DOCSLIB.ORG

Structural and Functional Comparisons of the Drosophila Virilis And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structural and Functional Comparisons of the Drosophila Virilis And Proc. NatI. Acad. Sci. USA Vol. 87, pp. 5916-5920, August 1990 Genetics Structural and functional comparisons of the Drosophila virilis and Drosophila melanogaster rough genes (homeobox/eye development/evolution) ULRIKE HEBERLEIN AND GERALD M. RUBIN Howard Hughes Medical Institute and Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Contributed by Gerald M. Rubin, May 23, 1990 ABSTRACT We have isolated the homeobox gene rough tions were carried out at 420C in 2x SSC (1 x SSC is 0.15 M (ro) from Drosophila viriis. Comparison ofthe predicted amino NaCI/0.015 M sodium citrate, pH 7) containing 35% form- acid sequences of the D. melanogaster and D. virus rough amide, 0.1% Ficoll, 0.1% bovine serum albumin, 0.1% poly- proteins reveals that domains of high conservation, including vinylpyrrolidone, and 100 ,ug of sonicated salmon sperm the homeodomain, are interspersed with highly diverged re- DNA per ml. Washing conditions were lx SSC/0.1% SDS, gions. Stretches of significant sequence conservation are also 50'C. Approximately one clone was obtained per genome observed in the 5' promoter region and in the introns. The D. screened. DNA blot analysis of the isolated phage DNA virusrough gene rescues the rough mutant phenotype and is identified an 8-kilobase (kb) genomic Sal I fragment that properly regulated when introduced into the D. melanogaster hybridized with the D. melanogaster rough cDNA. This genome. Thus the rough protein as well as the cis-regulatory fragment was subcloned into pBluescript KS(+) (Strata- elements that ensure proper temporal and spatial regulation gene), and random clones were generated by sonication and are functionally conserved between these Drosophila species. subcloning into phage M13. Sequencing was done by the chain-termination method (8). Both strands were sequenced The compound eye ofDrosophila consists ofseveral hundred except for two 100-base-pair (bp) regions in the first intron. units, or ommatidia, each containing a stereotyped arrange- Sequences were compiled and analyzed using the IntelliGe- ment of photoreceptor, pigment, and cone cells. These om- netics and University of Wisconsin Genetics Computer matidia develop during late larval and pupal life in the eye Group software packages. imaginal disc, in a process that The 8-kb DNA fragment containing the D. virilis rough involves the recruitment of gene was cloned into the P-element transformation vector undifferentiated epithelial cells into gradually growing om- pDM30 (9) and germ-line transformants were obtained by matidial clusters (for review see refs. 1 and 2). The rough (ro) standard techniques (10). mutation disrupts cellular interactions at an early stage of Antibody staining of eye imaginal discs with the rough ommatidial assembly, leading to irregularly arranged clusters monoclonal antibody (MAbrol) was carried out exactly as containing variable numbers of photoreceptor cells (3). described (4). Fixation and sectioning of adult Drosophila The rough gene encodes a homeodomain protein (3, 35) and heads were performed as described (11). is believed to specify the identity ofa subset ofphotoreceptor cells in the developing retina (4, 5). The rough protein is restricted to the eye imaginal disc, where it is expressed in a RESULTS AND DISCUSSION complex and dynamic pattern (4). Unlike mutations in other The D. virilis rough gene was isolated from a genomic library Drosophila homeobox genes, flies carrying complete loss-of- by virtue of its cross-hybridization with a D. melanogaster function alleles of rough are viable (unpublished data). This, rough cDNA (see Materials and Methods). The regions of together with the relatively small size of the rough gene, homologous sequence in the two genes were found to be provides a unique opportunity to study structure-function completely contained within an 8-kb D. virilis Sal I fragment. relationships of a homeodomain protein in its natural devel- The DNA sequence of most of this genomic fragment is opmental context. shown in Fig. 1, which includes alignments with D. melano- As a first step to identify functionally relevant domains of gaster protein-coding sequences. From the analysis of these the rough protein, as well as cis-regulatory DNA sequences alignments we conclude that the D. virilis DNA fragment required for proper regulation, we have compared the se- contains all the protein-coding sequences, as well as -1 kb quences of the rough genes from two distantly related Droso- each of 5' and 3' noncoding DNA. The D. melanogaster phila species, D. melanogaster and D. virilis.* These two rough protein is encoded by three exons. The DNA se- species are separated by an evolutionary period of "60 million quences ofthe splice sites and adjacent regions are conserved years (6), which is sufficiently distant for unconstrained DNA in the two species, arguing that the overall genomic organi- sequences to have diverged extensively, allowing putative zation is the same. A dot-matrix comparison of the D. virilis functional elements to be identified by sequence conservation. and D. melanogaster rough sequences is shown in Fig. 2. To test whether the observed conservation is of functional Although the homologies are concentrated in the coding importance, we introduced the D. virilis rough gene into the D. regions, several stretches of highly conserved sequence are melanogaster genome and analyzed its function. observed in each intron. The conservation at the DNA level in the three exons, calculated as percent nucleotide identity MATERIALS AND METHODS relative to the total number of nucleotides in the D. mela- A genomic D. virilis library in bacteriophage A EMBL3 (ref. nogaster sequence, is 46%, 81%, and 69% in the first, second, 7; a gift of M. Scott, Stanford University) was screened with and third exons, respectively. It is difficult to calculate the a full-length D. melanogaster rough cDNA (3). Hybridiza- overall conservation in the introns due to significant differ- ences in their length. However, -209o% of the sequence The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" *The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. M35372). 5916 Downloaded by guest on September 25, 2021 Genetics: Heberlein and Rubin Proc. Nat!. Acad. Sci. USA 87 (1990) 5917 viv rCGGATCCGACCAACTG-1050TCGAGTTGAAGCAAGGTAGTTCGTTAAGACTCCGGACTTGGCACTAC 15 Orvi CTACCTTATAGCGTTATCCTGCACGACACCTAAGCATC-918TTTCTCGCATTTTAGTATTAGCAATGC-1 vi TTAAAATGAAGATACAAGGCCGrATCACATTACATT -786AATCAATTGCAATCCCGGCGGCCACGTCG-8 vi rGATAATTCACATTATCCAAAtTTGGTTTGCAA -390GATTTTTTTATTGAAAATATTCATGAAGATA-9 vivi rAAAAATAACCAAGGAACAAAGATTCTTATAC-258GGTTCTCGCAATGCGCGTTGTCCCTCACAAAT -5 vi r AGGGGCCTTCTTGTCCTGGAATTAGGAGTATAGTGATCGTCACACGGACCTGTGTCGTTGGCAATTT -126 1-. vi r TATACCATTACCTCTTGTTATCGAAATTTAGGAGTACCACCTACAAAGGCGTATTGATGAGACCATT 6 mel HOR H KYVEI G SPDG SP- -8- 0- LODP 25 mel - ----AA-GT- -C--AGTTGAGATTGGCTCA-CC-AC-GCTC-CCG ----AGGAGTG-CAG-TTAGATC-C vir CATATGCATTCATTAGTACGTCCACGGGCAATCGACAACACTGCCCAGGAAGTACATTCATCAGCAA 138 vir LOO0N P S S P1L H A E K F I1K S 585 T P T 24 mel I A.N T-I-SV ---------------------S. 56 mel ATAG-G...................ACACT- -- -A-T- -AT-CGT----A-C--C-6---G----A--G- -T----A-0-------T-G- -A----CT-C.... vi r GCAACGACGACGACGACGACAGAAGTCTCAGCCGGCGCTTCCCATCTGGGCTAGGACCAAGGAGAAC 270 vir A T P A P A S A T A T A P N H T V L A T P 0 R P S S P R 0 F F E R 1 Y G H L E T R T H N 68 4-HKPPPC mel -N -FE-D----0-H-- ----- V ---------- --T--AA Y- A -0 106 mel TCG--A-AT--G--A--C--C--_C--A------C-----T--C ---T ---A----TC-----A-----C--C--C------AC---GC---C-GCA-A--- CG-C--C--T virt GGGGGCAATAGGGAAAGCAAGCTCAACAGAGACGACTGCGCTTGTATAGGGGCCTATATTCGCTTA 402 vir S F S G 0 I 0 v G T H A F T P Y 0 5 0 G G 5 A S S P 0 1 S I 5 0 F R V S 1 V S F P 5 Y E 112 .LPOHPSQQHOQHHHHHHHPPOLVHQKLSYVSPPPA IG mel F YG HA K- - I -A - GA- - P v- -H --------P S- --F S- 181 mel --CT---GT-ACG-CAA---C--T-TT--CGC---T-GAGC ----TC-TGTCC-G--A-AC--A.....C--C----CC-AAG---C----CT-C-G----C---C----C vi r TTCTCCTCCGATCGGGAGCCATCACCATTCGCGTTTATCGCTTCGTACGAATAGCGTTCGATTIATC 534 vir L H A P T P 0 Y S A Y 6 A I A N A T L P P A I S F P A F S A 0 P H I 8 A G F S A F 1 154 vir ATCACAATACCAATGCTCATATTCATTTAAGACACATTGTCGAAATAAAATATAAGTTTTGAATAAC 666 vir GGAAAAATGAACGATCCTTTTTTGAAAATATTGGGTCTAATGAAAAAATTTGATAAGAGTTGGTTAC 798 vir AAAGTTGCAATATTAGAAATTGTGAATGAAATCTTCTGACCTTTTGATAAATTAATTTTAGAACTAT 930 vir GAAGCTGCTTGACTCCGtTTCAACGTGTTTAAGTGCCTTCTGATTCTTAGTAATGATCAACACATAC 1062 vir YAAAAAAGMCAC GTAATTCAACGTTTAAGCAGCAGTAAGTTGAAAAAGCCTCTACTTATCAGTA 1194 vir GTGAACTTCMTGCGTGTCAGCATTTAAATGCGTCCCGTCATAAGAGTGAAAAAAGACATGCGTGATA 1326 vivCGATiTAATTTTGCGATAATCCrTTAACTCTACAGA 1458TCGAAGTTGTACCAGAAGAGTTAAAGTTC15 vir TAWTTAAGTGAACAGTGACTAGTTGAATCCAAGATAAAATCAGGGCCGAAAGTATAAAAAGAAATCG 1S90 OrviAATGAArCGATCTATGACAGAAATAACTACATAT 1722TTAAGTTTATATAAACGTTGTGATGGA12 vir ATATGCTATACTGAATCAAAACGTTCATACATTTGAATTTTTTGCACAAGTACTTATGCAAACTGTA 1854 vir CTTATACTTTGAGTAGCGGAAAGG GACACCTACTCC GT TGTAAAAGTTCTTATCGTAATAT T 19866 vir TTGAATGAMCATTTTATCATGTCAATdTTTTGTTTTTGCCTTCCGCCCGTTTAGTCCGTCTCCAA 2118 vir AGGTfijfiffG& TGTTCACATGCACAGTCCATGACCTCAATTCAGGCTGTGCGTTTGCGAGCGGCA 2382 vir ATGATTGCGCAGAGACCGCGCAGAAAGGAGATTATGTTTAAGTAAAGGAAGTATCAGGTTCCCCGCC 2514 vir ATCGTCAA AGAGAGGAAAAATATCGAGATCTAAGACAGTTAAACTGATGCGAACTGTAAAAAAAT 2646 vir ATGCAAAAGCAAAGMAAGATGCTAAAGAAAACCGAAAAGTCGAGAGAGAAAGGGCTTTAAGAAGAAGAAAGCAAAAAAAMAACAAGAATAAATTTAAGATAOGTAAAAATT
Load more

Recommended publications
  • Acoustic Duetting in Drosophila Virilis Relies on the Integration of Auditory and Tactile Signals Kelly M Larue1,2, Jan Clemens1,2, Gordon J Berman3, Mala Murthy1,2*
    RESEARCH ARTICLE elifesciences.org Acoustic duetting in Drosophila virilis relies on the integration of auditory and tactile signals Kelly M LaRue1,2, Jan Clemens1,2, Gordon J Berman3, Mala Murthy1,2* 1Princeton Neuroscience Institute, Princeton University, Princeton, United States; 2Department of Molecular Biology, Princeton University, Princeton, United States; 3Lewis Sigler Institute for Integrative Genomics, Princeton University, Princeton, United States Abstract Many animal species, including insects, are capable of acoustic duetting, a complex social behavior in which males and females tightly control the rate and timing of their courtship song syllables relative to each other. The mechanisms underlying duetting remain largely unknown across model systems. Most studies of duetting focus exclusively on acoustic interactions, but the use of multisensory cues should aid in coordinating behavior between individuals. To test this hypothesis, we develop Drosophila virilis as a new model for studies of duetting. By combining sensory manipulations, quantitative behavioral assays, and statistical modeling, we show that virilis females combine precisely timed auditory and tactile cues to drive song production and duetting. Tactile cues delivered to the abdomen and genitalia play the larger role in females, as even headless females continue to coordinate song production with courting males. These data, therefore, reveal a novel, non-acoustic, mechanism for acoustic duetting. Finally, our results indicate that female-duetting circuits are not sexually differentiated, as males can also produce ‘female-like’ duets in a context- dependent manner. DOI: 10.7554/eLife.07277.001 *For correspondence: [email protected] Introduction Competing interests: The Studies of acoustic communication focus on the production of acoustic signals by males and the authors declare that no competing interests exist.
    [Show full text]
  • Pan-Arthropod Analysis Reveals Somatic Pirnas As an Ancestral TE Defence 2 3 Samuel H
    bioRxiv preprint doi: https://doi.org/10.1101/185694; this version posted September 7, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Pan-arthropod analysis reveals somatic piRNAs as an ancestral TE defence 2 3 Samuel H. Lewis1,10,11 4 Kaycee A. Quarles2 5 Yujing Yang2 6 Melanie Tanguy1,3 7 Lise Frézal1,3,4 8 Stephen A. Smith5 9 Prashant P. Sharma6 10 Richard Cordaux7 11 Clément Gilbert7,8 12 Isabelle Giraud7 13 David H. Collins9 14 Phillip D. Zamore2* 15 Eric A. Miska1,3* 16 Peter Sarkies10,11* 17 Francis M. Jiggins1* 18 *These authors contributed equally to this work 19 20 Correspondence should be addressed to F.M.J. ([email protected]) or S.H.L. 21 ([email protected]). 22 23 24 bioRxiv preprint doi: https://doi.org/10.1101/185694; this version posted September 7, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 25 Abstract 26 In animals, PIWI-interacting RNAs (piRNAs) silence transposable elements (TEs), 27 protecting the germline from genomic instability and mutation. piRNAs have been 28 detected in the soma in a few animals, but these are believed to be specific 29 adaptations of individual species. Here, we report that somatic piRNAs were likely 30 present in the ancestral arthropod more than 500 million years ago. Analysis of 20 31 species across the arthropod phylum suggests that somatic piRNAs targeting TEs 32 and mRNAs are common among arthropods.
    [Show full text]
  • Genetic Analysis of Drosophila Virilis Sex Pheromone: Genetic Mapping of the Locus Producing Z-(Ll)-Pentacosene
    Genet. Res., Camb. (1996), 68, pp. 17-21 With 1 text-figure Copyright © 1996 Cambridge University Press 17 Genetic analysis of Drosophila virilis sex pheromone: genetic mapping of the locus producing Z-(ll)-pentacosene MOTOMICHI DOI*, MASATOSHI TOMARU, HIROSHI MATSUBAYASHI1, KIYO YAMANOI AND YUZURU OGUMA Institute of Biological Sciences, University of Tsukuba, 1-1-1, Tsukuba, Ibaraki 305, Japan (Received 27 June 1995 and in revised form 18 December 1995) Summary Z-(ll)-pentacosene, Drosophila virilis sex pheromone, is predominant among the female cuticular hydrocarbons and can elicit male courtship behaviours. To evaluate the genetic basis of its production, interspecific crosses between D. novamexicana and genetically marked D. virilis were made and hydrocarbon profiles of their backcross progeny were analysed. The production of Z- (ll)-pentacosene was autosomally controlled and was recessive. Of the six D. virilis chromosomes only the second and the third chromosomes showed significant contributions to sex pheromone production, and acted additively. Analysis of recombinant females indicated that the locus on the second chromosome mapped to the proximity of position 2-218. - and some work on the genetic basis of their control 1. Introduction has been done. Female cuticular hydrocarbons in Drosophila play an In D. simulans, intrastrain hydrocarbon poly- important role in stimulating males and can elicit male morphism is very marked, and two loci that are courtship behaviours, that is, some can act as a sex involved in controlling the hydrocarbon variations pheromone (Antony & Jallon, 1982; Jallon, 1984; have been identified. One is Ngbo, mapped to position Antony et al. 1985; Oguma et al. 1992; Nemoto et al.
    [Show full text]
  • Introduction to the Genomics Education Partnership and Collaborative Genomics Research in Drosophila
    Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Vol. 34, 135-165, 2013 Introduction to the Genomics Education Partnership and Collaborative Genomics Research in Drosophila Julia A. Emerson1, S. Catherine Silver Key2, Consuelo J. Alvarez3, Stephanie Mel4, Gerard P. McNeil5, Kenneth J. Saville6, Wilson Leung7, Christopher D. Shaffer7 and Sarah C. R. Elgin7 1Amherst College, Department of Biology, P.O. Box 5000, Amherst MA 01002 USA 2North Carolina Central University, Department of Biology, 2246 MTSB, Durham NC 27701 USA 3Longwood University, Department of Biological and Environmental Sciences, 201 High St., Farmville VA 23909 USA 4University of California San Diego, Division of Biological Sciences, 9500 Gilman Drive 0355, La Jolla CA 92093 USA 5York College/CUNY, Department of Biology, 94-20 Guy R. Brewer Blvd., Jamaica NY 11451 USA 6 Albion College, Biology Department, 611 E. Porter St., Albion MI 49224 USA 7Washington University, Department of Biology, Campus Box 1137, One Brookings Dr., St. Louis MO 3130 USA ([email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]) The GEP, a group of faculty from over 90 primarily undergraduate institutions, is using comparative genomics to engage students in research within regular courses. Using a versatile curriculum, GEP undergraduates undertake projects to improve draft genomic sequences and/or participate in the annotation of these improved sequences. An additional goal of the annotation curriculum is for students to gain a sophisticated understanding of eukaryotic gene structure. Students do so by carefully mapping the protein-coding regions of putative genes from recently- sequenced Drosophila species.
    [Show full text]
  • An Analysis of the Chromosomes of the Two Sub-Species Drosophila Virilis Virilis and Drosophila Virilis Americana* Roscoe D
    AN ANALYSIS OF THE CHROMOSOMES OF THE TWO SUB-SPECIES DROSOPHILA VIRILIS VIRILIS AND DROSOPHILA VIRILIS AMERICANA* ROSCOE D. HUGHES Columbia University, New York, and Medical College of Virginia, Richmond, Virginia Received July 19, 1939 INTRODUCTION NCREASING attention is being focused on the use of Drosophila as a I convenient organism for investigating such fundamental problems as the formation of new species and interspecific sterility. Studies of the hybrid from the cross D. melarzogasterXD. simulans by PATAU(I935), and by HORTON(1939), and D. pseudoobscuraXD. miranda by DOB- ZHANSKY and TAN(1936), as well as studies of the hybrids from the inter- racial crosses of D. pseudoobscura by DoszHANsKY and STURTEVANT (1938), have amply demonstrated the advantages of the salivary gland technique in affording a new approach to such old problems, and making possible a more critical analysis of the differences in gene alignment. The present paper is a study of the differences in gene alignment of the two sub-species, D. virilis virilis and D.virilis americana as determined by the salivary gland chromosome analysis of the hybrid, and the differences in the chromosome configurations in the larval ganglion cells. Such a study has made necessary a revision of my preliminary map (HUGHES1936) of the salivary gland chromosomes of D. virilis. These two sub-species are of special interest because, among other reasons, they can be crossed easily and yield hybrids which are partially fertile (SPENCER1938). Both male and female hybrids are partially fertile when crossed inter se, or backcrossed to either parent sub-species. That two sub-species differing so widely in gene alignment, in the chromosome configuration of the ganglion cells, in phenotypic appearance, and physio- logical characteristics can be crossed is unusual for the genus Drosophila, and it is remarkable indeed that the hybrid is partially fertile.
    [Show full text]
  • Variability Levels, Population Size and Structure of American and European Drosophila Montana Populations
    Heredity 86 (2001) 506±511 Received 22 September 2000, accepted 22 January 2001 Variability levels, population size and structure of American and European Drosophila montana populations JORGE VIEIRA* & ANNELI HOIKKALAà Institute of Cell, Animal and Population Biology, University of Edinburgh, Edinburgh EH9 3JT U.K. and àDepartment of Biology, University of Oulu, P.O. Box 3000, FIN-90401 Oulu, Finland The level and patterns of nucleotide diversity have been characterized for two X-linked loci, fused (fu; a region of 2362 bp) and suppressor of sable (su(s); a region of 413 bp), in one European and one American D. montana population. Sequence variation at these loci shows that the two populations are divergent, although they may not be completely isolated. Data on the level of silent site variability at su(s) (1.1% and 0.5% for the European and American populations, respectively) suggest that the eective population sizes of the two populations may be similar. At the fused locus, one European sequence was highly divergent and may have resulted from gene conversion, and was excluded from the analysis. With this sequence removed, the level of silent site variability was signi®cantly lower in the European population (0.28%) than in the American population (2.3%), which suggests a selective sweep at or near fu in the former population. Keywords: DNA sequence variation, Drosophila montana, fused, population structure. Introduction Higuchi, 1979). Allozyme variability studies have been conducted so far only on North American D. montana Knowledge of the level and patterns of nucleotide populations (Baker, 1975, 1980). Thus it is not known polymorphisms within and between conspeci®c popula- whether there is a single world-wide D.
    [Show full text]
  • Evolution of a Distinct Genomic Domain in Drosophila: Comparative Analysis of the Dot Chromosome in Drosophila Melanogaster and Drosophila Virilis
    Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.116129 Evolution of a Distinct Genomic Domain in Drosophila: Comparative Analysis of the Dot Chromosome in Drosophila melanogaster and Drosophila virilis Wilson Leung,* Christopher D. Shaffer,* Taylor Cordonnier,*,† Jeannette Wong,* Michelle S. Itano,*,‡ Elizabeth E. Slawson Tempel,* Elmer Kellmann,*,§ David Michael Desruisseau,* Carolyn Cain,*,** Robert Carrasquillo,*,†† Tien M. Chusak,*,‡‡ Katazyna Falkowska,* Kelli D. Grim,*,§§ Rui Guan,*,*** Jacquelyn Honeybourne,* Sana Khan,*,††† Louis Lo,* Rebecca McGaha,*,‡‡‡ Jevon Plunkett,*,§§§ Justin M. Richner,*,**** Ryan Richt,* Leah Sabin,*,†††† Anita Shah,*,‡‡‡‡ Anushree Sharma,*,§§§§ Sonal Singhal,*,***** Fine Song,*,††††† Christopher Swope,* Craig B. Wilen,*,†††† Jeremy Buhler,‡‡‡‡‡ Elaine R. Mardis§§§§§ and Sarah C. R. Elgin*,1 †Ross University School of Medicine, Portsmouth, Commonwealth of Dominica, West Indies 00109-8000, ‡Department of Cell and Developmental Biology, University of North Carolina, Chapel Hill, North Carolina 27599, §Robller Vineyard Winery, New Haven, Missouri 63068, **Department of Human Genetics, University of Chicago, Chicago, Illinois 60637, ††Harvard Medical School, Boston, Massachusetts 02115, ‡‡Marshall School of Business, University of Southern California, Los Angeles, California 90033, §§Baylor College of Medicine, Houston, Texas 77054, ***College of Medicine, University of Illinois, Chicago, IL 60612, †††Department of Obstetrics and Gynecology, University of Oklahoma Health Sciences
    [Show full text]
  • Mini-Review an Insect-Specific System for Terrestrialization Laccase
    Insect Biochemistry and Molecular Biology 108 (2019) 61–70 Contents lists available at ScienceDirect Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb Mini-review an insect-specific system for terrestrialization: Laccase- mediated cuticle formation T ∗ Tsunaki Asano , Yosuke Seto, Kosei Hashimoto, Hiroaki Kurushima Department of Biological Sciences, Tokyo Metropolitan University, Tokyo, 192-0397, Japan ABSTRACT Insects are often regarded as the most successful group of animals in the terrestrial environment. Their success can be represented by their huge biomass and large impact on ecosystems. Among the factors suggested to be responsible for their success, we focus on the possibility that the cuticle might have affected the process of insects’ evolution. The cuticle of insects, like that of other arthropods, is composed mainly of chitin and structural cuticle proteins. However, insects seem to have evolved a specific system for cuticle formation. Oxidation reaction of catecholamines catalyzed by a copper enzyme, laccase, is the key step in the metabolic pathway for hardening of the insect cuticle. Molecular phylogenetic analysis indicates that laccase functioning in cuticle sclerotization has evolved only in insects. In this review, we discuss a theory on how the insect-specific “laccase” function has been advantageous for establishing their current ecological position as terrestrial animals. 1. Introduction the cuticle hardens after molting in crustaceans and diplopods (Shaw, 1968; Barnes, 1982; Nagasawa,
    [Show full text]
  • Germline Transformation of Drosophila Virilis Mediated by the Transposable Element Hobo
    Copyight 0 1996 by the Genetics Society of America Germline Transformation of Drosophila Virilis Mediated by the Transposable Element hobo Elena R. Lozovskaya,* Dmitry I. Nurminsky,* Daniel L. Had* and David T. Sullivan’ *Department of Organismic and Euolutionaly Biology, Haruard University, Cambridge, Massachusetts 02138 and tDepartment of Biology, Syracuse University, Syracuse, New York 13244-0001 Manuscript received July 17, 1995 Accepted for publication September 21, 1995 ABSTRACT A laboratory strain of Drosophila uirilis was genetically transformed with a hobo vector carrying the miniwhite cassette using a helper plasmid with an hsp7Odriven hobo transposasecoding sequence. The rate of transformation was 0.5% per fertile GO animal. Three transgenic insertions were cloned and characterized and found to be authentic hobo insertions. These results, together with the known wide- spread distribution of hobo in diverse insect species, suggest that hobo and related transposable elements may be of considerable utility in the germline transformation of insects other than D. melanogaster. HERE is at present considerable interest in the Thusfar, most transformation experiments have T application of germline transformation to the ge- been carried out with D. melanogaster as a model organ- netic manipulation of arthropod genomes, especially ism. One advantage is that the experimental procedures those of agricultural pests and vectors of human dis- for injection of DNA and the treatment of embryos are ease (KIDWELL 1993; WARRENand CRAMPTON 1994). well established (SPRADLING1986). Another advantage For a number of reasons, transposable elements are is that any one of a number of genetic marker systems strong candidates as potential vectors. An experimen- can be used in vector construction and transformation.
    [Show full text]
  • Phylogenetic Relationships Among Species Groups of the Virilis-Repleta
    Molecular Phylogenetics and Evolution Vol. 21, No. 2, November, pp. 327–331, 2001 doi:10.1006/mpev.2001.1002, available online at http://www.idealibrary.com on SHORT COMMUNICATION Phylogenetic Relationships among Species Groups of the virilis–repleta Radiation of Drosophila Andrey Tatarenkov1 and Francisco J. Ayala Department of Ecology and Evolutionary Biology, 321 Steinhaus Hall, University of California, Irvine, California 92697-2525 Received December 4, 2000; revised April 25, 2001 One of the largest radiations within the Drosophili- repleta radiation. This analysis is informative about nae is the virilis–repleta radiation, as evaluated by the relationships within species complexes, but leaves re- number of species and species groups (Throckmorton, lationships among the species complexes, subgroups, 1962, 1975). The virilis and repleta species groups have and groups largely unresolved. been extensively used as model systems in the studies We explore phylogenetic relationships of the virilis– of mechanisms of speciation, mapping genes, and chro- repleta radiation using two nuclear genes, Ddc and mosomal rearrangements (Patterson and Stone, 1952; amd, in representatives of 12 species groups and five Powell, 1997). Drosophila virilis is a prominent refer- subgroups of the repleta group. We address two main ence species for comparison with D. melanogaster in questions: (1) monophyly of the virilis–repleta radia- regard to patterns and mechanisms of molecular and tion, and (2) phylogenetic relationships of species genomic evolution (Nurminsky et al., 1996; Hartl and groups and subgroups to one another within the out- Lozovskaya, 1995). The Drosophila repleta group lined clade. within this radiation is potentially very promising for A sample of 20 species that belong to the virilis– the study of speciation mechanisms, because it dis- repleta radiation (sensu Throckmorton, 1975) are listed plays a range of different degrees of reproductive iso- in Table 1.
    [Show full text]
  • In Vivo Length Oscillations of Indirect Flight Muscles in the Fruit Fly Drosophila Virilis
    The Journal of Experimental Biology 199, 2767–2774 (1996) 2767 Printed in Great Britain © The Company of Biologists Limited 1996 JEB0580 IN VIVO LENGTH OSCILLATIONS OF INDIRECT FLIGHT MUSCLES IN THE FRUIT FLY DROSOPHILA VIRILIS WAI PANG CHAN AND MICHAEL H. DICKINSON* Department of Integrative Biology, University of California, Berkeley, CA 94720, USA Accepted 14 August 1996 Summary We have used high-speed video microscopy to measure measurements of indirect flight muscle strain in other in vivo length oscillations of the indirect flight muscles of insects, but almost an order of magnitude greater than the the fruit fly Drosophila virilis during tethered flight. The strain amplitudes used in most biophysical studies of changes in muscle strain were measured by tracking the skinned Drosophila fibers. The results suggest that serial deformation of the thoracic exoskeleton at the origin and compliance within this sarcomere would need to relieve insertion of both the dorsal longitudinal (DLM) and the approximately 70 % of the total strain in order for dorsal ventral (DVM) muscles. The mean peak-to-peak individual crossbridges to remain attached throughout a strain amplitudes were found to be 3.5 % for the DLMs and complete contraction–extension cycle. 3.3 % for the DVMs, although the strain amplitude within individual cycles ranged from 2 to 5 %. These values are Key words: stretch-activation, strain, mechanical power, crossbridge, consistent with the small number of previous flight, muscle, Drosophila virilis. Introduction The flight muscles of many insects including beetles, bees maximize power output, especially when operating at high and flies are segregated into two anatomically and frequency (Josephson and Young, 1987; Ellington, 1991).
    [Show full text]
  • Drosophila Information Service
    Drosophila Information Service Number 103 December 2020 Prepared at the Department of Biology University of Oklahoma Norman, OK 73019 U.S.A. ii Dros. Inf. Serv. 103 (2020) Preface Drosophila Information Service (often called “DIS” by those in the field) was first printed in March, 1934. For those first issues, material contributed by Drosophila workers was arranged by C.B. Bridges and M. Demerec. As noted in its preface, which is reprinted in Dros. Inf. Serv. 75 (1994), Drosophila Information Service was undertaken because, “An appreciable share of credit for the fine accomplishments in Drosophila genetics is due to the broadmindedness of the original Drosophila workers who established the policy of a free exchange of material and information among all actively interested in Drosophila research. This policy has proved to be a great stimulus for the use of Drosophila material in genetic research and is directly responsible for many important contributions.” Since that first issue, DIS has continued to promote open communication. The production of this volume of DIS could not have been completed without the generous efforts of many people. Except for the special issues that contained mutant and stock information now provided in detail by FlyBase and similar material in the annual volumes, all issues are now freely-accessible from our web site: www.ou.edu/journals/dis. For early issues that only exist as aging typed or mimeographed copies, some notes and announcements have not yet been fully brought on line, but key information in those issues is available from FlyBase. We intend to fill in those gaps for historical purposes in the future.
    [Show full text]