.yexcr.2007.06.018 Wall, M. E., Wani, M. C., Cook, C. E., Palmer, K. H., McPhail, A. A., & Sim, G. A. (1966). Plant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from camptotheca acuminata1, 2. Journal of the American Chemical Society, 88(16), 3888-3890. Wang, L., Wang, M., Wang, S., Qi, T., Guo, L., Li, J., … Zeng, X. (2013). Actin Polymerization Negatively Regulates p53 Function by Impairing Its Nuclear Import in Response to DNA Damage. PLoS ONE, 8(4), 1–12. https://doi.org/10.1371/journal.pone.0060179 Wei, C. L., Wu, Q., Vega, V. B., Chiu, K. P., Ng, P., Zhang, T., . . . Ruan, Y. (2006). A global map of p53 transcription-factor binding sites in the human genome. Cell, 124(1), 207–219. https://doi.org/10.1016/j.cell.2005.10.043 Weinberg, R. A. (1999). The retinoblastoma protein and cell cycle control. Cell, 81, 323– 330. Wen, C. (2016). LH14E, A Novel β-catenin protein inhibitor and cell cycle arresting drug, outperforms other Wnt mimetics. Unpublished Manuscript. California State University, Fullerton. World Health Organization. (2015). 19th WHO Model List of Essential Medicines. Http://Www.Who.Int/Medicines/Publications/Essentialmedicines/En, (April), 1–43. https://doi.org/10.1016/S1473-3099(14)70780-7 Ye, T., Xiong, Y., Yan, Y., Xia, Y., Song, X., Liu, L., . . . Yu, L. (2014). The anthelmintic drug niclosamide induces apoptosis, impairs metastasis and reduces immunosuppressive cells in breast cancer model. PLoS ONE, 9(1). https://doi.org/10.1371/journal.pone.0085887 Yo, Y.-T., Lin, Y.-W., Wang, Y.-C., Balch, C., Huang, R.-L., Chan, M. W. Y., . . . Lai, H.-C. (2012). Growth Inhibition of Ovarian Tumor-Initiating Cells by Niclosamide. Molecular Cancer Therapeutics, 11(8), 1703–1712. https://doi.org/10.1158/1535- 7163.MCT-12-0002 Yousefi, B., Rahmati, M., & Ahmadi, Y. (2014). The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21. Life Sciences, 99(1–2), 14–17. https://doi.org/10.1016/j.lfs.2014.01.063