DOCSLIB.ORG

S1: Patient Samples and Associated Genomic Information Tumor Samples Were Ascertained from Three Independent Cohorts

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
S1: Patient Samples and Associated Genomic Information Tumor Samples Were Ascertained from Three Independent Cohorts S1: Patient samples and associated genomic information Tumor samples were ascertained from three independent cohorts. 1) The TCGA cohort of HGSC was collated by investigators from international hospital and universities, mostly from North America (1). Germline, somatic mutation and methylation status of HRR pathway members was available to us for 316 tumors and patients. From these we selected cases that had either somatic or germline pathogenic BRCA1/2 mutation or no apparent disruption of the BRCA pathway (wild-type) for gene expression and copy number analysis, including: • 280 cases with gene expression profiles, including 210 cases for which the molecular subtypes were identified in a previous publication (2) (27 BRCA1 mutated, 28 BRCA2 mutated, 10 BRCA1 methylated and 145 wild type). • 204 cases with copy number data (34 BRCA1 mutated, 30 BRCA2 mutated, 140 wild-type). • Gene expression profiles of additional 196 samples for clinical validation of the BRCA1/2 classifier. Mutation status of these samples was not available at the time of this study. 2) The Australian Ovarian Cancer Study (AOCS) is a population based case-control cohort of ovarian cancer patients ascertained at diagnosis between 2002 and 2006 (3). Research associated with the use of AOCS samples and clinical data was approved by the Human Research Ethics Committees at the Peter MacCallum Cancer Centre. A cohort of high grade serous samples was selected from tumors where germline BRCA1 and BRCA2 mutations (4) and Affymetrix U133 2.0 data were available (3). As described below, all 132 tumors were screened for somatic BRCA1/2 mutations using a high-resolution melt analysis (5), and for methylation of the BRCA1, PALB2 and FANCF gene promoters using methylation-sensitive high-resolution melting technology (6, 7) after bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). One hundred and eleven of the 132 tumors profiled could be classified into one of the four molecular subtypes of HGSC previously described (3) and were used in the subsequent gene expression analysis. 3) Gene expression data for a cohort of 61 ovarian cancer tumors with mixed histologies, ascertained from the Memorial Sloan-Kettering Cancer Centre, and generated using in-house cDNA microarray chips manufactured at the National Cancer Institute Microarry Facility, was publically available as supplementary data provided by the journal 1 (8). 1 http://jnci.oxfordjournals.org/content/94/13/990/suppl/DC1 Study ID Gene Exon Nomenclature Location 2476 BRCA1 11 c.3302G>A Germline 3958 BRCA1 2 c.80+3A>C Germline 2410 BRCA2 11 c.[4094G>A] Germline 4256 BRCA2 3 c.[68-7T>A] Germline 1096 BRCA2 22 c.[8830A>T] Germline 1033 BRCA2 15 c.7504C>T Germline 6496 BRCA2 18 c.[7985C>A] Germline 66211 BRCA1 15 c.4669G>C Germline 20392 BRCA1 7 c.[305C>G] Germline 32023 BRCA1/BRCA2 17/11 c.[4987-20A>G/c.[5446A>C] Germline Supplementary Table 1 : Germline unclassified sequence variants identified in 132 AOCS tumors. Pathogenicity of sequence variants was assessed by reference to the Breast Information Core database (BIC), protein function prediction algorithims (SIFT, PolyPhen 2.0, AGVGD), splice site prediction algorithms (NNSPLICE, MaxEntScan, Splice Site Finder-Like, Human Splicing Finder) and literature searches as necessary. This process was standardised by use of the Alamut program (Interactive Biosoftware) as described in (4). 1 also found to be methylated at the BRCA1 gene promoter. 2 co-existing BRCA1 pathogenic mutation 3 co-existing BRCA2 pathogenic mutation, and BRCA1 gene promoter methylation S2: Somatic BRCA1/2 mutation detection using High-Resolution Melting (HRM) Analysis DNA extracted from fresh-frozen primary tumor tissue was screened for mutations in all coding exons, and intron-exon boundaries, of BRCA1 and BRCA2 using high resolution melting (HRM) analysis, as previously described (5) with the LightCycler®480 thermocycler (Roche). The success of the melting curve analysis relies on a heteroduplex being formed by the wild-type and mutant DNA sequences during the PCR step. To account for potential loss of heterozygosity at either BRCA1 or BRCA2 locus, which would result in a duplex being formed between two similar DNA strands (i.e. two mutant strands in the absence of a wild-type strand), needle macrodissected or high tumor content samples (≥80%tumor) were mixed with a 4ng/ul wild-type control DNA in a 1:1 ratio before being added to the assay. Data output was analysed with the LightCycler®480 Software (Version 1.5.0.39; Roche) and using the Gene Scanning workflow. The melting curves for each amplicon were normalised, and the temperature-shift differences plotted. Samples in which a melt profile differed from that of the wild- type control were selected for Sanger DNA sequence analysis. The HRM product of selected amplicons was PCR amplified, and sequenced using the BigDye Terminator v3.1 (Applied Biosystems) assay. After purification and re-suspension in HiDi Formamide solution (Applied Biosystems) the samples underwent capillary electrophoresis on an ABI3730 sequencer (Applied Biosystems). Mutant sequences were imported into the SequencherTM 4.10.1 software (Gene Codes) for comparison to a wild-type sequence. Mutations were confirmed in a second independent analysis by sequencing of both the forward and reverse strands. S3: Methylation-sensitive HRM analysis Tumor DNA that was used for HRM analysis also underwent a methylation-sensitive high-resolution melting analysis as described previously (6, 7). Briefly, 200ng of DNA was bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) as per the manufacturer’s instructions. Bisulfite converted DNA was added to a mastermix utilising HotStarTaq DNA polymerase containing forward and reverse primers for each assay (Supplementary Table 2) and 5 μmol/L SYTO 9 (Life Technologies, Carlsbad, CA). Assays were performed on the Rotor-Gene 6000 (Corbett, Sydney, Australia), with slight variations in cycling conditions depending on the target (Supplementary Table 3). Temperature was increased by 0.2°C per second during the HRM step. Samples were assayed in duplicate. Appropriate DNA methylation standard controls were included in each assay (in duplicate) for a comparison of extent of methylation during the analysis; 100%, 50%, 25%,10%, 5%, 1% or 0% of fully methylated DNA in unmethylated DNA, as well as a no template control. HRM analysis was performed with the software provided for the Rotor-Gene 6000 (Corbett). For each sample the negative first derivative of the fluorescence over temperature were plotted; the resulting peaks representing the ratio of both methylated and unmethylated DNA in the amplified product. Melting curves were then compared to those of the DNA methylation standard controls, and the extent of methylation estimated based on the shared features between the samples and the controls (6, 7). Gene Forward Primer Reverse Primer Product Size BRCA1 TTGTTGTTTAGCGGTAGTTTTTTGGTT* CAATCGCAATTTTAATTTATCTATAATTCCC* 81bp PALB2 TTTTCGGTTTAGGGTTAATTGGGTT CACCTTTTCCTTCTCCTCACAACTAAA 135bp FANCF ATTGATATGTATTTCGATTAATAGTATTGT ATCCAAATACTACAAAAAAAATTCCATAAA# 149bp Supplementary Table 2: Primers for the methylation-sensitive HRM analysis. * These primers were published in Wong et al. (2011) (9). # This primer was published in Taniguchi et. al (2003) (10). BRCA1 Assay PALB2 Assay FANCF Assay Temperature Time Cycles Temperature Time Cycles Temperature Time Cycles 95°C 15 minutes 1 95°C 15 minutes 1 95°C 15 minutes 1 95°C 10 seconds 50 95°C 20 seconds 50 95°C 20 seconds 50 61°C 10 seconds 62°C 20 seconds 56°C 25 seconds 72°C 20 seconds 72°C 30 seconds 72°C 20 seconds 95°C 1 minute 1 95°C1 minute197°C1 minute1 65-95°C 1 70-95°C 1 65-95°C 1 Supplementary Table 3: Cycling conditions for the methylation-sensitive HRM analysis Twenty-three cases showed evidence of methylation in the analysis, although in two cases this was deemed to be not biologically significant due to the fact that both cases carried a germline BRCA2 pathogenic mutation (Supplementary Table 4). Study ID Estimated % of methylated alleles in Estimated % of tumor material in DNA Other BRCA DNA event 958 <5% MD BRCA2 GL PATH 3202 ~ 50% 50% BRCA2 GL PATH 7492 ~ 50% 60% - 3102 ~15-20% 60% - 3133 ~10% 50% - 5154 ~20% 80% - 1024 ~ 50% 90% - 7329 ~ 50% 40% - 451 ~90% 80% - 1806 ~50% 60-70% - 1978 ~60% MD - 3612 ~100% 90% - 3793 ~50% 80% - 4465 ~50% 70% - 9152 ~50% 85-90% - 6483 ~80% 50-60% - 5349 ~25-30% 90-100% - 4051 ~30% 70% - 2738 ~30% MD - 6621 ~30% 50% BRCA1 UV 3961 ~20% MD - 3843 ~40% 60-80% - 6977 ~30% 70% - Supplementary Table 4: BRCA1 gene promoter methylation detected in the 132 AOCS cases by methylation-sensitive HRM analysis. GL = germline; UV = unclassified variant; MD = macro-dissected GL BRCA1/2 Somatic BRCA1/2 BRCA1 methylation Wild-Type positive positive positive Total Cases 21 8 21 82 Age at Diagnosis (years) Mean 55.01 62.48 55.57 62.79 Standard Deviation 8.71 7.17 9.31 9.76 Primary Site Ovary 81.0% 62.5% 85.7% 74.4% Fallopian Tube 4.8% - 4.8% 4.9% Peritoneum 14.3% 37.5% 9.5% 20.7% Histology Serous 100% 100% 100% 100% FIGO Stage I 4.8% - 14.3% 2.4% II - - 14.3% 2.4% III 81.0% 100% 57.1% 82.9% IV 9.5% - 14.3% 6.1% Not Known 4.8% - - 6.1% Tumour Grade 1 - - - 3.7% 2 4.8% - 23.8% 19.5% 3 81.0% 100% 76.2% 69.5% Not Known 14.3% - - 7.3% Residual Disease Nil macroscopic 28.6% - 33.3% 22.0% ≤ 1cm 52.4% 62.5% 38.1% 32.9% > 1cm 19.0% 37.5% 28.6% 39.0% Not Known/Size Not Known - - - 6.1% Time from diagnosis to disease progression (months) Median 18.10 14.60 23.40 12.30 Range 8.51 – 41.98 10.85 – 20.71 5.00 – 37.31 0.76 – 55.59 Time from diagnosis to death (months) Median 47.1 59.60 62.10 37.10 Range 19.20 – 84.00 20.25 – 71.34 14.56 – 66.94 0.76 – 83.47 Supplementary Table 5: Clinico-pathological features of the AOCS cohort used in this analysis S4: Bioinformatic analyses S4.1 BRCA mutation status and molecular subtypes A sample was considered to have abnormal BRCA status if the sample had a pathogenic germline or somatic mutation in either BRCA gene, or the BRCA1 promoter was methylated.
Load more

Recommended publications
  • The HECT Domain Ubiquitin Ligase HUWE1 Targets Unassembled Soluble Proteins for Degradation
    OPEN Citation: Cell Discovery (2016) 2, 16040; doi:10.1038/celldisc.2016.40 ARTICLE www.nature.com/celldisc The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation Yue Xu1, D Eric Anderson2, Yihong Ye1 1Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA; 2Advanced Mass Spectrometry Core Facility, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA In eukaryotes, many proteins function in multi-subunit complexes that require proper assembly. To maintain complex stoichiometry, cells use the endoplasmic reticulum-associated degradation system to degrade unassembled membrane subunits, but how unassembled soluble proteins are eliminated is undefined. Here we show that degradation of unassembled soluble proteins (referred to as unassembled soluble protein degradation, USPD) requires the ubiquitin selective chaperone p97, its co-factor nuclear protein localization protein 4 (Npl4), and the proteasome. At the ubiquitin ligase level, the previously identified protein quality control ligase UBR1 (ubiquitin protein ligase E3 component n-recognin 1) and the related enzymes only process a subset of unassembled soluble proteins. We identify the homologous to the E6-AP carboxyl terminus (homologous to the E6-AP carboxyl terminus) domain-containing protein HUWE1 as a ubiquitin ligase for substrates bearing unshielded, hydrophobic segments. We used a stable isotope labeling with amino acids-based proteomic approach to identify endogenous HUWE1 substrates. Interestingly, many HUWE1 substrates form multi-protein com- plexes that function in the nucleus although HUWE1 itself is cytoplasmically localized. Inhibition of nuclear entry enhances HUWE1-mediated ubiquitination and degradation, suggesting that USPD occurs primarily in the cytoplasm.
    [Show full text]
  • Mouse Gm44504 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Gm44504 Knockout Project (CRISPR/Cas9) Objective: To create a Gm44504 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Gm44504 gene (NCBI Reference Sequence: NM_001278271 ; Ensembl: ENSMUSG00000015290 ) is located on Mouse chromosome X. 7 exons are identified, with the ATG start codon in exon 4 and the TAG stop codon in exon 7 (Transcript: ENSMUST00000178691). Exon 6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 6 starts from about 32.91% of the coding region. Exon 6 covers 44.37% of the coding region. The size of effective KO region: ~209 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 6 7 Legends Exon of mouse Gm44504 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 209 bp section of Exon 6 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 209 bp section of Exon 6 is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Bag6 Complex Contains a Minimal Tail-Anchor–Targeting Module and a Mock BAG Domain
    Bag6 complex contains a minimal tail-anchor–targeting module and a mock BAG domain Jee-Young Mocka, Justin William Chartrona,Ma’ayan Zaslavera,YueXub,YihongYeb, and William Melvon Clemons Jr.a,1 aDivision of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125; and bLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892 Edited by Gregory A. Petsko, Weill Cornell Medical College, New York, NY, and approved December 1, 2014 (received for review February 12, 2014) BCL2-associated athanogene cochaperone 6 (Bag6) plays a central analogous yeast complex contains two proteins, Get4 and Get5/ role in cellular homeostasis in a diverse array of processes and is Mdy2, which are homologs of the mammalian proteins TRC35 part of the heterotrimeric Bag6 complex, which also includes and Ubl4A, respectively. In yeast, these two proteins form ubiquitin-like 4A (Ubl4A) and transmembrane domain recognition a heterotetramer that regulates the handoff of the TA protein complex 35 (TRC35). This complex recently has been shown to be from the cochaperone small, glutamine-rich, tetratricopeptide important in the TRC pathway, the mislocalized protein degrada- repeat protein 2 (Sgt2) [small glutamine-rich tetratricopeptide tion pathway, and the endoplasmic reticulum-associated degrada- repeat-containing protein (SGTA) in mammals] to the delivery tion pathway. Here we define the architecture of the Bag6 factor Get3 (TRC40 in mammals) (19–22). It is expected that the complex, demonstrating that both TRC35 and Ubl4A have distinct mammalian homologs, along with Bag6, play a similar role (23– C-terminal binding sites on Bag6 defining a minimal Bag6 complex.
    [Show full text]
  • Ubl4a Is Required for Insulin-Induced Akt Plasma Membrane Translocation Through Promotion of Arp2/3-Dependent Actin Branching
    Ubl4A is required for insulin-induced Akt plasma membrane translocation through promotion of Arp2/3-dependent actin branching Yu Zhaoa, Yuting Lina, Honghong Zhanga, Adriana Mañasa, Wenwen Tangb, Yuzhu Zhangc, Dianqing Wub, Anning Linc, and Jialing Xianga,1 aDepartment of Biology, Illinois Institute of Technology, Chicago, IL 60616; bDepartment of Pharmacology, Yale University School of Medicine, New Haven, CT 06520; and cBen May Department for Cancer Research, University of Chicago, Chicago, IL 60637 Edited by Melanie H. Cobb, University of Texas Southwestern Medical Center, Dallas, TX, and approved July 1, 2015 (received for review May 6, 2015) The serine-threonine kinase Akt is a key regulator of cell prolifer- Results ation and survival, glucose metabolism, cell mobility, and tumor- Ubl4A-Deficient Mice Display Increased Neonatal Mortality and a igenesis. Activation of Akt by extracellular stimuli such as insulin Defect in Liver Glycogen Synthesis. To better understand the bi- centers on the interaction of Akt with PIP3 on the plasma mem- ological functions of Ubl4A, we generated Ubl4A-deficient mice brane, where it is subsequently phosphorylated and activated (Fig. S1). Ubl4A knockout (KO) mice were viable but displayed by upstream protein kinases. However, it is not known how Akt increased neonatal mortality (occurring mostly within 24 h after is recruited to the plasma membrane upon stimulation. Here we A report that ubiquitin-like protein 4A (Ubl4A) plays a crucial role in birth) compared with their wild type (WT) littermates (Fig. 1 ). insulin-induced Akt plasma membrane translocation. Ubl4A knock- We noticed that some Ubl4A KO pups displayed signs of cyanosis A Inset out newborn mice have defective Akt-dependent glycogen syn- before death (Fig.
    [Show full text]
  • Lipopolysaccharide Treatment Induces Genome-Wide Pre-Mrna Splicing
    The Author(s) BMC Genomics 2016, 17(Suppl 7):509 DOI 10.1186/s12864-016-2898-5 RESEARCH Open Access Lipopolysaccharide treatment induces genome-wide pre-mRNA splicing pattern changes in mouse bone marrow stromal stem cells Ao Zhou1,2, Meng Li3,BoHe3, Weixing Feng3, Fei Huang1, Bing Xu4,6, A. Keith Dunker1, Curt Balch5, Baiyan Li6, Yunlong Liu1,4 and Yue Wang4* From The International Conference on Intelligent Biology and Medicine (ICIBM) 2015 Indianapolis, IN, USA. 13-15 November 2015 Abstract Background: Lipopolysaccharide (LPS) is a gram-negative bacterial antigen that triggers a series of cellular responses. LPS pre-conditioning was previously shown to improve the therapeutic efficacy of bone marrow stromal cells/bone-marrow derived mesenchymal stem cells (BMSCs) for repairing ischemic, injured tissue. Results: In this study, we systematically evaluated the effects of LPS treatment on genome-wide splicing pattern changes in mouse BMSCs by comparing transcriptome sequencing data from control vs. LPS-treated samples, revealing 197 exons whose BMSC splicing patterns were altered by LPS. Functional analysis of these alternatively spliced genes demonstrated significant enrichment of phosphoproteins, zinc finger proteins, and proteins undergoing acetylation. Additional bioinformatics analysis strongly suggest that LPS-induced alternatively spliced exons could have major effects on protein functions by disrupting key protein functional domains, protein-protein interactions, and post-translational modifications. Conclusion: Although it is still to be determined whether such proteome modifications improve BMSC therapeutic efficacy, our comprehensive splicing characterizations provide greater understanding of the intracellular mechanisms that underlie the therapeutic potential of BMSCs. Keywords: Alternative splicing, Lipopolysaccharide, Mesenchymal stem cells Background developmental pathways, and other processes associated Alternative splicing (AS) is important for gene regulation with multicellular organisms.
    [Show full text]
  • Ubl4a Is Required for Insulin-Induced Akt Plasma Membrane Translocation Through Promotion of Arp2/3-Dependent Actin Branching
    Ubl4A is required for insulin-induced Akt plasma membrane translocation through promotion of Arp2/3-dependent actin branching Yu Zhaoa, Yuting Lina, Honghong Zhanga, Adriana Mañasa, Wenwen Tangb, Yuzhu Zhangc, Dianqing Wub, Anning Linc, and Jialing Xianga,1 aDepartment of Biology, Illinois Institute of Technology, Chicago, IL 60616; bDepartment of Pharmacology, Yale University School of Medicine, New Haven, CT 06520; and cBen May Department for Cancer Research, University of Chicago, Chicago, IL 60637 Edited by Melanie H. Cobb, University of Texas Southwestern Medical Center, Dallas, TX, and approved July 1, 2015 (received for review May 6, 2015) The serine-threonine kinase Akt is a key regulator of cell prolifer- Results ation and survival, glucose metabolism, cell mobility, and tumor- Ubl4A-Deficient Mice Display Increased Neonatal Mortality and a igenesis. Activation of Akt by extracellular stimuli such as insulin Defect in Liver Glycogen Synthesis. To better understand the bi- centers on the interaction of Akt with PIP3 on the plasma mem- ological functions of Ubl4A, we generated Ubl4A-deficient mice brane, where it is subsequently phosphorylated and activated (Fig. S1). Ubl4A knockout (KO) mice were viable but displayed by upstream protein kinases. However, it is not known how Akt increased neonatal mortality (occurring mostly within 24 h after is recruited to the plasma membrane upon stimulation. Here we A report that ubiquitin-like protein 4A (Ubl4A) plays a crucial role in birth) compared with their wild type (WT) littermates (Fig. 1 ). insulin-induced Akt plasma membrane translocation. Ubl4A knock- We noticed that some Ubl4A KO pups displayed signs of cyanosis A Inset out newborn mice have defective Akt-dependent glycogen syn- before death (Fig.
    [Show full text]
  • High Functioning Autism with Missense
    International Journal of Molecular Sciences Article High Functioning Autism with Missense Mutations in Synaptotagmin-Like Protein 4 (SYTL4) and Transmembrane Protein 187 (TMEM187) Genes: SYTL4- Protein Modeling, Protein-Protein Interaction, Expression Profiling and MicroRNA Studies Syed K. Rafi 1,* , Alberto Fernández-Jaén 2 , Sara Álvarez 3, Owen W. Nadeau 4 and Merlin G. Butler 1,* 1 Departments of Psychiatry & Behavioral Sciences and Pediatrics, University of Kansas Medical Center, Kansas City, KS 66160, USA 2 Department of Pediatric Neurology, Hospital Universitario Quirón, 28223 Madrid, Spain 3 Genomics and Medicine, NIM Genetics, 28108 Madrid, Spain 4 Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, KS 66160, USA * Correspondence: rafi[email protected] (S.K.R.); [email protected] (M.G.B.); Tel.: +816-787-4366 (S.K.R.); +913-588-1800 (M.G.B.) Received: 25 March 2019; Accepted: 17 June 2019; Published: 9 July 2019 Abstract: We describe a 7-year-old male with high functioning autism spectrum disorder (ASD) and maternally-inherited rare missense variant of Synaptotagmin-like protein 4 (SYTL4) gene (Xq22.1; c.835C>T; p.Arg279Cys) and an unknown missense variant of Transmembrane protein 187 (TMEM187) gene (Xq28; c.708G>T; p. Gln236His). Multiple in-silico predictions described in our study indicate a potentially damaging status for both X-linked genes. Analysis of predicted atomic threading models of the mutant and the native SYTL4 proteins suggest a potential structural change induced by the R279C variant which eliminates the stabilizing Arg279-Asp60 salt bridge in the N-terminal half of the SYTL4, affecting the functionality of the protein’s critical RAB-Binding Domain.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • PRC1 Collaborates with SMCHD1 to Fold the X-Chromosome and Spread
    ARTICLE https://doi.org/10.1038/s41467-019-10755-3 OPEN PRC1 collaborates with SMCHD1 to fold the X- chromosome and spread Xist RNA between chromosome compartments Chen-Yu Wang 1,2, David Colognori1,2,3, Hongjae Sunwoo 1,2,3, Danni Wang 1,2 & Jeannie T. Lee 1,2 X-chromosome inactivation triggers fusion of A/B compartments to inactive X (Xi)-specific structures known as S1 and S2 compartments. SMCHD1 then merges S1/S2s to form the Xi 1234567890():,; super-structure. Here, we ask how S1/S2 compartments form and reveal that Xist RNA drives their formation via recruitment of Polycomb repressive complex 1 (PRC1). Ablating Smchd1 in post-XCI cells unveils S1/S2 structures. Loss of SMCHD1 leads to trapping Xist in the S1 compartment, impairing RNA spreading into S2. On the other hand, depleting Xist, PRC1, or HNRNPK precludes re-emergence of S1/S2 structures, and loss of S1/S2 com- partments paradoxically strengthens the partition between Xi megadomains. Finally, Xi- reactivation in post-XCI cells can be enhanced by depleting both SMCHD1 and DNA methylation. We conclude that Xist, PRC1, and SMCHD1 collaborate in an obligatory, sequential manner to partition, fuse, and direct self-association of Xi compartments required for proper spreading of Xist RNA. 1 Department of Molecular Biology, Massachusetts General Hospital, Boston, MA, USA. 2 Department of Genetics, The Blavatnik Institute, Harvard Medical School, Boston, MA, USA. 3These authors contributed equally: David Colognori, Hongjae Sunwoo. Correspondence and requests for materials should be addressed to J.T.L. (email: [email protected]) NATURE COMMUNICATIONS | (2019) 10:2950 | https://doi.org/10.1038/s41467-019-10755-3 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-10755-3 ammalian chromosomes show a distinct topological (HNRNPK), or polycomb repressive complex 1 (PRC1) prevents Morganization.
    [Show full text]
  • The Role of BAG6 in Protein Quality Control
    The role of BAG6 in protein quality control A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health 2017 Yee Hui Koay School of Biological Sciences List of contents Page List of tables 5 List of figures 6 List of abbreviations 9 Abstract 13 Declaration 14 Copyright statement 14 Acknowledgement 15 Chapter 1: Introduction 1.1 Protein folding and quality control 16 1.2 Degradation of misfolded proteins 21 1.3 Protein biosynthesis and quality control at the endoplasmic reticulum 24 1.4 BAG6 31 1.4.1 BAG6 structure 32 1.4.2 BAG6 in tail-anchored protein targeting 34 1.4.3 BAG6 in degradation of mislocalised proteins 35 1.4.4 BAG6 triages targeting and degradation 39 1.4.5 BAG6 in endoplasmic reticulum-associated degradation 43 1.5 Aims and objectives of study 46 Chapter 2: Materials and methods 2.1 DH5α competent cells preparation 47 2.2 Plasmid DNA preparation 47 2.3 Plasmid construction 49 2.3.1 Myc-BirA-pcDNA5/FRT/TO 49 2.3.2 BAG6-myc-BirA-pcDNA5/FRT/TO 51 2.3.3 BAG6(∆N)-myc-BirA-pcDNA5/FRT/TO 51 2.3.4 HA3-XBP1u G519C(∆HR2)-pcDNA3.1(+) 52 2.4 Cell culture 52 2 2.5 Stable inducible cell line generation and induction 53 2.6 siRNA transfection 53 2.7 Transient transfection for immunoblotting and immunofluorescence microscopy 54 2.8 Treatment with proteasome and lysosomal protease inhibitors 55 2.9 Endo Hf treatment 55 2.10 Cycloheximide chase 55 2.11 SDS-PAGE and immunoblotting 56 2.12 Immunofluorescence microscopy 58 2.13 Cell cracking 59 2.14 Co-immunoprecipitation
    [Show full text]
  • BAG6 Antibody A
    Revision 1 C 0 2 - t BAG6 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 3 2 Web: [email protected] 5 www.cellsignal.com 8 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H M R Mk Pg Endogenous 150 Rabbit P46379 7917 g g g p p Product Usage Information (SCP) that dephosphorylates SMAD proteins resulting in subsequent termination of BMP- mediated events (12). Application Dilution 1. Hessa, T. et al. (2011) Nature 475, 394-7. 2. David, R. (2011) Nat Rev Mol Cell Biol 12, 550. Western Blotting 1:1000 3. Ast, T. and Schuldiner, M. (2011) Curr Biol 21, R692-5. 4. Mariappan, M. et al. (2010) Nature 466, 1120-4. Storage 5. Leznicki, P. et al. (2010) J Cell Sci 123, 2170-8. 6. Minami, R. et al. (2010) J Cell Biol 190, 637-50. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% 7. Wang, Q. et al. (2011) Mol Cell 42, 758-70. glycerol. Store at –20°C. Do not aliquot the antibody. 8. Claessen, J.H. and Ploegh, H.L. (2011) PLoS One 6, e28542. 9. Nguyen, P. et al. (2008) Mol Cell Biol 28, 6720-9. Specificity / Sensitivity 10. Sasaki, T. et al. (2007) Genes Dev 21, 848-61. 11. Kwak, J.H. et al. (2008) J Biol Chem 283, 19816-25.
    [Show full text]
  • Absence of Gdx/UBL4A Protects Against Inflammatory Bowel Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/376103; this version posted July 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Absence of GdX/UBL4A protects against inflammatory bowel diseases 2 by regulating NF-кB signaling in DCs and macrophages 3 Chunxiao Liu1,6, Yifan Zhou2,6, Mengdi Li1, Ying Wang1, Liu Yang1, Shigao Yang1, Yarui 4 Feng1, Yinyin Wang1, Yangmeng Wang1, Fangli Ren1, Jun Li3, Zhongjun Dong2, Y. 5 Eugene Chin4, Xinyuan Fu5, Li Wu2,3,*, Zhijie Chang1,* 6 1State Key Laboratory of Membrane Biology, School of Medicine, Tsinghua University, 7 Beijing (100084), China. 8 2Institute for Immunology, School of Medicine, Tsinghua University, Beijing (100084), 9 China. 10 3Institute of Immunology, PLA, The Third Military Medical University, Chongqing, 11 (400038), China. 12 4Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese 13 Academy of Sciences, Shanghai Jiaotong University School of Medicine, Shanghai 14 (200025), China. 15 5Department of Biochemistry, Yong Loo Lin School of Medicine, National University of 16 Singapore, Singapore (117597). 17 6 These authors contributed equally to this work. 18 * Corresponding authors: 19 Zhijie Chang Tel: (86-10)62785076; Fax: (86-10)62773624; 20 E-mail: [email protected] 21 Li Wu Tel: (86-10)62794835; Fax: (86-10)62794835; 22 E-mail: [email protected] 23 24 25 26 27 1 bioRxiv preprint doi: https://doi.org/10.1101/376103; this version posted July 25, 2018.
    [Show full text]