Chapter 1 on Page 17)

UC San Diego UC San Diego Electronic Theses and Dissertations

Title Protein localization and peptidoglycan hydrolysis during engulfment in Bacillus subtilis

Permalink https://escholarship.org/uc/item/4wn6d926

Author Aung, Stefan Denis

Publication Date 2007

Peer reviewed|Thesis/dissertation

eScholarship.org Powered by the California Digital Library University of California

UNIVERSITY OF CALIFORNIA, SAN DIEGO

Protein localization and peptidoglycan hydrolysis during engulfment in Bacillus subtilis

A dissertation submitted in partial satisfaction of the

requirements for the degree Doctor of Philosophy

Biology

Stefan Denis Aung

Committee in charge:

Professor Kit Pogliano, Chair Professor Doug Bartlett Professor Michael Burkart Professor Partho Ghosh Professor Lorraine Pillus

2007

Stefan Denis Aung, 2007

The Dissertation of Stefan Denis Aung is approved, and it is acceptable in quality and form for publication on microfilm:

Chair

University of California, San Diego

2007

iii

Dedication

To my wife, Carissa, and my parents, Dr. Louis and Maureen Aung, who have always

supported me in all my endeavors. Thank you for raising me the right way, and for

loving me unconditionally.

Table of Contents

Signature Page ……………………………………………………………………… iii

Dedication …………………………………………………………………………... iv

Table of Contents ……………………………………………………………………. v

List of Symbols and Abbreviations ………………………………………………… ix

List of Figures...……………………………………………………………………... xi

List of Tables .………………………………………………………………………xiv

Acknowledgements ………………………………………………………………….xv

Curriculum Vitae ...……………………………………………………………….. xvii

Abstract ………………………………………………………………………...... xviii

I. CHAPTER ONE: Introduction……………..………………………………………...1

A. Survival strategies...... 3

B. Engulfment - The beginning stages of sporulation ………………………………. 7

C. Engulfment - What is known?...... 10

D. A potential role for peptidoglycan hydrolases ...... 15

E. Two modules mediate membrane migration during engulfment ...... 21

II. CHAPTER TWO: Dual localization pathways for the engulfment proteins during Bacillus subtilis sporulation ………………………………….…………………….. 30

A. Summary ………………………………………………………………………... 31

B. Introduction …………………………………………………………………...… 31

C. Results …………………………………………………………………………... 32

1. Localization of SpoIIB ………………………………………………………... 32 2. Interactions between the DMP proteins …………………………………….… 34

3. Localization of SpoIIM and SpoIIP to the septum partially depends on SpoIIB ………………………………………………………………………… 35

4. Rescue of the synergistic engulfment defect of SpoIIP-GFP, spoIIB strains … 35 5. Colocalization of SpoIIB with FtsZ and SpoIIM and SpoIIP ………………… 35 6. Evidence for a SpoIIB-independent targeting pathway ………………………. 35 7. Elimination of both the primary (SpoIIB) and secondary (SpoIVFAB) localization pathways blocks engulfment at the stage of septal thinning …….. 38

D. Discussion ………………………………………………………………………. 38

E. Experimental procedures ………………………………………………………... 40

1. Bacterial strains, genetic manipulations and growth condtions ………………. 40 2. Construction of m-Cherry fusions ……………………………………………. 41 3. Microscopy and image analysis ………………………………………………. 41 4. Antibody production ………………………………………………………….. 41 5. Co-immunoprecipitation and Western blotting ………………………………. 41 6. Immunofluorescence microscopy …………………………………………….. 41

F. Acknowledgements ……………………………………………...……………… 42

G. References ………………………………………………………..………….….. 42

H. Supplemental data …………………………………………………...………….. 44

I. Acknowledgements ...... 47

III. CHAPTER THREE: A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forespore ……………………….………..…… 48

A. Abstract ………………………………………………………………………… 49

B. Introduction …………………………………………………………………….. 49

C. Results ………………………………………………………………………….. 50

1. A genetic screen for membrane migration-defective mutants ……………….. 50 2. Localized mutagenesis of spoIID …………………………………………….. 52 3. Localization of the mother cell-expressed engulfment proteins ……………... 53

4. SpoIID is a peptidoglycan hydrolase ………………………………………… 54 5. The leading edge of the engulfing membrane advances adjacent to the cell wall …………………...………………………………………………….. 55

D. Discussion ……………………………………………………………………… 55

E. Materials and methods ………………………………………………………….. 56

1. Bacterial strains, genetic manipulations, and growth conditions ….………….. 56 2. Localized mutagenesis of spoIID ………………………………….………….. 57 3. Isolation of spoIIP95-2 ……………………...…………………….………….. 57 4. Construction of GFP fusions ……………………………………....…………. 57 5. Microscopy and image analysis ……...…………………………….…………. 58 6. Overexpression and purification of His-SpoIID and His-SpoIIP …………….. 58 7. Renaturing gel electrophoresis for cell wall hydrolytic activity ……………… 58 8. Electron microscopy ………………………………………………………….. 58

F. Acknowledgements ……….………………………………………….………..… 58

G. References ………………………………………………………………………. 59

H. Acknowledgements ...... 61

IV. CHAPTER FOUR: Mutational analysis of the endopeptidase SpoIID in Bacillus subtilis …………………………………………………………………………..….. 62

A. Abstract ...... 63

B. Introduction ...... 64

C. Materials and Methods...... 70

1. Bacterial strains, genetic manipulations, and growth conditions...... 70

2. Construction of His6-SpoIID...... 70 3. Site-directed mutagenesis ...... 71 4. Microscopy and image analysis ...... 71 5. Overexpression and purification of His-SpoIID and mutant proteins ...... 72 6. Renaturing gel electrophoresis for cell wall hydrolytic activity (Zymography).73

vii

7. Cell wall binding...... 73 8. Spore titer assay ...... 74 D. Results...... 76

1. Site-directed mutagenesis of SpoIID ...... 76 2. Peptidoglycan hydrolysis is necessary for engulfment...... 81 3. Sporulation defective mutants...... 81 4. SpoIID is an endopeptidase ...... 87 E. Discussion...... 92

F. Acknowledgements...... 96

V. CHAPTER FIVE: Concluding Discussion ………………………….…………….. 97

VI. APPENDIX: Crystallization Trials of SpoIID ….…………………..……..………110

A. Introduction...... 111

B. Results ...... 113

1. Purification and crystallization trials of first generation construct, His6-SpoIID (27-343)...... 113 2. Limited Proteolysis ...... 119

3. Second generation construct, His6-TEV-SpoIID (56-343) ...... 123 4. Purification of third generation construct, SpoIID (56-343) ...... 125 5. Crystallization trials of third generation construct, SpoIID (56-343)...... 127 6. Discussion ...... 130 C. Acknowledgements ...... 132

VII. REFERENCES ………………………………………………………………….. 133

viii

List of Symbols and Abbreviations

C celsius dI deionized

DAPI 4’, 6-diamidino-2-phenylindole

DMSO dimethylsulfonyloxide

DNA deoxyribonucleic acid

DNAse I deoxyribonuclease I

DSM Difco sporulation media

Dpm meso-diaminopimelic acid

EtOH ethanol

FM 4-64 red fluorescent membrane stain g gram

GFP green fluorescent protein (derived from Aequorea Victoria)

HPLC high performance liquid chromatography hr./hrs. hour/hours

IPTG isopropyl-β-D-thiogalactopyranoside

Kan kanamycin

KOH potassium hydroxide

M molarity mA milliamp mg milligram min minute ml/mls milliliter/milliliters

mM millimolar

NaCl sodium chloride

NAG N-acetylglucosamine

NAM N-acetylmuramic acid nm nanometer

OD optical density

O/N overnight

PAGE polyacrylamide gel electrophoresis

PMSF phenylmethylsulfonyl flouride rpm revolutions per minute

RT room temperature

SDS sodium dodecyl sulfate sec second t time

μm micrometer

μg microgram

μl microliter

V volt

List of Figures

CHAPTER ONE

Figure 1.1. Developmental pathways of Bacillus subtilis...... 5

Figure 1.2. Schematic representation of engulfment ...... 9

Figure 1.3. Localization pattern of GFP-SpoIID, GFP-SpoIIM, GFP-SpoIIP ...... 14

Figure 1.4. Classes of peptidoglycan hydrolases...... 17

Figure 1.5. Two modules for engulfment ...... 24

CHAPTER TWO

Figure 2.1. The sporulation pathway of B. subtilis ……….…………………………… 32

Figure 2.2. Localization of SpoIIB-mCherry…….…………………………………….. 33

Figure 2.3. Localization of GFP-SpoIIM and GFP-SpoIIP in mutant backgrounds .…. 34

Figure 2.4. Localization of GFP-SpoIIP in the presence of untagged SpoIIP to rescue synergistic engulfment defects…………….....…………………………….. 36

Figure 2.5. Colocalization of SpoIIB-mCherry with FtsZ-GFP, GFP-SpoIIM and GFP-SpoIIP………………….…………………………………………...… 37

Figure 2.6. Synergistic engulfment defect in the absence of SpoIIB and SpoIVFAB.… 38

Figure 2.7. Model for DMP localization …………….………………………………… 39

Figure 2.S1. Quantification of relative enrichment of GFP-SpoIIP in wild type and spoIIB sporangia ……………………….………………………………... 44

Figure 2.S2. Localization of SpoIIP by immunofluorescenece microscopy….……….. 45

CHAPTER THREE

Figure 3.1. The sporulation pathway of B. subtilis ……………….………………….… 50

Figure 3.2. Engulfment phenotypes of spoIIP mutants……….……………………..… 51

Figure 3.3. Engulfment phenotypes of spoIID mutants……………………………….. 53

Figure 3.4. Localization of the essential engulfment proteins………………………… 54

Figure 3.5. SpoIID shows peptidoglycan hydrolase activity…………..……………… 55

Figure 3.6. Transmission electron micrograph of wild-type B. subtilis (PY79) at a late stage of engulfment…………………………………………………... 55

Figure 3.7. Model for peptidoglycan hydrolysis-driven membrane migration………... 56

CHAPTER FOUR

Figure 4.1. Schematic representation of engulfment in Bacillus subtilis ...... 66

Figure 4.2. Sequence alignment of SpoIID showing conserved amino acids targeted for site-directed mutagenesis ………..…………………………………….. 78

Figure 4.3. Biochemical activity of SpoIID mutants ...... 79

Figure 4.4. CD spectra of wild type and E88A...... 80

Figure 4.5. Engulfment phenotypes of SpoIID mutant proteins...... 83

Figure 4.6. HPLC chromatograms of SpoIID treated peptidoglycan ...... 89

APPENDIX

Figure A.1. Nickel affinity and size exclusion chromatograpy of His6-SpoIID (27-343)...... 114

Figure A.2. Biochemical activity of His6-SpoIID (27-343)...... 116

Figure A.3. Size exclusion chromatography of SpoIID (27-343) and size standards..... 118

xii

Figure A.4. Limited Proteolysis of His6-SpoIID (27-343) ...... 120

Figure A.5. Zymography and cell wall binding of thermolysin digestion products...... 121

Figure A.6. Cleavage of His6-TEV-SpoIID (56-343) with TEV protease...... 124

Figure A.7. SDS-PAGE analysis of purified SpoIID(56-343) ...... 126

Figure A.8. Image of crystal drop from JMAC36 condition ...... 128

xiii

List of Tables

CHAPTER TWO

Table 2.1. Strains used in this study …………….…………………………………….. 40

Table 2.S1. Spore titers of strains used in these studies………….……………………. 46

Table 2.S2. Scoring of colocalization of SpoIIB with SpoIIP and SpoIIM in early versus late sporangia……………………………………………………... 46

CHAPTER THREE

Table 3.1. Percent sporangia showing the indicated engulfment phenotype ……….…. 52

Table 3.2. Spore production by various B. subtilis strains ….…………………………. 52

Table 3.3. Bacterial strains used in this study …………….………………………….... 57

CHAPTER FOUR

Table 4.1. Strains used in this study ……………….…………….……………………..75

Table 4.2. Spore titers of SpoIID mutants ……………………….……………………. 85

Table 4.3. Percent sporangia showing the indicated engulfment phenotype …….……. 86

xiv

Acknowledgements

I would like to thank all the members of the Pogliano labs, past and present, for their help and support during the past several years. Jenny Antonucci, Angelica Abanes-

De Mello, Rachel Agress, Eric Becker, Dan Broder, Shinobu Chiba, Kristina Coleman,

Amber Dance, Ria del Rosario, Alan Derman, Jennifer Fredlund-Gutierrez, Jamie

Gregory, Nick Herrera, Xin Jiang, Rachel Larsen, Grace Lim, Kenny Lin, Linda Liu,

Kenny Mok, Ana Perez, Aileen Rubio, Marc Sharp, Jonathan Shum, and Ya-Lin Sun – thanks for making the lab a fun and relaxing place to be.

I would especially like to thank Kit Pogliano, who I am grateful for supporting and guiding me throughout my graduate studies. You have been an amazing advisor and mentor, and your optimism and encouragement have helped make my graduate experience enjoyable. I have learned a great deal from you, most importantly how to think critically.

I would also like to thank Joe Pogliano, who was a tremendous help during my earlier graduate school years.

Thanks to my committee members, Partho Ghosh, Doug Bartlett, Lorraine Pillus, and Mike Burkart, for your helpful suggestions and advice.

The text of Chapter 2, in full, is a reprint of the material as it appears in:

Aung, S., Shum, J., Abanes-De Mello, A., Broder, D.H., Fredlund-Gutierrez, J., Chiba, S., and Pogliano, K. (2007). Dual localization pathways for the engulfment proteins during Bacillus subtilis sporulation. Mol Microbiol 65, 1534-1546.

I was the primary researcher of this work.

The text of Chapter 3, in full, is a reprint of the material as it appears in:

Abanes-De Mello, A., Sun, Y.L., Aung, S., and Pogliano, K. (2002). A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forspore. Genes Dev 16, 3253-3264.

I was a secondary researcher and contributed substantially to the results reported as well as the preparation of the manuscript.

The text of Chapter 4, in part, will be submitted for publication. I am the primary author of the manuscript.

xvi

Curriculum Vitae

EDUCATION 2007 Doctor of Philosophy, Biology University of California, San Diego

2000 Bachelors of Science, Microbiology (cum laude) Minor in Economics University of California, San Diego

EXPERIENCE 2007 Lecturer, UCSD Division of Biological Sciences (La Jolla, CA)

2005 Teaching Assistant, Cold Spring Harbor Laboratories (Cold Spring Harbor, NY)

2001 Staff Research Associate, UCSD Division of Biological Sciences (La Jolla, CA)

1998-2005 Teaching Assistant, UCSD Division of Biologial Sciences (La Jolla, CA)

HONORS RECEIVED • Regents Scholar University of California, San Diego (1996-2000) • National Merit Scholar University of California, San Diego (1996-2000) • Provost’s Honors University of California, San Diego (1996-1998) • Warren College Honors Program University of California, San Diego (1996- 2000) • U.C. Davis National Science Foundation (NSF) Young Scholars Program (USDA/ARS labs) University of California, Davis (1995)

RESEARCH PUBLICATIONS Aung, S., Shum, J., Abanes-De Mello, A., Broder, D.H., Fredlund-Gutierrez, J., Chiba, S., and Pogliano, K. (2007). Dual localization pathways for the engulfment proteins during Bacillus subtilis sporulation. Mol Microbiol 65, 1534-1546.

Abanes-De Mello, A., Sun, Y.L., Aung, S., and Pogliano, K. (2002). A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forspore. Genes Dev 16, 3253-3264.

Ho, T.Q., Zhong, Z., Aung, S., and Pogliano, J. (2002). Compatible bacterial plasminds are targeted to independent cellular locations in Escherichia coli. EMBO J 21, 1864- 1872.

xvii

ABSTRACT OF THE DISSERTATION

Protein localization and peptidoglycan hydrolysis during engulfment in Bacillus subtilis

Stefan Denis Aung

Doctor of Philosophy in Biology

University of California, San Diego, 2007

Professor Kit Pogliano, Chair

In response to unfavorable environmental conditions such as nutrient starvation, the gram positive soil bacterium Bacillus subtilis enters into a developmental pathway known as sporulation. Shortly following the commitment to sporulation, B. subtilis divides asymmetrically, dividing the cell into two compartments, a smaller forespore (the future spore) and a larger mother cell. Subsequently, in a process that resembles eukaryotic phagocytosis, known as engulfment, the mother cell membranes migrate up and around the forespore. The completion of engulfment is marked by the mother cell

xviii

membranes fusing at the forespore pole, releasing the immature spore into the mother cell cytoplasm where further spore maturation takes place. Three mother cell expressed proteins, SpoIID, SpoIIM, and SpoIIP have been shown to mediate both the early step of engulfment, septal thinning and subsequent membrane migration. Research presented in this dissertation addresses how SpoIID, SpoIIM and SpoIIP are targeted to the sporulation septum, and in particular, the role of SpoIID during engulfment.

My studies of the engulfment proteins led to the discovery of two pathways that are involved in targeting SpoIID, SpoIIM, and SpoIIP (DMP) to the septum. Normally,

SpoIID, SpoIIM, and SpoIIP localize to the septum in a SpoIIB-dependent manner.

However, in the absence of SpoIIB, cells were able to complete engulfment, albeit at a slower rate than wild type. This suggested the presence of a secondary, SpoIIB- independent pathway for targeting the DMP complex to the septum. In fact, my studies showed that a secondary, compensatory targeting pathway does exist, and is mediated by the SpoIIQ-SpoIIIAH (Q-AH) zipper via the mother cell expressed proteins SpoIVFA and SpoIVFB. Thus, the Q-AH zipper not only provides a compensatory mechanism for membrane migration during engulfment when DMP activity is reduced, but also indirectly mediates a compensatory septal localization pathway for DMP when its primary targeting pathway is disrupted.

My research also demonstrated that SpoIID functions as a peptidoglycan hydrolase. Site directed mutagenesis of conserved amino acids within SpoIID has led to the identification of residues important for the proteins enzymatic activity as well as its function in vivo. I have thereby demonstrated that the peptidoglycan hydrolase activity of

SpoIID is required during engulfment, and have found mutations which suggest that

xix

SpoIID also functions later in sporulation, as they block spore formation but not membrane migration. In collaboration with the Popham lab at Virginia Tech, we have determined that SpoIID acts as an endopeptidase capable of cleaving the peptide cross- bridges that link adjoining glycan strands. These studies, in total, have added to our mechanistic knowledge of engulfment by further characterizing the biochemical activity of SpoIID and correlating its in vitro activities with its function in vivo.

I. CHAPTER ONE:

Introduction

1 2

Bacteria are remarkably complex and fascinating microorganisms. In their respective habitats, bacteria actively search for nutrients and adapt to constantly changing environmental conditions in order to replicate. Ultimately, the principal goal of a bacterial cell is survival. In order to survive and persist in their environments, bacteria employ diverse strategies, including the production of differentiated cell types adapted for food acquisition, motility, or prolonged starvation. One particularly elaborate survival strategy, endospore formation, results in the creation of a specialized cell type called a spore. Spores are remarkably robust, with the ability to survive and remain dormant for extended periods (perhaps thousands or millions of years) of time (Cano and

Borucki, 1995; Kennedy et al., 1994; Nicholson and Galeano, 2003; Vreeland et al.,

2000). Additionally, spores are highly resistant to high temperatures, UV radiation, detergents, chemicals, and other enzymes (Alderton and Snell, 1969; Cortezzo and

Setlow, 2005; Melly et al., 2002; Melly and Setlow, 2001; Nicholson et al., 2000; Setlow,

1995; Young and Setlow, 2004). These characteristics allow spores to, in a sense, hibernate indefinitely until more favorable environmental conditions are encountered.

Endospore formation is limited to a few bacterial clades, including the members of the genera Bacillus and Clostridia. These bacteria are ubiquitously found throughout the world, primarily in the soil and animal intestines, and in various environments of high salt, temperature, etc. (Bisson et al., 2007; Chou et al., 2007; Jensen et al., 2003; Kim et al., 2007; Martinez and Caballero, 2002; Nong et al., 2007; Robles et al., 2000; Uribe et al., 2003). In our everyday lives, these gram-positive soil bacteria have a wide range of impact, in obvious and more subtle ways. Members of the genus Bacillus are responsible

3 for producing enzymes that represent approximately 60% of the global industrial enzyme market (Westers et al., 2004). Alkaline proteases, amylases, and isomerases are commonly used in the detergent, paper, leather, textile and food industries (Gupta et al.,

2002; Horikoshi, 1999; Saeki et al., 2007). Also, Bacillus thuringiensis produces a crystal toxin that has been used effectively as an insecticide in agriculture (Nicholson,

2002; Qaim and Zilberman, 2003). From a medical perspective, Bacillus anthracis,

Clostridium botulinum, Clostridium tetani, and Clostridium perfringens are the causative agents of anthrax, botulism, tetanus, and gangrene, respectively (Bruggemann et al.,

2003; Johnson and Bradshaw, 2001; Spencer, 2003; Titball et al., 1989). Additionally, and perhaps more importantly, the removal of spores from medical instruments and surfaces is often a key test in assessing how sterile an environment is, since if spores are not present, most microorganisms are likely not present as well.

The most well characterized endospore forming bacterium is the gram-positive, rod-shaped bacterium Bacillus subtilis. B. subtilis is an ideal model organism for basic scientific research. The rapid growth of B. subtilis, coupled with its genetic tractability and amenability to biochemical and cell biological methods, allow questions such as bacterial development and differentiation to be addressed. Sporulation, in particular, is one of the better understood examples of bacterial development and differention.

Survival strategies

Normally, when environmental conditions are suitable, B. subtilis and other microorganisms grow vegetatively. A hallmark of vegetative growth is an exponential

4 increase in cell number, and indeed bacteria are able to grow and divide in a manner only limited by the availability of nutrients. When environmental conditions change for the worse, however, to a situation such as nutrient deprivation, cell division ceases and B. subtilis enters into stationary phase. During stationary phase, B. subtilis assesses its situation, and weighs entry into alternative developmental pathways based upon its best prospects for survival (Grossman, 1995; Lazazzera, 2000; Msadek, 1999; Phillips and

Strauch, 2002). Competence, motility, biofilm formation and sporulation comprise the identified developmental pathways, and ultimately survival strategies, that B. subtilis has at its disposal (Fig. 1.1) (Pottathil and Lazazzera, 2003; Veening et al., 2006). B. subtilis can become naturally competent, a state that could facilitate obtaining nutrient sources or allowing for an expansion of its genetic capabilities via DNA uptake (Dubnau, 1991;

Grossman, 1995; Hamoen et al., 2003). Alternatively, this gram-positive soil bacterium can begin to express motility genes that allow it to chemotax towards better conditions or away from toxic ones (Fenchel, 2002; Liu and Zuber, 1998; Tokunaga et al., 1994).

Finally, if conditions are especially harsh, the most energy intensive and time consuming option of sporulation may be chosen (Errington, 2003b; Hoch, 1993; Piggot and Hilbert,

2004; Stragier and Losick, 1996).

Figure 1.1. Developmental pathways of Bacillus subtilis. (A) Normally, B. subtilis grows and divides vegetatively. When environmental conditions turn unfavorable, and the cells enter stationary phase, the cells can enter into one of three pathways to promote survival. (B) First, cells can become competent and take up DNA from the environment. (C) Alternatively, cells can express genes for motility and chemotax towards or away from favorable and unfavorable conditions, respectively. (D) Finally, cells can decide to sporulate, transitioning into a dormant state indefinitely. When conditions turn favorable, the spores can germinate and resume vegetative growth.

Engulfment – The beginning stages of sporulation

Several characteristic morphological changes are evident once a cell transitions from vegetative growth and becomes committed to sporulation (for a more detailed review on the initiation of sporulation, please see (Errington, 2003b; Piggot and Hilbert,

2004; Stragier and Losick, 1996)). First, the formation of an axial filament occurs, where the two chromosomes following DNA replication become aligned along the long axis of the cell (Errington, 2001; Pogliano et al., 2002; Ryter, 1965a). Following axial filament formation, an asymmetric cell division event occurs which positions a septum near the cell pole(Errington, 2001; Levin et al., 1998; Pogliano et al., 1999; Ryter, 1965b). As a result, two distinct cellular compartments are created, a smaller forespore (the future spore) and a larger mother cell (Fig. 1.2A). The subsequent activation of cell-specific sigma factors, σF in the forespore and σE in the mother cell, gives rise to differential gene

expression in the forespore and mother cell (Errington, 2003b). These differences in

gene expression direct the different developmental fates of the two cells: the forespore

develops into the future spore, whereas the mother cell lyses up completion of sporulation

to release the mature spore. Following polar septation, the septal peptidoglycan is

thinned and the mother cell membrane begins to migrate up and around the forespore in a

phagocytosis-like process known as engulfment (Fig. 1.2B & C). The completion of

engulfment is marked by the fusion of the leading edges of the mother cell membrane at

the forespore pole and the subsequent release of the forespore into the mother cell

cytoplasm (Fig. 1.2D & E) (Sharp and Pogliano, 1999). Further maturation and

development of the engulfed forespore (immature spore), including the formation of the

8 cortex (which confers characteristics of heat-resistance and dormancy to the spore) and production of SASPs (resistance to UV radiation), takes place in the mother cell. Finally, upon the completion of morphogenesis, the mother cell lyses, releasing the mature spore into the environment.

ABC D E

Figure 1.2. Schematic representation of engulfment. (A) Early in sporulation, an asymmetric cell division event occurs, generating the mother cell and forespore. (B) The first stage of engulfment, septal thinning, initiates when the peptidoglycan within the sporulation septum is thinned. (C) Next, membrane migration occurs, where the mother cell membrane begins to migrate up and (D) around the forespore. (E) Finally, the leading edges of the engulfing mother cell membrane meet and fuse at the forespore pole, releasing the forespore into the mother cell cytoplasm.

Although engulfment is an essential part of the spore formation pathway of B. subtilis, it has remained unclear how this phagocytosis-like process occurs. Therefore, my goal was to gain a better understanding of the cellular components and mechanisms involved in engulfment to allow us to work towards a more completely integrated view of how bacteria are able to achieve this phagocytosis-like step.

Engulfment – What is known?

Previous genetic studies of sporulation have implicated several proteins in the process of engulfment: SpoIIB (Margolis et al., 1993), SpoVG (Margolis et al., 1993),

SpoVS (Resnekov et al., 1996), SpoIID (Lopez-Diaz et al., 1986), SpoIIM (Smith et al.,

1993), SpoIIP (Frandsen and Stragier, 1995), and SpoIIQ (Londono-Vallejo et al., 1997;

Sun et al., 2000). Of these proteins, spoVG and spoVS mutants are normal for engulfment and thus their products are unlikely to be directly involved in engulfment. In addition, SpoIIB (Perez et al., 2000) and SpoIIQ (Sun et al., 2000) are not essential for engulfment, since single mutants in the respective genes are able to complete engulfment, albeit at a slower rate than wild type. However, SpoIIB serves to temporally and spatially regulate engulfment (Perez et al., 2000); as discussed further below, my thesis research showed that it is involved in localization of the essential engulfment proteins.

Furthermore, Sun et al. (2000) demonstrated that forespore specific gene expression is dispensible for engulfment, suggesting that the essential engulfment machinery resides in the mother cell. In keeping with this finding, only three mother cell expressed proteins,

SpoIID, SpoIIM, and SpoIIP (Abanes-De Mello et al., 2002; Eichenberger et al., 2003) have been shown to be essential for engulfment but dispensible for viability (SpoIIP is also produced in the forespore, but only mother cell expression is required for engulfment) (Dworkin and Losick, 2005). The idea that only SpoIID, SpoIIM, and

SpoIIP are essential for engulfment but not viability is bolstered by the fact that no new mother cell expressed engulfment proteins were found following the systematic inactivation of all new mother cell expressed genes identified by microarray analysis

(Eichenberger et al., 2003) or in a large scale genetic screen performed in the Pogliano laboratory (Abanes-De Mello et al., 2002). SpoIID, SpoIIM, and SpoIIP are conserved throughout all endospore forming bacteria (Stragier, 2002), such as other Bacillus sp. and

Clostridia sp., underscoring their importance during sporulation.

SpoIID, SpoIIM, and SpoIIP play a critical role during the first stage of engulfment, septal thinning. During this stage, the peptidoglycan between the forespore and mother cell membranes is thinned, starting in the middle and proceeding towards the edges, as viewed by electron microscopy (Piggot et al., 1994). Mutants defective in septal thinning (i.e., spoIID, spoIIM, spoIIP null mutants) exhibit a characteristic bulge phenotype readily visualized by electron (Frandsen and Stragier, 1995; Perez et al., 2000;

Smith et al., 1993) or fluorescence microscopy (Pogliano et al., 1999). This phenotype is likely to be a consequence of the growing forespore pushing through a weakened region of the unthinned septum, with these mutant sporangia having central constrictions imposed on them by the remaining septal peptidoglycan. Furthermore, SpoIID, SpoIIM, and SpoIIP also mediate the dissolution of the partial septa formed at a second potential division site at the mother cell pole (Eichenberger et al., 2001; Pogliano et al., 1999).

Thus, in the absence of these proteins, engulfment is blocked and partial septa remain at the forespore distal pole of the mother cell.

Septal thinning allows the second stage of engulfment, membrane migration, to occur. During membrane migration, the mother cell membrane moves up and around the forespore. Although no protein specifically required for membrane migration has been identified, recent genetic and cell biological studies have revealed a role for SpoIID and

SpoIIP throughout engulfment. Specifically, Abanes-De Mello et al. (Abanes-De Mello et al., 2002) showed that certain mutations in spoIID and spoIIP that either produced reduced levels of wild type protein or proteins of reduced activity reduced the rate of both septal thinning and membrane migration. Additionally, localization of these proteins via

GFP fusions showed that SpoIID, SpoIIM, and SpoIIP are recruited preferentially to the sporulation septum, where they track along the leading edge of the engulfing membrane

(Fig. 1.3) (Abanes-De Mello et al., 2002). Together these results suggest that the mother cell engulfment proteins are involved in membrane migration as well as septal thinning.

A second mechanism for membrane migration was identified by Broder and

Pogliano (2006), who showed that membrane migration can be mediated in a DMP- independent manner. In their studies, the enzymatic removal of the septal peptidoglycan with lysozyme allowed engulfment to proceed in a manner that depended on the forespore expressed protein SpoIIQ and its mother cell ligand, SpoIIIAH, but not on the

DMP proteins (Broder and Pogliano, 2006). Broder and Pogliano also showed that in intact cells, the Q-AH zipper is essential for engulfment when SpoIID, SpoIIM, and/or

SpoIIP activity is reduced, or when SpoIIB is absent, suggesting that it participates in engulfment in intact cells as well as protoplasts. The final step of engulfment occurs

13 once the engulfing mother cell membrane reaches the forespore pole and the membranes fuse to release the forespore into the mother cell, where further maturation of the future spore occurs. This fusion event requires the DNA translocase SpoIIIE, which has been proposed to mediate membrane fusion by a paired channel model (Liu et al., 2006; Sharp and Pogliano, 1999).

A B C D

Figure 1.3. Localization pattern of GFP-SpoIID, GFP-SpoIIM, GFP-SpoIIP. The three mother cell expressed proteins that are essential for engulfment and initially (A) localize to the sporulation septum, (B) spread across the septum, then (C & D) form foci at the leading edges of the engulfing membrane, where they remain throughout engulfment.

A potential role for peptidoglycan hydrolases

The engulfment proteins identified to date are all membrane proteins, most of which have large extracellular domains expected to protrude from the membrane towards the bacterial cell wall that surrounds all bacterial cells. The cell wall is essential for determining cell shape and providing these cells with structural support and the ability to withstand intracellular turgor pressures (Jones et al., 2001; Koch, 2006; Stewart, 2005).

Peptidoglycan is the key structural element of bacterial cell walls, existing as a three dimensional polymer of the alternating disaccharides N-acetylyglucosamine (NAG) and

N-acetylmuramic acid (NAM) cross-linked by peptide side chains attached to the NAM groups (Bugg and Walsh, 1992; Foster and Popham, 2002; Holtje, 1998; Scheffers and

Pinho, 2005; Stewart, 2005).

This huge macromolecule is remodeled by enzymes that are capable of degrading peptidoglycan, known as peptidoglycan hydrolases, allowing cells to undergo structural transformation. Peptidoglycan hydrolases play important and diverse roles in bacteria, as they are involved in a wide range of processes such as cell separation, cell elongation, cell wall turnover, motility, protein secretion, and pathogenicity (Blackman et al., 1998;

Foster and Popham, 2002; Keep et al., 2006; Smith et al., 2000). Because some peptidoglycan hydrolases are capable of lysing cells (hence the term autolysins), their activity must be strictly regulated. Based upon substrate specificity, there are four general classes of peptidoglycan hydrolases: (1) glucosaminidases; (2) muramidases; (3)

N-acetylmuramoyl-L-alanine amidases (amidases); (4) endopeptidases (Fig. 1.4)

(Blackman et al., 1998; Smith et al., 2000). Most bacterial cells have a wide complement

16 of peptidoglycan hydrolases encoded by their genomes, yet it is not always clear what role they play in the cell or how their activities are regulated.

Figure 1.4. Classes of peptidoglycan hydrolases. Peptidoglycan hydrolases are classified based on their substrate specificity. (1) glucosaminidases; (2) muramidases; (3) N-acetylmuramoyl-L-alanine amidases (amidases); (4) endopeptidases. NAG – N- acetylglucosamine; NAM – N-acetylmuramic acid; Dpm – meso-diaminopimelic acid

For example, B. subtilis encodes at least 30 such enzymes (Blackman et al., 1998;

Foster and Popham, 2002; Smith et al., 2000), although new families of enzymes continue to be discovered even in this well studied organism (Chapter 4, Aung et al., manuscript in preparation). In growing B. subtilis cells, peptidoglycan hydrolases are thought to be involved in peptidoglycan maturation, cell wall turnover, cell elongation and the separation of recently divided cells (Blackman et al., 1998; Foster and Popham,

2002; Keep et al., 2006; Smith et al., 2000). The major vegetative cell peptidoglycan hydrolase LytC plays a role in cell wall turnover, removing older cell wall material from the outer surface of cells, allowing for cell elongation and growth (Blackman et al., 1998;

Margot and Karamata, 1992). In a second example, mature peptidoglycan is composed of NAM at the nonreducing terminus although the building block of peptidoglycan is a disaccharide-pentapeptide monomer, suggesting a role for the glucosaminidase LytD, which removes the β(1-4) glycosidic bond between the NAG and NAM moieties (Atrih et al., 1999; Margot et al., 1994). However, the phenotype of lytD mutants is subtle, as cells lacking LytD still have some NAM at the nonreducing terminus, suggesting the presence of another unidentified enzyme with similar activity and making it unclear exactly what role LytD has in the cell (Smith et al., 2000). Other modifications found in mature peptidoglycan, such as different length peptide side chains are also likely produced by amidase and endopeptidase enzymes. While it is tempting to speculate that these modifications might provide positional or temporal information within the bacterial cell, the inability to map these modifications within the cell wall and the often subtle

19 phenotypes resulting from the inactivation of these enzymes (likely a consequence of functional redundancy) makes it unclear if this is the case.

Peptidoglycan hydrolases have been shown to play critical roles in the cell separation that accompanies the onset of motility in B. subtilis (Blackman et al., 1998;

Foster and Popham, 2002; Keep et al., 2006; Smith et al., 2000). Normally, B. subtilis cells grow in long chains composed of completely divided cells in which septal peptidoglycan has not been split to mediate cell separation. However, in stationary phase and during motility, B. subtilis exists primarily as single cells. Five distinct proteins,

LytC, LytD, LytE, LytF, and YwbG are all involved in cell separation, as mutants in any of these genes results in abnormally long chains of cells (Blackman et al., 1998; Ishikawa et al., 1998; Margot et al., 1999; Margot et al., 1998; Ohnishi et al., 1999). The functional redundancy of these proteins is shown by the fact that while strains lacking just one enzyme ultimately separate, eliminating several enzymes results in extremely long chains of cells that form visible bundles and clumps in liquid culture (Blackman et al., 1998; Ishikawa et al., 1998; Margot et al., 1999; Margot et al., 1998; Ohnishi et al.,

1999). The expression of LytC, LytD, and LytE is coregulated (by the regulatory genes sigD and sinR) with genes required for motility (Lazarevic et al., 1992; Margot et al.,

1999; Rashid and Sekiguchi, 1996). Interestingly, genetic experiments suggest although these enzymes catalyze distinct hydrolysis reactions, they are able to substitute for one another in supporting cell separation (Blackman et al., 1998; Margot et al., 1994; Rashid et al., 1995). Thus, one puzzling aspect of enzymes that remodel peptidoglycan is the apparent ability of proteins that catalyze different enzymatic reactions to substitute for one another to support various cellular processes.

The sporulation pathway in B. subtilis provides an example of the critical role played by peptidoglycan hydrolases in remodeling the bacterial cell during differentiation. Key events in engulfment such as septal thinning and membrane migration, as well as dissolution of the partial septa at potential division sites were long predicted to require localized peptidoglycan degradation, but although over 30 proteins have been identified as either peptidoglycan hydrolases or probable peptidoglycan hydrolases in B. subtilis, none of these had been shown to be essential for engulfment

(Foster and Popham, 2002; Smith et al., 2000). This raised the possibility that the

SpoIID, SpoIIM, and/or SpoIIP engulfment proteins were themselves peptidoglycan hydrolases that serve to mediate septal thinning and membrane migration.

Recent work, including the research presented in this thesis (Chapters 3-4), has solved this puzzle, by demonstrating that these sporulation specific proteins are indeed involved in peptidoglycan hydrolysis (Abanes-De Mello et al., 2002; Chastanet and

Losick, 2007). Interestingly, SpoIID displays sequence similarity to the B. subtilis LytB protein, which has been reported to regulate the activity of the major vegetative cell wall hydrolase LytC (Kuroda et al., 1992; Lopez-Diaz et al., 1986), a N-acetyl-muramoyl-L- alanine amidase involved in cell separation (Blackman et al., 1998). Shortly after joining the Pogliano lab, I helped demonstrate that SpoIID acts as a peptidoglycan hydrolase, showing cell wall hydrolytic activity in zymography gels as well as cell wall binding activity (Chapter 3) (Abanes-De Mello et al., 2002). SpoIIM shows no identifiable homology to known hydrolases, and it is unlikely to be a hydrolase due to its predicted structure as a polytopic membrane protein with five transmembrane domains and only very small extracellular domains. SpoIIP shows homology to the N-terminal catalytic

21 domain of the N-acetylmuramoyl-L-alanine amidase CwlV of Paenibacillus polymyxa

(Soding et al., 2005) and has recently been shown to degrade peptidoglycan (Chastanet and Losick, 2007). Although the sporulation proteins SpoIIQ and SpoIIB are not essential for engulfment, they show homology to known peptidoglycan hydrolases. For example, SpoIIQ, which facilitates membrane migration across the forespore pole under some sporulation conditions (Cutting et al., 1990; Sun et al., 2000; Zhang et al., 1998) is homologous to lysostaphin, a zinc metalloprotease that belongs to the M23 family of endopeptidases and cleaves the peptide cross bridges in Staphylococcus aureus peptidoglycan (Recsei et al., 1987; Rudner and Losick, 2002). SpoIIB is involved in the localization of the engulfment proteins (Chapter 2) (Aung et al., 2007) and shows weak homology to the cell wall binding domain of the Bacillus licheniformis amidase CwlM and slight homology to the hydrolase CwlC (Errington, 2003b; Soding et al., 2005).

These observations clearly suggest that remodeling the bacterial cell wall is critical for engulfment.

Two modules mediate membrane migration during engulfment

The commitment to enter the sporulation pathway is not one that is taken lightly by a bacterium, as the process requires 6-8 hours and during this time, the cell cannot divide if new nutrients are provided, nor resume growth if sporulation is blocked after the initiation of engulfment (Dworkin and Losick, 2005). Thus, in addition to the multitude of checkpoints for entry into sporulation (Burbulys et al., 1991; Fujita and Losick, 2003;

Jiang et al., 2000) it seems logical that once a cell commits to sporulation, multiple mechanisms would exist to make certain that sporulation succeeds and ultimately

22 survival is ensured. Recent studies of engulfment and protein localization have confirmed this prediction that compensatory systems will act to assure the completion of essential steps in sporulation. Thus far, two compensatory systems have been identified for engulfment, although it remains possible that other proteins are involved (Abanes-De

Mello et al., 2002). The primary mechanism for membrane migration is governed by the

SpoIID, SpoIIM, and SpoIIP peptidoglycan hydrolase complex. It has been proposed that this mother cell membrane-anchored complex processively hydrolyzes the peptidoglycan adjacent to the forespore in the septal space, using the peptidoglycan (cell wall) as a stationary track to drag the mother cell membrane up and around the forespore

(Fig. 1.5A; (Abanes-De Mello et al., 2002). Directed movement of the DMP motor proteins could occur in a manner similar to a “burnt-bridge” Brownian ratchet, where the biased or directional diffusion of a protein along a linear track such as peptidoglycan occurs as a result of the protein destroying its preferred binding site to prevent backward diffusion (Antal and Krapivsky, 2005; Mai et al., 2001). Adapted to engulfment, the model predicts that SpoIID, SpoIIM, and SpoIIP hydrolyze the peptidoglycan track in the septal space, using thermal energy to move unidirectionally around the forespore. The primary goal of my thesis research has been to more fully characterize the hydrolytic activity of these enzymes, which is necessary to allow this hypothesis to be more rigorously tested.

A second, compensatory mechanism for membrane migration, mentioned briefly in a previous section, exists to make engulfment more efficient and robust. This DMP- independent mechanism is the Q-AH zipper (Fig. 1.5B) (Broder and Pogliano, 2006).

This zipper acts in a ratchet-like manner, possibly contributing directionality to

23 engulfment by helping to ensure continued movement of the mother cell membrane around the forespore. There is precedence for such directional movement imparted by ratchets in processes such as transcription and translation (Bar-Nahum et al., 2005;

Okamoto et al., 2002; Saffarian et al., 2004). The existence of two independently acting mechanisms for membrane migration not only contributes to the efficiency and robustness of engulfment, but increases a sporulating cell’s likelihood of survival during stressful times.

Figure 1.5. Two modules for engulfment. (A) In the DMP model of engulfment, a mother cell membrane-anchored protein complex drives membrane migration. This complex is comprised of the mother cell expressed proteins SpoIIM (speckled box), SpoIIP (blue lollipop), and SpoIID (red pacman). This model proposes that the processive peptidoglycan hydrolase SpoIID drags the mother cell membrane (thick gray line) up and around the forespore membrane (thin gray line) as it cleaves the peptidoglycan (solid black lines and broken black lines) adjacent to the forespore membrane. The arrow indicates the direction of engulfment. (B) In this DMP- independent model for membrane migration, the forespore expressed protein SpoIIQ and its mother cell partner SpoIIIAH form a zipper with help to ensure the completion of engulfment

Engulfment during B. subtilis sporulation is one of the very few examples of endocytic processes in bacteria, other than a handful of examples of other endocytic processes in bacterial cells, such as magnetosome biogenesis (Komeili et al., 2006;

Scheffel et al., 2006). It is inherently interesting to understand how such seemingly simple cells are able to achieve something normally associated with eukaryotic cells that lack a cell wall and have an elaborate cytoskeletal and motor protein system. Therefore, my thesis work focused on gaining a better mechanistic understanding of engulfment, and in particular, the role of the peptiodglycan hydrolase SpoIID during this early stage of sporulation.

Much like their eukaryotic counterparts, prokaryotic cells use dynamic protein localization to control a variety of cellular processes such as cell differentiation (Gitai et al., 2005; Shapiro et al., 2002). Therefore, one question that I sought to address was how the known engulfment proteins, SpoIID, SpoIIM, and SpoIIP are targeted to the sporulation septum. Experiments performed by Jonathan Shum and Angelica Abanes-De

Mello hinted at the possibility of SpoIIB directly or indirectly targeting the DMP engulfment machinery to the septum. Two lines of evidence supported this possibility.

First, a SpoIIB-mCherry fusion localized to the sporulation septum in an FtsZ-dependent manner, and before DMP (Chapter 2; Aung et al. 2007; (Perez et al., 2000). Second,

GFP-SpoIIM and GFP-SpoIIP fusion proteins failed to localize to the septum in spoIIB- mutants (Chapter 2; Aung et al., 2007). However, one caveat with these studies was that the GFP fusion proteins caused a synergistic engulfment defect when combined with mutations that normally slow engulfment, such as spoIIB- and spoIIQ-. I revisited the

GFP-SpoIIM and GFP-SpoIIP localization experiments, building from the work of previous graduate student Angelica Abanes-De Mello, and found that SpoIIB is required for targeting the DMP machinery to the septum (Chapter 2, Aung et al. 2007). I also addressed the synergistic engulfment defects seen with the GFP fusion proteins, and in doing so, uncovered a second, SpoIIB-independent targeting pathway for DMP mediated by the SpoIIQ-SpoIIIAH zipper via the mother cell proteins SpoIVFA and SpoIVFB.

This second pathway serves to compensate for and allow proper localization of DMP in the absence of SpoIIB. These experiments will be discussed in greater detail in Chapter

2, which has recently been published (Aung et al., 2007). The presence of a compensatory localization pathway for the engulfment proteins and for engulfment itself shows that B. subtilis has evolved an efficient and robust mechanism for ensuring the completion of sporulation, and ultimately its own survival.

Shortly after joining the Pogliano lab, I helped show that SpoIID has peptidoglycan hydrolase activity (Chapter 3, (Abanes-De Mello et al., 2002). This sparked my interest in how the peptidoglycan hydrolase SpoIID functions during engulfment, as studying the protein could allow a correlation between its biochemical and cell biological activities, a critical step towards a mechanistic view of engulfment.

Towards this end, I initially collaborated with Professor Partho Ghosh in an attempt to solve the three dimensional crystal structure of SpoIID in order to gain insights into the mechanism of action of this enzyme. Unfortunately, while I was able to successfully purify various stable, and active forms of the enzyme, crystallization trials were unsuccessful. However, I was able to glean some insights into the in vitro behavior of

SpoIID through these experiments. Specifically, I was able to identify the proteolytically

28 stable and general functional domains of SpoIID, as well as able to demonstrate that

SpoIID exists, at least in vitro, as a monomer. These studies are discussed in the

Appendix.

Since the crystallization trials failed to produce crystals for structural analysis, I pursued a site-directed mutagenesis strategy to identify critical amino acids important for the enzymatic and in vivo activities of SpoIID (Chapter 4). I was able to identify one amino acid that is a likely active site residue, as the SpoIID mutant was completely defective for cell wall hydrolytic activity but retained cell wall binding activity. By introducing this point mutation into B. subtilis, I was able to directly show that peptidoglycan hydrolase activity is required for engulfment. Additionally, I helped identify four mutants that have full biochemical activity, yet show various engulfment defects. Two of the mutants show early engulfment defects, suggesting a potential role in interacting with other proteins involved in engulfment or in the regulation of hydrolase activity in vivo. The other two mutant proteins displayed a late engulfment phenotype, suggesting a role for SpoIID in the later stages of engulfment or membrane fusion.

Current research is underway to further characterize these mutants. Finally, in collaboration with the Popham lab at Virginia Tech, my studies have demonstrated that

SpoIID is an endopeptidase that specifically cleaves the peptide cross-bridges that link adjoining glycan chains of the peptidoglycan. This is the first identification of a peptidoglycan hydrolase in B. subtilis capable of cleaving the predominant cross-bridge that connects the disaccharide-pentapeptide monomers of peptidoglcyan. These findings and those discussed previously have helped advance our understanding and view of the complex process of endospore development in B. subtilis.

Continued advances in our understanding of engulfment during B. subtilis sporulation will further add to our understanding of complex developmental processes in bacteria, answering questions such as how these microorganisms direct protein localization, move macromolecules, and remodel their cell wall to allow growth and development. Application of cell biological methods, such as high resolution fluorescence microscopy and cryo-electron microscopy will further add to our understanding of how bacteria survive and play an important role in our lives.

Additionally, understanding a basic process such as engulfment, which is conserved across all endospore forming bacteria, will allow application of this knowledge to treating diseases caused by the pathogenic endospore forming bacteria.

II. CHAPTER TWO:

Dual localization pathways for the engulfment proteins during Bacillus subtilis sporulation

30 31 32 33 34 35

36 37 38 39

40 41 42 43

44 45 46

Acknowledgements

This chapter, in full, is a reprint of the material as it appears in:

Permission was obtained from the co-authors. I am the primary researcher and author of this paper. This research was performed under the supervision of Dr. Kit Pogliano.

III. CHAPTER THREE:

A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forspore

48 49 50 51 52 53

54 55 56

57 58 59 60

Acknowledgements

This chapter, in full, is a reprint of the material as it appears in:

Abanes-De Mello, A., Sun, Y.L., Aung, S., and Pogliano, K. (2002). A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forspore. Genes Dev 16, 3253-3264.

Permission was obtained from the co-authors. I was a secondary researcher and contributed substantially to the results reported as well as the preparation of the manuscript. This research was performed under the supervision of Dr. Kit Pogliano.

IV. CHAPTER FOUR:

Mutational analysis of the endopeptidase SpoIID in Bacillus subtilis

62 63

Abstract

A mother cell membrane complex comprised of the SpoIID, SpoIIM, and SpoIIP proteins mediate the early steps of engulfment, septal thinning and membrane migration during Bacillus subtilis sporulation. SpoIID and SpoIIP function as peptidoglycan hydrolases, allowing engulfment to proceed by removing the cell wall material in the septal space between the mother cell and forespore membranes. I here further characterize the enzymatic activity of SpoIID, which shows no recognizable similarity to previously characterized enzymes that degrade peptidoglycan. This study identifies an amino acid critical for the peptidoglycan hydrolase activity of SpoIID, but not for its cell binding or folding. This active site amino acid plays a direct role in engulfment, as an amino acid substitution completely arrests engulfment in intact cells. I also have identified two separate classes of mutations that do not alter the biochemical activity of

SpoIID, but block spore formation during either the early or late stages of engulfment.

The mutations that block engulfment at early steps might identify amino acids involved in interacting with other engulfment proteins. The mutations that cause a late engulfment arrest suggest a role for SpoIID late in engulfment, perhaps at the membrane fusion stage.

Furthermore, in collaboration with the Popham lab at Virginia Tech, I demonstrate that

SpoIID is a founding member of a class of endopeptidases that cleave the cell wall at the meso-diaminopimelic acid peptide cross-bridges between adjoining glycan chains.

Introduction

Bacterial cells are encased in cell walls, which they rely upon for their structural integrity. Peptidoglycan is the key skeletal component of bacterial cell walls, existing as a three-dimensional polymer of glycan chains cross-linked to short peptide chains (Atrih et al., 1999; Bugg and Walsh, 1992; Foster and Popham, 2002; Holtje, 1998; Jones et al.,

2001; Koch, 2006; Scheffers and Pinho, 2005; Stewart, 2005). The importance of peptidoglycan is highlighted by the fact that the cell wall and peptidoglycan biosynthesis is responsible for determining cell shape and imparting the structural integrity required for cell survival (Carballido-Lopez, 2006; Holtje, 1998; Jones et al., 2001; Scheffers and

Pinho, 2005). This macromolecule undergoes constant remodeling to allow for structural transformations, such as cell elongation and cell division. Peptidoglycan hydrolases, enzymes that digest cell wall peptidoglycan, are the keys to this ability to remodel

(Blackman et al., 1998; Shockman and Holtje, 1994; Smith et al., 2000). These peptidoglycan hydrolases function in a wide range of diverse and important cellular processes, including cell growth, cell division, cell-wall turnover, motility, protein secretion, pathogenicity, and differentiation (Blackman et al., 1998; Foster, 1994).

A dramatic example of the requirement for peptidoglycan hydrolases in the remodeling of the bacterial cell is provided by the sporulation pathway of B. subtilis, where they are required for engulfment, a key early step during the sporulation pathway in Bacillus subtilis and other endospore-forming bacteria (for reviews see (Errington,

2003b; Piggot and Hilbert, 2004; Stragier and Losick, 1996)) (Fig. 4.1). Shortly after a

65 cell becomes committed to sporulation, an asymmetric cell division event takes place which generates two cells that lie side-by-side with each other, a smaller forespore (the future spore), and a larger mother cell (Fig. 4.1A) (Levin and Losick, 1996; Pogliano et al., 1999; Ryter, 1965b). Engulfment rearranges these two daughter cells such that the forespore is completely enclosed in the mother cell cytoplasm (Fig. 4.1B-E).

Peptidoglycan hydrolases are known to be involved in three key steps of engulfment.

First, during the inital stage of engulfment, septal thinning, the peptidoglycan between the forespore and mother cell is removed, starting in the middle of the septum and proceeding towards the edges (Fig. 4.1B) (Abanes-De Mello et al., 2002; Chastanet and

Losick, 2007; Piggot et al., 1994). Second, they are required for the dissolution of partial septa synthesized at the second potential cell division site at the distal forespore pole

(Eichenberger et al., 2001; Pogliano et al., 1999). Third, they are required for membrane migration following septal thinning, where the mother cell membrane migrates up and around the forespore (Abanes-De Mello et al., 2002). The final step of engulfment, which is not known to require peptidoglycan hydrolysis is membrane fusion, where the engulfing membranes eventually meet and fuse at the forespore pole, releasing the forespore into the mother cell cytoplasm (Fig. 4.1C-E) (Liu et al., 2006; Sharp and

Pogliano, 1999). At this point, engulfment is complete, and the forespore is able to undergo further spore maturation in a protected environment.

Figure 4.1. Schematic representation of engulfment in Bacillus subtilis. (A) Shortly after a cell commits to sporulation, an asymmetric cell division even takes places which separates the cell into two compartments, a larger mother cell and a smaller forespore. (B) Septal thinning, the first step of engulfment, begins as the peptidoglycan between the mother cell and forespore membranes (grey) is thinned. This step is mediated by the mother cell expressed proteins SpoIID, SpoIIM, and SpoIIP. (C) The next step of engulfment, membrane migration begins when the mother cell membrane moves up and around the forespore and is also dependent upon DMP. Under some conditions where activity of SpoIID, SpoIIM, and SpoIIP is diminished, the SpoIIQ-SpoIIIAH zipper helps to facilitate membrane migration. (D) Next, the mother cell membrane meets and (F) fuses at the forespore pole in a step dependent upon SpoIIIE. Following membrane fusion, the forespore is released into the mother cell cytoplasm, where further spore maturation can occur.

The mother cell expressed membrane proteins SpoIID, SpoIIM and SpoIIP are required for septal thinning, membrane migration, as well as for dissolution of the aborted septa at the second potential division site (Abanes-De Mello et al., 2002;

Chastanet and Losick, 2007; Eichenberger et al., 2001; Pogliano et al., 1999) (Chapter 3).

Of these two proteins, SpoIID and SpoIIP have peptidoglycan hydrolase activity

(Abanes-De Mello et al., 2002; Chastanet and Losick, 2007), while SpoIIM is likely involved in localization and stability of the complex (Chapter 2; Aung et al., 2007)

(Abanes-De Mello et al., 2002; Chastanet and Losick, 2007). It is likely that SpoIID,

SpoIIP, and SpoIIM are in a complex with each other as they colocalize (Abanes-De

Mello et al., 2002) and SpoIID and SpoIIP interact via co-immunoprecipitation (Chapter

2; Aung et al., 2007) and affinity chromatography (Chastanet and Losick, 2007). Also, the fact that efficient septal localization of the engulfment proteins requires SpoIIB suggests a possible interaction between these proteins (Chapter 2; Aung et al., 2007). It has been proposed that these proteins assemble a mother cell membrane anchored complex that cleaves the peptidoglycan surrounding the forespore in a processive fashion, dragging the mother cell membrane around the forespore during engulfment (Chapter 3)

(Abanes-De Mello et al., 2002). This hypothesis implies that peptidoglycan plays a cytoskeleton-like role in engulfment, providing a track along which proteins anchored in the mother cell membrane move.

In contrast to this positive role for the cell wall, Broder et al. (2006) demonstrated that peptidoglycan is a barrier to the engulfing membranes, because the enzymatic removal of peptidoglycan by lysozyme allowed engulfment to proceed faster than in

68 intact cells. This might suggest that the role of the SpoIID, SpoIIM, and SpoIIP complex

(DMP) is to simply eliminate this barrier, but this would require some unidentified protein(s) to generate the force necessary to move the mother cell membranes up and around the forespore because the SpoIIQ-SpoIIIAH (Q-AH) zipper that mediates engulfment in the absence of the cell wall is not normally necessary in intact cells. It therefore appears that either there are critical engulfment proteins that remain unidentified despite previous large scale efforts (Abanes-De Mello et al., 2002;

Eichenberger et al., 2003; Sharp and Pogliano, 1999) or that engulfment is mediated by two mechanisms, the DMP motor machinery and the Q-AH zipper, which serves to facilitate membrane migration when the activity of DMP is diminished (Broder and

Pogliano, 2006). In this scenario, the septal peptidoglycan acts both as a barrier to the engulfing membrane and as a track for the DMP proteins, similar to collagen, which acts both as a barrier to the migration of cells through tissues and as a track along which proteases that degrade it move (Saffarian et al., 2004).

The data presented in this chapter provides a combined genetic and biochemical analysis of the peptidoglycan hydrolase SpoIID, identifying critical amino acids important for its enzymatic activity and for its in vivo function. Furthermore, I show for the first time that peptidoglycan hydrolysis is required for engulfment during septal thinning and membrane migration. Finally, in collaboration with the Popham lab at

Virginia Tech, I helped demonstrate that SpoIID is a founding member of a class of endopeptidases that cleaves the cross-links in peptidoglycan between Dpm (meso- diaminopimelic acid) and D-Ala. These experiments are critical steps that will allow

69 future experiments to directly test the burnt bridge Brownian motor model for DMP activity.

Materials and Methods

Bacterial strains, genetic manipulations, and growth conditions

B. subtilis strains (Table 4.1) used in this study are derivatives of wild-type strain

PY79 (Youngman et al., 1984). Mutations were introduced into PY79 derivatives by transformation (Dubnau and Davidoff-Abelson, 1971). Strains were sporulated at 37˚C by either nutrient exhaustion on solid Difco Sporulation Medium (Schaeffer et al., 1965) or by resuspension (Sterlini and Mandelstam, 1969). Spore titers were determined after heating cultures grown at 37˚C for 20 minutes at 80˚C. E. coli strain DH5α was used to propagate the plasmids used in this study, and strain BL21 (DE3) was used to overexpress plasmid constructs. Sequencing of plasmid constructs was performed by

Eton Bioscience Inc.

Construction of His6-SpoIID

SpoIID, from residues 27-343, was PCR amplified from PY79 chromosomal

DNA using the following primers:

5’GAGCCGCATTAGCACCATCATCATCATCATCAGCATAATAAGGAAGCGGGG3’

and 5’ GCGGCGGTCGACTTACTTTTTCGCCATATATTTATT 3’

(the restriction sites of NdeI and SalI are underlined, respectively). pET30a (Novagen)

was used as the vector DNA, although the N-terminal His6-tag was encoded on the primer. PCR fragments were digested with NdeI and SalI (New England Biolabs) and ligated into NdeI and SalI-digested pET30a. The ligation mix was transformed into

DH5α and transformants selected for on LB Kan 50 μg/ml. All constructs were confirmed to be correct by DNA sequencing.

Site-directed mutagenesis

A modified version of the QuikChange® (Stratagene) site-directed mutagenesis

strategy (Sawano and Miyawaki, 2000) was used to generate the spoIID point mutants. pSA12 was used as the E. coli overexpression template and pKP1a was used as the

template for the B. subtilis point mutants. Primers encoding the desired codon changes

were used. First, PNK-treated primers were subjected to the quick change reaction, with

the following thermal cycler reaction conditions: 65˚C 5 min., 95˚C 2 min., 20 cycles of

95˚C 10 sec., 55˚C 30 sec., 65˚C 9 min., and 75˚C 7 min. Following the thermal cycle

reaction, 1 μl of DpnI was added to the mixture and incubated overnight at 37˚C. The

next day, 0.3 μl of Pfu turbo and 0.3 μl of Taq DNA ligase was added to the mixture and

a second thermal cycler reaction run with the following conditions: 2 cycles of 95˚C 30

sec., 55˚C 60 sec., 70˚C 9 min., and 75˚C 7 min. The reaction mix was concentrated by

ethanol precipitation, and transformed into XL-1 blue chemically competent cells

(Stratagene). Transformants were selected for on LB Kan 50 μg/ml plates grown

overnight at 37˚C.

Microscopy and image analysis

An Applied Precision Spectris Deconvolution microscope was used to collect and

deconvolve images, as previously described (Aung et al., 2007). Samples of sporulating

bacteria were collected at the appropriate timepoints, and stained with a final

72 concentration of 5 μg/ml FM 4-64 (Invitrogen) to visualize membranes and 0.2 μg/ml 4’,

6-diamidino-2-phenylindole (DAPI; Invitrogen) to visualize DNA and applied to poly-L-

Lysine treated coverslips (Pogliano et al., 1999). Images were processed using

DeltaVision software, and following deconvolution, images from the medial focal planes were converted to TIFF files and imported into Adobe Photoshop.

Overexpression and purification of His-SpoIID and mutant proteins

Point mutations of the targeted residues were introduced into an E. coli overexpression vector encoding a N-terminal His6-tagged version of the soluble domain

of SpoIID (27-343). Overnight cultures of the strains were made in LB Kan 50 μg/ml and grown at 37˚C. The following day, a 1:250 dilution of the overnight culture was made into 4L of fresh LB Kan 50 μg/ml (mutants were grown in 50 ml cultures) and grown in a shaking water bath at 37˚C and 250 rpm. Cultures were grown to mid-log phase (OD600nm = 0.5), and protein overexpression induced by the addition of IPTG to a

final concentration of 1 mM. The growth temperature was shifted down to 25˚C (250

rpm), and the induced cultures allowed to grow for an additional 3 hrs. Cultures were

harvested by centrifugation at 5000 rpm and 4˚C. Pellets were resuspended in lysis buffer (50 mM sodium phosphate 500 mM NaCl 10 mM imidazole, pH 8.0 and 1 mM

PMSF) and sonicated. Following sonication, the cleared lysate was collected by centrifugation at 15,0000 rpm and 4˚C. The cleared lysate was filtered through a

0.22 μm filter, and mixed with equilibrated Sigma HIS-select beads (Sigma-Aldrich).

The mixture was loaded onto a glass chromatography column (Bio-Rad) and washed with

20 CV (column volumes) of Buffer A (50 mM sodium phosphate 500 mM NaCl 10 mM imidazole, pH 8.0). Buffer B (50 mM sodium phosphate 500 mM NaCl 500 mM imidazole, pH 8.0) was used to elute the protein. Sigma HIS-Select® spin columns

(Sigma-Aldrich) were used to purify the SpoIID mutants. Proteins were dialyzed into 10

mM Tris-Cl 150 mM NaCl, pH 8.0. Concentrations were determined by A280nm analysis

and confirmed by the Bradford assay. Aliquots of the purified proteins were flash frozen

in liquid nitrogen for storage at -80˚C.

Renaturing gel electrophoresis for cell wall hydrolytic activity (Zymography)

Zymography assays were performed as previously described (Abanes-De Mello et

al., 2002; Foster, 1992). Briefly, purified His6-SpoIID (27-343) and SpoIID mutants

were subjected to SDS-PAGE, with gels containing 0.1% (w/v) M. luteus cells as

substrate. SDS-PAGE gels were run at room temperature at a constant 15 mA.

Following electrophoresis, gels were rinsed in deionized water and transferred to 250 mL of renaturation solution (25 mM Tris-Cl, 1% Trition X-100, pH 7.2). The zymography gels were incubated at 37˚C for 12-18 hrs. with gentle shaking. Following incubation, gels were rinsed with deionized water, stained with 0.01% (w/v) methylene blue in 0.01%

(w/v) potassium hydroxide for 2 hrs., and destained with deionized water. Zones of clearing in the blue background indicated cell wall hydrolytic activity. Lysozyme and bovine serum albumin (BSA) were used as positive and negative controls, respectively.

Cell wall binding

10 μg of purified SpoIID and 10 μg of BSA (negative control) were added to 200

μg of purified B. subtilis cell walls and incubated on ice for 30 min. Following

74 incubation, the reaction mixture was centrifuged at 14,000 rpm, 5 min. The supernatant fraction and pellet fraction (solubilized with 8M Urea) were separated, and 2x SDS sample buffer was added to each fraction. 1/10 of the fractions, along with no cell wall loading controls, were loaded onto 12.5% SDS-PAGE gels, and run at 170 V for 45 min.

Gels were stained with Coomassie blue. The absence of the protein from the supernatant and enrichment in the pellet fraction indicated cell wall binding activity.

Spore titer assay

To test for heat resistant spores, single colonies were inoculated into 3 mls of

Difco sporulation media (DSM) and grown at 37˚C. After 24 hrs., the undiluted culture was incubated at 80˚C for 20 min. Following incubation, 10-fold serial dilutions

(undiluted to 10-6) were made in microtiter dishes using 1x T-base. 100 μl of each

dilution was plated in duplicate on LB agar plates. Plates were incubated overnight at

37˚C to allow for spore germination, and following incubation, the number of heat

resistant spores / ml of culture was determined.

Table 4.1: Strains used in this study Strain Genotype Reference PY79 Wild type (Youngman et al., 1984) KP7 spoIID298 (Lopez-Diaz et al., 1986) SA100 pSA12 / BL21 (DE3) This study

SA200 spoIID298, amyE::PspoIIDspoIIDY65AΩkan This study SA201 spoIID298, amyE::PspoIIDspoIIDE73AΩkan This study SA202 spoIID298, amyE::PspoIIDspoIIDE78AΩkan This study SA203 spoIID298, amyE::PspoIIDspoIIDE79AΩkan This study SA204 spoIID298, amyE::PspoIIDspoIIDY80AΩkan This study SA205 spoIID298, amyE::PspoIIDspoIIDS87AΩkan This study SA206 spoIID298, amyE::PspoIIDspoIIDE88AΩkan This study SA207 spoIID298, amyE::PspoIIDspoIIDM89AΩkan This study SA208 spoIID298, amyE::PspoIIDspoIIDP90AΩkan This study SA209 spoIID298, amyE::PspoIIDspoIIDK94AΩkan This study SA210 spoIID298, amyE::PspoIIDspoIIDE96AΩkan This study SA211 spoIID298, amyE::PspoIIDspoIIDK99AΩkan This study SA212 spoIID298, amyE::PspoIIDspoIIDQ101AΩkan This study SA213 spoIID298, amyE::PspoIIDspoIIDR106AΩkan This study SA214 spoIID298, amyE::PspoIIDspoIIDT107AΩkan This study SA215 spoIID298, amyE::PspoIIDspoIIDS181AΩkan This study SA216 spoIID298, amyE::PspoIIDspoIIDT182AΩkan This study SA217 spoIID298, amyE::PspoIIDspoIIDS184AΩkan This study SA218 spoIID298, amyE::PspoIIDspoIIDE189AΩkan This study SA219 spoIID298, amyE::PspoIIDspoIIDY201AΩkan This study SA220 spoIID298, amyE::PspoIIDspoIIDK203AΩkan This study SA221 spoIID298, amyE::PspoIIDspoIIDS204AΩkan This study SA222 spoIID298, amyE::PspoIIDspoIIDS207AΩkan This study SA223 spoIID298, amyE::PspoIIDspoIIDD210AΩkan This study SA224 spoIID298, amyE::PspoIIDspoIIDS213AΩkan This study SA225 spoIID298, amyE::PspoIIDspoIIDK215AΩkan This study SA226 spoIID298, amyE::PspoIIDspoIIDT219AΩkan This study SA227 spoIID298, amyE::PspoIIDspoIIDE223AΩkan This study SA228 spoIID298, amyE::PspoIIDspoIIDQ226AΩkan This study SA229 spoIID298, amyE::PspoIIDspoIIDQ228AΩkan This study SA230 spoIID298, amyE::PspoIIDspoIIDK234AΩkan This study SA231 spoIID298, amyE::PspoIIDspoIIDF295AΩkan This study SA232 spoIID298, amyE::PspoIIDspoIIDH297AΩkan This study SA233 spoIID298, amyE::PspoIIDspoIIDV299AΩkan This study SA234 spoIID298, amyE::PspoIIDspoIIDM301AΩkan This study SA235 spoIID298, amyE::PspoIIDspoIIDQ303AΩkan This study

Results

Site-directed mutagenesis of SpoIID

In order to identify amino acids that were involved in the enzymatic activity of

SpoIID, we conducted a localized site-directed mutagenesis. First, since SpoIID showed no obvious homology to known peptidoglycan hydrolases and is conserved across all endospore forming bacteria, I performed a sequence alignment to identify potential catalytic amino acids (Fig. 4.2). Second, I reasoned that catalytic amino acids were likely those involved in well characterized hydrolysis reactions: (1) nucleophiles; (2) polar residues that increase the activity of a nucleophile; (3) residues that can coordinate an active site metal. I chose 36 residues that fit these criteria and together with former student Jonathan Shum, used site directed mutagenesis to replace the targeted amino acids with Alanine, which are unable to participate in hydrolysis reactions but can often be accommodated in proteins without severely disrupting protein folding or stability.

The mutations were constructed in two separate plasmids, one designed to express the

His6-tagged soluble domain of SpoIID in E. coli for biochemical analysis, and a second to

express the native protein under endogenous control in B. subtilis for an in vivo analysis

of its ability to support engulfment.

I first purified and characterized the biochemical activities of the mutant proteins.

Of the 36 mutant proteins, I identified one that was fully defective in cell wall hydrolase

activity. The mutant protein, E88A, showed a sharp decrease in cell wall hydrolase

activity compared to wild type, as assessed by zymography, but retained full cell wall

77 binding activity (Fig. 4.3). These results suggested that E88A could be an active site residue of SpoIID.

In order to confirm that the E88A mutant phenotype was a result of disrupting an active site residue and not simply due to misfolding caused by the replacement of

Glutamate by Alanine, Circular Dichroism (CD) spectroscopy was performed on the mutant and wild-type proteins to compare their general secondary structure composition.

The far-UV CD spectra (Fig. 4.4) of the mutant E88A was nearly identical to the wild- type SpoIID (27-343) protein. Taken together with the fact that the E88A mutant protein binds cell walls as efficiently as the wild type SpoIID, these results suggest that the mutation we introduced disrupted an amino acid critical for enzymatic activity but not for protein folding.

Figure 4.2. Sequence alignment of SpoIID showing conserved amino acids targeted for site-directed mutagenesis. A full sequence alignment of B. subtilis SpoIID was made against other Bacillus sp. and C. perfringens. Conserved amino acids (shaded grey) were chosen for site-directed mutagenesis. The numbered residues show the amino acids that showed either a defect in biochemical activity (88) or a defect in engulfment (203, 204, 210, 219) when changed to Alanine.

Figure 4.3. Biochemical activity of SpoIID mutants. (A) Zymography assay showing the loss of cell wall hydrolytic activity of the E88A mutant. (B) Cell wall binding assay showing wild type levels of cell wall binding activity of the five mutants that displayed an interesting phenotype.

Figure 4.4. CD spectra of wild type and E88A. Far-UV CD spectra (180-280 nm) of the wild type SpoIID and E88A proteins. The spectra of the two proteins was almost identical, suggesting the E88A mutation did not adversely affect the secondary structure of the protein.

Peptidoglycan hydrolysis is necessary for engulfment

I was interested in correlating the in vitro enzymatic activities of SpoIID with its in vivo function during engulfment. Therefore, in order to examine the effects of peptidoglycan hydrolysis on engulfment, I introduced the catalytically defective mutant into B. subtilis (using an integration vector encoding the full length spoIID under the native promoter) and looked for any engulfment-related defects. Interestingly, the E88A mutant resembled a null mutation in spoIID, as it was unable to initiate or complete engulfment, and formed the characteristic bulge phenotype of engulfment mutants when viewed by fluorescence microscopy (Fig. 4.5C; Tables 4.2 & 4.3) These results provide direct evidence that the peptidoglycan hydrolase activity of SpoIID is required for engulfment.

Sporulation defective mutants

The mutant analysis also led to the identification of four mutants, K203A, S204A,

D210A, and T219A, that were wild type for cell wall hydrolysis and binding but were impaired at various steps of engulfment. Two of the mutants, K203A and S204A showed no septal thinning or membrane migration when observed by fluorescence microscopy

(Fig. 4.5D-E; Tables 4.2 & 4.3). Interestingly, the K203A but not the S204A mutant showed an increase in the frequency of disporic sporangia (approximately 2 times that of a null mutant). These sporangia result from the failure to block cell division at the second potential site for polar septation, which lies within the mother cell (Pogliano et al.,

1999). In wild type sporangia, division at this site commences, but the engulfment

82 proteins mediate the degradation of septal peptidoglycan, thereby mediating retraction of the partial septa (Chastanet and Losick, 2007; Eichenberger et al., 2001; Pogliano et al.,

1999). The disporic phenotype of the mutants mimics that of a double or triple engulfment mutant knockout (Pogliano et al., 1999). Thus, although it displays normal in vitro activities, it is possible that the K203A mutation disrupts interactions between

SpoIID and the other engulfment proteins and/or the Q-AH zipper or SpoIVFAB.

Preliminary studies show that GFP-SpoIIP localizes to the middle of the septum in the

K203A and S204A backgrounds (data not shown), suggesting that these mutations do not completely block the interaction between SpoIID and SpoIIP, SpoIIM, or SpoIIB. It is therefore possible that these mutations either lead to the assembly of a nonfunctional hydrolase complex or prevent interactions with other proteins involved in engulfment such as the Q-AH zipper (Broder and Pogliano, 2006), SpoIVFAB (Aung et al., 2007), or the DivIB cell division protein (Broder and Pogliano, 2006; Thompson et al., 2006).

The other two mutant proteins with normal biochemical activities, D210A and

T219A, showed a more intermediate engulfment phenotype, as they were able to proceed past the step of septal thinning and initiate membrane migration (Fig. 4.5F-G). However, both mutant proteins failed to complete engulfment, as 0% of the sporangia were fused

3.5 hours after the initiation of sporulation compared to 83% of wild type sporangia

(Table 4.3). These results suggest a role for SpoIID during late in engulfment, perhaps during the final stages of membrane migration, where the precise alignment of the mother cell membranes might be necessary, or in the step of membrane fusion itself. These mutants provide the first hint that SpoIID might participate in this late step of engulfment.

Figure 4.5. Engulfment phenotypes of SpoIID mutant proteins. (A) Wild type sporangia, showing smooth, curved septa indicative of normal engulfment (arrow). Scale bar, 1 μm. (B) Null mutant of spoIID, with sporangia arrested at the stage of septal thinning and showing characteristic bulge phenotype (arrowhead). (C) E88A mutant, showing a phenotype similar to the null mutant (arrowhead). (D) The K203A mutant shows a severe early engulfment defect, with an increase in the frequency of dispores (double arrowhead). (E) The S204A mutant, showing an early engulfment defect. (F) and (G) D210A and T219A mutants, respectively, showing essentially normal membrane migration. However, these mutants are unable to complete engulfment (triple arrowhead).

Table 4.2. Spore titers of SpoIID mutants Genotype Spore titer (spores/ml)a PY79 3.6 x 108 IID298 3.0 x 101 E88A 1.5 x 104 K203A 1.5 x 104 S204A 8.0 x 103 D210A 3.0 x 106 T219A 5.5 x 105 a The number of heat resistant spores/ml of culture was determined for the various SpoIID mutants and controls.

Table 4.3. Percent sporangia showing the indicated engulfment phenotype Earlya Lateb Bulgec Fusedd Disporese (t3.5) (t2.5)

WT 49.9% 49.7% 0.4% 83% 4.0% (238/477) (237/477) (2/477) (317/381) (7/176)

Null 62.5% 1% 36.5% 0% 12.9% (185/296) (3/296) (108/296) (0/68) (36/278)

E88A 56.4% 0% 43.6% 0% 9.2% (136/241) (0/241) (105/241) (0/70) (26/282)

K203A 72.4% 0.3% 27.3% 0% 22.1% (278/384) (1/384) (105/384) (0/90) (89/402)

S204A 65.3% 0.4% 34.3% 0% 10.9% (177/271) (1/271) (93/271) (0/349) (41/376)

D210A 58.5% 36.0% 5.5% 0% 7.6% (267/456) (164/456) (25/456) (0/365) (15/198)

T219A 56.7% 42.2% 1.1% 0% 2.4% (255/450) (190/450) (5/450) (0/327) (8/339)

Sporangia were scored at t1.75 hours after the initiation of sporulation unless otherwise noted. a Early - septum was flat or slightly curved b Late - engulfment was >50% complete c Bulge – forespore beginning to push through or already into the mother cell cytoplasm d Fused – Forespores that have been completely engulfed as assessed by membrane fusion at t3.5hrs. after the initiation of sporuation (Sharp and Pogliano, 1999) eDispores – Assessed by the presence of either partial or complete second septa t2.5hrs. after the initiation of sporulation.

SpoIID is an endopeptidase

Finally, I sought to identify the precise substrate specificity of SpoIID. To this end, we collaborated with the Popham lab, and treated peptidoglycan prepared from sporulating cells (t2hrs.) with purified SpoIID. Following treatment, the peptidoglycan

from both the pellet, which contained large cell wall fragments, and the supernatant,

which contained the smaller, soluble digestion products, were analyzed. Peptidoglycan from the pellet fraction was digested with mutanolysin to produce more manageable fragment sizes, and the muropeptides derived from the peptidoglycan were separated by high performance liquid chromatography (HPLC). Eight unique peaks (Fig. 4.6) were found when comparing the HPLC profile of the SpoIID treated peptidoglycan to the untreated peptidoglycan. Mass spectrometry analysis indicated that of these eight peaks, six were peptidoglycan-derived muropeptides and two were peptides from the protein preparation. Additionally, the unique peptidoglycan-derived muropeptide peaks were not found in SpoIID boiled prior to mixing with peptidoglycan. The unique peaks were collected and their structures analyzed using mass spectrometry.

Mass spectrometry analysis of purified peak C resulted in the determination of a predicted muropeptide structure consisting of a disaccharide-tetrapeptide (NAG-NAM disaccharide with a L-Ala-D-Glu-Dpm-D-Ala peptide side chain). In vegetative B. subtilis cells, tetrapeptide side chains are involved in cross-linking, in which the terminal

D-Ala on the tetrapeptide is bound by a peptide bond to the Dpm residue on another

strand (Popham et al., 1996). Thus, the increase in this disaccharide-tetrapeptide (DS-

TP) muropeptide in SpoIID-treated peptidoglycan suggests that SpoIID is an

88 endopeptidase that cleaves existing peptide cross-links. Further analysis of the peaks showed approximately a 1/3 decrease in the cross-linking of the peptidoglycan following

SpoIID treatment (35.0% to 24.6%) (data not shown), consistent with the ability of

SpoIID to cleave cross links in the peptidoglycan.

Figure 4.6. HPLC chromatograms of SpoIID treated peptidoglycan. B. subtilis peptidoglycan purified from cells t2hrs. after the onset of sporulation was treated with SpoIID (lower panel). Following incubation, the digestion products were treated with mutanolysin and run on reversed phase HPLC. Compared to untreated peptidoglycan (upper panel), 8 unique peaks were found. 6 of these peaks (A-F) were determined to be peptidoglycan derived products, whereas 2 of the peaks (G-H) were not peptidoglycan derived.

The increase in uncrosslinked peptidoglycan suggested that SpoIID could be cleaving the peptidoglycan at two potential sites. One site would be directly at the peptide cross-link between Dpm and D-Ala of adjacent glycan chains, and the other between the Dpm and D-Ala on the same tetrapeptide attached to a single glycan chain

(see Fig. 1.4, Chapter 1 on page 17). To distinguish between these two possibilities, the purified muropeptide from peak C was treated with fluorodinitrobenzene (FDNB) to modify free amino groups, followed by acid hydrolysis and identification of the resulting dinitrophenyl amino acids (DNP-amino acids) by HPLC and mass spectrometry (data not shown). If SpoIID cleaved at site 1, the resulting product would have been a disaccharide-tetrapeptide with a free amino group on the Dpm residue, whereas cleavage at site 2 would have resulted in a free amino group on the D-Ala residue. From these experiments, the only modified amino acid was Dpm, inidicating that SpoIID cleaves at site 1. Taken together, these results demonstrate that SpoIID is an endopeptidase that cleaves the peptidoglycan directly at the cross-link between Dpm of one tripeptide and the D-Ala of another tetrapeptide, leaving a linear tetrapeptide.

Discussion

These studies provide biochemical, genetic, and cell biological evidence that the peptidoglycan hydrolase activity of SpoIID is required for engulfment in B. subtilis.

Mutational analysis of conserved residues of SpoIID has revealed an active site residue,

E88, which is required for the cell wall hydrolase activity of this essential engulfment protein. The E88A mutation clearly shows there are at least 2 separate and independent domains of SpoIID, one responsible for cell wall hydrolase activity and the other for cell wall binding, because the latter function was not impaired. Expression of the mutant protein in living B. subtilis cells demonstrated that the hydrolase activity of SpoIID is required for septal thinning and is likely essential for membrane migration. SpoIID likely contains additional amino acids that are important for SpoIID activity, because most endopeptidase reactions involve two nucleophilic attacks on the substrate (Polgar, 2005).

Finally, in a collaborative effort with Dr. David Popham’s laboratory at Virginia

Polytechnic Institute and State University. I demonstrated that SpoIID is an endopeptidase that cuts the peptide cross-link between meso-diaminopimelate (Dpm) and

D-Ala on adjoining glycan strands within the peptidoglycan.

Peptidoglycan hydrolases can be classified into 4 general groups based on substrate specificity: (1) glucosaminidase; (2) muramidase / lytic transglycosylase; (3) amidase; (4) endopeptidase (see Fig. 1.4, Chapter 1 on page 17). The biochemical studies in this chapter demonstrate that SpoIID is a founding member of a new subclass of endopeptidases that function by removing the peptide cross-links between adjoined

93 glycan strains. Previously, the only peptidoglycan hydrolases in B. subtilis thought to mediate hydrolysis of the peptidoglycan cross-links were members of the lysostaphin- type family (SpoIIQ and SpoIVFA). Oddly, lysostaphin specifically cleaves the pentaglycine moiety that cross-links the side-peptides in S. aureus (Schindler and

Schuhardt, 1964), a moiety that has not been observed in B. subtilis peptidoglycan (Foster and Popham, 2002). Therefore, SpoIID represents the first peptidoglycan hydrolase identified in B. subtilis that cleaves the bond that links the Dpm of one side-chain tripeptide and D-Ala of another side-chain tetrapeptide. Interestingly, the substrate specificity of SpoIID suggests that it is likely capable of hydrolyzing the majority of crosslinks in the B. subtilis cell wall to leave long and uncrosslinked glycan chains.

These glycan chains include both tripeptide and tetrapeptide side chains that can potentially serve as substrates for subsequent biosynthetic reactions (Scheffers and Pinho,

2005). It is therefore intriguing to speculate that selective cuts in the peptidoglycan during engulfment, rather than the complete removal of the cell wall material in the septal space, might allow sporulating bacteria to “recycle” the peptidoglycan for use in germ cell wall or cortex biosynthesis later in the spore formation pathway (Foster and Popham,

2002).

Interestingly, SpoIIP has recently been found to be a peptidoglycan hydrolase

(Chastanet and Losick, 2007), showing homology to the N-terminal catalytic domain of the N-acetylmuramoyl-L-alanine amidase CwlV of Paenibacillus polymyxa. If SpoIIP has a similar substrate specificity to CwlV, then two types of peptidoglycan modifications are likely made during engulfment: (1) Removal of peptide cross-links by

SpoIID and (2) Separation of the peptide side chains from the glycan strands by SpoIIP.

Research reported in Chapter 2 (Aung et al., 2007) and by Chastanet and Losick (2007) have recently demonstrated that SpoIID and SpoIIP interact, most likely in a mother-cell complex anchored by the polytopic membrane protein SpoIIM. Additional evidence for the interaction of these enzymes is that the absence of either SpoIID or SpoIIP in sporulating cells results in this mother cell complex being trapped at the middle of the sporulation septum, unable to complete septal thinning or initiate membrane migration.

Thus, the cell wall hydrolytic activity of both enzymes is necessary for the efficient progression of engulfment, suggesting that the enzymes modify or enhance the activity of one another, as has been reported in the case of the vegetative cell autolysins LytB and

LytC (Herbold and Glaser, 1975; Kuroda et al., 1992). However, it remains unclear how these two distinct hydrolytic activities of SpoIID and SpoIIP function in engulfment, and whether or not these two peptidoglycan hydrolases work in tandem on the same strand of peptidoglycan, on adjoining strands, or if, despite their interaction and proximity, they act independently. Further experiments are required to tease apart the topological relationships between these two enzymes and their common substrate.

The studies in this chapter have also identified two separate classes of mutant proteins that have normal biochemical activites but completely block engulfment in living cells. The first class, K203A and S204A, causes an early engulfment defect at the stage of septal thinning. The K230A mutant showed an increase in frequency of disporice sporangia, a phenotype that has been previously seen in double and triple engulfment mutants (Pogliano et al., 1999). These results suggest that the K203A mutant could be involved in protein-protein interactions with other proteins involved in engulfment. The second class of mutant proteins, D210A and T219A, show a late

95 engulfment defect at the stage of membrane fusion, suggesting for the first time a potential role for SpoIID during a later stage of engulfment. It is possible that SpoIID functions at this step to precisely align the leading edge of the engulfing membrane in preparation for fusion, or it might directly participate in membrane fusion, which requires the membrane protein SpoIIIE (Liu et al., 2006; Sharp and Pogliano, 1999). One possible way that these mutations could block membrane fusion is by preventing the relocalization of SpoIIIE from the septal midpoint to the site of membrane fusion at the distal pole. It is also possible that the completion of membrane fusion is more directly coupled to modification of the peptidoglycan, as is suggested by the ability of mutations in the E. coli SpoIIIE homologue FtsK to be suppressed by mutations in the peptidoglycan DD- endopeptidase PBP5 (Begg et al., 1995). Further characterization of these two new classes of spoIID mutations will allow a more complete picture of the multiple roles of

SpoIID in engulfment.

Acknowledgements

The text of this chapter will be submitted for publication. I am the primary researcher of this work and all experiments were performed by me with the exception of the analysis of hydrolytic products by HPLC. This research was performed under the supervision of Dr. Kit Pogliano.

V. CHAPTER FIVE:

Concluding Discussion

97 98

In order to ensure survival in times of nutrient starvation, Bacillus subtilis and other endospore forming bacteria sporulate. The end result of sporulation is the formation of a robust spore that is capable of remaining dormant indefinitely (Cano and

Borucki, 1995; Kennedy et al., 1994; Nicholson and Galeano, 2003; Vreeland et al.,

2000). However, the real beauty of this survival mechanism lies in the fact that once favorable conditions reemerge, the dormant endospore is able to germinate and resume vegetative growth.

Engulfment is an essential early step in the spore developmental pathway of

Bacillus subtilis and other endospore forming bacteria, and is one of the few endocytic events in bacterial cells (Errington, 2003b; Piggot and Hilbert, 2004; Stragier and Losick,

1996). Previous studies have implicated four proteins, SpoIID, SpoIIM, SpoIIP, and

SpoIIIE, as essential for engulfment (Frandsen and Stragier, 1995; Lopez-Diaz et al.,

1986; Sharp and Pogliano, 1999; Smith et al., 1993). Mother cell expression of SpoIID,

SpoIIM, and SpoIIP mediate the early stages of engulfment, septal thinning and membrane migration (Chapter 3) (Abanes-De Mello et al., 2002), whereas SpoIIIE mediates the final stage of engulfment, membrane fusion (Liu et al., 2006; Sharp and

Pogliano, 1999). Results from fluorescence microscopy experiments with GFP fusion proteins to the engulfment proteins showed that SpoIID, SpoIIM, and SpoIIP all localize initially to the newly formed sporulation septum, then relocalize to the leading edges of the engulfing mother cell membrane, where they remain until the completion of engulfment (Abanes-De Mello et al., 2002). Although at the outset of my thesis the engulfment machinery had been identified and the process somewhat characterized,

99 several questions remained. For instance, how are the engulfment proteins targeted to the septum? Second, once the engulfment proteins are at the septum, how do they relocalize to the leading edge of the engulfing mother cell membranes? Finally, how do the engulfment proteins function mechanistically during engulfment? The data presented in this dissertation helps to address these questions, by first showing the mechanisms by which the engulfment proteins localize to their site of action. The latter half of the dissertation focuses on efforts aimed at examining the engulfment protein SpoIID, characterizing its enzymatic activity with respect to its function during engulfment.

Dynamic protein localization is critical throughout the life cycle of bacteria, during processes such as cell division, signal transduction, and development (Errington,

2003a; Gitai et al., 2005; Lybarger and Maddock, 2001; Shapiro et al., 2002). In fact, during sporulation in B. subtilis, a well characterized mechanism for protein localization depends upon a zipper-like interaction between the forespore expressed protein SpoIIQ and its mother cell partner, SpoIIIAH (Blaylock et al., 2004). The Q-AH zipper, which participates in membrane migration during engulfment (Broder and Pogliano, 2006), directs the localization of several mother cell membrane proteins required for the activation of the post-engulfment transcription factors σG and σK to the septum (Blaylock

et al., 2004; Doan et al., 2005; Jiang et al., 2005). The zipper thus integrates the

morphological checkpoint of engulfment with the signaling pathways that are essential

for proper spore development.

Since the Q-AH zipper mediates the localization of several protein complexes, it

seemed reasonable that it could also facilitate the targeting of the engulfment machinery

SpoIID, SpoIIM, and SpoIIP. However, initial studies suggested otherwise, as GFP-

100

SpoIIP and GFP-SpoIIM localized to the septum in both spoIIQ and spoIIIAGH single mutants. Therefore, I examined the possibility that another sporulation protein, SpoIIB, was involved in targeting the engulfment proteins to the septum. Initial experiments performed by Ana Perez, Jonathan Shum and Angelica Abanes DeMello suggested that

SpoIIB may be involved in directly or indirectly getting the DMP machinery to the septum. My studies showed that SpoIIB is in fact the primary targeting mechanism for the DMP complex, as mutants in spoIIB showed decreased localization of the engulfment proteins SpoIIM and SpoIIP and instead showed a random mother cell membrane distribution. In fact, by initially localizing to the septum during its biogenesis and remaining at the completed septum, SpoIIB acts, either directly or indirectly, as a landmark for the septal localization of the engulfment machinery (Aung et al, 2007).

This localization mechanism is similar to that of the C. cresentus TipN protein, which localizes to the nascent septum and remains at the cell pole to serve as a landmark for polar localization (Huitema et al., 2006; Lam et al., 2006). I also helped show that once at the septum, SpoIIM mediates the localization of SpoIIP, while SpoIID and SpoIIP are required for moving the DMP proteins to the leading edges of the engulfing mother cell membranes. These results suggested that SpoIIB, DMP are in a complex and that SpoIIB is required for localization.

One limitation with these studies stemmed from the fact that while the GFP fusions to the engulfment proteins showed wild type levels of spore formation and complemented the respective null mutations (Abanes-De Mello et al., 2002), they exhibited a synergistic and complete engulfment defect when combined with a spoIIB mutation (Chapter 2) or with other mutations that slow engulfment (Broder and Pogliano,

101

2006). Normally, spoIIB mutant sporangia show incomplete and haphazard septal thinning; however, this engulfment defect is transient, and sporangia are able to recover and complete engulfment, suggesting that the engulfment proteins must ultimately localize (Perez et al., 2000). I addressed the synergistic engulfment defect by expressing the GFP-SpoIIP fusion with native SpoIIP, in a background lacking spoIIB. This rescued the synergistic engulfment defect, giving two populations of cells. One population appeared similar to the strains lacking native SpoIIP, with sporangia showing essentially random localization of GFP-SpoIIP and no engulfment. However, in cells that were able to overcome the transient engulfment defect, GFP-SpoIIP localized normally to the sporulation septum and even to the leading edges of the engulfing cell membranes.

Therefore, the absence of SpoIIB compromised, but did not completely block localization of SpoIIP to the septum and leading edge. These results suggested that SpoIIB is either directly or indirectly required for efficient localization of SpoIIP and SpoIIM to the septum, and that a second mechanism likely existed for localizing the engulfment proteins.

In search of a secondary localization pathway for the engulfment proteins, I took a genetic and cell biological approach. By using fluorescence microscopy, I was able to assess the effects of double mutants of candidate proteins and spoIIB on the localization of SpoIIP. I reasoned that if there were indeed two mechanisms by which the engulfment proteins localize to the septum, knocking out both pathways should result in the complete loss of localization. I initially tested the Q-AH zipper (Broder and Pogliano, 2006), which localizes by an independent manner to the septum (Rubio and Pogliano, 2004), as a candidate for a secondary localization pathway. Inactivating both spoIIB and either

102 spoIIQ or spoIIIAGH resulted in a random mother cell distribution of SpoIIP, suggesting a role for the Q-AH zipper in localizing the engulfment proteins. Furthermore, I was able to show that the mother cell proteins SpoIVFA and SpoIVFB, which require the Q-AH zipper for their localization, mediate this compensatory, SpoIIB-independent localization pathway. Thus, there appears to be two distinct mechanisms for DMP localization, a primary mechanism in which SpoIIB acts as a septal landmark protein, and a secondary,

SpoIIB-independent pathway that depends upon the Q-AH zipper (via SpoIVFAB). This redundancy in targeting mechanisms echos the redundancy in membrane migration described by Broder et al. (2007), highlighting the importance of engulfment in survival of B. subtilis.

Future experiments are needed to determine whether localization via the two pathways are mediated by direct protein-protein interactions, as has been demonstrated for the Q-AH zipper (Blaylock et al., 2004) and its subsequent recruitment of

SpoIVFA/SpoIVFB to the septum (S. Chiba, personal communication). While biochemical evidence suggests that SpoIID and SpoIIP interact (Aung et al., 2007)

(Chastanet and Losick, 2007), no interactions have been yet been detected between

SpoIID and proteins such as SpoIIB, SpoIIM or SpoIVFAB. An alternative to the protein-protein interaction based localization pathway is peptidoglycan modification, which could serve as a means to bind and localize engulfment proteins to the septum. In keeping with this possibility, SpoIIB shows some sequence similiarity to the CwlC amidase (Chastanet and Losick, 2007; Soding et al., 2005), SpoIIQ and SpoIVFA show sequence similarity to the lysostaphin like family of endopeptidases (Rudner et al., 1999), and SpoIID is a peptidoglycan hydrolase and cell wall binding protein (Chapter 3;

103

(Abanes-De Mello et al., 2002). It is therefore possible that the genetic hierarchy for localization represents a requirement for early proteins, such as SpoIIB, to modify the peptidoglycan in such a way so that the engulfment proteins can bind to the septum. This possibility is attractive since it would be a logical mechanism for the spatial and temporal regulation of these peptidoglycan hydrolases, which is necessary to avoid cell lysis. It is also attractive, because peptidoglycan is a large molecule that is stationary until it is recycled that could provide an ideal landmark within bacterial cells.

As discussed in Chapter 3, my early thesis studies helped demonstrate that SpoIID has peptidoglycan hydrolase activity (Abanes-De Mello et al., 2002). This was an important finding, since although localized peptidoglycan degradation was thought to be necessary during septal thinning and membrane migration, no peptidoglycan hydrolases had been identified that were required for engulfment. It now seems convenient that of the three proteins that have been shown to be essential for the early stages of engulfment, two of them, SpoIID and SpoIIP, have peptiodglycan hydrolase activity. Furthermore, my studies demonstrated that SpoIID is the founding member of a new class of peptidoglycan hydrolase whose only members described to date are found in the endospore forming bacteria, suggesting that it might have a novel hydrolytic activity that is capable of promoting membrane migration during engulfment.

This finding led to my interest in characterizing the cell wall binding and hydrolytic activities of SpoIID, with the hopes of correlating these activities of SpoIID with its function during engulfment and its ability to localize to the septum.

Unfortunately, crystallization experiments aimed at solving the three dimensional crystal structure of this newly discovered hydrolase proved unsuccessful (Appendix). However,

104 by taking a site-directed mutagenesis strategy to identify amino acids responsible for the activity of SpoIID, I was able to show that one amino acid, E88 is likely an active site residue of SpoIID. Substituting this amino acid with Alanine completely blocks hydrolytic activity and ability to support engulfment in living cells, but has no effect on cell wall binding. This result provides the first direct demonstration that the peptidoglycan hydrolysis activity of SpoIID is essential for engulfment.

In collaboration with the Popham lab, I was also able to demonstrate the substrate specificity of SpoIID. SpoIID has endopeptidase activity, and is capable of cleaving the peptide cross-links in peptidoglycan between Dpm (meso-diaminopimelic acid), the amino acid that cross-links the peptide side chains of adjacent peptidoglycan strands.

This particular endopeptidase substrate specificity is novel to the previously identified B. subtlis peptidoglycan hydrolases (Foster and Popham, 2002; Smith et al., 2000), consistent with the lack of detectable sequence similarity between SpoIID and proteins outside of the endospore forming bacteria. The breakdown products of the peptidoglycan resulting from SpoIID activity would be a long glycan chain with a tripeptide side chain and another glycan chain with a tetrapeptide side chain. This is intriguing because these products could potentially be “recycled” for use later on in the spore formation pathway, such as in germ cell wall biosynthesis, rather than being completely removed. Cuts such as those made by SpoIID would potentially leave cleavage products that could serve as monomeric substrates for subsequent reactions.

My mutagenesis studies also helped identify four other mutants, K203A, S204A,

D210A, and T219A that were wild type for their biochemical activities (cell wall hydrolase and binding) but were defective in various stages of sporulation. The first two

105 mutants, K203A and S204A, showed an early engulfment defect, blocked at the stage of septal thinning. In addition, the K203A mutant showed approximately a two-fold increase in the frequency of disporic sporangia compared to the null mutant. This increase in disporic sporangia has been previously observed in double and triple engulfment mutants, and to a greater extent in σΕ mutants (Pogliano et al., 1999).

Therefore, it is possible that the K203A mutant could be involved in protein-protein

interactions with other proteins involved in engulfment. Studies are currently underway

to test the effects of these mutations on the localization of GFP-SpoIIP and GFP-SpoIIM.

Preliminary results suggest that septal localization of GFP-SpoIIP is not impaired in the

K203A or S204A background, suggesting that these mutations do not completely block

the interaction between SpoIID and SpoIIP, SpoIIM, or SpoIIB. However, it remains

possible that these amino acids might regulate septal thinning, for example, by activiating

the SpoIIP hydrolase.

The other two sporulation defective mutants with normal biochemical activities,

D210A and T219A, show a late engulfment defect. Although both these mutants progress past the septal thinning stage and initiate membrane migration, they fail to

complete the last stage of engulfment, membrane fusion. This suggests that SpoIID

might play a role in membrane fusion. One possibility is that the mutations block

relocalization of the DNA translocase SpoIIIE, which is required for engulfment

membrane fusion from the septal midpoint to the site of fusion (Liu et al., 2006; Sharp

and Pogliano, 1999). Another possibility is that peptidoglycan remodeling enzymes are

directly involved in this later step or engulfment, or perhaps that the engulfing

membranes do not meet in the appropriate topology to support fusion. Further

106 experiments on these mutants are required, including examining localization of SpoIIIE and using electron microscopy to examine the topology of the engulfing membranes at higher resolution. Should these studies fail to clearly illuminate the reasons these SpoIID mutants are sporulation defective, a suppressor analysis might be useful to identify interacting proteins.

The fact that single mutations that abolish the hydrolytic activity of either SpoIID or SpoIIP cause a complete block in engulfment at the septal thinning stage demonstrates that the hydrolase activity of both proteins is required for engulfment to proceed. It also suggests that perhaps SpoIID and SpoIIP might regulate each others activity in vivo.

There is precedent for such a regulatory effect, as has been reported for the B. subtilis vegetative autolysins LytB and LytC, the latter of which has N-acetylmuramoyl-L- alanine amidase activity (Herbold and Glaser, 1975; Kuroda et al., 1992; Lazarevic et al.,

1992). In the Herbold and Glaser study, LytB was shown to increase the activity of LytC three-fold in vitro. In support of a potential regulatory interaction between SpoIID and

SpoIIP, co-immunoprecipitation experiments have shown a direct interaction between

SpoIID and SpoIIP (Aung et al, 2007). Further biochemical studies are required to determine the extent to which activity of these two enzymes are coordinated.

A critical future aim of engulfment studies will be to further characterize the enzymatic activity of SpoIID in order to further elucidate the precise hydrolytic mechanism and to determine if its activity is compatible with the previously proposed model for hydrolysis-mediated membrane movement. In this model, it is thought that

SpoIID and possibly SpoIIP act as motor proteins, dragging the mother cell membrane around the forespore as they hydrolyze the septal peptidoglycan (Abanes-De Mello et al.,

107

2002). A key requirement of this model is that SpoIID and SpoIIP should be processive enzymes that move along a strand of peptidoglycan. Classic enzymatic studies should be able to address this issue, although the purified bacterial cell walls normally used as substrates for these enzymes are far from ideal for these studies as they are massive and biochemically complex molecules, so it will likely be necessary to use synthetic substrates in these studies. There is precedent for enzymes involved in peptidoglycan metabolism acting processively, as the enzymes that comprise the peptidoglycan biosynthesis machinery, as well as several cell wall hydrolases, are processive enzymes that likely travel along the peptidoglycan strands as they synthesize or degrade cell wall material (Barrett et al., 1984; Herbold and Glaser, 1975; Holtje, 1996, 1998). This list of processive enzymes includes the B. subtilis LytB protein that SpoIID shows sequence similarity to, and which has been reported to confer processivity to the LytC protein it modifies (Herbold and Glaser, 1975). Thus, it is possible that SpoIID can act processively during engulfment, perhaps in concert with the SpoIIP hydrolase, which is predicted to have the same hydrolytic activity as LytC (Chastanet and Losick, 2007).

Together these findings suggest that the SpoIID and SpoIIP complex might be the active, processive enzyme(s) necessary for engulfment.

Revisiting the structural studies with SpoIID, perhaps trying to crystallize it with its cell wall substrate or with the interacting protein SpoIIP, might help shed some light on the question of processivity, since many processive enzymes partially or completely enclose their substrates (Breyer and Matthews, 2001). However, the ultimate test of the

Brownian ratchet motor model for engulfment will be single molecule experiments with purified active and inactive SpoIID (with or without SpoIIP) and synthetic peptidoglycan

108 substrates. The model predicts that only the enzymatically active protein will be able to move in a directional manner along its peptidoglycan substrate (Saffarian et al., 2004), while the inactive protein will bind and move bidirectionally. The E88A mutant isolated in my thesis research will be ideal for such studies as it retains full cell wall binding activity in the absence of hydrolytic activities.

Another key experiment will be to determine the precise hydrolysis mechanism of

SpoIID. Towards this end, a metal analysis should be performed with purified SpoIID to test the possibility that SpoIID is a metalloenzyme, like many other peptidoglycan hydrolases (Smith et al., 2000). Additionally, a search for additional amino acids that affect the activity of SpoIID will be needed, looking for amino acids that could help coordinate an active site metal or be directly involved in catalysis. Towards this aim, a few conserved amino acids are visible in the alignment in Fig. 4.2 (Chapter 4) and should be mutagenized and tested for their ability to support sporulation. I performed circular dichroism spectroscopy experiments to ensure that the loss of hydrolase activity seen in the E88A mutant was a result of knocking out a critical active site residue rather than misfolding caused by substitution of an Alanine. Although these experiments showed that the secondary structure of these mutant proteins seem intact as compared to wild type, it will be important to look at their protein levels in vivo using western blots with α-

SpoIID antibodies.

Peptidoglycan hydrolases must be strictly regulated to prevent lysis of the bacterial cell (autolysis), which is under considerable turgor pressure. Therefore, it will be important to determine how the activity of SpoIID is spatially and temporally regulated. Several possible post-translational modes of peptidoglycan hydrolase

109 regulation exist, ranging from differences in substrate conformation, covalent modifications of the peptidoglycan, secondary polymer (such as teichoic acids) distribution and the ionic environment of the cell wall (Cheung and Freese, 1985; Clarke,

1993; Fischer et al., 1981; Koch et al., 1985). First, as mentioned previously, SpoIID might require a modifier protein, such as SpoIIP in order to be active in vivo such that the proteins only act when they are both localized to the correct location in the cell. Second, specific modifications in the septal peptidoglycan may allow SpoIID to preferentially bind and hydrolyze peptidoglycan in a specific manner. Finally, the pH of the local environment which SpoIID functions may play a role in regulating SpoIID. Co- expression experiments with SpoIID and SpoIIP will help address the first possibility. As previously noted, SpoIID shows sequence similiarity to LytB, which increases the activity of the vegetative autolysin LytC three-fold (Herbold and Glaser, 1975; Kuroda et al., 1992; Lazarevic et al., 1992). It will be interesting to see how the activity of either enzyme is affected in the presence of the other. For instance, will the hydrolase activity of SpoIIP be elevated in the presence of SpoIID, much like the LytB-LytC interaction?

Also, further reversed phase HPLC analysis should be performed of peptidoglycan treated with purified SpoIIB, SpoIIQ, or SpoIVFA to help address the idea that these proteins are enzymes that modify septal peptidoglycan. Future studies will help to determine which of these regulatory mechanisms, if any, regulate SpoIID activity.

The work discussed in this dissertation has added to our understanding of engulfment in B. subtilis. However, further work must be done to gain a clearer mechanistic picture of this key aspect of spore development.

VI. APPENDIX:

Crystallization Trials of SpoIID

110 111

Introduction

Although the early engulfment events of septal thinning and membrane migration likely require peptidoglycan dissolution, my studies described in Chapter 3 were the first to investigate whether any of the engulfment proteins had the ability to hydrolyze peptidoglycan. It was somewhat surprising to find that SpoIID had clear peptidoglycan hydrolysis activity since LytB, a B. subtilis protein that SpoIID shares sequence similarity with, was reported not to have peptidoglycan hydrolysis activity itself (Kuroda et al.,

1992). It was also interesting that no similarity could be found between SpoIID and known peptidoglycan hydrolases, even using iterative homology detection programs

(Soding et al., 2005). This suggested that either SpoIID was the founding member of a newly recognized class of peptidoglycan hydrolysis enzymes that were limited to the endospore forming bacteria, or that it was so highly diverged from related proteins that no primary sequence similarity could be found.

Therefore, the finding that SpoIID is a peptidoglycan hydrolase led to several questions. First, what is the mechanism by which SpoIID hydrolyzes cell wall? Second, is the substrate specificity of SpoIID specific to septal peptidoglycan, or does SpoIID act specifically at the septum in association with SpoIIM and SpoIIP? Third, how does the hydrolysis of the septal cell wall material contribute to engulfment? Fourth, is SpoIID a highly divergent member of another hydrolase family. In order to answer these questions and to gain critical insights into the mechanism of action of this peptiodglycan hydrolase,

I attempted to solve the three-dimensional crystal structure of SpoIID in collaboration

112 with Dr. Partho Ghosh. My goal was to identify active site residues, as well as amino acids critical for cell wall binding and localization of SpoIID. In doing so, I hoped to gain critical insights into the mechanism of action of this newly discovered peptidoglycan hydrolase.

113

Results

Purification and crystallization trials of first generation construct, His6-SpoIID (27- 343)

The first step in solving the crystal structure of SpoIID was to obtain pure, native

protein. Since SpoIID has a predicted transmembrane domain, I chose to initially work

with a construct that encoded just the soluble domain of SpoIID. I constructed a N-

terminal His6-tagged version of SpoIID, which included residues 27-343, for use in an E.

coli expression vector. A two-step purification scheme (Ni2+ affinity chromatography

followed by size exclusion chromatography) resulted in pure protein (Fig. A.1), as

assessed on SDS-PAGE gels.

114

Figure A.1. Nickel affinity and size exclusion chromatograpy of His6-SpoIID (27- 343). (A) SDS-PAGE analysis of fractions eluted from Nickel MC/M chromatography run. (L) Ladder; (S) Supernatant; (P) Pellet fraction; (FT) Flow through; (W) Initial wash; (10-18, 20) Fractions eluted from column (B) SDS-PAGE analysis of fractions eluted from size exclusion run on Superdex-75 16/60 column. (L) Ladder; (27-39, odd numbers) Fractions corresponding to peak A280nm readings

115

The purified His6-SpoIID (27-343) protein was shown to have cell wall hydrolytic activity in zymography assays, as well as cell wall binding activity in cell wall binding assays (Fig. A.2). Size exclusion chromatography indicated that the protein was soluble and eluted from the column as a monomer (Fig. A.3). Additionaly, I used dynamic light scattering (DLS) analysis, which is a sensitive method to screen for aggregation prior to crystallization, to assess the quality of the stock His6-SpoIID (27-343) protein solution.

DLS showed a polydispersity of 26.8%. This value was slightly higher than the ~15-20% cutoff for predicting the likelihood of crystallization (Protein Solutions, Inc.).

Crystallization trials were set up using two commonly used crystallization screens

(Hampton and JMAC; 212 conditions) as well as additional salt-based screens.

Unfortunately, these screens resulted in no hits.

116

Figure A.2. Biochemical activity of His6-SpoIID (27-343). (A & B) Zymography assay of purified His6-SpoIID (27-343). In (A), coomassie stained gel of various amounts of purifed SpoIID (1 μg and 2 μg) with Lysozyme (Lys) and BSA as positive and negative controls, respectively. (B) Zymography gel containing M. luteus cells as cell wall substrate. Lanes corresponding to purified SpoIID exhibit zones of clearing. (C) Cell wall binding assay showing Lysozyme (Lys), lower band, and BSA, upper band, as positive and negative controls, respectively. L – Ladder; No wall - amount of proteins mixed with cell wall; Cell wall supernatant – Proteins bound to the cell wall are removed from the supernatant; Cell wall pellet – Proteins bound to the cell wall are enriched in the pellet fraction. (D) Cell wall binding assay showing SpoIID (lower band) and BSA (upper band) as positive and negative controls, respectively. L – Ladder; No wall - amount of proteins mixed with cell wall; Cell wall supernatant – Proteins bound to the cell wall are removed from the supernatant; Cell wall pellet – Proteins bound to the cell wall are enriched in the pellet fraction.

117

118

Figure A.3. Size exclusion chromatography of SpoIID (27-343) and size standards. Comparison to known size standards shows that the eluted SpoIID (27-343) protein is approximately 35.9 kDa, compared to the predicted molecular with the predicted molecular weight of 34.6 kDa. Thus, the purified SpoIID (27-343) exists in vitro as a monomer.

119

Limited Proteolysis

Since the first generation SpoIID construct resulted in no hits in crystallization trials, I used limited proteolysis to define floppy domains of SpoIID, which may have hindered crystallization. By separately digesting the His6-SpoIID (27-343) protein with

the proteases thermolysin and trypsin, I identified two smaller proteolytic fragments that

remained stable after various time points. Independent treatment with the two proteases thermolysin and trypsin yielded similar digestion products (Fig. A.4). Mass spectrometry analysis unambiguously identified the fragments as digestion intermediates that resulted from the N-terminal digestion of the His6-SpoIID (27-343). Both thermolysin digestion

products displayed wild type levels of hydrolytic and cell wall binding activity (Fig. A.5).

These results suggested the existence of a 30 residue floppy, flexible domain of SpoIID

not involved in its enzymatic activities that may have affected its crystallization. This

provided the rationale for the construction of a shorter SpoIID construct to be used for crystallization.

120

Figure A.4. Limited Proteolysis of His6-SpoIID (27-343). SpoIID (27-343) was digested with the proteases thermolysin and trypsin, and samples run on a SDS-PAGE gel following various timepoints. L – Ladder; Lanes 1-3 represent digestion with thermolysin at t = 0, 1, 2 hrs., respectively; Lanes 4-7 represent digestion with trypsin at t = 0, 1, 6, 24 hrs., respectively. Thermolysin digestion products: SpoIID(42-343) and SpoIID(55- 343). Trypsin digestion products: SpoIID(51-343) and SpoIID(57-343).

121

Figure A.5. Zymography and cell wall binding of thermolysin digestion products. Biochemical activity of thermolysin digestion products of SpoIID (27-343). The upper panel represents the coomassie stained gel showing amounts of protein loaded onto gel. The lower panel represents the zymography gel with M. luteus cells as substrate. L – Ladder; Lys – Lysozyme; BSA; 1-3 – t = 0, 1, 2 hrs. following thermolysin digestion, respectively; 4 – No cell wall control containing BSA (upper band) as a negative control and thermolysin digestion products; 5 – Supernatant fraction of cell wall + SpoIID (27- 343) digestion products. Both digestion products exhibit wild type levels of cell wall hydrolytic (1-3) and cell wall binding activity (5).

122

123

Second generation construct, His6-TEV-SpoIID (56-343)

The second generation construct for crystallization trials consisted of a N-terminal

His6- tag and a 7 residue recognition site for TEV protease, followed by residues 56-343

of SpoIID. The TEV protease recognition site was added for removal of the His6 tag following purification to eliminate the possibility of the His6 tag interfering with SpoIID

crystallization. This protein expressed and purified well, but attempts at cleaving the His6 tag with TEV protease were unsuccessful (Fig. A.6). Cleavage efficiency may have been improved by placing a spacer between the affinity tag and the TEV recognition site.

Although the His6 tag could not be removed from the purified protein, I set up

crystallization trials with this construct since it retained cell wall hydrolytic activity as

well as cell wall binding activity. Unfortunately, this construct did not show any hits in

crystallization trials.

124

Figure A.6. Cleavage of His6-TEV-SpoIID (56-343) with TEV protease. Purified His6-TEV-SpoIID (56-343) was cleaved with TEV protease, and the reaction mixture run 2+ over a Ni -affinity column to bind the digested His6-TEV tag and recover the cleaved SpoIID (56-343) in the flow through fractions. However, TEV cleavage was unsuccessful, as the majority of the uncleaved protein was eluted off the column.

125

Purification of third generation construct, SpoIID (56-343)

Subsequently, I generated a third generation construct of SpoIID, with residues

56-343. In order to bypass the problem of cleaving the His6 affinity tag with TEV

protease, I used the NEB IMPACT™ protein purification system. The IMPACT™

system allowed the fusion of an intein (protein splicing element) and chitin binding

domain (CBD) tag to the protein of interest. It takes advantage of the self-cleavage

activity of the intein to remove the CBD affinity tag, leaving just the native residues of

the desired protein of interest. The advantage of using the intein system lies in the fact

that upon purification, just the native residues of SpoIID would remain, increasing the

likelihood of crystallization. N and C-terminal tagged versions of SpoIID(56-343) were

cloned into the appropriate expression vectors.

After a small scale overexpression in E. coli, expression and solubility tests were conducted to ensure that this construct would be viable for a large scale purification and crystallization trials. These tests showed that the C-terminal tagged version of the

SpoIID(56-343) intein construct overexpressed well and was soluble. Subsequently, a large scale expression of the SpoIID(56-343) intein construct was performed. A two-step purification scheme, involving an initial affinity chromatography step (chitin beads) followed by a size exclusion chromatography step, was employed to generate protein suitable for crystallization trials. SpoIID(56-343) eluted off the size exclusion column as a single peak, the size of the protein (~ 30 kDa) corresponding to its monomeric form.

The protein appeared pure, as visualized on a SDS-PAGE gel (Fig. A.7).

126

Figure A.7. SDS-PAGE analysis of purified SpoIID(56-343). Following purification of the intein tagged SpoIID on chitin beads, the purifed protein was run over a Superdex- 75 16/60 column. L – ladder; 25-33 – fractions from size exclusion chromatograpy run. The bands seen represent ~30kDA protein that corresponds to the predicted size of SpoIID (56-343).

127

Crystallization trials of third generation construct, SpoIID (56-343)

The purified SpoIID (56-343) protein was shown to have cell wall hydrolytic activity in a zymography assay, as well as cell wall binding activity (data not shown).

Since this construct displayed purity and activity comparable to the His6-SpoIID(27-343)

construct, crystallization trials (sitting drops at room temperature) were set up using two

commonly used crystallization screens (Hampton and JMAC). The protein was

concentrated down to ~15mg/ml for use in crystal trials. In contrast, the His6-SpoIID(27-

343) protein was placed into crystal trials at a concentration of ~30mg/ml. The reason

that the SpoIID(57-343) protein was not concentrated further was due to a lower yield of

protein from the purification. However, the 15mg/ml concentration seemed reasonable

since approximately half of the drops formed a precipitate. After 3 days at room

temperature, one condition, JMAC36 (30%MPD, 200mM MgCl2, 100mM citrate, pH5.6)

gave a hit. Multiple, tiny crystals were observed (approximately 20μm x 20μm in size)

under a skin of denatured protein (Fig. A.8).

128

Figure A.8. Image of crystal drop from JMAC36 condition. Purified SpoIID (57-343) was concentrated to ~15mg/ml and setup into crystallization trials as sitting drops. Small crystals underneath a skin of protein formed after 3 days at room temperature.

129

However, the JMAC36 condition that gave a hit in the initial crystallization trials turned out to be a salt crystal rather than a protein crystal. Three observations support this finding. First, I was unable to obtain crystals with the same condition, even using the same protein prepared from the same purification. Second, putting the crystals from the initial drop that yielded crystals up on a X-ray set (UCSD Chemistry Department) resulted in a diffraction pattern that suggested the crystals were salt. Finally, optimization around the condition by varying precipitant (i.e., MPD) concentration and pH also failed to produce any crystals.

130

Discussion

In summary, I have been able to purify three different, yet active, soluble forms of

SpoIID. Although these forms of SpoIID are essentially pure as assessed by SDS-PAGE gels and are functional (able to bind and cleave cell walls), I have been unsuccessful in crystallizing these proteins. The SpoIID(56-343) construct was defined by limited proteolysis and mass spectrometry experiments, suggesting that this was the most stable fragment and possibly offered the best chance of crystallizing the protein.

It is possible that revisiting the crystallization of SpoIID in the future could be potentially fruitful. Although 212 different crystallization conditions were used to crystallize various SpoIID constructs, it was by no means an exhaustive screen. Research institutions such as the Hauptman-Woodward Medical Research Institute now have the capability to perform high-throughput crystallization experiments, using automated liquid-handling systems to quickly set-up and screen 1536 different conditions. Also, the recent finding (Chastanet and Losick, 2007) that SpoIIP acts as a peptidoglycan hydrolase, coupled with the fact that SpoIID and SpoIIP interact (Aung et al., 2007;

Chastanet and Losick, 2007) gives rise to the possibility of co-crystallizing the proteins.

Another viable alternative for solving the three-dimensional crystal structure of SpoIID is perhaps trying to crystallize SpoIID homologs from other Bacillus sp. and Clostridia sp.

Possible candidate species for SpoIID constructs include B. anthracis, the thermophile B. stearothermophilus, and C. perfringens.

131

Therefore, since attempts at crystallization failed to shed any light on the mechanism of SpoIID action, I decided to take a different approach to define critical amino acids responsible for the enzymatic activity of this mother cell expressed engulfment protein, adopting a localized site-directed approach to ferret out the functional amino acids of SpoIID and collaborating with Dr. David Popham to perform enzymatic studies on SpoIID (as previously discussed in Chapter 4).

132

Acknowledgements

I gratefully acknowledge Dr. Case McNamara and Dr. Partho Ghosh for their guidance and assistance in my attempts to crystallize SpoIID.

VII. REFERENCES

133 134

Abanes-De Mello, A., Sun, Y.L., Aung, S., and Pogliano, K. (2002). A cytoskeleton- like role for the bacterial cell wall during engulfment of the Bacillus subtilis forespore. Genes Dev 16, 3253-3264.

Alderton, G., and Snell, N. (1969). Chemical states of bacterial spores: dry-heat resistance. Appl Microbiol 17, 745-749.

Antal, T., and Krapivsky, P.L. (2005). "Burnt-bridge" mechanism of molecular motor motion. Phys Rev E Stat Nonlin Soft Matter Phys 72, 046104.

Atrih, A., Bacher, G., Allmaier, G., Williamson, M.P., and Foster, S.J. (1999). Analysis of peptidoglycan structure from vegetative cells of Bacillus subtilis 168 and role of PBP 5 in peptidoglycan maturation. J Bacteriol 181, 3956-3966.

Bar-Nahum, G., Epshtein, V., Ruckenstein, A.E., Rafikov, R., Mustaev, A., and Nudler, E. (2005). A ratchet mechanism of transcription elongation and its control. Cell 120, 183-193.

Barrett, J.F., Dolinger, D.L., Schramm, V.L., and Shockman, G.D. (1984). The mechanism of soluble peptidoglycan hydrolysis by an autolytic muramidase. A processive exodisaccharidase. J Biol Chem 259, 11818-11827.

Begg, K.J., Dewar, S.J., and Donachie, W.D. (1995). A new Escherichia coli cell division gene, ftsK. J Bacteriol 177, 6211-6222.

Bisson, I.A., Marra, P.P., Burtt, E.H., Jr., Sikaroodi, M., and Gillevet, P.M. (2007). A molecular comparison of plumage and soil bacteria across biogeographic, ecological, and taxonomic scales. Microb Ecol 54, 65-81.

Blackman, S.A., Smith, T.J., and Foster, S.J. (1998). The role of autolysins during vegetative growth of Bacillus subtilis 168. Microbiology 144 ( Pt 1), 73-82.

135

Blaylock, B., Jiang, X., Rubio, A., Moran, C.P., Jr., and Pogliano, K. (2004). Zipper- like interaction between proteins in adjacent daughter cells mediates protein localization. Genes Dev 18, 2916-2928.

Breyer, W.A., and Matthews, B.W. (2001). A structural basis for processivity. Protein Sci 10, 1699-1711.

Broder, D.H., and Pogliano, K. (2006). Forespore engulfment mediated by a ratchet- like mechanism. Cell 126, 917-928.

Bruggemann, H., Baumer, S., Fricke, W.F., Wiezer, A., Liesegang, H., Decker, I., Herzberg, C., Martinez-Arias, R., Merkl, R., Henne, A., et al. (2003). The genome sequence of Clostridium tetani, the causative agent of tetanus disease. Proc Natl Acad Sci U S A 100, 1316-1321.

Bugg, T.D., and Walsh, C.T. (1992). Intracellular steps of bacterial cell wall peptidoglycan biosynthesis: enzymology, antibiotics, and antibiotic resistance. Nat Prod Rep 9, 199-215.

Burbulys, D., Trach, K.A., and Hoch, J.A. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64, 545-552.

Cano, R.J., and Borucki, M.K. (1995). Revival and identification of bacterial spores in 25- to 40-million-year-old Dominican amber. Science 268, 1060-1064.

Carballido-Lopez, R. (2006). Orchestrating bacterial cell morphogenesis. Mol Microbiol 60, 815-819.

Chastanet, A., and Losick, R. (2007). Engulfment during sporulation in Bacillus subtilis is governed by a multi-protein complex containing tandemly acting autolysins. Mol Microbiol 64, 139-152.

Cheung, H.Y., and Freese, E. (1985). Monovalent cations enable cell wall turnover of the turnover-deficient lyt-15 mutant of Bacillus subtilis. J Bacteriol 161, 1222- 1225.

136

Chou, J.H., Chou, Y.J., Lin, K.Y., Sheu, S.Y., Sheu, D.S., Arun, A.B., Young, C.C., and Chen, W.M. (2007). Paenibacillus fonticola sp. nov., isolated from a warm spring. Int J Syst Evol Microbiol 57, 1346-1350.

Clarke, A.J. (1993). Extent of peptidoglycan O acetylation in the tribe Proteeae. J Bacteriol 175, 4550-4553.

Cortezzo, D.E., and Setlow, P. (2005). Analysis of factors that influence the sensitivity of spores of Bacillus subtilis to DNA damaging chemicals. J Appl Microbiol 98, 606-617.

Cutting, S., Oke, V., Driks, A., Losick, R., Lu, S., and Kroos, L. (1990). A forespore checkpoint for mother cell gene expression during development in B. subtilis. Cell 62, 239-250.

Doan, T., Marquis, K.A., and Rudner, D.Z. (2005). Subcellular localization of a sporulation membrane protein is achieved through a network of interactions along and across the septum. Mol Microbiol 55, 1767-1781.

Dubnau, D. (1991). Genetic competence in Bacillus subtilis. Microbiol Rev 55, 395- 424.

Dubnau, D., and Davidoff-Abelson, R. (1971). Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor- recipient complex. J Mol Biol 56, 209-221.

Dworkin, J., and Losick, R. (2005). Developmental commitment in a bacterium. Cell 121, 401-409.

Eichenberger, P., Fawcett, P., and Losick, R. (2001). A three-protein inhibitor of polar septation during sporulation in Bacillus subtilis. Mol Microbiol 42, 1147-1162.

Eichenberger, P., Jensen, S.T., Conlon, E.M., van Ooij, C., Silvaggi, J., Gonzalez- Pastor, J.E., Fujita, M., Ben-Yehuda, S., Stragier, P., Liu, J.S., et al. (2003). The sigmaE regulon and the identification of additional sporulation genes in Bacillus subtilis. J Mol Biol 327, 945-972.

137

Errington, J. (2001). Septation and chromosome segregation during sporulation in Bacillus subtilis. Curr Opin Microbiol 4, 660-666.

Errington, J. (2003a). Dynamic proteins and a cytoskeleton in bacteria. Nat Cell Biol 5, 175-178.

Errington, J. (2003b). Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol 1, 117-126.

Fenchel, T. (2002). Microbial behavior in a heterogeneous world. Science 296, 1068- 1071.

Fischer, W., Rosel, P., and Koch, H.U. (1981). Effect of alanine ester substitution and other structural features of lipoteichoic acids on their inhibitory activity against autolysins of Staphylococcus aureus. J Bacteriol 146, 467-475.

Foster, S.J. (1992). Analysis of the autolysins of Bacillus subtilis 168 during vegetative growth and differentiation by using renaturing polyacrylamide gel electrophoresis. J Bacteriol 174, 464-470.

Foster, S.J. (1994). The role and regulation of cell wall structural dynamics during differentiation of endospore-forming bacteria. Soc Appl Bacteriol Symp Ser 23, 25S- 39S.

Foster, S.J., and Popham, D.L. (2002). Structure and synthesis of cell wall, spore cortex, teichoic acid, S-layers and capsules. In Bacillus subtilis and its relatives: From genes to cells, A.L. Sonenshein, J.A. Hoch, and R. Losick, eds. (Washington, D.C., American Society for Microbiology), pp. 15-20.

Frandsen, N., and Stragier, P. (1995). Identification and characterization of the Bacillus subtilis spoIIP locus. J Bacteriol 177, 716-722.

Fujita, M., and Losick, R. (2003). The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division. Genes Dev 17, 1166-1174.

138

Gitai, Z., Dye, N.A., Reisenauer, A., Wachi, M., and Shapiro, L. (2005). MreB actin- mediated segregation of a specific region of a bacterial chromosome. Cell 120, 329- 341.

Grossman, A.D. (1995). Genetic networks controlling the initiation of sporulation and the development of genetic competence in Bacillus subtilis. Annu Rev Genet 29, 477-508.

Gupta, R., Beg, Q.K., and Lorenz, P. (2002). Bacterial alkaline proteases: molecular approaches and industrial applications. Appl Microbiol Biotechnol 59, 15-32.

Hamoen, L.W., Venema, G., and Kuipers, O.P. (2003). Controlling competence in Bacillus subtilis: shared use of regulators. Microbiology 149, 9-17.

Herbold, D.R., and Glaser, L. (1975). Bacillus subtilis N-acetylmuramic acid L- alanine amidase. J Biol Chem 250, 1676-1682.

Hoch, J.A. (1993). Regulation of the phosphorelay and the initiation of sporulation in Bacillus subtilis. Annu Rev Microbiol 47, 441-465.

Holtje, J.V. (1996). Lytic transglycosylases. EXS 75, 425-429.

Holtje, J.V. (1998). Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli. Microbiol Mol Biol Rev 62, 181-203.

Horikoshi, K. (1999). Alkaliphiles: some applications of their products for biotechnology. Microbiol Mol Biol Rev 63, 735-750, table of contents.

Huitema, E., Pritchard, S., Matteson, D., Radhakrishnan, S.K., and Viollier, P.H. (2006). Bacterial birth scar proteins mark future flagellum assembly site. Cell 124, 1025-1037.

Ishikawa, S., Hara, Y., Ohnishi, R., and Sekiguchi, J. (1998). Regulation of a new cell wall hydrolase gene, cwlF, which affects cell separation in Bacillus subtilis. J Bacteriol 180, 2549-2555.

139

Jensen, G.B., Hansen, B.M., Eilenberg, J., and Mahillon, J. (2003). The hidden lifestyles of Bacillus cereus and relatives. Environ Microbiol 5, 631-640.

Jiang, M., Shao, W., Perego, M., and Hoch, J.A. (2000). Multiple histidine kinases regulate entry into stationary phase and sporulation in Bacillus subtilis. Mol Microbiol 38, 535-542.

Jiang, X., Rubio, A., Chiba, S., and Pogliano, K. (2005). Engulfment-regulated proteolysis of SpoIIQ: evidence that dual checkpoints control sigma activity. Mol Microbiol 58, 102-115.

Johnson, E.A., and Bradshaw, M. (2001). Clostridium botulinum and its neurotoxins: a metabolic and cellular perspective. Toxicon 39, 1703-1722.

Jones, L.J., Carballido-Lopez, R., and Errington, J. (2001). Control of cell shape in bacteria: helical, actin-like filaments in Bacillus subtilis. Cell 104, 913-922.

Keep, N.H., Ward, J.M., Cohen-Gonsaud, M., and Henderson, B. (2006). Wake up! Peptidoglycan lysis and bacterial non-growth states. Trends Microbiol 14, 271-276.

Kennedy, M.J., Reader, S.L., and Swierczynski, L.M. (1994). Preservation records of micro-organisms: evidence of the tenacity of life. Microbiology 140 ( Pt 10), 2513- 2529.

Kim, S., Jeong, H., and Chun, J. (2007). Clostridium aestuarii sp. nov., from tidal flat sediment. Int J Syst Evol Microbiol 57, 1315-1317.

Koch, A.L. (2006). The exocytoskeleton. J Mol Microbiol Biotechnol 11, 115-125.

Koch, A.L., Kirchner, G., Doyle, R.J., and Burdett, I.D. (1985). How does a Bacillus split its septum right down the middle? Ann Inst Pasteur Microbiol 136A, 91-98.

Komeili, A., Li, Z., Newman, D.K., and Jensen, G.J. (2006). Magnetosomes are cell membrane invaginations organized by the actin-like protein MamK. Science 311, 242-245.

140

Kuroda, A., Rashid, M.H., and Sekiguchi, J. (1992). Molecular cloning and sequencing of the upstream region of the major Bacillus subtilis autolysin gene: a modifier protein exhibiting sequence homology to the major autolysin and the spoIID product. J Gen Microbiol 138, 1067-1076.

Lam, H., Schofield, W.B., and Jacobs-Wagner, C. (2006). A landmark protein essential for establishing and perpetuating the polarity of a bacterial cell. Cell 124, 1011-1023.

Lazarevic, V., Margot, P., Soldo, B., and Karamata, D. (1992). Sequencing and analysis of the Bacillus subtilis lytRABC divergon: a regulatory unit encompassing the structural genes of the N-acetylmuramoyl-L-alanine amidase and its modifier. J Gen Microbiol 138, 1949-1961.

Lazazzera, B.A. (2000). Quorum sensing and starvation: signals for entry into stationary phase. Curr Opin Microbiol 3, 177-182.

Levin, P.A., and Losick, R. (1996). Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis. Genes Dev 10, 478-488.

Levin, P.A., Shim, J.J., and Grossman, A.D. (1998). Effect of minCD on FtsZ ring position and polar septation in Bacillus subtilis. J Bacteriol 180, 6048-6051.

Liu, J., and Zuber, P. (1998). A molecular switch controlling competence and motility: competence regulatory factors ComS, MecA, and ComK control sigmaD- dependent gene expression in Bacillus subtilis. J Bacteriol 180, 4243-4251.

Liu, N.J., Dutton, R.J., and Pogliano, K. (2006). Evidence that the SpoIIIE DNA translocase participates in membrane fusion during cytokinesis and engulfment. Mol Microbiol 59, 1097-1113.

Londono-Vallejo, J.A., Frehel, C., and Stragier, P. (1997). SpoIIQ, a forespore- expressed gene required for engulfment in Bacillus subtilis. Mol Microbiol 24, 29-39.

Lopez-Diaz, I., Clarke, S., and Mandelstam, J. (1986). spoIID operon of Bacillus subtilis: cloning and sequence. J Gen Microbiol 132, 341-354.

141

Lybarger, S.R., and Maddock, J.R. (2001). Polarity in action: asymmetric protein localization in bacteria. J Bacteriol 183, 3261-3267.

Mai, J., Sokolov, I.M., and Blumen, A. (2001). Directed particle diffusion under "burnt bridges" conditions. Phys Rev E Stat Nonlin Soft Matter Phys 64, 011102.

Margolis, P.S., Driks, A., and Losick, R. (1993). Sporulation gene spoIIB from Bacillus subtilis. J Bacteriol 175, 528-540.

Margot, P., and Karamata, D. (1992). Identification of the structural genes for N- acetylmuramoyl-L-alanine amidase and its modifier in Bacillus subtilis 168: inactivation of these genes by insertional mutagenesis has no effect on growth or cell separation. Mol Gen Genet 232, 359-366.

Margot, P., Mauel, C., and Karamata, D. (1994). The gene of the N- acetylglucosaminidase, a Bacillus subtilis 168 cell wall hydrolase not involved in vegetative cell autolysis. Mol Microbiol 12, 535-545.

Margot, P., Pagni, M., and Karamata, D. (1999). Bacillus subtilis 168 gene lytF encodes a gamma-D-glutamate-meso-diaminopimelate muropeptidase expressed by the alternative vegetative sigma factor, sigmaD. Microbiology 145 ( Pt 1), 57-65.

Margot, P., Wahlen, M., Gholamhoseinian, A., Piggot, P., and Karamata, D. (1998). The lytE gene of Bacillus subtilis 168 encodes a cell wall hydrolase. J Bacteriol 180, 749-752.

Martinez, C., and Caballero, P. (2002). Contents of cry genes and insecticidal toxicity of Bacillus thuringiensis strains from terrestrial and aquatic habitats. J Appl Microbiol 92, 745-752.

Melly, E., Cowan, A.E., and Setlow, P. (2002). Studies on the mechanism of killing of Bacillus subtilis spores by hydrogen peroxide. J Appl Microbiol 93, 316-325.

Melly, E., and Setlow, P. (2001). Heat shock proteins do not influence wet heat resistance of Bacillus subtilis spores. J Bacteriol 183, 779-784.

Msadek, T. (1999). When the going gets tough: survival strategies and environmental signaling networks in Bacillus subtilis. Trends Microbiol 7, 201-207.

142

Nicholson, W.L. (2002). Roles of Bacillus endospores in the environment. Cell Mol Life Sci 59, 410-416.

Nicholson, W.L., and Galeano, B. (2003). UV resistance of Bacillus anthracis spores revisited: validation of Bacillus subtilis spores as UV surrogates for spores of B. anthracis Sterne. Appl Environ Microbiol 69, 1327-1330.

Nicholson, W.L., Munakata, N., Horneck, G., Melosh, H.J., and Setlow, P. (2000). Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev 64, 548-572.

Nong, G., Chow, V., Schmidt, L.M., Dickson, D.W., and Preston, J.F. (2007). Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root- knot nematodes. FEMS Microbiol Ecol 61, 327-336.

Ohnishi, R., Ishikawa, S., and Sekiguchi, J. (1999). Peptidoglycan hydrolase LytF plays a role in cell separation with CwlF during vegetative growth of Bacillus subtilis. J Bacteriol 181, 3178-3184.

Okamoto, K., Brinker, A., Paschen, S.A., Moarefi, I., Hayer-Hartl, M., Neupert, W., and Brunner, M. (2002). The protein import motor of mitochondria: a targeted molecular ratchet driving unfolding and translocation. EMBO J 21, 3659-3671.

Perez, A.R., Abanes-De Mello, A., and Pogliano, K. (2000). SpoIIB localizes to active sites of septal biogenesis and spatially regulates septal thinning during engulfment in bacillus subtilis. J Bacteriol 182, 1096-1108.

Phillips, Z.E., and Strauch, M.A. (2002). Bacillus subtilis sporulation and stationary phase gene expression. Cell Mol Life Sci 59, 392-402.

Piggot, P., Bylund, J.E., and Higgins, M.L. (1994). Morphogenesis and gene expression during sporulation. In Regulation of bacterial differentiation, P. Piggot, C.P. Moran, Jr., and P. Youngman, eds. (Washington, D.C., American Society for Microbiology), pp. 113-137.

Piggot, P.J., and Hilbert, D.W. (2004). Sporulation of Bacillus subtilis. Curr Opin Microbiol 7, 579-586.

143

Pogliano, J., Osborne, N., Sharp, M.D., Abanes-De Mello, A., Perez, A., Sun, Y.L., and Pogliano, K. (1999). A vital stain for studying membrane dynamics in bacteria: a novel mechanism controlling septation during Bacillus subtilis sporulation. Mol Microbiol 31, 1149-1159.

Pogliano, J., Sharp, M.D., and Pogliano, K. (2002). Partitioning of chromosomal DNA during establishment of cellular asymmetry in Bacillus subtilis. J Bacteriol 184, 1743-1749.

Polgar, L. (2005). The catalytic triad of serine peptidases. Cell Mol Life Sci 62, 2161- 2172.

Popham, D.L., Helin, J., Costello, C.E., and Setlow, P. (1996). Analysis of the peptidoglycan structure of Bacillus subtilis endospores. J Bacteriol 178, 6451-6458.

Pottathil, M., and Lazazzera, B.A. (2003). The extracellular Phr peptide-Rap phosphatase signaling circuit of Bacillus subtilis. Front Biosci 8, d32-45.

Qaim, M., and Zilberman, D. (2003). Yield effects of genetically modified crops in developing countries. Science 299, 900-902.

Rashid, M.H., Mori, M., and Sekiguchi, J. (1995). Glucosaminidase of Bacillus subtilis: cloning, regulation, primary structure and biochemical characterization. Microbiology 141 ( Pt 10), 2391-2404.

Rashid, M.H., and Sekiguchi, J. (1996). flaD (sinR) mutations affect SigD-dependent functions at multiple points in Bacillus subtilis. J Bacteriol 178, 6640-6643.

Recsei, P.A., Gruss, A.D., and Novick, R.P. (1987). Cloning, sequence, and expression of the lysostaphin gene from Staphylococcus simulans. Proc Natl Acad Sci U S A 84, 1127-1131.

Resnekov, O., Alper, S., and Losick, R. (1996). Subcellular localization of proteins governing the proteolytic activation of a developmental transcription factor in Bacillus subtilis. Genes Cells 1, 529-542.

144

Robles, S., Rodriguez, J.M., Granados, I., and Guerrero, M.C. (2000). Sulfite- reducing clostridia in the sediment of a high mountain lake (Laguna Grande, Gredos, Spain) as indicators of fecal pollution. Int Microbiol 3, 187-191.

Rubio, A., and Pogliano, K. (2004). Septal localization of forespore membrane proteins during engulfment in Bacillus subtilis. EMBO J 23, 1636-1646.

Rudner, D.Z., Fawcett, P., and Losick, R. (1999). A family of membrane-embedded metalloproteases involved in regulated proteolysis of membrane-associated transcription factors. Proc Natl Acad Sci U S A 96, 14765-14770.

Rudner, D.Z., and Losick, R. (2002). A sporulation membrane protein tethers the pro-sigmaK processing enzyme to its inhibitor and dictates its subcellular localization. Genes Dev 16, 1007-1018.

Ryter, A. (1965a). [Electron Microscope Study of the Bacterial Nucleus and Its Bond with the Cytoplasmic Membrane.]. Pathol Biol (Paris) 13, 252-263.

Ryter, A. (1965b). [Morphologic Study of the Sporulation of Bacillus Subtilis.]. Ann Inst Pasteur (Paris) 108, 40-60.

Saeki, K., Ozaki, K., Kobayashi, T., and Ito, S. (2007). Detergent alkaline proteases: enzymatic properties, genes, and crystal structures. J Biosci Bioeng 103, 501-508.

Saffarian, S., Collier, I.E., Marmer, B.L., Elson, E.L., and Goldberg, G. (2004). Interstitial collagenase is a Brownian ratchet driven by proteolysis of collagen. Science 306, 108-111.

Sawano, A., and Miyawaki, A. (2000). Directed evolution of green fluorescent protein by a new versatile PCR strategy for site-directed and semi-random mutagenesis. Nucleic Acids Res 28, E78.

Schaeffer, P., Millet, J., and Aubert, J.P. (1965). Catabolic repression of bacterial sporulation. Proc Natl Acad Sci U S A 54, 704-711.

Scheffel, A., Gruska, M., Faivre, D., Linaroudis, A., Plitzko, J.M., and Schuler, D. (2006). An acidic protein aligns magnetosomes along a filamentous structure in magnetotactic bacteria. Nature 440, 110-114.

145

Scheffers, D.J., and Pinho, M.G. (2005). Bacterial cell wall synthesis: new insights from localization studies. Microbiol Mol Biol Rev 69, 585-607.

Schindler, C.A., and Schuhardt, V.T. (1964). Lysostaphin: A New Bacteriolytic Agent for the Staphylococcus. Proc Natl Acad Sci U S A 51, 414-421.

Setlow, P. (1995). Mechanisms for the prevention of damage to DNA in spores of Bacillus species. Annu Rev Microbiol 49, 29-54.

Shapiro, L., McAdams, H.H., and Losick, R. (2002). Generating and exploiting polarity in bacteria. Science 298, 1942-1946.

Sharp, M.D., and Pogliano, K. (1999). An in vivo membrane fusion assay implicates SpoIIIE in the final stages of engulfment during Bacillus subtilis sporulation. Proc Natl Acad Sci U S A 96, 14553-14558.

Shockman, G.D., and Holtje, J.V. (1994). Microbial peptidoglycan (murein) hydrolases. In Bacterial Cell Wall, J.M. Ghuysen, and R. Hakenbeck, eds. (Amsterdam, Elsevier), pp. 131-166.

Smith, K., Bayer, M.E., and Youngman, P. (1993). Physical and functional characterization of the Bacillus subtilis spoIIM gene. J Bacteriol 175, 3607-3617.

Smith, T.J., Blackman, S.A., and Foster, S.J. (2000). Autolysins of Bacillus subtilis: multiple enzymes with multiple functions. Microbiology 146 ( Pt 2), 249-262.

Soding, J., Biegert, A., and Lupas, A.N. (2005). The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res 33, W244- 248.

Spencer, R.C. (2003). Bacillus anthracis. J Clin Pathol 56, 182-187.

Sterlini, J.M., and Mandelstam, J. (1969). Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance. Biochem J 113, 29-37.

146

Stewart, G.C. (2005). Taking shape: control of bacterial cell wall biosynthesis. Mol Microbiol 57, 1177-1181.

Stragier, P. (2002). A gene odyssey: Exploring the genomes of endospore-forming bacteria. In Bacillus subtilis and its relatives: From genes to cells, A.L. Sonenshein, J.A. Hoch, and R. Losick, eds. (Washington, D.C., American Society for Microbiology), pp. 519-526.

Stragier, P., and Losick, R. (1996). Molecular genetics of sporulation in Bacillus subtilis. Annu Rev Genet 30, 297-241.

Sun, Y.L., Sharp, M.D., and Pogliano, K. (2000). A dispensable role for forespore- specific gene expression in engulfment of the forespore during sporulation of Bacillus subtilis. J Bacteriol 182, 2919-2927.

Thompson, L.S., Beech, P.L., Real, G., Henriques, A.O., and Harry, E.J. (2006). Requirement for the cell division protein DivIB in polar cell division and engulfment during sporulation in Bacillus subtilis. J Bacteriol 188, 7677-7685.

Titball, R.W., Hunter, S.E., Martin, K.L., Morris, B.C., Shuttleworth, A.D., Rubidge, T., Anderson, D.W., and Kelly, D.C. (1989). Molecular cloning and nucleotide sequence of the alpha-toxin (phospholipase C) of Clostridium perfringens. Infect Immun 57, 367-376.

Tokunaga, T., Rashid, M.H., Kuroda, A., and Sekiguchi, J. (1994). Effect of degS- degU mutations on the expression of sigD, encoding an alternative sigma factor, and autolysin operon of Bacillus subtilis. J Bacteriol 176, 5177-5180.

Uribe, D., Martinez, W., and Ceron, J. (2003). Distribution and diversity of cry genes in native strains of Bacillus thuringiensis obtained from different ecosystems from Colombia. J Invertebr Pathol 82, 119-127.

Veening, J.W., Smits, W.K., Hamoen, L.W., and Kuipers, O.P. (2006). Single cell analysis of gene expression patterns of competence development and initiation of sporulation in Bacillus subtilis grown on chemically defined media. J Appl Microbiol 101, 531-541.

147

Vreeland, R.H., Rosenzweig, W.D., and Powers, D.W. (2000). Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal. Nature 407, 897-900.

Westers, L., Westers, H., and Quax, W.J. (2004). Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism. Biochim Biophys Acta 1694, 299-310.

Young, S.B., and Setlow, P. (2004). Mechanisms of Bacillus subtilis spore resistance to and killing by aqueous ozone. J Appl Microbiol 96, 1133-1142.

Youngman, P., Perkins, J.B., and Losick, R. (1984). A novel method for the rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertions. Mol Gen Genet 195, 424-433.

Zhang, B., Hofmeister, A., and Kroos, L. (1998). The prosequence of pro-sigmaK promotes membrane association and inhibits RNA polymerase core binding. J Bacteriol 180, 2434-2441.