Identification of a 60-Kilodalton Rb-Binding Protein, RBP60, That

Home , Retinoblastoma protein

Identification of a 60-Kilodalton Rb-Binding Protein, RBP60, That Allows the Rb-E2F Complex To Bind DNA SUBIR KUMAR RAY, MAY ARROYO, SRILATA BAGCHI, AND PRADIP RAYCHAUDHURI* Department ofBiochemistry (MIC 536), University ofIllinois at Chicago, Box 6998, Chicago, Illinois 60680 Received 11 March 1992/Returned for modification 17 April 1992/Accepted 1 July 1992

Several reports have indicated that the product of the retinoblastoma gene (Rb) complexes with the transcription factor E2F. We present evidence that the DNA-binding of the Rb-E2F complex involves another cellular factor. Addition of Rb to purified preparations of E2F does not generate an Rb-E2F complex that can bind DNA, and in fact, we see an inhibition of the DNA-binding ability of E2F. On the other hand, addition of Rb to cruder preparations of E2F results in the formation of an Rb-E2F complex (E2Fr) that can bind DNA and produces a distinct complex in gel retardation assays. We have identified and purified a 60-kDa protein that allows the Rb-E2F complex to bind DNA, and we show that this 60-kDa protein exerts its effect by directly interacting with Rb.

The retinoblastoma gene is one of the best characterized contrast, Rb induces formation of a complex involving E2F tumor suppressor genes. The protein encoded by the reti- and its cognate sequence. By fractionating extracts from noblastoma gene, Rb, binds several DNA tumor virus onco- mouse L cells, we have identified and purified a factor, proteins (12, 15, 16) including adenovirus ElA, simian virus RBP60, that protects E2F from Rb inhibition and allows 40 T antigen, and papillomavirus E7 protein. More recently, formation of an Rb-E2F complex that can bind specifically to Rb has been shown to interact with cellular transcription the E2F cognate element. Moreover, we also show that factors E2F and DRTF, which are regulated by some of RBP60 is an Rb-binding protein. The significance and the these oncoproteins (2, 3, 8, 10, 26). Interaction of Rb with role of RBP60 are discussed. E2F is particularly interesting, as it provides an insight into the biochemical function of Rb. E2F has been shown to be involved in the regulation of several proliferation-associated MATERIALS AND METHODS genes (5, 18, 25). Thus, one description of Rb function would Cells and extracts. Mouse L cells and HeLa cells were be that Rb, by negatively regulating E2F, inhibits the expres- grown in Spinner culture using supplemented minimal essen- sion of genes associated with cell proliferation. tial medium (GIBCO; BRL) and 5% calf serum. Extracts The interaction between Rb and E2F has been observed in were prepared by following a previously described proce- several different situations. Extracts of U937 human dure (29, 30). promonocytic cell line contain an Rb-E2F complex that GST-Rb fusions. pGEX-2T clones containing Rb cDNA binds the E2F cognate sequence (8, 31). A second piece of and various mutations at the BamHI site were obtained from evidence that Rb forms a complex with E2F came from a Bill Kaelin and D. M. Livingston (Harvard Medical School). different approach, in which an Rb affinity column selected The clones were transformed into Escherichia coli DH5a. cellular proteins that specifically recognized an oligonucleo- The induction of GST-Rb production and the purification of tide homologous to the E2F cognate sequence (10). Again, in GST-Rbs were carried out by following a previously pub- a different situation, Rb was isolated from mouse L cells in lished procedure (21). The purified preparations were ana- the form of a cellular complex, E2F-I, that specifically lyzed in sodium dodecyl sulfate (SDS)-gels and then stained inhibited the DNA-binding activity of E2F by forming an with Coomassie brilliant blue, and the concentration of Rb E2F-E2F-I complex (2). This third example is different from was estimated by comparing intensities of bands with those the first two in that it suggests that Rb under certain of known standards. conditions can inhibit the DNA-binding ability of E2F. One Plasmids. To obtain the pGEM clones of Rb for in vitro way to reconcile these differences is to postulate the involve- transcription-translation, the Rb sequences from the various ment of other proteins in the Rb-E2F interactions; these pGEX-2T constructs were recovered by polymerase chain other proteins would then determine the mode of Rb regu- reaction. GGGAAGCT'TAGCAGGTATGATCCAACAATT lation of E2F activity. Thus, it would be extremely valuable AATGATGATT was used as the upstream primer, and to identify the accessory proteins involved in Rb-E2F inter- GGCGGATCCTCATTTCTCTTCCTTGTTTGAGGTATC actions and to analyze their roles in Rb function. CAT was used as the downstream primer. The products of To study the interaction of Rb with E2F, we have initiated the polymerase chain reaction were digested with HindIII a detailed analysis using glutathione-S-transferase (GST)-Rb and BamHI and cloned into the HindIII-BamHI sites of fusion proteins. Data presented here show that the addition pGEM 3Z (Promega). of fusion Rb to purified preparations of E2F results in an Assay of E2F. E2F is assayed on the basis of its ability to inhibition of E2F DNA-binding activity. However, addition bind DNA in a sequence-specific manner. The conditions of of these fusion Rbs to cruder preparations of E2F does not the assay have been described elsewhere (28). cause an inhibition of the DNA-binding activity of E2F; in Purification of E2F. E2F was purified from uninfected HeLa cell nuclear extracts and from L-cell whole-cell extracts by using a previously described procedure (34) with * Corresponding author. the following modifications. A Q-Sepharose column was 4327 4328 RAY ET AL. MOL. CELL. BIOL. used in place of the Mono-Q column, and the Q-Sepharose- lleLu tell E2F L-tell EZF column-purified E2F was further purified through a phosphocellulose column as described before (34). The phosphocel- m m lulose-purified E2F from L-cell extracts was treated with '1; a- La: a : :i a) Er K DI 0.9% deoxycholate followed by 1% Nonidet P-40 as de- CBE ° W Z C k >~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_: :; scribed before (1). Upon DNA affinity chromatography, such deoxycholate-treated E2F yields E2F preparations that Gi are essentially free of all E2F-binding proteins. Affinity chromatography was carried out as described before (34). Assay of RBP60. RBP60 is assayed on the basis of its ability to counteract Rb inhibition of E2F and produce a slower migrating complex in gel retardation assays. A typical *' * a;a* reaction mixture contained 20 mM HEPES (N-2-hydroxy- w _ ethylpiperazine-N'-2-ethanesulfonic acid; pH 7.6), 50 mM KCI, 1 mM MgCl2, 0.2 mM dithiothreitol, 1 ,ug of salmon sperm DNA, 0.2 ng of a 3'-end-labeled E2 promoter-containing probe (1), about 5 ng of E2F purified from HeLa cells (34), 1 ng of GST-Rb fusion protein, and 2 to 5 ,ul of column fraction in a total volume of 30 pl. The reaction mixtures were incubated at 25°C for 30 min. Ficoll was added to a final concentration of 3% at the end of the incubation, and an aliquot (7 ,ul) was analyzed in gel retardation assays as described before (34). -* Purification of RBP60. Highly purified preparations of mimi RBP60 can be obtained as by-products of E2F-I purification FIG. 1. Rb-E2F interactions. E2F from HeLa cells at various (2). A large proportion of RBP60 copurifies with E2F-I in stages of purification (A, B, and C) and from L cells (D) was assayed heparin-agarose column, ammonium sulfate fractionation, for DNA binding in the presence of wild-type (WT-RB) or mutant (MU-RB) Rb fusion proteins (10 ng). Heparin-agarose-purified E2F and DEAE-Sepharose chromatographies. RBP60 does not (HA; 5 ,ug), 0.05 ,ug of phosphocellulose-purified E2F (PC), or a few bind to phosphocellulose; as a result, during the purification nanograms of affinity-purified E2F (AFF) was incubated with of E2F-I by phosphocellulose chromatography, E2F-I is GST-Rb fusion proteins in a reaction mixture that contained com- recovered from the bound fractions, and RBP60 is recovered ponents required for the sequence-specific DNA binding of E2F (see from the unbound fraction. The RBP60 activity so obtained Materials and Methods) in a total reaction volume of 30 ,u. At the from L-cell extracts (from 40 liters of cell) was concentrated end of a 30-min incubation at 25°C, aliquots (7 pJ) were analyzed by by precipitation with ammonium sulfate and further purified gel retardation assays as described before (28). The faster migrating by glycerol (7.5 to 30% [vol/vol]) gradient centrifugation. band probably represents partially proteolyzed E2F. In vitro translation of Rb. The plasmids (pGEM 3Z) containing Rb sequences at the HindIII-BamHI sites were linearized with BamHI, and capped RNA was made by proteins were added to E2F at different stages of purification following a previously described protocol (1). RNAs were (Fig. 1). translated in vitro with the reticulocyte lysate kit from We have purified E2F from extracts of HeLa cells and L Promega Biotechnology. [s35]tnethionine-labeled full-length cells by following a procedure described previously (34; see translation products were assayed by SDS-polyacrylamide also Materials and Methods above) with slight modifications. gel electrophoresis and autoradiography. The extracts were fractionated successively through hep- Far-Western blotting. Far-Western blotting experiments to arin-agarose, Q-Sepharose, phosphocellulose, and an E2F- detect Rb-RBP60 interaction were carried out by following a binding site-specific affinity column (for details, see refer- protocol described before (23). ence 34). L-cell extract E2F, which has the same size and binding specificity as HeLa cell E2F (1), purifies as a cyclin A-E2F complex through the phosphocellulose column (data RESULTS not shown). This complex is dissociated with deoxycholate (1) before it is applied to the affinity column. This step yields DNA binding of the Rb-E2F complex involves another E2F that is free of the binding proteins. As can be seen in factor. We have used two GST-Rb fusion proteins, pGT- Fig. 1, these various preparations of E2F interact with Rb to RB(379-928) and pGT-RB(379-928; 706 C-F) (21). Both of produce different results. these fusion proteins contain the C-terminal 549 residues of Addition of the wild-type GST-Rb fusion protein to cruder Rb (between residues 379 and 928), but pGT-RB(379-928; preparations of E2F, for example, the heparin-agarose- 706 C-F) contains a point mutation that results in a replace- purified E2F (Fig. 1A), induced formation of a complex, ment of the cysteine residue at position 706 with a phenyl- E2Fr, at the expense of the E2F-DNA complex. However, alanine. Recent work (17) has shown that a C-terminal addition of the same amount of the wild-type GST-Rb to 56-kDa fragment of Rb is functionally active and can arrest either phosphocellulose-purified (Fig. 1B) or affinity-purified the cell's progression through the cell cycle at the G1 phase. (Fig. 1C and D) E2F did not produce the E2Fr complex, and Thus, for simplicity, we will refer to pGT-RB(379-928) as in fact, Rb inhibited the DNA-binding activity of E2F. The wild type. The point mutant described above [pGT-RB(379- affinity-purified L-cell E2F and HeLa-cell E2F behaved 928; 706 C-F)] is a loss-of-function mutant and does not bind similarly in these assays. The Q-Sepharose-purified E2F DNA tumor virus oncoproteins (21). Also, it has been shown from HeLa cells exhibited an intermediate phenotype (data that this mutant is phosphorylation defective (22). As de- not shown). In this experiment, we used 10 ng of GST-Rb; scribed below, the wild-type and mutant GST-Rb fusion however, we got the same result with 5 ng of GST-Rb. These VOL. 12, 1992 RBP60 AND Rb-E2F COMPLEX 4329 effects of Rb on E2F are not nonspecific, because addition of GST-Rb had no effect on the DNA-binding activity of o another transcription factor, E4F (data not shown). Thus, there are two major differences between purified E2F and E2F in the crude extracts. First, E2F in the crude extracts is protected from Rb inhibition, and second, E2F in ) w the crude extracts forms a complex with Rb that binds DNA LL and migrates differently from the E2F-DNA complex in gel CMWo U) retardation assays. These results suggest that cruder prepa- + +CL + a. rations of E2F contain activities that allow formation of an 0 CDm Rb-E2F-DNA complex. A similar suggestion is made by c cc QC cc co a: m Hiebert et al. (18a) on the basis of experiments using cc n 100 + Mono-Q-purified and affinity-purified E2F preparations. In <, X m a]; com l those experiments, the Mono-Q-purified preparation of E2F CM+ + + + +++ + + CnL produced an Rb-E2F complex that bound DNA, whereas the a : affinity-purified preparation failed to produce such a com- w c plex. We included a phosphocellulose chromatography step in our E2F purification procedure before performing an affinity column step. E2F purified in this manner does not form an Rb-E2F-DNA complex; moreover, we also find that Rb inhibits the DNA-binding ability of E2F. This is consis- tent with our previous observation that Rb copurifies with an inhibitor, E2F-I, that inhibits the DNA-binding activity of -E2Fr E2F. The extent of Rb inhibition of the DNA-binding activ- IS- -E2F ity of E2F varies with preparations of purified E2F. How- ever, purified E2F was reproducibly unable to form the E2Fr complex. Identification of cellular activity, RBP60, that induces formation of the E2Fr complex. Since we routinely fractionate L-cell extracts, various column fractions obtained from such extracts were assayed for an activity that would produce the E2Fr complex. The column fractions were assayed in reaction mixtures that contained purified E2F, pGT-RB(379- 928), and a specific DNA probe along with other components required for E2F-specific DNA binding. L-cell extracts were first fractionated by heparin-agarose chromatography, and the 0.25 M eluate of this column was then fractionated by ammonium sulfate and DEAE-Sepharose chromatography 2 3 4 5 6 7 5 9 10 11 as described before (2). In the course of these fractionations, FIG. 2. Identification of an activity that induces formation of the we identified an activity, RBP60, that blocked Rb inhibition E2Fr complex. Affinity-purified E2F was incubated alone (lane 1) or and cooperated with the wild-type Rb (lane 5, Fig. 2) but not with the indicated components in the presence of reagents required with a mutant Rb, pGT-RB(379-928; 706 C-F) (lane 7, Fig. 2), for the sequence-specific DNA binding of E2F as described in the to induce the formation of the E2Fr complex. Moreover, as text. The RBP60 activity used in this experiment was an 0.1 M can be seen in Fig. 2, the reconstituted Rb-E2F complex is eluate of a phosphocellulose column (see Materials and Methods). regulated by adenovirus ElA protein. Addition of GST-ElA Reaction mixtures received 0.1 p,g of RBP60 (lane 2); 10 ng of dissolved the E2Fr complex and released free E2F (lane 9, pGT-RB(379-928) (WT-RB) (lane 3); 10 ng of pGT-RB(379-928; 706 C-F) (Mutant-RB) (lane 4); 0.1 jig of RBP60 and 10 ng of WT-RB Fig. 2). Thus, this reconstituted Rb-E2F complex behaves (lane 5); the same components as lane 5 plus 50 ng of an oligonu- similarly to the ElA-regulated Rb-E2F complex present in cleotide corresponding to the E2F-binding site (lane 6); 0.1 ,ug of the extracts of the U937 promonocytic cell line (8). RBP60 and 10 ng of Mutant-RB (lane 7); 0.1 ,ug of RBP60, 10 ng of A large proportion of the RBP60 activity copurifies with WT-RB, and 10 ng of GST (lane 8); 0.1 p.g of RBP60, 10 ng of E2F-I activity in heparin-agarose, ammonium sulfate frac- WT-RB, and 10 ng of GST-E1A (12s) (lane 9); 0.1 ,ug of RBP60 alone tionation, and DEAE-Sepharose chromatographies (data not in the absence of added E2F (lane 10); or 0.1 pg of RBP60 and 10 ng shown). RBP60 was separated from E2F-I during chroma- of WT-RB in the absence of E2F (lane 11). tography through a phosphocellulose column. E2F-I binds to phosphocellulose (2), and all RBP60 activity was detected in the flowthrough material of this column (data not shown). min, indicating that the native molecular weight of RBP60 is The RBP60 at this step is usually over 70% pure, because slightly less than that of bovine serum albumin. We also see most of the proteins applied to phosphocellulose bind to the increases in the levels of E2F-DNA complex in fractions 12, column. The phosphocellulose-purified material was further 13, 14, and 15. These increases in the E2F-DNA complex purified by glycerol gradient centrifugation. Figure 3 shows most likely result from the breakdown of the E2Fr complex. results of this purification procedure. Figure 3A shows an As can be seen in Fig. 3B, the major protein in the active assay for RBP60 activity, and Fig. 3B shows a silver-stained fractions of the purified RBP60 is a 60-kDa polypeptide. We SDS-gel of the gradient fractions. Clearly, fractions 12, 13, also detected a minor band of 57 kDa. We believe that the 14, and 15 contained the RBP60 activity that blocked Rb 57-kDa band is a breakdown product of the 60-kDa band, as inhibition and produced the E2Fr complex. Also, the RBP60 digestion of these two polypeptides with CNBr produced activity sedimented slightly slower than bovine serum albu- almost identical band patterns (data not shown). Further- 4330 RAY ET AL. MOL. CELL. BIOL.

A Ila as e ( 6 0 C ) B DA).6 k r," L-cell HeLa cell I I E2F E2F

rN Nr N rN

< C < C _ c r.~~ _,. C

-F2Fr -E2F-- -E2

E2Fr--. E2F --- ..... <

fraction no. * 6 7 8 9 Q0 ½;, 33-e

96kD - 66kD -

45kD-

3ikD- -i

1 2 3 4 5 6

21kD - FIG. 4. E2Fr complex induced by purified RBP60 contains Rb. E2Fr complexes were reconstituted by using glycerol gradient- and fraction no. 45 7 8 9 IC 1' 2 13 l151 1' purified RBP60 affinity-purified E2F from L cells (lanes 1 to 3) or HeLa cells (lanes 4 to 6) by following the procedure described FIG. 3. Purification of RBP60. RBP60 activity was purified from under the assay of RBP60 in Materials and Methods except that L-cell extracts by heparin-agarose, ammonium sulfate, DEAE- reaction mixtures in lanes 2 and 5 also received 0.3 pg of an Sepharose, and phosphocellulose chromatographies and finally by antiserum against the c-fos protein (c-fos Ab2; Oncogene Science) glycerol gradient centrifugation (as described in Materials and and reaction mixtures in lanes 3 and 6 received 0.3 ,ug of an Methods). (A) Assay of RBP60 activity in fractions obtained from antiserum against Rb (Rb-Ab2; Oncogene Science). At the end of a the glycerol gradient. An aliquot (3 ,ul) of the indicated fractions was 30-min incubation, aliquots of the reaction mixtures were analyzed assayed in the presence of 10 ng of wild-type Rb and affinity-purified as before. E2F as described in the text. A separate glycerol gradient was run with standard molecular weight marker proteins. Peak fractions, containing bovine serum albumin (BSA) and aldolase, are indicated E2Fr complex induced by purified RBP60 contains Rb. We at the top with arrows. (B) SDS-polyacrylamide gel analysis of the glycerol gradient fractions. Aliquots (50 ,u) of the indicated fractions then tested to see whether the E2Fr complex induced by were subjected to 10% SDS-polyacrylamide gel electrophoresis purified RBP60, purified E2F, and Rb contains Rb as a followed by silver staining. The first lane at the left shows the component of the complex. To do this, the E2Fr complex migrations of molecular weight markers. was first formed with purified L-cell E2F (lanes 1 to 3, Fig. 4) or purified HeLa-cell E2F (lanes 4 to 6, Fig. 4). The complexes were then further incubated alone, with an Rb- more, the experiment whose results are shown in Fig. 3 also peptide antiserum (RB-Ab2; Oncogene Science) or with a shows that the 60-kDa polypeptide comigrates with the control antiserum (fos-Ab2; Oncogene Science). As can be RBP60 activity during glycerol gradient centrifugation (com- seen in Fig. 4, Rb-specific antiserum specifically recognizes pare Fig. 3A and B). Thus, on the bases of the sedimentation the E2Fr complex and causes a further retardation of that property of RBP60, SDS-gel analysis, and copurification of complex in a mobility shift assay. This suggests that the the 60-kDa band with the RBP60 activity during glycerol E2Fr complex contain Rb as a component. The control gradient centrifugation, we conclude that the 60-kDa poly- antiserum had no effect on the E2Fr complex (lanes 2 and 4, peptide represents the RBP60 activity. Fig. 4). VOL. 12, 1992 RBP60 AND Rb-E2F COMPLEX 4331

_ _ B. _~ _ N N N N CL CL - -L I- e0 e a: W Lo Lo to

*: t. g-7kD --7D i,.. - PHOSPHORYLASE B (97 kD) -671(0- -666

GST-E1A [ - BOVINE SERUM ALBUMIN (66 kD) -450kD -45kD

-3tkD I -31kD -OVALBUMIN (451kD)

,, r:, " "

4 t... 2 3 1 2 WT-RB MU-RB wr- MU- - CARBONIC ANHYDRASE (31kD) RB RB

FIG. 5. RBP60 is an Rb-binding protein. (A) Far-Western blotting for EIA. GST-E1A fusion proteins GST-12SE1A and GST- 12SE1A(CR1) were used in this experiment. The construction of plasmid-encoding GST-12SE1A has been described before (2). The plasmid encoding GST-12SE1A(CR1) was constructed by following a similar protocol except that an ElA plasmid bearing a deletion corresponding to amino acids 38 to 67 of ElA (27) was used as template in the polymerase chain reaction. We always get partial degradation of the ElA fusion proteins during purification by using a standard protocol. The wild-type construct (GST-12SE1A) produces two bands (66 and 46 kDa) in a Coomassie-stained SDS-gel, and the mutant [GST-12SELA(CR1)] produces two bands of 63 and 50 kDa. The 66- and 63-kDa bands represent the full-length products. ElA fusion proteins (6 ,ug in each lane) were applied for 10% SDS-gel electrophoresis followed by electroblotting to nitrocellulose. Lanes 1 and 3 contained the wild-type fusion protein (GST-12SE1A), and lanes 2 and 4 contained the mutant product [GST-12SElA(CR1)]. Lanes 1 and 2 were probed with wild-type Rb (WT-RB), while lanes 3 and 4 were probed with mutant Rb (MU-RB). (B) Far-Western blotting for Rb binding of RBP60. Phosphocellulose-purified RBP60 [RBP60(PC); 2 Fg of protein] was electrophoresed in a 10% SDS-gel and then Western blotted to a nitrocellulose membrane. The nitrocellulose membrane was cut, and lane 1 was probed with wild-type '35-labeled Rb (WT-RB), whereas lane 2 was probed with s35-labeled mutant Rb (MU-RB) as described before (23). The blots were covered with Saran wrap, and autoradiography was carried out for 64 h. Migrations of molecular weight standards are indicated at the right. (C) Far-Western assay for RBP60, phosphorylase b, bovine serum albumin, ovalbumin, and carbonic anhydrase. Phosphocellulose-purified RBP60 (0.5 ,ug; RBP60) and Bio-Rad low-molecular-weight marker (2 pLg of each of the indicated proteins [lane M.W.MARKER]) were electrophoresed in a 10% SDS-gel and then blotted to a nitrocellulose membrane. The blot was then probed with s35-labeled wild-type Rb as described above. Autoradiography was carried out for 24 h.

RBP60 is an Rb-binding protein. We then investigated how blotted onto a nitrocellulose membrane. The nitrocellulose RBP60 counteracts Rb inhibition and induces formation of blot was denatured and renatured by sequential treatment the E2Fr complex. A titration experiment (not shown) with with 6 M guanidine hydrochloride and 0.1 M guanidine increasing amounts of RBP60 suggested that the reaction hydrochloride as described before (23). The blots were then involved in the formation of the E2Fr complex was noncat- separately probed with reticulocyte lysate containing s35- alytic and most likely involved physical association of the labeled wild-type and mutant Rbs. As can be seen in Fig. SA, components. RBP60 alone, when added to E2F, did not alter wild-type Rb binds a fusion protein containing wild-type the mobility of the E2F-DNA complex in gel retardation ElA (GST-12SE1A) and poorly binds an ElA fusion protein assays (Fig. 2, lane 2). This observation suggests that RBP60 [GST-12SElA(CR1)] that lacks sequences of ElA (amino most likely does not interact with E2F directly and that the acids 38 to 67) important for Rb-ElA interaction (33). formation of the E2Fr complex may involve an interaction Moreover, a mutant Rb gene product (MU-RB) that does not between Rb and RBP60. Attempts to see a specific interac- bind ElA (21) was also unable to bind ElA in the far- tion between Rb and RBP60 by using GST-Rb fusion protein Western assay (Fig. 5A, lanes 3 and 4). These results linked to glutathione-Sepharose were blurred by nonspecific indicate that a far-Western assay with s35-labeled Rb can be binding of RBP60 to the glutathione-Sepharose beads (data used to detect specific Rb-binding Eroteins. not shown). However, the availability of s35-labeled Rb Reticulocyte lysates containing 35-labeled wild-type Rb allowed us look for a direct interaction between Rb and and mutant Rb were then used to probe blots containing RBP60 by using the far-Western method (23). RBP60 (Fig. SB). In this experiment, RBP60 purified by the Appropriate pGEM clones encoding amino acid residues phosphocellulose step was used. Clearly, wild-type Rb rec- 379 to 928 of Rb (WT-RB) or with a point mutation (MU-RB; ognized RBP60 (Fig. SB, lane 1), and mutant Rb was replacement of cysteine with phenylalanine at residue 706) significantly impaired in its ability to bind RBP60. Moreover, were used to produce s35-labeled Rb by using SP6 polymer- when a series of polypeptides including phosphorylase b (2 ase and reticulocyte lysates (data not shown). The s35- ,ug), bovine serum albumin (2 ,ug), ovalbumin (2 p,g), and labeled Rbs were then used to probe protein blots containing carbonic anhydrase (2 ,ug) was probed simultaneously RBP60 or a known Rb-binding protein, ElA, by following with RBP60 (0.5 p,g), only RBP60 was recognized by Rb. the protocol described before (23). Briefly, the protein These results suggest that Rb can specifically interact with samples were separated by SDS-gel electrophoresis and then RBP60. 4332 RAY ET AL. MOL. CELL. BIOL.

DISCUSSION cell cycle and that this restriction point occurs long before the time at which Rb becomes hyperphosphorylated. Micro- The studies of Rb regulation of E2F activity have signifi- injection of Rb after the restriction point had no inhibitory cant impact on our understanding of the biochemical func- effect on cells' progression through the cell cycle. This tion of Rb and Rb-mediated tumor suppression. E2F-binding suggests that the growth-inhibitory function of Rb can be sites are present in the promoters of several proliferation- neutralized by mechanisms other than phosphorylation. This associated genes (5, 25). E2F sites in the promoters of c-myc is interesting in light of our observation that extracts from and dhfr have been shown to regulate expression of these growing cells contain a factor, RBP60, that protects targets genes (5, 18). Negative regulation of E2F activity by Rb such as E2F from Rb inhibition. would prevent expression of these proliferation-associated It is quite likely that the inhibitory function of Rb is genes, which in turn would inhibit cell proliferation. We regulated at two levels. The first level may involve specific recently identified an inhibitor, E2F-I, that specifically in- interaction of Rb with regulatory proteins, for example, hibits the DNA-binding activity of E2F (27). Moreover, we RBP60. In the absence of RBP60, Rb-E2F complex does not also showed that Rb is an integral part of this inhibitory bind DNA, and the addition of RBP60 stimulates the DNA- activity (2). Here, we show that Rb produced in bacteria can binding activity of an Rb-E2F complex, most likely by inhibit the DNA-binding activity of E2F. The bacterially interacting with Rb. One attractive model would be that this produced GST-Rb fusion protein is much less active than is a mechanism by which Rb is localized on the DNA for the E2F-I in that it cannot inhibit E2F in crude extract, and second level of regulation, which is hyperphosphorylation. again, the extent of the inhibition obtained with purified E2F In this regard, it is interesting to note that a cell cycle- varies from 60 to 90%. The reason for this difference regulated kinase that can potentially phosphorylate Rb is between Rb and E2F-I is not clear. also localized to the DNA by the same transcription factor, We also find that adding Rb to crude extracts induces the E2F (7, 14, 31) and that E2F-binding sites are present in formation of a new E2F-containing complex, E2Fr. This multiple copies in cellular promoters (25). suggests that the crude cellular extracts contain proteins that DRTF, an E2F-related factor, has been shown to interact allow the Rb-E2F complex to bind DNA. We have fraction- with Rb dependent on cyclin A (3, 4). We, however, have ated mouse L-cell extracts and looked for activities that not seen any indication of cyclin A in the E2Fr complex. The would allow formation of the E2Fr complex. These fraction- purified RBP60 is not recognized by antiserum raised against ations resulted in the identification of a factor, RBP60, that cyclin A. On the other hand, it is quite possible that RBP60 apparently contains two properties; that is, it can block Rb represents other type of cyclins, especially the G1 cyclins inhibition and at the same time can induce the formation of (19). Clearly, further analysis of RBP60 will be valuable in the E2Fr complex. We have not been able to separate these this regard. two activities; they copurify as a single entity with RBP60. One explanation for these phenomena is that Rb can form a ACKNOWLEDGMENTS binary complex with E2F and that this binary complex has a We thank J. R. Nevins (Duke University), E. B. Tichener lower affinity for DNA; addition of RBP60 produces a (University of Illinois at Chicago [UIC]), and R. Storti (UIC) for ternary complex which has higher affinity for DNA, and this critically reviewing the manuscript. We also thank W. Kaelin and D. DNA complex (E2Fr) has a mobility that is distinct from that Livingston (Harvard Medical School) for providing us with the of the simple E2F-DNA complex. Support for this explana- pGEX-Rb clones. The cyclin A antiserum was a generous gift of tion comes from the purification and characterization of Tony Hunter and J. Pines (Salk Institute). RBP60. S.B. is supported by grants from the American Cancer Society- Several Rb-binding proteins have been identified (13, 20, Illinois division (M6-66578), the Leukemia Research Foundation, 21). However, their biochemical functions have yet to be and the Council for Tobacco Research-USA Inc. This work was also supported by Public Health Service grant CA 55279-01 from the determined. By doing biochemical assays, we have identified National Cancer Institute to P.R. a 60-kDa Rb-binding protein that appears to modulate Rb regulation of the DNA-binding activity of E2F. Although a REFERENCES direct interaction between Rb and E2F has yet to be shown, 1. Bagchi, S., P. Raychaudhuri, and J. R. Nevins. 1990. Adenovirus we find that bacterially produced Rb can interact with the ElA protein can dissociate heteromeric complexes involving most purified preparations of E2F, leading to an apparent the E2F transcription factor: a novel mechanism for ElA loss of the DNA-binding activity of E2F, and we speculate trans-activation. Cell 62:659-669. that this Rb-E2F interaction involves formation of a binary 2. Bagchi, S., R. Weinmann, and P. Raychaudhuri. 1991. The complex containing Rb and E2F. RBP60 reverses the inhib- retinoblastoma protein copurifies with E2F-I, an ElA-regulated itory effect of Rb and induces the formation of a complex, inhibitor of the transcription factor E2F. Cell 65:1063-1072. 3. Bandara, L. R., J. P. Adamczewskd, T. Hunt, and N. B. La E2Fr, that binds DNA and in gel retardation assays migrates Thangue. 1991. Cyclin A and the retinoblastoma gene product slower than a simple E2F-DNA complex. Given the facts complex with a common transcription factor. Nature (London) that the formation of the E2Fr complex is dependent on E2F, 352:249-251. Rb, and RBP60 (Fig. 2) and that this complex contains Rb 4. Bandara, L. R., and N. B. La Thangue. 1991. Adenovirus ElA (Fig. 4) along with the observation that RBP60 is an Rb- prevents the retinoblastoma gene product from complexing with binding protein, it is quite likely that the E2Fr complex a cellular transcription factor. Nature (London) 351:494-497. contains all three components. 5. Blake, M. C., and J. C. Azizkhan. 1989. Transcription factor It has been suggested that the function of Rb is regulated E2F is required for efficient expression of the hamster dihydro- folate reductase gene in vitro and in vivo. Mol. Cell. Biol. by phosphorylation (6, 9, 11, 24). Several lines of evidence 9:4994-5002. (11) indicate that Rb is hyperphosphorylated at the G1-S 6. Buchkovich, K., L. A. Duffy, and E. Harlow. 1989. The retino- boundary of the cell cycle and that the hyperphosphorylated blastoma protein is phosphorylated during specific phases of the Rb is functionally inactive. However, more-recent experi- cell cycle. Cell 58:1097-1105. ments (17) indicate that the regulatory function of Rb is 7. Cao, L., B. Faha, M. Dembski, L.-H. Tsai, E. Harlow, and N. inactive after a certain restriction point in the G1 phase of the Dyson. 1992. Independent binding of the retinoblastoma protein VOL. 12, 1992 RBP60 AND Rb-E2F COMPLEX 4333

and p107 to the transcription factor E2F. Nature (London) can interact specifically with the T/ElA-binding region of the 355:176-179. retinoblastoma gene product. Cell 64:521-532. 8. Chellapan, S. P., S. Heibert, M. Mudryj, J. M. Horowitz, and 22. Kaye, F. J., R. A. Kratzke, J. L. Gerster, and J. M. Horowitz. J. R. Nevins. 1991. The E2F transcription factor is a cellular 1990. A single amino acid substitution results in a retinoblas- target for the RB protein. Cell 65:1053-1061. toma protein defective in phosphorylation and oncoprotein 9. Chen, P.-L., P. Scully, J.-Y. Shew, J. Y. J. Wang, and W.-H. binding. Proc. Natl. Acad. Sci. USA 87:6922-6926. Lee. 1989. Phosphorylation of the retinoblastoma gene product 23. Lee, W. S., C. C. Kao, G. 0. Bryant, X. Liu, and A. Berk. 1991. is modulated during the cell cycle and cellular differentiation. Adenovirus ElA activation domain binds the basic repeat in the Cell 58:1193-1198. TATA box transcription factor. Cell 67:365-376. 10. Chittenden, T., D. M. Livingston, and W. G. Kaelin, Jr. 1991. 24. Ludlow, J. W., J. Shon, J. M. Pipas, D. M. Livingston, and J. A. The T/ElA-binding domain of the retinoblastoma product can DeCaprio. 1990. The retinoblastoma susceptibility gene product interact selectively with a sequence-specific DNA-binding pro- undergoes cell cycle-dependent dephosphorylation and binding tein. Cell 65:1073-1082. to and release from SV 40 large T. Cell 60:387-396. 11. DeCaprio, J. A., J. W. Ludlow, J. Figge, J. Shew, C. M. Huang, 25. Mudryj, M., S. W. Heibert, and J. R. Nevins. 1990. A role for W. H. Lee, E. Marsilio, E. Paucha, and D. M. Livingston. 1989. the adenovirus inducible E2F transcription factor in a prolifer- The product of the retinoblastoma susceptibility gene has prop- ation-dependent signal transduction pathway. EMBO J. 7:2179- erties of a cell cycle regulatory element. Cell 58:1085-1095. 2184. 12. DeCaprio, J. A., J. W. Ludlow, J. Figge, J. Y. Shew, C. M. Lee, 26. Phelps, W. C., S. Bagchi, J. A. Barnes, P. Raychaudhuri, V. E. Marsilio, E. Paucha, and D. M. Livingston. 1988. SV40 large Kraus, K. Munger, P. M. Howiey, and J. R. Nevins. 1991. tumor antigen forms a specific complex with the product of the Analysis of trans activation by human papillomavirus type 16 retinoblastoma susceptibility gene. Cell 54:275-283. E7 and adenovirus 12S ElA suggests a common mechanism. J. 13. Defeo-Jones, D., P. S. Huang, R. E. Jones, K. M. Haskell, G. A. Virol. 65:6922-6930. Vuocolo, M. G. Hanobik, H. E. Huber, and A. Oliff. 1991. 27. Raychaudhuri, P., S. Bagchi, E. Moran, S. Devoto, V. Krause, Cloning of cDNA for cellular proteins that bind to the retino- and J. R. Nevins. 1991. Domains of the adenovirus ElA protein blastoma gene product. Nature (London) 352:251-254. that are required for oncogenic activity are also required for 14. Devoto, S. H., M. Mudryj, J. Pines, T. Hunter, and J. R. Nevins. dissociation of cellular transcription factor complexes. Genes 1992. A cyclin A-protein kinase complex possesses sequence- Dev. 5:1200-1211. specific DNA binding activity: p33 cdk2 is a component of the 28. Raychaudhuri, P., S. Bagchi, S. D. Neill, and J. R. Nevins. 1990. E2F-cyclin A complex. Cell 68:167-176. Activation of E2F transcription factor in adenovirus-infected 15. Dyson, N., K. Buchkovich, P. Whyte, and E. Harlow. 1989. The cells involves ElA-dependent stimulation of DNA-binding ac- cellular 107k protein that binds to adenovirus ElA also associ- tivity and induction of cooperative binding mediated by an E4 ates with the large T antigens of SV40 and JC virus. Cell gene product. J. Virol. 64:2702-2710. 58:249-255. 29. Raychaudhuri, P., S. Bagchi, and J. R. Nevins. 1989. DNA- 16. Dyson, N., P. M. Howley, K. Munger, and E. Harlow. 1989. The binding activity of the adenovirus-induced transcription factor is human papillomavirus 16 E7 oncoprotein is able to bind to the regulated by phosphorylation. Genes Dev. 3:620-627. retinoblastoma gene product. Science 243:934-937. 30. Raychaudhuri, P., R. Rooney, and J. R. Nevins. 1987. Identifi- 17. Goodrich, D. W., N. P. Wang, Y. Qian, E. Y.-H. P. Lee, and cation of an ElA inducible cellular factor that interacts with W.-H. Lee. 1991. The retinoblastoma gene product regulates regulatory sequences within the adenovirus E4 promoter. progression through the Gl phase of the cell cycle. Cell 67:293- EMBO J. 6:4073-4081. 302. 31. Shirodkar, S., M. Ewen, J. A. DeCaprio, J. Morgan, D. M. 18. Hiebert, S. W., M. Blake, J. Azizkhan, and J. R. Nevins. 1991. Livingston, and T. Chittenden. 1992. The transcription factor Role of the E2F transcription factor in ElA-mediated transac- E2F interacts with the retinoblastoma product and a p107-cyclin tivation of cellular genes. J. Virol. 65:3547-3552. A complex in a cell cycle-regulated manner. Cell 68:157-166. 18a.Hiebert, S. W., S. P. Chellapan, J. M. Horowitz, and J. R. 32. Whyte, P., J. J. Buchkovich, J. M. Horowitz, S. H. Friend, M. Nevins. 1992. The interaction of RB with E2F coincides with an Raybuck, R. A. Weinberg, and E. Harlow. 1988. Association inhibition of the transcriptional activity of E2F. Genes Dev. between an oncogene and an anti-oncogene: the adenovirus 6:177-185. ElA proteins bind to the retinoblastoma gene product. Nature 19. Hunter, T., and J. Pines. 1991. Cyclins and cancer. Cell 66: (London) 334:124-129. 1071-1074. 33. Whyte, P., N. M. Williamson, and E. Harlow. 1989. Cellular 20. Huang, S., W.-H. Lee, and E. Y.-H. P. Lee. 1991. A cellular targets for transformation by the adenovirus ElA proteins. Cell protein that competes with SV40 T antigen for binding to the 56:67-75. retinoblastoma gene product. Nature (London) 350:160-162. 34. Yee, A. S., P. Raychaudhuri, L. Jakoi, and J. R. Nevins. 1989. 21. Kaelin, W. G., Jr., D. C. Pallas, J. A. DeCaprio, F. J. Kaye, and The adenovirus-inducible factor E2F stimulates transcription D. M. Livingston. 1991. Identification of cellular proteins that after specific DNA binding. Mol. Cell. Biol. 9:578-585.