Role of TMEM141 in Cholesterol Metabolism

A thesis submitted

To Kent State University in partial

Fulfillment of the requirements for the

Degree of Master of Science

Wrood S. Al-Khfajy

December, 2014

Thesis written by

Wrood S. Al-Khfajy

B.S., Al-Mustansiriya University, 2007

M.S., Kent State University, 2014

Approved by

Yanqiao Zhang, Associate Professor, M.D., Masters Advisor.

Yoonkwang Lee, Assistant Professor, Ph.D., Committee member.

Werner Geldenhuys, Assistant Professor, Ph.D., Committee member.

Eric Mintz, Professor, Ph.D., Director, School of Biomedical Sciences.

James L. Blank, Ph.D., Dean, College of Arts & Sciences

Table of Contents

List of Figures...... viii

List of abbreviations...... xi

Acknowledgments...... xv

Dedication……………………………………….……………………………………………..xvi

Chapter One: Introduction

1-1 The Nuclear receptor...... 1

1-2 Farnesoid X receptor (FXR) is a nuclear receptor...... 2

1-2-1 FXR Ligands………………………..…………………………………………………… 3

1-2-2 FXR DNA binding motifs………………………………………………………………...3

1-2-3 Function of FXR…………………………………………………………….………….…4

1-2-4 Role of FXR in bile acid metabolism………………………………………………..….5

1-2-5 FXR and lipid metabolism……………………………………………………………… 5

1-2-6 FXR and cholesterol metabolism……………………………………………………… 6

1-2-6-1 FXR and the cholesterol absorption……….………………..….……6

1-2-6-2 FXR and de novo cholesterol synthesis……………………….…....6

1-2-6-3 FXR and reverse cholesterol transport………………………………6

1-2-7 FXR and triglyceride metabolism………….…...……………...……….………………7

1-2-8 FXR and glucose metabolism…………………………………..………………………7

1-3 Cholesterol homeostasis…………………….…………………………………………….8

III

1-3-1 Cholesterol synthesis…………...……………...…………………..……….…….…….8

1-3-2 Cholesterol absorption and transport……….……………….…..………...…10

1-3-3 Role of High density lipoprotein (HDL) in cholesterol homeostasis……….11

1-3-4 HDL and reverse cholesterol transport…………………………………….…12

1-3-5 The anti-inflammatory and antioxidant activity of HDL……………...... ……13

1-4 ABCA1-mediated the regulation of cholesterol efflux…………………………………14

1-4-1 ABCA1 and HDL biogenesis…………………………………………………..14

1-4-2 Mechanism of ABCA1-mediated cholesterol efflux…………………………16

1-4-3 Sub-cellular localization of ABCA1……………………….…...... 17

1-4-4 Regulation of ABCA1 transcription………………………………….…..……18

a) Pre-transcriptional regulation………………...……………………………18

b) Transcriptional regulation………………………………...... 19

c) Post-translational regulation of ABCA1 activity……………………….…20

1- Regulation of ABCA1 degradation pathways………………...... 20

a) Calpain mediated ABCA1 degradation……..……………………23

b) Ubiquitin– mediated ABCA1 degradation pathway……………..20

2- Regulation of ABCA1 by microRNAs……………………………..22

1-5 Transmembrane protein141 and cholesterol homeostasis …..…………………..….23

Chapter Two: Materials and methods

2-1 Mice, Diets and Ligands …………………………………………………………………26

2-2 Adenovirus…………………………………………………………………………………26

2-3 Real-Time PCR……………………………………………………………………………27

2-4 Western Blot Assay……………………………………………………………………….28

2-5 Reporter Plasmids………………………………………………………………………...28

2-6 Transient Transfection……………………………………………………………………29

2-7 Lipid and Lipoprotein Analysis…………………………………………………………...29

2-8 VLDL Secretion……………………………………………………………………………30

2-9 Co-immunoprecipitation…………………………………………………………………..30

2-10 Immuno-flourascence……………...... 30

2-11 Cholesterol efflux in RAW-264.7 macrophages………………….…………………..31

2-12 Isolation of the primary Hepatocytes …………………………….……………………32

2-13 Statistical analysis……….………………………………………………………………32

Chapter Three: Results

3-1 Tmem141 expression is induced by GW4064 in wild-type but not FXR-deficient mice…………………………………………………...... 33

3-2 Tmem141 expression is induced by INT747 in wild-type but not FXR-deficient mice…………………………………………………...... 35

3-3 Identification of the FXR response element in the Tmem141 gene….………...….36

3-4 Knockdown of hepatic Tmem141 markedly reduces Plasma Cholesterol………..38

3-5 Hepatic Tmem141 deficiency results in down-regulation of multiple genes involved in lipid metabolism………………..…………………….………..…………………….…….42

3-6 Knockdown of Tmem141 in the liver decreases the expression of hepatic ATP – binding cassette Transporter sub-family A1 (ABCA1) protein level by 80 %...... 44

3-7 Over-expression of hepatic Tmem141 had no effect on lipid metabolism………….48

3-8 Over-expression of hepatic Tmem141 has no effect on the expression of ABCA1,

ApoA1 or lipogenic genes:…………………………………………………...…….…….…..49

3-9 Over-expression of Tmem141 has no impact on Hepatic ATP-binding cassette transporter sub-Family A1 (ABCA1) expression...... …………………………….…...... 50

3-10 Knockdown of hepatic Tmem141 does not affect Very-Low-Density Lipoprotein

(VLDL) secretion……………..……………………………….……………………….……....51

3-11 Knockdown of Tmem141 in the liver partially reduces plasma cholesterol levels in

Ldlr -/-mic………………………………..…………………………….………………………...52

3-12 Hepatic over-expression of Tmem141 has no effect on plasma cholesterol or

Triglyceride levels in Ldlr -/- mice ………………….…………………………………….…..54

3-13 Hepatic knockdown of Tmem141 has no effect on plasma cholesterol or

Triglyceride levels in apoe -/- mice ………………….…………………….……….………..55

3-14 Hepatic over-expression of Tmem141 has no effect on plasma cholesterol or

Triglyceride levels in apoe -/- mice …..…………..………………………………………....57

3-15 Tmem141 deficiency impairs cholesterol efflux from primary hepatocytes…...….59

3-16 Knockdown of Tmem141 decreases the expression of ABCA1 protein level in

RAW macrophages cells…………………………………………….…………………..…...60

3-17 Tmem141 deficiency impairs cholesterol efflux from macrophages ……………....61

3-18 Liver X receptor, a key regulator of HDL and cholesterol metabolism, does not regulate Tmem141 expression …………………………………………………………..….63

3-19 Tmem141 over expression dose not improves ABCA1 stability……...... 64

3-20 Tmem141 interacts with ABCA1 in vitro………….……………………………...... 65

3-21 Tmem141 mRNA and protein distribution patterns………………………………….66

3-22 TMEM141 is localized in late endosome/ lysosome compartments...... 67

3-23 Tmem141 expression is reduced in db/db mice ………………………………….….69

3-24 High-Fat diet selectively reduces Tmem141 expression in mice liver ………….....71

3-25 Tmem141 regulates ABCA1 expression in human…………………………………..73

Chapter Four: Discussion

4- Discussion ………………………………………………………………………….……….82

References ……………………………………………………………………………………92

VII

List of Figures

Figure 1-1 Structure and DNA binding of nuclear receptors……..…………………………1

Figure 1-2 FXR regulate a large number of target genes involved in bile acid, lipoprotein and glucose metabolism ……………………………………………………………………….4

Figure 1-3 Major steps of cholesterol biosynthesis…………….…….....…………….…….9

Figure 1-4 Metabolism of chylomicron, VLDL, IDL and LDL…………………………...…11

Figure1-5 ABCA1 and reverse cholesterol transport……………………….…….………..15

Figure 1-6: HDL formation by ABCA1...... …...17

Figure 1-7 Tmem141A NMR spectroscopy structure…….……………………………..…23

Figure 1-8 Tmem141 isoforms…………………………………………………..………...... 24

Figure 3-1: Hepatic Tmem141 is induced by synthetic FXR agonist GW4064 in wild-type but not in FXR-/- mice by FXR...... …...34

Figure 3-2: Hepatic Tmem141 is induced by synthetic FXR agonist INT747 in wild-type but not in FXR-/- mice by FXR...... …....36

Figure 3-3: Identification of an FXRE in the Tmem141 gene……..……………...……….37

Figure 3-4 Knockdown of Tmem141 in the liver reduce plasma cholesterol level mainly in the HDL fraction…………………………………………………………………………..…41

Figure 3-5 Hepatic Tmem141 deficiency down regulates the expression of multiple genes involved in lipid metabolism …………………………….…………………...……….43

Figure 3-6 Hepatic Tmem141 deficiency reduces the liver expression of ATP –binding cassette transporter sub-family A1 and ApoA-1…………….…………………...……..…45

VIII

Figure 3-7 Over-expression of Tmem141 in the liver of wild-type mice……………....…48

Figure: 3-8 Hepatic over- expression of Tmem141 has no Effect on genes implicated in lipid metabolism……………………………………………….……………………….....……49

Figure 3-9 Hepatic Tmem141 over expression had no effect on the liver expression of

ATP –binding cassette transporter sub-family A1 and ApoA-1 ……………..….….…..50

Figure 3-10 Loss of hepatic Tmem141 has no effect on VLDL secretion..…….……..…52

Figure 3-11 Tmem141 deficiency reduces plasma cholesterol level, partially through

LDL receptor lipids ……………….……….………………………..…………………………53

Figure 3-12 Over- expression of hepatic Tmem141 reduces plasma glucose of LDLR-/- mice………………….………………………..…………………...…………………..……….54

Figure 3-13 Knockdown of hepatic Tmem141 had no effect on plasma lipids of ApoE-/- mice……………………………………………………………………….………………...…..56

Figure 3-14 Over- expression of hepatic Tmem141 had no effect on plasma lipids of

ApoE-/- mice…………………………………...………………………………………...….…58

Figure 3-15 Suppression of hepatic Tmem141 correlates with a decrease in ABCA1- mediated cholesterol efflux from the primary Hepatocytes……………………..….……..59

Figure 3-16 Tmem141 deficiency reduces ABCA1 in mouse macrophages..…..……...60

Figure 3-17 Suppression of macrophage-Tmem141 correlates with a decrease in

ABCA1-mediated cholesterol efflux………………………………………………………….62

Figure 3-18 LXR activation dose not regulate Tmem141expression in the liver….…....63

Figure 3-19 Effect of Tmem141 over-expressions on ABCA1 abundance and stability...... ………...64

Figure 3-20 Tmem141 interacts with ABCA1 in vitro.……………………………...……...65

Figure 3.21 Tissue distribution of murine Tmem141 protein………………..……....……67

Figure 3.22 Tmem141Ais located mainly in endosomes/ Lysosomes ………..……...…68

Figure 3-23 hepatic Tmem141expression is reduced in db/db mice ………...….……..70

Figure 3-24 hepatic Tmem141expression is reduced in HF fed mice mice …...... ….72

Figure 3-25 Tmem141 down-regulates ABCA1 expression in human hepatocytes.…...73

List of abbreviations

ABCA1: ATP-binding cassette transporter A1

ABCG5: ATP-binding cassette transporter G5

ABCG8: ATP-binding cassette transporter G8

ACC1: acetyl-CoA carboxylases 1

ACC2: acetyl-CoA carboxylases 2

ACAT: acyl-CoA: cholesterol acyltransferase

ApoA-I: apolipoprotein A1

ApoB: Apo lipoprotein B

ApoE: Apo lipoprotein E

BSEP: bile salt export pump

Ca2+: calcium (ionic)

CAD: coronary artery disease

CVD: cardiovascular disease

CE: cholesteryl ester

CDCA: Chenodeoxycholic Acid

DCA: deoxycholic acid

DBD: DNA binding domain

CETP: cholesteryl ester transfer protein

CYP7A1: cytochrome P450 type 7A1

CK2: Casein kinase

FPLC: fast protein liquid chromatography

EL: by endothelial lipase

EGFR: epidermal growth factor-like repeats

ER: endoplasmic reticulum

FXR: Farnesoid X receptor

FXRE: FXR response element

FH: familial hypercholesterolemia

G6PC: glucose-6- phosphatase

HL: hepatic lipase

HDL: high-density lipoprotein

HDL-C: high-density lipoprotein cholesterol

HMGCR: 3-hydroxy-methylglutaryl-coenzyme A reeducates

IDL: intermediate-density lipoprotein

ICAM-1: intercellular adhesion molecule-1

INT-747: obeticholic acid (OCA or INT-747)

JAK2: Janus kinase 2

KCl: potassium chloride

LAL: lysosomal acid lipase

LCAT: lecithin cholesterol acyl transferase

LDL: low-density lipoprotein xv

LCA : Lithocholic acid

LDL-C: low-density lipoprotein cholesterol

LDLR: low density lipoprotein receptor

XII

LPL: lipoprotein lipase

LRP: LDL receptor related protein

LXR: liver X receptor

MDR1: multi-drug resistance protein 1

MS: Metabolic syndrome

MTP: Microsomal triglyceride transfer protein

NTCP: Na- taurocholate co transporting poly peptide

NR: nuclear receptor

NBD: nucleotide binding domain

NEFA: non-esterified fatty acids

NPC: Niemann Pick disease type C

PA: phosphatidic acid

PC: phosphatidyl choline

PCSK9: pro-protein convertase subtilisin kexin type 9

PEST: proline, glutamine, serine, threonine recognition sequence

PEPCK: Phosphoenolpyruvate carboxykinase

PKA: protein kinase A

PKC: protein kinase C

PPAR: peroxisome proliferator-activated receptor

RCT: reverse cholesterol transport

RXR: retinoid X receptor

SHP: small heterodimer partner

SR: scavenger receptor

XIII

SR-BI: scavenger receptor B1

SREBP: sterol regulatory element binding protein

TD: Tangier disease

TG: triglyceride

TMEM: Transmembrane Membrane

Tmem141: Transemembrane protein 141

UC: unesterified cholesterol

WB: Western blot

VLDL: very low-density lipoprotein

VCAM-1: vascular cell adhesion molecule-1

6ECDA: 6α-ethyl-chenodeoxycholic acid

XIV

Acknowledgements

I would like to thank Professor Yanqiao Zhang for his help, professional supervision and provided me with all the support and flexibility which enabled me to finish my master that I do not have enough words to express my sincere appreciation. My sincerest thanks to the members of my defense committee; Dr. Yoonkwang Lee and Dr.

Werner Geldenhuys for their valuable comments, guidance, support and careful attention to details. I must express my very profound gratitude to the financial support of the Higher Committee for Education Development in Iraq (HCED), Iraq.

Dedications

I would wish to dedicate this work to the Merciful God and my wonderful Family.

To the memory of my beloved Grandmother, I owe you lots and lots of kindness, love and support. I miss you so much, but know deep in my heart that you are watching over me.

To my dear Father, for instilling a hard work ethic, thanks for your unfailing support, encouragement and unconditional love. I know you would have been proud to see my accomplishments.

To my loving mother for keeping her prayers and hope alive; who has never stopped encouraging me along the way, I owe an enormous amount of respect and love This accomplishment would not have been possible without my parents. I truly love you both.

To my wonderful husband Munaf, You were always around at times I need you. Words would never say how grateful I am to you. This thesis could not have been achieved without you Thank you for being my Friend, my Lover, and my Husband. I Love you

Darling as wide as the world.

To my sisters and brother for providing me with the reinforcement, continuous encouragement, and beloved in every situation.

To my beautiful daughters Zainab and Zahraa, we had lots and lots of fun hours thought my journey, I couldn’t imagine doing my master without you; you really gave me the reason to continue.

XVI

Chapter one: Introduction

1-1 The nuclear receptor:

The nuclear receptor (NR) super families are Ligand-regulated transcriptional factors. The NR family encompasses of 48 members [1]. They regulate transcription of target genes in response to lipophilic signaling molecules, including endocrine hormones, vitamins, xenobitics and dietary lipids. Thus, the NR act as a biosensor for various metabolic or toxicological disorders, enabling the organisms to modulate the transcription of their target genes [2].

Figure 1-1 Structure of nuclear receptors. Tops -Schematic 1D amino acid sequence of a nuclear receptor. Bottom – 3D structures of the DBD (bound to DNA) and LBD (bound to hormone) regions of the nuclear receptor (Adapted from Kumer, R 1999).

NR consists of a DNA – binding domain (DBD) connected by a flexible hinge to ligand

_binding domain (LBD) (Figure 1-1) [3]. The binding of the ligand to a nuclear receptor results in a conformational change in the receptor, which in turn , activate the receptor to bind to a specific regulatory element within the promoter of target genes to up- regulate/ down-regulate the expression of these genes [4].

A unique property of NR is their ability to directly manipulate the expression of genes that play a crucial role in all aspects of development, metabolism and reproduction, which explain why the molecular target of about 13% of all FDA-approved drugs are NR and used for treatment of various diseases, including metabolic syndrome, inflammation and cancer [5-7]. As Ligand activated transcriptional factors, The NRs are potentially attractive pharmaceutical targets [8]

1-2 Farnesoid X receptor (FXR) is a nuclear receptor:

FXR is an adopted member of the metabolic nuclear receptor subfamily. Initially, FXR was named on the basis that farnesol metabolites are legends for this receptor.

Subsequently, in 1999, studies revealed that bile acids such as CDCA and cholic acid are the endogenous legends for this receptor [9]. FXR is predominantly expressed in the liver, intestine and kidney; it is also expressed in the adrenal gland, pancreases and reproductive tissues in a lower Level [9]. There are four isoforms of FXR in human and mouse (FXR alpha 1-4) due to difference splicing between exon 5 and exon 6 [10]. The primary physiological role of FXR is to function as a bile acid biosensor in the enterohepatic tissues [10].

1-2-1 FXR ligands:

Chendoxy cholic acid (CDCA) is the most potent endogenous ligands for the FXR, but to a lower extent, DCA and LCA also activate FXR [11-13]. However, bile acids are not specific agonist for the FXR because they also can also activate multiple nuclear receptors such as PXR, CAR, TGR5 and vitamin D receptor in addition to FXR [11-13].

The reality that bile acid binding to several nuclear receptors highlights the importance of providing of specific FXR agonist such as GW4064 and Fexaramine (synthetic agonist) and 6E-CDCA (semi- synthetic agonist) which act as a tool to analyze FXR specific transcriptional signaling [10].

1-2-2 FXR DNA binding motifs:

All NRs form obligate heterodimers with Retinoid X receptor (RXR) to regulate the expression of their target genes upon Ligand activation. Then the FXR/RXR heterodimer binds to DNA sequences called FXR response element (FXREs) on the promoter region of target genes [11-13]. The FXREs contain two copies of a six nucleotide sequence (AGGTCA or closely related sequences) arrange as inverted repeats separated by single nucleotide (also called IR1). On the other hand, other inverse repeats have been reported such as IR0, IR8, ER8 or DR1 but FXR/RXR heterodimer bind to IR1 motif with high affinity [11-13].

Further works have shown that active FXR also promote the transcriptional repression of number genes indirectly through the regulation of SHP gene [14-15]. Recent advances in the investigation of other biological roles of FXR because FXR binding site were detected close to genes that are not only implicated in lipid, fatty acid and steroid

metabolism but also other genes controlling transport, kinase signaling and glycolysis

[10].

1-2-3 Function of FXR:

FXR deficient mice, synthetic ligands and gene profile analysis have been greatly aided in the studying the biological role of FXR (Figure 1-2) [11-13].

Number of studies revealed implication of FXR in regulation of genes involved in various biological pathways, including metabolism, liver regeneration, antitherosclerosis, tumor suppressor, repression of intestinal bacteria overgrowth and protection from hepatotoxic agent [16] ,[17].

Figure 1-2 FXR regulate a large number of target genes involved in bile acid, lipoprotein and glucose metabolism. FXR binds to DNA either as a hetrodimer with RXR or as a monomer to regulate the expression of various genes (Adapted from Wang, 2008).

1-2-4 Role of FXR in bile acid metabolism:

Bile acids act as a detergent to facilitate the digestion and subsequent absorption of dietary fats and cholesterol in the small intestine. Furthermore, catabolism of cholesterol to form bile acids is the principle mean of elimination of cholesterol from the body [4].

Bile acids are synthesized mainly by the hepatocytes by oxidation of cholesterol via the

CYP7A1[18]. FXR regulates BA homeostasis by modulating the transcription of key genes involved in BA synthesis, conjunction, secretion and uptake [14, 17].

When the levels of hepatic bile acids are high, FXR induces SHP (small heterodimer partner) which inhibits the expression of cholesterol 7-alpha hydroxylase (CYP7A1), the rate limiting enzyme in the bile acid biosynthesis. In addition, FXR down regulates the expression of bile acid salts importers such as NTCP (Na- taurocholate Co transporting polypeptide), thereby it blocks the entry of intestinal bile acid into the hepatocytes .

FXR also regulates the outflow of bile acids from the liver by inducing the transcription of bile salt export pump (BESP) and multi drug resistance protein (MDR2), by this mean, increasing the export of bile acid into the bile duct and secretion of bile acids into the gall bladder [19-21]. Several studies proposed that FXR as a drug target might be used to treat the cholestatic liver injuries by preventing gall stone formation that is occurring via induction of bile acid transporters BESP and MDR2 [13, 21].

1-2-5 FXR and lipid metabolism:

Previous clinical studies suggested a role of bile acid in the regulation of fatty acid, triglycerides and lipoprotein metabolism. Consistent with these finding, FXR null mice show marked hypercholestermia and hypertriglyceridia [22-23], suggesting a role of

FXR in the regulation of target genes involved in lipid metabolism, and is considered a potential pharmacological targets for metabolic syndrome.

1-2-6 FXR and cholesterol metabolism:

Cholesterol homeostasis is maintained by nutritional intake, intestinal absorption, de novo synthesis, catabolism, reverse cholesterol transport and excretion into the bile [24].

FXR plays a central role in the cholesterol homeostasis. This is occurring via regulating genes that are involved in each of the following processes:

1-2-6-1 FXR and the cholesterol absorption:

FXR up regulate ABCG8 and ABCG5, resulting in re-secretion of absorbed cholesterol into the intestinal lumen, and this effect is associated with decreased intestinal cholesterol absorption [23].

1-2-6-2 FXR and de novo cholesterol synthesis:

FXR induces hepatic HMGCOA reductase expression, a rate controlling enzyme, in the biosynthesis of cholesterol [25]. Several studies have shown that ligand activation of

FXR reduces the plasma cholesterol level [26-27].

1-2-6-3 FXR and reverse cholesterol transport:

FXR induces the expression of the hepatic scavenger receptor B1 (SR-B1), resulting in increasing HDL-C uptake by the liver and peripheral tissues and low plasma levels of

HDL-C [25]. However, FXR highly represses human APO lipoprotein A1 (APOA-1)

expression, a major protein component of HDL, consequently; concerns have been raised about the therapeutic value of the FXR agonist in lowering plasma cholesterol level [28]. Several studies have shown that activation of FXR by 6-ECDCA and

GW4064 in the different hypercholestermic mouse models (APOE-/- , ob/ob, db/db) reduces HDL-C plasma level [16, 29-31]. This is consistent with the finding that plasma

HDL-C was increased in FXR-/- mice [28] [23].

1-2-7 FXR and triglyceride metabolism:

Clinical studies have shown an inverse relationship between the bile acid pool and triglyceride concentration. The function of hepatic FXR in regulating triglycerides is complex and targeted different molecular mechanisms [10].

Activation of FXR by treatment with FXR agonist resulted in the repression in hepatic

SREBP-1C, a key lipogeneic activator and induction of PPAR alpha, which stimulate fatty acid B- oxidation [11-13]. In addition, FXR also increases lipoprotein lipase (LPL) activity indirectly and induces VLDL receptor expression that promotes plasma TG clearance [10]. Other studies revealed that FXR activation could also reduce MTP expression, which takes on central function in the synthesis and secretion of VLDL- TG

[32].

1-2-8 FXR and glucose metabolism:

Activation of FXR by treatment with an agonist such as GW4064 repressed hepatic gluconeogenic genes, including G6PC (glucose-6- phosphatase) and PEPCK resulting

in increasing of hepatic glycogen synthesis in diabetic mice. This suggests that FXR activation improves glucose tolerance and insulin sensitivity in diabetic mice [30].

1-3 Cholesterol homeostasis:

Cholesterol is a fundamental structural component of vertebrate cell membranes and is required to maintain membrane permeability and fluidity [33].

In addition, cholesterol as well serves as a precursor for the biosynthesis of bile salt, steroid hormones and vitamins [34]. However, accumulation of excessive cholesterol

(Hypercholestermia) is toxic to the cells and associated with atherosclerosis, which is the major reason of death in western society, accordingly it is crucial to regulate the cholesterol level in the body. Cholesterol homeostasis are tightly regulated by uptake, biosynthesis, metabolism, transport and billiard excretion [35].

1-3-1 cholesterol synthesis

Cholesterol is synthesized from its precursor acetyl-coA through a complex metabolic pathway (Figure 1-3). HMG-COA reeducates is the rate limiting enzyme in cholesterol synthesis [36], inhibitors of HMG-CO reeducates (Statin) have been used widely to lower cholesterol synthesis since late 1980 [37] . Simply due to inefficiency and highly adverse effect, it is important to find novel drugs targeting cholesterol at different stages.

Figure 1-3. Major steps of cholesterol biosynthesis (adapted from Durrington PN, 2007).

The de novo cholesterol synthesis is tightly regulated by the sterol regulatory binding protein (SREBP2), the biosensor of intracellular concentration of free cholesterol in hepatic cells [38]. The inactive SREBP2 is located in the endoplasmic reticulum. When the cholesterol is low in the cell, SREBP-2 is activated to water soluble, which is translocated to the nucleus. These activated SREBPs bind to specific sterol regulatory element DNA sequences to induce the expression of enzymes involved in the cholesterol biosynthesis [39].

1-3-2 cholesterol absorption and transport:

Cholesterol is a hydrophobic molecule, so it is not soluble in the hydrophilic environment of the bloodstream. Cholesterol is carried through the bloodstream as lipoproteins.

Lipoproteins are classified according to their molecular size, in order of largest to the smallest into: chylomicrons, VLDL, IDL, LDL and HDL. After dietary cholesterol is absorbed in the small intestine, it is assembled with TG into the chylomicrons. As the chylomicron move through circulation, some of TG are hydrolyzed by lipoprotein lipase, and the chylomicrons’ remnants are then taken up by the liver (Figure 1-4).

VLDL particles are made by the liver and contain excess TG and cholesterol, which are not used for bile acid synthesis. As VLDL transport through the blood, the blood vessels absorb some of the TG to form IDL molecules, which now contain more cholesterol.

Then IDL molecule transport through the blood stream and continue losing their TG content until they form LDL molecules, which have the highest percentage of cholesterol than other lipoproteins. Thus, they are the primary carriers of cholesterol in the body.

The major route by which LDL lipoproteins are cleared from blood circulation is by LDLR receptor pathway. After their binding to the LDL receptor (LDLR) through APOB100, both LDL and their receptors are internalized by endocytosis to form a vesicle within the cell. Then these vesicles fuse with a lysosome for degradation. The APO B is hydrolyzed to its component amino acids while the cholesterol ester is hydrolyzed to free cholesterol. Meanwhile, the LDL receptor is recycled back to the cell surface. Now, and within the cell, the cholesterol can either be used for membrane biosynthesis or stored in the cell [127].

Figure 1-4 an outline of the major metabolic pathways of the major lipoproteins (adapted from

Durrington, 2007).

1-3-3 Role of High-density lipoprotein (HDL) in cholesterol homeostasis

HDL is the second major cholesterol carrier in the blood after LDL. HDL is a heterogeneous population of lipoprotein particles, which composed from a different protein and lipids. ApoA-1 is the most common and most abundant protein in all serum

HDL particles [40]. Epidemiological evidence indicated that HDL served as anti- atherogenic and the reduction in HDL level in plasma is correlated with increasing susceptibility to atherosclerotic CVD. The cardioprotective effect of HDL primarily results from its biological role in removing excessive cholesterol from the peripheral

tissues, including macrophage in arterial vessels, back to the liver for eventual excretion from the body in a process called reverse cholesterol transport (RCT). Furthermore,

HDL also protects against CVD secondary by inhibition of inflammation, oxidation stress, infection, thrombosis and plaque rupture [41-42].

1-3-4 HDL and reverse cholesterol transport:

RCT is the process by which excess cholesterol in extra hepatic tissues is transported back to the liver for excretion as bile. Cholesterol is not catabolized in peripheral cells, thus HDL formation is the only route by which cholesterol can be transported back to the liver, where it is converted to bile acid and subsequently secreted in the intestinal lumen for fecal excretion. The major steps in RCT include: acquiring of free cholesterol and phospholipids from hepatic ABCA1 by the lipid poor ApoA-1 to generate nascent

HDL particles (Figure 1-5)[43]. The nascent HDL particles acquire free cholesterol from the peripheral tissues mediated by extra hepatic ABCA1. Then the free cholesterol carried by HDL is esterified by the plasma enzyme cholesterol acetyl transferees

(LCAT). The nascent HDL recruits different protein components to generate the mature

HDL [44]. Meanwhile, CETP transfers equimolar of cholesterol esters from HDL to

APOB containing lipoprotein (VLDL/LDL) in exchange for TG. The cholesterol esters carried by VLDL /LDL are then delivered back to the liver via LDLR (indirect RCT). The phospholipids and TG carried by HDL are hydrolyzed by endothelial lipase (EL) and hepatic lipase (HL) respectively, while the cholesterol esters in HDL are removed from the circulation when ApoA-1/HDL binds to scavenger receptor class B -type 1 (SR-B1)

located on the Hepatocytes. The cholesterol esters are then converted either into free cholesterol or bile acids [43-44].

1-3-5 The anti-inflammatory and anti-oxidant activity of HDL:

High-density lipoprotein (HDL) and APO lipoprotein AI (ApoA-I) protect against the development of atherosclerotic cardiovascular disease, because of their role in promoting cholesterol efflux and reverse cholesterol transport. However, HDL has been also demonstrated multiple other beneficial effects on inflammation, oxidation stress, platelet function, thrombolytic balance and endothelial function that inhibit atherogenosis

[45]. HDL and ApoA-I exhibit anti-inflammatory effect which is mediated by inhibition the expression of adhesion molecules in endothelial cells, including the vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), and E- selectin. As a result HDL reduces the recruitment of blood monocytes- macrophages into the artery wall and inhibits atherogenosis [46].

The anti-oxidant property of HDL is promoted by the inhibition of the oxidation of LDL with subsequent reduction in its uptake by scavenger receptors expressed on smooth muscles and macrophages localized within the vascular wall, resulting in prevention of progressive accumulation of lipids within blood vessels and generation of fatty streak

[45] [47].

1-4 ABCA1-mediated the regulation of cholesterol efflux:

ABCA1 is a 2261- amino acid integral membrane protein that is belonging to the ABC transporters super-family, which uses ATP as a source of energy to pump a variety of substrates unidirectional across the membrane bilayer. ABCA1 mediates the transfer of extra cholesterol and phospholipids from cells to lipidate ApoA1 for nascent HDL particle formation during the earliest stage of RCT, promoting an efficient mean for cells for unloading excess toxic cholesterol. Mutation of human ABCA1 gene causes Tangier disease (TD); rare autosomal recessive disorder characterized by enlarged yellow- orange tonsils, skin xanthomas, and hepato (spleno) megaly. This disease is principally characterized by very low levels of HDL and ApoA-1 [48]. The physiological role of

ABCA1 has been determined by Tangier disease; the patients of TD are characterized by almost complete absence of HDL in the plasma and increased susceptibility to atherosclerotic CVD. Several studies proposed that human ABCA1 is a crucial factor in

HDL biogenesis, down reduction HDL level1 in mice resulted in reduction HDL level and cholesterol efflux [49-50]. In contrast, over expression of human ABCA1 has been reported to induce a plasma HDL level and protect against atherosclerosis [51].

1-4-1 ABCA1 and HDL biogenesis:

Hepatic ABCA1 mediates the initial efflux of cellular cholesterol and phospholipids to

Apo-A1 to generate pre- beta HDL (nascent HDL) [52-53]. Hepatic ABCA1 is the single most vital source for initial HDL biogenesis. Various studies have demonstrated that specific hepatic over expression of ABCA1 increases plasma HDL levels by two to three folds [54]. Further studies have revealed that liver-specific ABCA1- knockout mice

decreases the plasma HDL level by 80% [55]. Although hepatic ABCA1 is critical for the biogenesis of nascent HDL particles, the maturation of these early HDL particles occurs predominantly in extra hepatic tissues, which are achieved through the addition of more cholesterol from these tissues to the immature HDL via RCT process. These data suggested discrete and specific function of both hepatic and extra hepatic ABCA1 in the

HDL biogenesis [50].

ABCA1 and reverse cholesterol transport

ABCA1

ABCA1 Pre- HDL

ABCA1

ABCA1 Pre- HDL

Figure 1-5 ABCA1 and reverse cholesterol transport (modified from van der Velde and Groen, JCI,

2005)

1-4-2 Mechanism of ABCA1 mediated-cholesterol efflux:

ABCA1 is comprised of two halves of similar structure, each half has 6 transmembrane domains and two large extracellular domains [56]. The two domains are connected together through intermolecular disulfide bonds [57]. The mechanism through which

ABCA1 mediated cholesterol and phospholipids’ efflux is not fully agreed [58]. Early studies proposed that ABCA1 binds directly to lipid –free ApoA-1 lipoprotein, the binding of ApoA-1 by ABCA1 leads to the translocation of membrane cholesterol and phospholipids from the cytosolic leaflet to the exofacial leaflet of the plasma membrane, resulting in induction of membrane strain and subsequent bending, which lead to the formation of highly curved exovesiculated domain to which ApoA-1 binds with high affinity [58-59]. The next step is the formation of discoidal HDL particles as a result from spontaneous solubilization of membrane PL and cholesterol by the bound ApoA-1 [60].

Recently, a different model for the biogenesis of HDL particles by ABCA1 was revealed by Nagata (Figure 1-6). Nagata suggested that ABCA1 diffuses freely and translocates lipids on the plasma membrane by an ATP- dependent mechanism. After ABCA1 reserves sufficient lipid, it undergoes a conformational changed to form immobilized dimers interacted with the actin cytoskeleton in the plasma membrane. In the following step, lipid-free apoa1 binds directly to the extracellular domain of lapidated ABCA1 dimers followed by transferring of cholesterol and PL to lipid-free ApoA-1 that lead to the formation of discoidal HDL and dissociation of ABCA1 dimers into monomers to resume its function in collecting lipids [56].

Figure 1-6: HDL formation by ABCA1.

1-4-3 Sub-cellular localization of ABCA1:

ABCA1 localizes mainly to both the plasma membrane and in intracellular compartments within a cell [45, 53, 61-63]. The plasma membrane and endosomes are the major pool of cellular cholesterol [45] . Although ABCA1 mediating lipid efflux, mainly at cell membrane, several studies proposed that 20% of newly synthesized

ApoA-1 is lapidated intracellularly by ABCA1 before secretion from the cell, which highlighting the important role of intracellular cholesterol efflux mediated by ABCA1 [64] , it is proposed that cholesterol pools in late endosomes, and lysosomes are preferential sources of lipids in ABCA1- mediated cholesterol efflux [61, 65-66].The trafficking of ABCA1 and ApoA-1 to late endosomes and lysosomes is responsible for a quantitative percentage of the total ABCA1 mediated lipid efflux. Suggesting that internalization of ABCA1 was necessary to effectively mobilize cholesterol derived from acetylated LDL in early endosomes, and lysosomes pools, where the cholesterol would

be expected to be abundant [61, 65-66]. ABCA1 rapidly shuttles between the cell surface and intracellular compartments [62, 66]. Because ABCA1 localization is crucial for its function, its trafficking to specific intracellular and plasma membrane sites is gracefully controlled. The PEST (proline, glutamic acid, serine and threonine) sequence of ABCA1 (1283-13060) functions in ABCA1 internalization and trafficking to late endosome and lysosomes. Deletion of this sequence results in retaining of ABCA1 at the cell surface and impaired cholesterol efflux from late endosomal cholesterol pools

[63]. Sub cellular localization of ABCA1 can also be regulated at the posttranslational level by the addition of a saturated fatty acid (palmitate) to selected cysteine residues (3,

-23, -1110, and -1111) of ABCA1. Mutation of these cysteines results in a decreasing of

ABCA1 localization at the plasma membranes and less lipid’s efflux lipids to ApoA-I [67-

68].

1-4-4 Regulation of ABCA1 transcription:

ABCA1 promotes cellular cholesterol efflux and maintain cellular sterol homeostasis, so its expression should be regulated tightly through different pathways at various points throughout the transcriptional process, including:

a) Pre-transcriptional regulation:

Recent study has demonstrated epigenetic DNA methylation within ABCA1 gene promoter is negatively correlated to plasma HDL-C concentration and associated with increased risk of coronary artery disease (CAD) [69].

b) Transcriptional regulation:

ABCA1 mediated cholesterol efflux is tightly regulated at the transcriptional level by nuclear receptors LXR whose ligands are sterol metabolites such as 22-(R)- hydroxycholesterol, 24-(S)-hydroxycholesterol, 27-hydroxycholesterol and 24-(S), 25- epoxycholesterol [70-71]. In peripheral cells, such as macrophages and ﬁbroblasts,

ABCA1 gene expression is increased by loading cholesterol [72]. This response result when cholesterol accumulates in cells, intracellular levels of oxysterols increase; subsequently, LXR stimulated by binding of these oxysterols, induce the expression of

ABCA1. Activation of LXR by a Ligand binding lead to formation of obligate dimer with

RXR and this interaction induces the expression of many target genes involved in different steps of RCT, including ABCA1 which increases the cholesterol efflux and decreases the inflammation, ApoE which mediates cholesterol efflux from macrophages[73], ABCG1 which promote cholesterol efflux and RCT, ABCG5 and

ABCG8 which mediates cholesterol excretions into the bile [74-78]. Therefore, LXR activation by Ligand binding induces multiple pathways that involved in the excretion of excess cholesterol from body and increase HDL biogenesis and thereby decreases inflammation and atherogenesis. There are two non steroidal LXR agonists have been found (T0901317 and GW3965) to increases HDL biogenesis and reduce atherosclerosis [79-80]. However, LXR activation can also induce the expression of fatty acid synthase (FAS) and sterol regulatory binding element protein -1c (SREBP-1C) and thus increases fatty acid biosynthesis and hypertriglycerdimia .

In addition, Ligand for RXR such as 9-cis-retinoic acid can also induce ABCA1 transcription [81-82]. However, RXR forms heterodimer not only with LXR but also with

other nuclear receptors that involved in other different metabolic processes[83]. In addition to LXR, PPAR/ RXR heterodimers also up regulate ABCA1 expression and other genes involved in RCT, including ApoA-1, ApoA-II, SR-B1 and LPL [84].

C) Post-translational regulation of ABCA1 activity:

ABCA1-mediated cholesterol efflux is also highly regulated at the post-translational level.

Because cholesterol is an essential component of cells, excessive elimination of cholesterol can result in cell death, therefore, the ability to rapidly degrade ABCA1 in order to prevent excessive elimination is a crucial. Due to its rapid turnover rate (a half- life of 1-2 hours), ABCA1 can also be regulated at the level of protein stability [85-89].

Indeed, several recent studies revealed that there is significant discordance between relative mRNA and protein expression patterns [90], this suggests that post translation modifications are important in regulating ABCA1 protein levels and function.

1- Regulation of ABCA1 degradation pathways:

In vitro studies have confirmed that ABCA1 is regulated post-translationally, largely through control of its rate of degradation. The degradation of ABCA1 is regulated and is carried out via several pathways:

a) Calpain mediated ABCA1 degradation

Calpain-mediated proteolytic degradation is one of the major regulatory mechanisms of physiological function of ABCA1 to mediate HDL biogenesis or assembly [86-87]. A calpain-specific cleavage site Pro-Glu-Ser-Tyr (PEST) sequence is identified in the

cytoplasmic loop of ABCA1 that is important in ABCA1 internalization and trafficking to late endosomes and lysosomes. Deletion of this sequence abolished the proteolysis by calpain and prevented apoa1 from stabilizing ABCA1 protein [87] . Several protein kinases, including protein kinase A (PKA), protein kinase C (PKC), Janus 2 (JAK2) and

Casein kinase (CK2) play an important role in the regulation of ABCA1 stability [91]. In macrophages and fibroblasts cholesterol loading induces ABCA1 expression and activates ApoA-I dependent efflux. Cyclic AMP upregulates ABCA1 in macrophages, independently of cellular sterol levels, which it does by activating protein kinase A that phosphorylates the NBDs of ABCA1, increasing its activity [92].

On the other hand, phosphorylation of two threonine residue within the cyroplasmic’s domain of ABCA1 PEST sequence (T1286 and T1305) targets calpain protease to increase ABCA1 protein degradation. However, apoA-I binding counters phosphorylation and calpain-mediated degradation, thus increasing the stability of

ABCA1 at the plasma membrane [91, 93]. In addition, Calmodulin is Ca – binding protein. It binds ABCA1 near the PEST sequence (1283- 1306), and this interaction protects targets calpain protease to increase ABCA1 protein degradation. However, apoA-I binding counters phosphorylation and Calpain-mediated degradation, thus increasing the stability of ABCA1 at the plasma membrane calpain mediated ABCA1 degradation and increases ABCA1 cholesterol efflux activity [94].

b) Ubiquitin– mediated ABCA1 degradation pathway:

ABCA1 degradation also occurs independently of Calpain – involving pathway. It has recently been revealed that ubiquiantion is also a associated with the lysosomal

degradation of ABCA1[95]. Ubiquiantion is a regulated, post-translationally modification that conjugates ubiquitin (Ub) to lysine residues of targeted proteins in order to control their intracellular fate [96]. Once ubiquintiated at its lysine residue , ABCA1 can be degraded either by ubiquitin-proteasome pathway or via ubiquitin-lysosomal degradation which occurs through the endosomal sorting complex required for transport

(ESCRT) pathway [95, 97].

2- Regulation of ABCA1 by microRNAs:

More recent studies demonstrated that ABCA1 is also regulated post transcriptionally by two microRNAs, miR-33a and miR-33b, derived from intronic regions of the sterol response- element-binding protein genes SREBP-2 and SREBP-1, respectively [98].

Recently, it has been also shown that miR-144 reduce hepatic ABCA1 expression.

Activation of FXR in the liver induces the expression of miR-144, resulting in ABCA1 suppression and reduced HDL plasma levels [99].

1-5 Transmembrane protein 141 (Tmem141) and cholesterol homeostasis:

Tmem141 is a protein that, in humans, is encoded by the TMEM141 gene. TMEM141 gene belongs to the large family of genes encoding uncharacterized predicted transmembrane (TMEM) proteins. Tmem141 has not yet been reported in any study to date, the physiological role of Tmem141 remains largely unknown, in the present study, we report that Tmem141 is constitutively expressed in the brown adipose tissues, white adipose tissues and liver. The human TMEM141 gene is located on chromosome Chr9 q34.3 and encompasses five exons and four introns.) Bioinformatic’s prediction programs like TMHMM 2.0 and TMpred suggest that TMEM141 is a membrane protein that has an N-terminus inside and may contain two transmembrane domains.

Figure 1-7 Tmem141 NMR spectroscopy structure (adapted from Klammt, C 2012)

Two alternative TMEM141 transcripts 1 [NM_001040130.3] and 2 [NM_001109993.1], translating into two protein isoforms, 1 (NP_001035219.2) and 2 (NP_001103463.1),

have been proposed in mice: first contain 108 aa with 12 KDa MW, the second contains

77 aa with 9 KDa. Each transcript utilizes one of the two alternative exons, 1 and 2, which are spliced into mutually exclusive fashion. All positional information in this thesis refers to transcript 1 and isoform1 (Tmem141A).

Figure 1-8 Tmem141 isoforms in mice

Sequencing analysis revealed that TMEM141 is conserved in human, chimpanzee, rhesus monkey, dog, chicken, mouse, rat and zebra fish indicating that it may have important functions in vertebrates. The alignment of TMEM141 sequences from various eukaryotic organisms showed that TMEM141 is highly evolutionarily conserved.Other members of the gene family have been localized in different cellular organelles and have different physiological functions (Table 1-1)

TABLE 1- 1 Transmembrane proteins family (TMEM):

Protein Sub cellular Physiological function REF name localization # Tmem192 Lysosomes/ TMEM192 is important for tumor cell growth and [100] late endosomes proliferation. Tmem106B Lysosomes/ Controlling dendritic trafficking of lysosomes, the [101] Late risk factor in FTLD (Frontotemporal Lobar endosomes Degeneration). Tmem106A PM and Suppresses gastric cancer growth by inducing [102] Mitochondria Apoptosis Tmem147 ER TMEM147 is a novel core component of the [103] Nicalin-NOMO complex Tmem174 ER Activates AP-1 and promotes cell proliferation [104]

Tmem214 ER Essential for ER stress-induced apoptosis [105]

Tmem74 Lysosome Regulates and autophagy [106] autophagosome Tmem237 Ciliary Important for ciliogenesis [107] Transition zone Tmem14A Mitochondria Inhibits apoptosis [108] Tmem59 Golgi It modulates complex clycosylation, cell surface expression, and secretion of the Amyloid [109] Precursor Protein

Tmem70 Mitochondria Ancillary factor of mammalian ATP synthase [110- 111]

Tmem126A Mitochondria It encodes a mitochondrial IM-associatedcristae [112] Protein

Chapter Two: Materials and methods

2-1 Mice, Diets and Ligands:

C57BL/6 mice, ob/ob mice, db/db mice, and FXR-/- mice were purchased from the

Jackson Laboratories (Bar Harbor, Maine, USA). All mice were fed a standard chow.

ApoE-/- and LDLR-/- mice were purchased from the Jackson Laboratories (Bar Harbor,

Maine, USA), and were fed Western diets [40% kcal from fat, 1.25% cholesterol (wt/wt) which was purchased from Research Diets (New Brunswick, NJ). Specific FXR agonists

GW4064 [113] (30 mg/kg, twice a day) and OCA (INT-747) [114] (30 mg/kg/d) were administered by gavages. Unless otherwise stated, male mice were used and all mice were fasted for 5-6 h prior to euthanization. All the animal studies have been approved by the Institutional Animal Care and Use Committee at Northeast Ohio Medical

University.

2-2 Adenovirus:

Ad-Tmem141 was constructed by cloning mouse Tmem141 cDNA was transferred into the pAd/CMV/V5-DEST vector (Invitrogen) using the Gateway LR Clonase II enzyme mix according to the manufacturer's instructions (Invitrogen). After ligation reaction, we transformed 4 μl of ligation reaction into One-Shot TOP10 chemically competent Escherichia coli (Invitrogen). The correct recombinant adenoviral DNA was

isolated from the TOP10 E. coli by using Quick Plasmid Miniprep Kits (Invitrogen) and

2mg of recombinant adenoviral DNA was transfected into 293A cells (Invitrogen) using

Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's directions. The

293A cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate (Invitrogen) in a 37 °C incubator with 5% CO2. Plaque generation was typically visible in 5–7 days post-transfection. Cells and media were collected and subjected to three freeze/thaw cycles. The cell debris was pelleted at

3000 rpm for 10 minutes. To generate adenovirus expressing small hairpin RNA against

Tmem141, oligonucleotides were designed using BLOCK-iT™ RNAi Designer

(Invitrogen, CA), annealed, and ligated to pEnter/U6 vector (Invitrogen, CA). Adenovirus was then generated as described previously. Three different shRNA oligonucleotides against murine Tmem141 were designed. One of the three Ad-shTmem141 adenenoviruses was highly effective in knocking down endogenous Tmem141 expression in cultured cells was applied for subsequent works.

All generated adenoviruses were amplified in 293A cells and purified by cesium chloride gradient centrifugation. About 1.5x109 plaque formation units (pfu) of adenoviruses were infected into each mouse intravenously. Unless otherwise stated, 7 days post infection; mice were fasted for 5-6 h and then euthanized.

2-3 Real-Time PCR:

RNA was isolated using TRIzol Reagent (Invitrogen, CA). mRNA levels were determined by quantitative reverse-transcription polymerase chain reaction (qRT-PCR)

on a 7500 real-time PCR machine from Applied Biosystems (Foster City, CA) by using

SYBR Green Supermix (Roche, Indianapolis, IN). The results were calculated using CT values and normalized to 36B4 mRNA level.

2-4 Western Blot Assay:

Western blot assays were performed using whole lysates of the liver or cells’ samples.

Samples were then centrifuged at 12000 g for 30 mins at 4ºC to pellet nucleic acids.

The sample protein concentration was quantified using Thermo Scientific Pierce BCA

Protein Assay Kit. Samples to be used for Tmem141A and apoA1 analysis were boiled for 10 min at 100ºC. Samples used for ABCA1 analysis were not boiled, according to the antibody manufacturer’s guidelines (Novus). 25-50 micrograms of proteins were separated by a (6-12) % SDS-PAGE under reducing conditions and transferred to

PVDF membrane. Immunoblotting was performed according to standard protocols using polyclonal Tmem141A antibody was purchased from ProteinTech (Catalog no. 16092-1-

AP). β-actin antibody was from Novus Biologicals (CO), ABCA1 antibody from Novus

(Catalog no. NB400-105) and ApoA-I antibody was from Biodesign (Maine).

2-5 Reporter Plasmids:

Fragments of the mouse Tmem141A promoter/ regulatory regions were amplified by

PCR and inserted into the Hind3 and XhoI sites of pGL3-Basic (Promega). The

Tmem141A DNA fragments were named by designating the 5_- and 3_-ends of each fragment relative to the transcription start site. A mutation of the FXR response element

(FXRE) at -1591 and -1593 bp was introduced into the -1600 bp Tmem141A reporter

plasmid using the PCR. Structures of reporter plasmids were confirmed by nucleotide sequence analysis.

2-6 Transient Transfection:

HepG2 cells were plated in a 24-well plate and cultured in DMEM containing 10% FBS and transfected with 4μg of the -2300 to -80 bp Tmem141A reporter plasmids. Transient transfections were performed in triplicate. Briefly, pGL3-Tmem141A luciferase reporter constructs were transfected into HepG2 cells together with plasmids expressing FXR or

RXR, followed by treatment with either vehicle or GW4064 (1 μM). After 36 h, luciferase activities were determined and normalized to β-galactosidase activity. Luciferase assay reagent was obtained from Promega.

2-7 Lipid and Lipoprotein Analysis:

Approximately 100 mg liver was homogenized in methanol, and lipids were extracted in chloroform/methanol (2:1 v/v) as described [115]. Hepatic triglyceride and cholesterol levels were then quantified using Infinity reagents (Thermo Scientific (Waltham, MA).

Plasma lipid and glucose levels were also determined using Infinity reagents (Thermo

Scientific (Waltham, MA). The plasma lipoprotein profile was analyzed by FPLC as described [116]. Briefly, after 100 µl plasma was injected, lipoproteins were run at 0.5 ml/min in a buffer containing 0.15 M NaCl, 0.01 M Na2HPO4, 0.1 mM EDTA, pH 7.5, and separated on a Superose 6 10/300 GL column (GE Healthcare) by using BioLogic

DuoFlow Quad Tec 10 System (Bio-Rad, CA). 500 µl of sample per fraction was collected.

2-8 VLDL Secretion:

C57BL/6J mice were injected intravenously with specific adenoviruses. On day 6, these mice were fasted overnight, followed by intravenous injection of Tyloxapol (500 mg/kg).

Blood was taken at indicated time points and plasma TG levels determined. The VLDL secretion rate was determined as described [116].

2-9 Co-immunoprecipitation:

A Co – immunoprecipitation assay was used to test the physical interaction of

Tmem141A with ABCA1 in mice over-expressed Tmem141A in the liver. The NP-40

Lysis Buffer (1% NP-40, 150 mM NaCl, 2 mM EDTA, 50 mM Tris–HCl, pH 7.0, protease inhibitor cocktail) was used to extract the total protein. Lysates were centrifuged to get rid of debris (30 minute, 12,000 Xg, 40C). The supernatants were transferred to fresh

1.5 ml Eppendorf tube. Tmem141A proteins (1000 μg) were incubated with Tmem141A antibody (4ug) overnight at 40C followed by incubation for 3 h with Protein A- sephoarase beads (GE Healthcare PA). Rabbit IgG was used as a negative control.

Precipitates were washed three times with PBS and Immunocomplexes were then resolved by SDS-PAGE and immunoblotted with the indicated antibodies.

2-10 Immunoflourascence:

TMEM141A cDNA was amplified by PCR and subcloned into the EcoRI and HindIII restriction sites of p3XFLAG-CMV™-14 Expression Vector (Sigma-Aldrich). Resulting plasmid TMEM141A-CMV-3XFLAG were propagated in Escherichia coli, isolated and fully sequenced before transfection.

CHO Cells grown on cover slips were fixed in 4% (w/v) Para formaldehyde in PBS for

10 min at room temperature. Cells were permeabilised for 5 min by adding 0.2% 100-

Triton. Nonspecific binding sites were blocked by incubation in 3% horse serum in PBS that was also used as antibody diluents. Primary antibodies used included anti- Flag monoclonal-M2- AB (Sigma-Aldrich), anti-LAMP-2, anti-Calnexin (Novus). After extensive washing with PBS, fluorochrome-conjugated secondary antibodies were applied, goat anti-mouse FITC for Tmem141A, goat anti-Rabbit IgG Alexa flour for

LAMP-2, Calnexin. Nuclei were stained blue with DAPI. The cover slips were mounted, and viewed with a confocal microscope (Olympus).

2-11 Cholesterol Efflux in RAW-264.7 macrophages:

RAW-264.7 macrophages were plated in 24 well plate (50% confluence) using fresh

DMEM containing 0.2% Bovine Serum Albumin (BSA) and infected with either an Ad- shLacZ, or Ad-shTmem141A for 24 h prior loading with 1 μCi/ml 3H-cholesterol

(PerkinElmer) and acetylated LDL (50 μg/ml) (Biomedical Technologies, MA) for 24.

Then, the cells were washed twice with PBS and incubated with 1 ml of fresh media

(DMEM) containing 0.2% BSA for 4 hours. For efflux measurement, we washed the cells with PBS, then incubate cells with 1ml fresh media (DMEM) containing 0.2% BSA in the presence of apoAI (15 μl/ml) (AlfaAesar) as cholesterol acceptor for 24 hours. For efflux measurement, we transferred the RAW-264.7 cells media supernatant to scintillation vial containing 3ml of scintillation fluid and shake well. Count [3H] in the scintillation counter (Beckman). For total cellular radioactivity measurement, RAW-264.7 cells were dissolved and extracted by 0.1 M NaOH solution and transferred to a

scintillation vial and count [3H] as described previously. The cholesterol efflux study was done by incubating the cells with or without 10 μM LXR Ligand (T091317).

2-12 Isolation Primary Hepatocytes:

Mouse primary hepatocytes were isolated and cultured from previously infected mice with Ad-shLacZ or Ad-shTmem141A for 5 days as described [117]. The primary hepatocytes were plated in 12-well plate for 5 hours prior, and loaded with 1 μCi/ml 3H- cholesterol and acetylated LDL (50 μg/ml). After 24 hours, the cells were washed twice with PBS and incubated with 2 ml of fresh media (DMEM) containing 0.2% BSA for 4 hours. For efflux measurement, we washed the cells with PBS, then incubate cells with

2ml fresh media (DMEM) containing 0.2% BSA in the presence of ApoA-I (15 μl/ml) as cholesterol acceptor for 8 hours. Cholesterol efflux was measured by transferring the supernatant of Primary Hepatocytes cells media to a scintillation vial containing 3ml of scintillation fluid and shook well. Count [3H] in a scintillation counter (Beckman). For total cellular radioactivity measurement, Primary Hepatocytes cells were dissolved and extracted by 0.1 M NaOH solution and transferred to a scintillation vial and count [3H] as described previously. The Cholesterol efflux study was performed by treating the cells with or without 10 μM LXR Ligand (T091317).

2-13 Statistical Analysis:

Data were analyzed using Graphpad Prism 5.0. Groups were compared using two tailed non paired t tests. Data are expressed as the mean ± standard error of the mean and were considered significant at * P<0.05, ** P<0.01, *** P<0.001 vs. control group.

Chapter Three: Results

3-1 Tmem141 expression is induced by synthetic FXR agonist GW4064 in wild- type but not FXR-deficient mice:

FXR functions as a transcription factor regulating the transcription of numerous genes involved in bile acid homeostasis, lipoprotein and glucose metabolism. The microarray data from our laboratory suggest that activation of the nuclear receptor farnesoid X receptor (FXR) may induce hepatic Tmem141 expression. C57BL/6 wild-type mice were treated with specific synthetic FXR agonist GW4064; the results suggest that FXR agonist dramatically stimulated the expression of total Tmem141, Tmem141A and

Tmem141B at mRNA level (Figure 3-1 A, B, C). In contrast, both the hepatic Tmem141 isoforms were significantly reduced at mRNA level in FXR-/- mice. Treatment with

GW4064 also induced the increase of hepatic Tmem141 protein level (D, E) in WT mice, but not in FXR-/- mice. These results and consistent with the microarray data suggest that Tmem141 is a novel FXR target gene.

A B C

Tmem141(Total) Tmem141A Tmem141B 6 6 2.0 Vehicle * Vehicle * Vehicle GW4064 GW4064 *** GW4064 1.5 4 4 1.0 2 2 0.5 *** *** * 0 0.0 Relative mRNA expression mRNA Relative 0

 expression mRNA Relative Relative mRNA expression mRNA Relative WT Fxr WT Fxr  WT Fxr 

D E  WT Fxr 6 Vehicle GW-4064 Vehicle GW-4064 * Vehicle 4 GW4064 Tmem141

protein 2 β-actin ***

Relative Tmem141 Relative 0 WT Fxr 

Figure 3-1 Tmem141 expression is induced by GW4064 in wild-type but not FXR-deficient mice (A-

D) C57BL/6 mice were gavaged with vehicle (0.5% CMC [carboxyl methyl cellulose]) or GW4064 (30 mg/kg, twice a day) for 7 days (n 5-8 mice per group). Hepatic mRNA levels were quantified by qRT-PCR.

(A): total Tmem141, (B): Tmem141A, (C): Tmem141B. Hepatic protein levels were determined by western blot assays (D) (n=3 mice per group) and then quantified by normalization to β- actin by using image J (E).

* P<0.05, ** P<0.01, *** P<0.001 vs. Vehicle.

3-2 Hepatic Tmem141 expression is induced by the synthetic FXR agonist INT-747 in wild-type but not FXR-deficient mice:

In addition to GW4064, both hepatic Tmem141 mRNA isoforms were also induced in

WT mice but not in FXR-/- mice by treatment with obeticholic acid (OCA, INT-747)

(Figure 3-2 A, B, C), another potent and selective FXR agonist. In contrast, both the hepatic Tmem141 isoforms were significantly reduced at mRNA level in FXR-/- mice.

INT-747 treatment also highly induced hepatic TMEM141 protein levels (Figure 3-1 D,

E). Taken together, these results suggest that FXR agonists modulate the expression of both Tmem141 isoforms (Tmem141A and Tmem141B) in mouse liver in vivo.

A B C

Tmem141(total) Tmem141A Tmem141B 8 *** Vehicle 15 15 Vehicle 6 Vehicle INT-747 INT-747 INT-747 10 *** ** 4 10

2 5 5 * *** 0 0 0 *  

Relative mRNA expression Relative WT Fxr WT Fxr WT Fxr 

Relative mRNA expression mRNA Relative Relative mRNA expression Relative

D E

 WT Fxr 2.5 Vehicle 2.0 *** INT-747 Vehicle INT-747 Vehicle INT-747 1.5 Tmem141 1.0 protein 0.5 β-actin 0.0

Relative Tmem141 Relative WT Fxr 

Figure 3-2: Tmem141 expression is induced by INT747 in wild-type but not FXR-deficient mice. (A-

D) C57BL/6 mice were gavaged with vehicle (0.5% CMC [carboxyl methyl cellulose]) or INT-747 (OCA,

30 mg/kg/d) for 7 days (n=7 mice per group). Hepatic mRNA levels were quantified by qRT-PCR. (A): total Tmem141, (B): Tmem141A, (C): Tmem141B. Hepatic protein levels were determined by western blot assays (D) (n=3 mice per group) and then quantified by normalization to β- actin by using image J (E). *

P<0.05, ** P<0.01, *** P<0.001 vs. Vehicle.

3-3 Identification the FXR response element in the Tmem141 gene:

To understand the mechanism by which FXR regulates Tmem141 expression, we investigated Tmem141 promoter activity using pGL3 promoter-reporter constructs.

Hepatocytes were transfected with a series of DNA constructs containing a series

5’_deletions of the mouse Tmem141 promoter linked to the luciferase gene (Figure 3-3,

B). As shown in (Figure 3-3 A), GW4064 treatment highly induced Tmem141 promoter activity when longer promoter-reporter constructs were used (-2.3 , -1.8 and -0.5 KB promoter); Further 5 ′ -deletion of the Tmem141 sequences to -360 and -168 bp, the promoter activity still induced by FXR agonist treatment (Figure 3-3 A). FXR is known to often bind to an IR-1 element to regulate gene transcription. In Tmem141 promoter, there is a candidate IR-1 element ((AGGTCACAAA) located in the context of the -158 to

-149 bp. The mutation was introduced to that IR-1 element (IR-1 (M AAATCACAAA)

(Figure 3-3 C). Unfortunately, the mutation was not sufficient to reduce the promoter activity. Further deletion of Tmem141 sequences to -120 and -80 bp didn’t suppress

GW4064 responsiveness (Figure 3-3 A). These data suggested another possible FXRE located 80 bp upstream of the transcriptional site. Sequence analysis of the region downstream 80 bp revealed the presence of a sequence (-50 to - 40bp) that resembled

an IR-1 (Figure 3-3 C). We have attempted to clone that putative small fragment, but unfortunately due to the difficulty in amplifying a very small fragment about 40 bp, we can't processed to identify the potential FXRE at Tmem141 promoter. Taken together these result shows that the FXR response element is located within 80 bp upstream of the Tmem141 transcription start site.

A B +36 3 # # -2300 LUC # # # * # -1800 LUC 2 *

-500 LUC (folds) activity 1 -360 LUC

-168 LUC Relative Lusiferase 0 -168 mut LUC

-120 LUC -2.3 K -1.8 K -0.5 K Control -0.12 K- 0.08 K -0.368 K-0.168 K -80 LUC -0.168 K mut -168 promotor

C IR-1 #1 CCTGGTTCGAGGTCACAAAACCCCCAATTTCAACTGCTCTGTCACGCCCATCAGAAGCT CGCGGTTATAGGTCCCGCCCCCTAAGCCGGACAGAGCTTGACTGTCTCTGCTACGTTC TGCGTTCTGCGCAGGCCCGAGTCTTGAGCCCCGCCCCGCCCCCCAAGTCCTCCCTGG IR-1 #2

-168 mut

CCTGGTTCGAAATCACAAAACCCCCAATTTCAACTGCTCTGTCACGCCCATCAGAAGCT CGCGGTTATAGGTCCCGCCCCCTAAGCCGGACAGAGCTTGACTGTCTCTGCTACGTTC TGCGTTCTGCGCAGGCCCGAGTCTTGAGCCCCGCCCCGCCCCCCAAGTCCTCCCTGG IR-1 #2

Figure 3-3: Identification of the FXRE in the Tmem141 gene. (A) Hepatocytes were transiently transfected with a series of plasmid constructs containing a series of 5’ _deletion (B) of the mouse

Tmem141 gene linked to the luciferase (Luc) gene as described under “Experimental Procedures.” (A)

After transfection, cells were treated with or without GW4064 for 24 h. Cells were harvested, extracts

were prepared, and luciferase assays were performed. The results are folds increased vs, control of three experiments. (B): The constructs used in these experiments, the number at the left of each construct is the 5_-end of TMEM141 DNA in nucleotides relative to the transcription initiation site. The 3’ end of each construct is +36 bp upstream the transcriptional site. (C), the sequence of the mouse Tmem141 gene -

168 bp downstream the transcriptional site. The two candidates FXRE (IR-1) are indicated by red color 1

& 2. The sequence of a mutant (IR-1 #1) (168 Mut) is indicated underneath. Mutated sequences are in green. * P<0.05, # P<0.001 vs. Vehicle.

3-4 Knockdown of Hepatic Tmem141 markedly reduces Plasma Cholesterol:

FXR is known to play a key role in regulating lipid and glucose metabolism. Since our data shows that Tmem141 is a novel FXR target gene. we determined whether hepatic

Tmem141 is required for maintaining normal lipid or glucose homeostasis, we generated three adenoviruses expressing short hairpin RNA (shRNA) specifically against murine Tmem141 (Ad-shTmem141). One of the three Ad-shTmem141 adenenoviruses was highly efficient in knocking down endogenous Tmem141 expression in cultured cells, and was used for subsequent studies. Ad-shLacZ (control) or Ad-shtmem141A was intravenously injected into C57BL/ 6 mice. Remarkably, hepatic expression of Tmem141 shRNA reduced hepatic levels of Tmem141 mRNA (Figure 3-5

A) and protein (Figure 3-6) by 80%.

Surprisingly, Hepatic Tmem141 deficiency results in a markedly decrease in plasma total cholesterol (TC) levels by 8 fold (Figure 3-4 A), but caused no effect on plasma triglyceride (TG) (Figure 3.4 B) or glucose levels (Figure 3-4 C). We as well found that hepatic knockdown of Tmem141 has no effect on hepatic triglyceride or cholesterol levels (Figure 3-4 D and E) respectively. Analysis of plasma lipoproteins by fast protein liquid chromatography (FPLC) indicated that hepatic Tmem141 deficiency markedly

decreased plasma cholesterol levels in LDL fractions (50%) and cholesterol – HDL

(80 %) (Figure 3-4 F), but had no much effect on plasma triglyceride lipoprotein profile

(Figure 3-4 G). Together, the data above demonstrate that the reduction in plasma total cholesterol levels in Tmem141-deficient mice results from a marked reduction in plasma

HDL-C and LDL-C.

A Cholesterol B Triglycerides

150

60 100 40

(mg/dL) 50

(mg/dL) 20

Plasmacholesterol *** 0 0 Ad-ShLacZ Ad-shTmem141 PlasmaTriglycerides Ad-shLacZ Ad-shTmem141

C D

Glucose Hepatic Cholesterol

150 4 3 100

g/g) 2 

50 ( (mg/dL) 1

Plasma Glucose 0 0 Hepatic Cholesterol Hepatic Ad-shLacZ Ad-shTmem141 Ad-shLacZ Ad-shTmem141

Heplatic TG 10 8

g/g) 

( 4 2

Hepatic Triglycerides Hepatic 0 Ad-shLacZ Ad-shTmem141

Ad-shLacZ F Ad-shTmem141

40 HDL 30 20

g/Fraction) 10 LDL Cholesterol

 VLDL ( 0 12 15 18 21 24 27 30 33 G Fractions

15 Ad-shLacZ

VLDL Ad-shTmem141 10

g/Fraction) 5

LDL



( Triglycerides 0 12 15 18 21 24 27 30 33 36 Fractions

Figure: 3-4 Knockdown of Tmem141 in the liver highly reduces total plasma cholesterol level mainly in the HDL fraction. C57BL/6 mice were injected intravenously with (Ad-shLacZ) or (Ad- shTmem141) (n=6 mice per group). After 6 days, mice were fasted for 5 h prior to euthanization. Total cholesterol (TC) levels in the plasma (A) and liver (D), triglyceride level in plasma (B) and liver (E) were determined. Plasma Glucose level (C) was measured. Plasma cholesterol lipoprotein profile (F) and triglyceride lipoprotein profile (G) triglyceride lipoprotein profile (E) were determined by FPLC analysis.

* P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ.

3-5 Hepatic Tmem141 deficiency results in down-regulation of multiple genes involved in lipid metabolism:

To understand the mechanism by which hepatic Tmem141 deficiency results in a severe plasma cholesterol reduction, we analyzed hepatic gene expression by quantitative real-time PCR (QRT-PCR). The data in (Figure 3-5) shows that the mRNA levels of genes involved in cholesterol efflux (ABCA1, Apo-A1) reduced significantly by

3-fold and 1.5 -fold, respectively. Interestingly, SR-B1 and LDLR genes which involved in cholesterol uptake in the liver are also reduced. LCAT which involved in cholesterol esterification is significantly reduced in Tmem141A deficient mice. Remarkably, loss of hepatic Tmem141 resulted in a decrease in the levels of hepatic transcriptional factors

SREBP-1 and SREBP-2. Furthermore, hepatic genes involved in de novo cholesterol biosynthetic, including HMG-CoA reducatase (HMGCR) and CYp7A were not significantly different between the two groups. Therefore, de novo cholesterol biosynthesis has not been regarded as a quantitatively important contributor to the lowering effect of total plasma cholesterol in the Tmem141 deficient mice. ABCG5 and

ABCG8 that promote biliary excretion of sterols are not affected by loss of Tmem141 expression. Consistent with no changes in hepatic and plasma TG levels, Tmem141 deficiency has no effect on genes involved in TG metabolism, including (ACC1, ACC2) or VLDL secretion (MTP, ApoB). Finally, knockdown of Tmem141 in the liver has no consequence on the lysosomal protein NPC-1 and 2. Thus, the gene expression data which consistent with the plasma lipoprotein profile, indicating that hypocholesterolemia in Tmem141-deficient mice likely results from a defect in ABCA1 and ApoA1 expression, which are involved in HDL biogenesis.

Ad-shLacZ Ad-shTmem141 3

1 * * * * **

** ****** Relative mRNARelative

LRP MTP LDLR LCAT APOEApoB ACC1 NPC1NPC2 ABCA1ApoA1 SR-B1 ACAT1ACAT2 SREBP2 CYP7A1HMGCR ABCG5ABCG8 Tmem141 SREBP1-C

Figure 3-5 Hepatic Tmem141 deficiency down regulates the expression of multiple genes involved in lipid metabolism C57BL/6 mice were i.v. injected with either Ad-shLacZ or Ad-shTmem141. After 7 days, hepatic mRNA levels were quantified by QRT-PCR (n=6 per group). * P<0.05, ** P<0.01, ***

P<0.001 vs. Ad-shLacZ.

3-6 Knockdown of Tmem141 in the liver decreases the expression of hepatic ATP

–binding cassette Transporter sub-family A1 (ABCA1) protein level by 80 %:

Formation and metabolism of HDL largely rely on ATP binding cassette transporter A1

(ABCA1) to facilitate the efflux of cellular cholesterol to outside of cells. Since we observed a massive reduction in HDL- C fraction following hepatic Tmem141 down- regulation, we hypothesized that Tmem141 could be regulated HDL biogenesis via modulating the ABCA1 transporter, whose expression was analyzed at mRNA (Figure

3-5). We measured the protein level and we found that, hepatic Tmem141 deficiency led to about a 90 % reduction of the ABCA1 protein expression in liver of wild type mice in comparison to the control group (Figure 3-6). In addition, Tmem141 deficiency significantly reduces the expression of ApoA-1 protein level. Although knockdown of

Tmem141 represses the ABC transporter mRNA levels by 3- folds, ABCA1 protein levels reduce by more than 80 % compared with the control group, indicating that post-transcriptional repression of ABCA1 and is likely to exist in addition to the transcriptional inhibition. Tmem141 seems to be a hepatic player affecting the cholesterol fluxes fated to HDL, via regulation of ABCA1.

A B

Ad-shLacZ 2.0 Ad-shLacZ Ad-shTmem141 Ad-shTMEM141 1.5

Tmem141 1.0 0.5 ABCA1 expression ***

Relative protein Relative *** ApoA-1 0.0 *** β-actin ABCA1 ApoA-1 Tmem141

Figure 3-6 Hepatic Tmem141 deficiency reduces the liver expression of ATP –binding cassette transporter sub-family A1 and ApoA-1 C57BL/6 mice were infected with Ad-shLacZ or Ad-shTmem141 for 6 days (n=4mice pr group). Total hepatic protein levels were determined by Western blot assays (E, F). *

P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ treatment.

3-7 Over-expression of hepatic Tmem141 had no effect on lipid metabolism:

Our loss-of-function studies have demonstrated that hepatic Tmem141 is required for

maintaining the expression of numerous genes involved in lipid metabolism (Figures 3-

5). To determine whether over-expression of Tmem141 plays a role in lipid and/or

carbohydrate metabolism, we generated adenovirus expressing Tmem141 (Ad-

Tmem141), which was subsequently injected intravenously into C57BL/6 mice. The

over-expression of hepatic Tmem141 highly induces about 8 folds at both mRNA level

(Figure 3-8) and protein level (Figure 3-9). However, hepatic over-expression of

Tmem141 had no substantial effect on plasma cholesterol, triglycerides or glucose

levels, there are no substantial alterations in hepatic TG or cholesterol levels (Figure 3-7

A-E).

Analysis of plasma by fast protein liquid chromatography (FPLC) indicated that hepatic

Tmem141 over-expression had no effect on plasma cholesterol or Triglyceride - lipoprotein profile (Figure 3-7 F, G). These results suggest that augmentation of hepatic

Tmem141 activity may not affect lipid metabolism, therefore hepatic Tmem141 may be redundant for additional effects following Tmem141 over-expression.

A Cholesterol B Triglycerides 200

150 100 80 100

60 (mg/dL) 50 40

(mg/dL) 20 Plasma cholesterol Plasma 0 0

Ad-Empty Ad-Tmem141 PlasmaTriglycerides Ad-Empty Ad-Tmem141

C D Glucose Hepatic Cholesterol

150 4 3 100

g/g) 2

 (

(mg/dL) 50 1

Plasma Glucose Plasma 0 0 Ad-Empty Ad-Tmem141 Cholesterol Hepatic Ad-Empty Ad-Tmem141

Heplatic Triglycerides 8 G 6

g/g) 4

 ( 2 0

Hepatic Triglycerides Hepatic Ad-Empty Ad-Tmem141

Ad-Empty F Ad-Tmem141 50 HDL 40 30 20

g/Fraction) LDL Cholesterol  VLDL ( 10 0 12 15 18 21 24 27 30 33 36 FPLC G Ad-Empty 30 VLDL Ad-Tmem141

LDL

g/Fraction) 10



( Triglycerides 0 12 15 18 21 24 27 30 33 36 FPLC

Figure 3-7 Over-expression of Tmem141 in the liver of wild type mice. C57BL/6 mice were injected intravenously with (Ad-Empty) or (Ad-Tmem141) (n=6 mice per group). After 6 days, mice were fasted for

5 h prior to euthanization. Total cholesterol (TC) levels in the plasma (A) and liver (D), triglyceride level in plasma (B) and liver (E) were determined. Plasma Glucose level (C) was measured. Plasma cholesterol lipoprotein profile (F) and triglyceride lipoprotein profile (G) triglyceride lipoprotein profile (E) were determined by FPLC analysis. * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-Empty.

3-8 Over-expression of hepatic Tmem141 has no effect on the expression of

ABCA1, ApoA1 or lipogenic genes:

Our loss-of-function studies have demonstrated that hepatic Tmem141 is required for maintaining the expression of numerous genes involved in lipid metabolism. To determine whether over-expression of Tmem141 also alters these genes, we analyzed hepatic gene expression of mice over- expressed Tmem141 by real-time PCR. However, over-expression of Tmem141 had no substantial effect on ABCA1, ApoA-1, SR-B1,

SREBP-2, SREBP-1c, or LDLR expression level (Figure 3-8); suggesting that augmentation of hepatic Tmem14 activity may not affect lipid metabolism. Consistent with the plasma lipids that didn’t change (Figure 3-7); these data indicated that over- expression of Tmem141 in the liver of wild-type mice has not apparent phenotype.

10 Ad-Empty 8 *** Ad-Tmem141 6 4

2 Relative mRNARelative 0

LDLR ABCA1 ApoA1 SR-B1 SREBP2 Tmem141 SREBP1-C

Figure: 3-8 Hepatic over expression of Tmem141 has no effect on genes implicated in lipid metabolism C57BL/6 mice were injected intravenously with Ad-Empty or Ad-Tmem141 (n=6 mice per group). After 6 days, mice were fasted for 5 h prior to euthanization. Hepatic mRNA levels were determined by QRT-PCR. * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-Empty.

3-9 Over expression of Tmem141 has no impact on hepatic ATP-binding cassette transporter sub-Family A1 (ABCA1) expression:

We analyzed hepatic protein in mice over expressed Tmem141; we found that

Tmem141 had no effect on ABCA1 protein expression (Figure 3-9) and mRNA levels

(Figure 3-8) in the liver. The over expression of Tmem141 in the liver had no impact on lipid metabolism in wild type mice. In contrast, knockdown of Tmem141 in the liver decreases the levels of total plasma cholesterol and plasma HDL-C (high-density lipoprotein cholesterol) levels. The effect of hepatic Tmem141 deficiency on lipid metabolism likely results from its effect on down regulation of hepatic ABCA1 transporter which mediates the efflux of cholesterol and phospholipids to lipid-poor APO lipoproteins (APO-A1) to form HDL. Therefore, this observation explained the lack of effect Tmem141 over expression on the plasma total cholesterol level while the knockdown of Tmem141 had a remarkable effect

A B

Ad-Empty Ad-Tmem141 Ad-Empty 15 *** Ad-TMEM141 Tmem141 10 ABCA1 5

ApoA-1 expression

β-actin protein Relative 0

ABCA1 ApoA-1 TMEM141

Figure 3-9: Hepatic Tmem141 over expression had no effect on ABCA1 or ApoA-1 C57BL/6 mice were infected with Ad-Empty or Ad-Tmem141 for 6 days (n=6mice per group). Hepatic mRNA levels were determined by QRT-PCR (A–D) and protein levels determined by Western blot assays (E, F). * P<0.05, **

P<0.01, *** P<0.001 vs. Ad-Empty treatment.

3-10 Knockdown of Hepatic Tmem141 does not affect on Very-Low-Density

Lipoprotein (VLDL) secretion rate:

The substantial reduction in plasma total cholesterol in Tmem141-deficient mice (Figure

3-4) proposed that these mice might have reduced VLDL secretion rate since VLDL secretion is important for plasma lipoprotein metabolism. We tested this hypothesis by injecting Tyloxapol, an inhibitor for lipoprotein lipase (LPL), to mice that had been infected with Ad-shLacZ or Ad-shtmem141 for 6 days. Tmem141-deficient mice had markedly no change on plasma cholesterol (Figure 3-10 A) triglycerides (Figure 3-10 B) or ApoB48/100 secretion rate (Figure 3-10 C) at 0, 1, 2, or 3 hours after injection of

Tyloxapol. Thus, VLDL secretion does not contribute to the reduced plasma cholesterol levels following hepatic Tmem141 knockdown.

A Ad-shLacZ B Ad-shLacZ 200 Ad-shTmem141 Ad-shTmem141 150 2000 1500 100 1000 (mg/dL) 50 (mg/dL) 500 0

Plasma cholesterol Plasma 0

0 1 2 3 0 1 2 3 PlasmaTriglyceride Hours Hours

C Hours 0 1 2 3

ApoB-100 Ad-shLacZ ApoB-48

ApoB-100 Ad-shTmem141 ApoB-48

Figure 3-10 Loss of hepatic Tmem141 has no effect on VLDL secretion. (A–C) C57BL/6 mice were injected with Ad-shLacZ or Ad-shTmem141 via tail vain injection (n=6 mice per group). After 6 days, mice were fasted overnight, followed by intravenous injection of Tyloxapol (500 mg/kg). Blood was taken at indicated time points and plasma triglyceride levels determined (A). Plasma ApoB48/100levels were determined by Western blot assays (C). * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ.

3-11 Knockdown of Tmem141 in the liver partially reduces plasma cholesterol levels in Ldlr mice

The striking effect of Tmem141 on cholesterol metabolism in wild-type mice led us to investigate whether Tmem141 deficiency would ameliorate cholesterol accumulation in low density lipoprotein (LDL) receptor (LDLR) knockout mice fed an atherogenic diet for 2 weeks. The lipid profile of LDLR mice with a higher percent of cholesterol carried in IDL/LDL particles more closely resembles that in dyslipidemic humans. The purpose of this study is also to test our hypothesis of involvement of Tmem141 in decreasing hepatic HDL biogenesis with a subsequent increasing in LDL uptake. Because LDLR is required for LDL uptake and LDLR mice carry most of their cholesterol in LDL particles, in contrast to wild type mice which carry 90% of their cholesterol in HDL particles, therefore we anticipate a partial reduction in plasma cholesterol level.

In this study Ad-shLacZ or Ad-shTmem141 was delivered to LDLRmice intravenously.

Expectedly, we found that the knockdown of Tmem141 in LDLRmice significantly reduces plasma cholesterol by only 46% (Figure 3-11 A), compared to 80% reduction in wild-type mice (Figure 3-4A). Interestingly, Tmem141 deficiency also reduces plasma glucose levels (Figure 3-11C). Analysis of plasma by FPLC indicated that knockdown of

Tmem141 reduce VLDL, LDL and HDL cholesterol (Figure 3-11E) and has not

significant changes in TG (Figure 3-11F) level. These data suggest that Tmem141 deficiency reduces plasma cholesterol levels, partially via increasing the hepatic clearance of IDL/LDL through a mechanism that may involve the, the LDLr related protein (LRP) but is independent of LDLr, and the VLDL secretion rate.

A B

2000 300 1500 200 1000 ***

(mg/dL) 100

500 (mg/dL)

0 0 PlasmaTG level Plasmacholesterol Ad-shLacZ Ad-shTmem141 Ad-shLacZ Ad-shTmem141

200 150 *** 100

(mg/dL) 50

0 PlasmaGlucose Ad-shLacZ Ad-shTmem141

D E

Ad-shLacZ Ad-shLacZ Ad-shTmem141 400 VLDL 100 VLDL Ad-shTmem141 300 80 LDL 60 200 40

HDL g/Fraction)

g/Fraction) 100 20 LDL

Cholesterol

 

( ( 0 Triglycerides 0 12 15 18 21 24 27 30 33 36 12 15 18 21 24 27 30 33 36 FPLC Fractions FPLC Fractions

Figure 3-11: Tmem141 deficiency reduces plasma cholesterol levels, partially through LDL receptor. (A-E) LDLRmice were intravenously injected with either Ad-shLacZ or Ad-shTmem141 and fed a Western diet for 2 weeks (n =8 mice per group). After a 6-hour fast, mice were euthanized. Plasma

TG (B) and total cholesterol (TC) levels were quantified (A). Plasma cholesterol and TG lipoprotein profile was determined by FPLC (D), (E). * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ.

3-12 Hepatic over-expression of Tmem141 has no effect on plasma cholesterol or

Triglyceride levels in Ldlrmice:

Over expression of Tmem141 in LDLRmice has no impact on plasma lipid level.

Interestingly, Tmem141 over expression also reduces plasma glucose levels (Figure 3-

12C). Analysis of plasma by FPLC indicated that over expression of Tmem141 have not significant changes in cholesterol or triglyceride in plasma lipoprotein levels.

A B C

Cholesterol Triglycerides Glucose 1500 300 200 1000 200 150 ** 100

500 100

(mg/dL) (mg/dL) (mg/dL) 50

0 0 0 PlasmaGlucose

Plasma cholesterol Plasma Ad-Empty Ad-Tmem141 Ad-Empty Ad-Tmem141

Plasma Triglycerides Plasma Ad-Empty Ad-Tmem141

D E Ad-Empty Ad-Empty VLDL Ad-Tmem141 Ad-Tmem141 200 80 VLDL LDL 60 150 100 40

HDL g/Fraction)

g/Fraction) 50 20

 Cholesterol



( ( 0 Triglycerides 0 12 15 18 21 24 27 30 33 36 12 15 18 21 24 27 30 33 36 FPLC Fractions FPLC Fractions

Figure 3-12 over-expression of hepatic Tmem141 reduce plasma glucose level.of LDLR-/- (A-E)

LDLR mice were intravenously injected with either Ad-Empty or Ad-Tmem141 and fed a Western diet for 2 weeks (n =7 mice per group). After a 6-hour fast, mice were euthanized. Plasma TG (B) and total

cholesterol (TC) levels were quantified (A). Plasma cholesterol and TG lipoprotein profile was determined by FPLC (D), (E). * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-Empty.

3-13 Hepatic knockdown of Tmem141 has no effect on plasma triglyceride or cholesterol levels in Apoemice:

We hypothesized that the severe reduction in Total cholesterol in plasma of Tmem141 deficient mice may be due to lower nascent HDL biogenesis rate. In order to better unravel this hypothesis, we decided to include ApoE double knockout mice in our experiments. In these animals HDL-C should be lower than that in wild type mice.

Deletion of the ApoE gene in mice is associated with changes in lipoprotein metabolism.

The major plasma lipoprotein in these individuals is a cholesterol ester-enriched VLDL while the HDL –C in these mice is very low (-80 %) in compared to the control mice.

The purpose of this study was to test the hypothesis of involvement of Tmem141 in HDL metabolism since these mice have most of their cholesterol in non- HDL lipoproteins.

Under conditions of ApoE knockout, it appears that the knockdown mouse Tmem141 fails to reduce the total plasma cholesterol since these mice have very low cholesterol in

HDL fractions (Figure 3-13A). The FPLC profiles of the Tmem141-treated mice were like to those of the ApoE−/− mice (Figure 3-13E). In both cases, the cholesterol peak of the VLDL/LDL/IDL region was heavily enriched in cholesterol. The hypercholesterolemia caused by decreased rate of appearance of LDL/HDL in the plasma of Tmem141 deficient- wild type mice could be attributed to a marked reduction in ABCA1 expression with a subsequent reduction in HDL biogenesis and increased LDL uptake.

A B Cholesterol Triglycerides

1500 80 1000 60 40

500 (mg/dL) (mg/dL) 20

0 0 Plasmacholesterol Ad-shLacZ Ad-shTmem141 PlasmaTriglyceride Ad-shLacZ Ad-shTmem141

C D Glucose

150 2.5 2.0 100 1.5 1.0 50 *** (mg/dL) 0.5

0 mRNA Relative 0.0 Plasma Glucose Plasma Ad-shLacZ Ad-shTmem141 Ad-shLacZ Ad-shTmem141

E F

VLDL 300 VLDL Ad-shLacZ 50 Ad-shLacZ Ad-shTmem141 40 Ad-shTmem141 200 30 20

100 LDL g/Fraction)

g/Fraction) HDL 10



Cholesterol



( Triglycerides ( 0 0 0 10 20 30 40 121518212427303336 FPLC Fractions FPLC Fractions

Figure 3-13: Knockdown of hepatic Tmem141 has no effect on plasma lipids of ApoE-/- mice. (A-E)

ApoE-/- mice were intravenously injected with either Ad-shLacZ or Ad-shTmem141 and fed a western diet for 2 weeks (n =5 mice per group). After a 6-hour fast, mice were euthanized. Plasma TG (B) and total cholesterol (TC) levels were quantified (A). Hepatic mRNA was determined (D). Plasma cholesterol and

TG lipoprotein profile was determined by FPLC (E), (F). * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ.

3-14 Hepatic over-expression of Tmem141 has no effect on plasma triglyceride or cholesterol levels in Apoemice:

APO lipoprotein E (ApoE) insufficiency (or its abnormalities in humans) is related to a lot of pathological diseases; including dyslipidemia, atherosclerosis, Alzheimer’s disease, and shorter life span [118].To investigate the role of Tmem141 in the biogenesis of HDL

(high-density lipoprotein) particles in vivo, we infected ApoE−/− mice with adenoviruses expressing Tmem141. Treatment of ApoE−/− mice with the adenovirus expressing

Tmem14 did not affect significantly the total cholesterol, glucose or triglyceride levels in the infected mice (Figure 3-14). The FPLC profiles of the Tmem141-treated mice were similar to those of the ApoE−/− mice (Figures 3-14E and F). In both cases, the cholesterol peak of the VLDL/LDL/IDL region was heavily enriched in cholesterol.

A B Cholesterol Triglyceride 1500 80 1000 60 40

500 (mg/dL) (mg/dL) 20 0 0

Plasmacholesterol Ad-Empty Ad-Tmem141 Ad-Empty Ad-Tmem141 Plasma Triglyceride Plasma

C D Glucose 150 4 *** 100 3

50 2 (mg/dL) 1

0 Plasma Glucose Plasma

Relative mRNA Relative 0 Ad-Empty Ad-Tmem141 Ad-Empty Ad-Tmem141

E F Ad-Empty Ad-Empty 150 80 VLDL Ad-Tmem141 VLDL Ad-Tmem141 100 LDL 60 40 50

g/Fraction) HDL

g/Fraction) 20 LDL

Cholesterol



( ( 0 Triglycerides 0 0 10 20 30 40 12 15 18 21 24 27 30 33 36 FPLC Fractions FPLC Fractions

Figure 3-14: Over expression of hepatic Tmem141 had no effect on plasma lipids of ApoE mice.

(A-E) ApoE-/- mice were intravenously injected with either Ad-Empty or Ad-Tmem141 and fed a Western diet for 2 weeks (n =5 mice per group). After a 6-hour fast, mice were euthanized. Plasma TG (B) and total cholesterol (TC) levels were quantified (A). Hepatic mRNA was determined (D). Plasma cholesterol and TG lipoprotein profile was determined by FPLC (E), (F). * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-

Empty.

3-15 Tmem141 deficiency impairs cholesterol efflux from primary hepatocytes:

In concert with the current information, the absence of Tmem141 in the liver resulted in

ABCA1 down regulation, leading to reduction in HDL assembly that resulted in decreased total cholesterol in the plasma. Hepatic ABCA1 play a pivotal role in the removal of excess cellular cholesterol, by efflux cholesterol to lipid poor ApoA-1 to form nascent HDL particles. Thus, we tested whether the Tmem141 –associated decrease of

ABCA1 altered the hepatic cholesterol efflux in vitro. We found that the cholesterol efflux was reduced significantly in Tmem141 deficient cells (Figure 3-15).

Primary Hepatocytes

Ad-shLacZ Ad-shTmem141 20 15 * 10 *

Efflux % 5

H] cholesterol H] 3

[ 0 T-091317 - - + + (LXR ligand)

Figure 3-15 Suppression of hepatic Tmem141 correlates with a decrease in ABCA1-mediated cholesterol efflux from the primary hepatocytes. The efflux of [3H] -cholesterol from primary

Hepatocytes was measured in the absence or presence of TO-901317 (n=6), APO lipoprotein A-I was then added to the final concentration of 15 µg/ml. Radioactivity in the culture media and cellular lipid extracts was determined by scintillation counting and cholesterol efflux was calculated as (% efflux =

[CPM in media 100] / [CPM in media + CPM in lipid extracts]).. * P<0.05, ** P<0.01, *** P<0.001 vs. Ad- shLacZk

3-16 Knockdown of Tmem141 decreases the expression of ABCA1 protein level in

RAW macrophage cells:

Macrophages ABCA1 plays a pivotal role in the removal of cellular cholesterol by efflux cholesterol to HDL, which can prevent foam cell formation. The importance of Tmem141 in HDL metabolism was clearly demonstrated by the massive decrease in HDL levels in mice lacking Tmem141. To gain an insight into the modulation of macrophage ABCA1 expression by Tmem141 deficiency, RAW 264.7 macrophages were transfected with ad-shtmem141 in the presence or absence of T091317 (10 μM), an LXR agonist to increase the expression of ABCA1. Interestingly, we establish that the ABCA1 protein level was highly repressed by knockdown of Tmem141 compared with the control

(Figure 3-16).These data suggest a potential repression of ABCA1 in macrophages- deficient Tmem141 which is LXR-independent.

Ad-shLacZ A B 8 Ad-shTmem141 Ad-shLaZ Ad-shTmem141 6

Tmem141 4

ABCA1 expression 2 Relative protein Relative * β-actin 0 *

ABCA1 Tmem141

Figure 3-16 Tmem141 deficiency reduces ABCA1 expression in mouse macrophages. RAW macrophages 264.7 were infected with (Ad-shLacZ) or (Ad-shTmem141) (n=3 well per group) and treated with TO-901317 (10 μM to activate ABCA1 transcription. After 24 hours, cells were lysed, total protein determined and analyzed by western blot analysis * P<0.05 vs. Ad-shLacZ.

3-17 Tmem141 deficiency impairs cholesterol efflux from Macrophage:

ABCA1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation in macrophages. My in vivo data have shown that loss of hepatic

Tmem141 results in hypocholesterolemia likely via ABCA1-dependent regulation of both

LDL uptake and HDL biogenesis. We examined whether the Tmem141 –associated decrease of ABCA1 altered the cholesterol efflux within macrophages. To study the role of Tmem141 in ABCA1-mediated cholesterol efflux , ApoA-1 was used as an acceptor for cholesterol in order to assess ABCA1-dependent efflux, because ABCA1 is the sole determinant of specific cholesterol efflux to lipid-free ApoA-I. After activation of ABCA1 expression by the LXR agonist (T091317), cholesterol efflux to ApoA-1 was reduced significantly in Tmem141 deficient cells (Figure 3-17) Collectively, these data demonstrate that Tmem141 deficiency impairs the ability of macrophages to regulate the levels of key ATP-binding cassette (ABCA1) transporters and cholesterol efflux in response to LXR activation.

RAW 264.7 Macrophages

Ad-shLacZ 15 Ad-shTmem141

10 ***

Efflux % 5

H] cholesterol H]

3 [ 0 _ _ T-091317 + +

Figure 3-17 Suppression of macrophage-Tmem141 correlates with a decrease in ABCA1- mediated cholesterol efflux. The efflux of [3H] -cholesterol from Raw 264.7 macrophages was measured in the absence or presence of TO-901317 (10 μM to activate ABCA1 transcription). APO lipoprotein A-I was then added to the final concentration of 15 µg/ml. Radioactivity in the culture media and cellular lipid extracts was determined by scintillation counting and cholesterol efflux was calculated as

(% efflux = [CPM in media 100] / [CPM in media + CPM in lipid extracts]). Each value is an average of triplicates ± standard error. * P<0.05, ** P<0.01, *** P<0.001 vs. Ad-shLacZ.

3-18 Liver X receptor, a key regulator of HDL and cholesterol metabolism, does not regulate Tmem141 expression

The LXRs, a key regulator of cholesterol homeostasis, have been implicated in the control of HDL metabolism through regulation of many of genes involved in RCT, including the cholesterol-phospholipids transporter ABCA1 [119-120]. To determine whether activation of LXR modulate Tmem141 expression in vitro, AML-12

(Hepatocytes cell line) and RAW cell (macrophages cell line, were treated with 10 µM vehicle (-) or T0-91317 (+) for 48 hours, then protein expression was assessed by western blot (Figure 3-18). We found that Tmem141 protein expression was not affected by LXR activity. Thus, LXR activation has no impact on hepatic regulation of

Tmem141A expression.

A AML-12 Vehicle T091317 Tmem141 β-Actin

RAW 264.7 B Vehicle T091317

Tmem141 β-Actin

Figure 3-18 LXR activation dose not regulate Tmem141 expression in the liver: Western blot (n=3 per group) showing expression of Tmem141 in total cell lysates of AML12 (A) and RAW 264.7 cells (B) with or without adding TO-901317 (10 μM).

3-19 Tmem141 over expression does not improve ABCA1 stability:

To better understand, the Tmem141-dependent inhibition of ABCA1, we next analyzed

the impact of Tmem141 over expression on the cellular abundance of ABCA1 in

Hepatocytes (AML12) and macrophage (264.7) mouse’s cell lines. To assess the rate of

catabolism of ABCA1, cells were infected with Ad-Tmem141 and treated with LXR

agonist TO-901317 for 24 h to maximally stimulate expression of ABCA1 (Figure 3-18).

In the presence of T0-901317, the abundance of ABCA1 in RAW 264.7 cells did not

alter after 24 h incubation, even when Tmem141A expression was effectively increased.

Thus, Tmem141 over expression has no impact on ABCA1 abundance.

A Ad-Empty Ad-Tmem141

AML12 cells AML12 - T091317 + T091317 -T091317 + T091317 Tmem141

ABCA1

β-Actin

Ad-Empty Ad-Tmem141 B -T091317 + T091317 - T091317 + T091317

RAW cells RAW Tmem141

ABCA1

β-Actin

Figure 3-19 Effect of Tmem141 over expression on ABCA1 abundance and stability. A: Western blot

showing expression of ABCA1 in cell lysates of AML12 (A) and RAW 264.7 (B) cells after transfection

with ad-Tmem141 and activation of ABCA1 transcription with TO-901317 (10 μM).

3-20 Tmem141 interacts with ABCA1 in vitro:

Since our data show down regulation of hepatic ABCA1 expression in Tmem141 deficient mice, we tested whether there is a possible physical significance of interaction of Tmem141 with ABCA1 protein. ABCA1 immunoprecipitations were carried out using protein lysates from mouse liver over expressed Tmem141. We used Tmem141 antibody to pull down the immunoprespited complex, which is revealed with ABCA1 antibody. The presence of ABCA1 in the Tmem141-immunoprecipitated was demonstrated but it is not clear because of significant background on the Immunoblot

(Figure 3-20).

Cell lysates Co-IP

Ad-Empty Ad-Tmem141 IgG Anti-Tmem141

Tmem141

ABCA1

β-actin

Figure 3-20 Tmem141 show specific interaction with ABCA1, Co-immunoprecipitation of ABCA1 from the liver lysates over expressed Tmem141A and incubated with either Tmem141A antibody or the non specific polyclonal IgG antibody (negative control). The positive control is tissue lysates (100μg) incubated with Tmem141A antibody show both the endogenous Tmem141A protein level and over expressed Tmem141A.

3-21 Tmem141 mRNA and Protein distribution patterns

The global distribution pattern of adult murine Tmem141 mRNA expression was generated using RT-PCR to compare Tmem141 transcript levels relative to 36B4 mRNA levels in many tissues obtained from four individual wild type mice maintained on a chow diet. Highest Tmem141 mRNA expression was observed in brown adipose tissue, white adipose Tissue and brain. Moderate expression was observed in liver, kidney, pancreases, stomach, and small intestine. These experiments showed that Tmem141 mRNA is expressed widely throughout the body, but at different levels in different tissues. However, because expression of mRNA does not necessarily predict protein expression, we then determined the tissue-specific expression patterns of Tmem141 protein tissue distribution of Tmem141 protein obtained from four individual adult mice maintained on a chow diet and each tissue was analyzed by western blot and normalized to GAPDH levels.

Pancreas

Intestine Stomach BAT WAT Heart

Kidney

Brain

Spleen

Liver SK. muscle SK.

Tmem141 GAPDH

B 5 4 3 2 mRNA 1

0 Relative Tmem141 BAT Brain Liver WAT Heart Kidney Spleen Stomach Intestine Pancreas

Figure 3.21 Tissue distribution of murine Tmem141 protein. A, Q-pcr mRNA analysis of Tmem141A expression in different tissues from wild -type mice (n =4) normalized to 36B4. B, Western blot of pooled whole-cell lysates prepared from four adult murine tissues showing Tmem141A protein in multiple tissues.

After transfer to a PVDF membrane, the gel was cut in half and the top and bottom halves probed with

Tmem141A and glyceraldehydes phosphate dehydrogenase (GAPDH) antibodies, respectively.

3-22 TMEM141 is localized in late endosome/ lysosome compartments

To determine the sub-cellular localization of TMEM141, we constructed a TMEM141-

FLAG fusion plasmid. Using confocal microscopy, we observed that TMEM7141-Flag exhibited a punctuated cytoplasmic distribution. To assess the sub localization of

TMEM141, TMEM141-flag transfected CHO cells were co-stained with antibodies recognizing a number of established organelle marker proteins, TMEM141 Co-localized

with the lysosomal membrane protein Lamp-2. ABCA1 is known to localize to both cellular membrane and late endosome/lysosome. Therefore, TMEM141 may be important for stabilization of ABCA1 protein.

DAPI Lamp -2

Tmem141-FLAG Merge

Figure 3.22 Tmem141 is located mainly in endosomes/ Lysosomes: CHO cells were transiently cotransfected with p-Tmem141 plasmid, grown on glass cover slips for 48 hours, fixed, and permeabilised as described in “Materials and Methods.” Flag-tagged Tmem141 was detected using Monoclonal ANTI-

FALG M2 (1:1000) as primary Antibody and FITC –conjugated AffiniPure (1:2000 (green). Lysosomes were detected using a rabbit polyclonal anti-LAMP-2 antibody (1:1000) and Alexa-Fluor 594 (1:2000); right panels show the merged images. Co localization of the green and red labels is shown in yellow. The cells were then viewed by confocal microscopy. Representative images of at least three independent experiments are shown.

3-23 Tmem141 expression is reduced in db/db mice:

Obese animal models, including ob/ob, db/db mice, exhibit hyperlipidemia due to abnormal increases of lipid metabolism. Since Tmem141 is highly expressed in BAT and WAT and plays a role in metabolism, we decided to examine whether the level of

Tmem141A expression changes in the liver of obese mouse models feeding chow diet.

To answer this question, we investigated the mRNA expression of Tmem141 in the liver from db/db; ob/ob or STZ treated mice. Compared to control group, the mRNA levels of

Tmem141 were insignificantly different (Figure 3-23 D). To determine whether the protein levels of Tmem141 are changed in these mouse models, we performed western blot analysis. Consistent with the Tmem141 expression at the mRNA levels, no difference in Tmem141 protein expression was noted in STZ treated mice (Figure 3-23,

B). Surprisingly, on a chow diet, db/db mice have a significantly reduced Tmem141 expression as compared with wild-type mice (Figure 3-23, A). Our previous data showed that Tmem141 absence lead to ABCA1 reduction in the wild-type mice.

Therefore, we investigated Tmem14 mediated ABCA1 –down regulation under diabetes conditions. Interestingly, and under both conditions, ABCA1 expression in the liver from db/db mice is also highly decreased. Therefore, the metabolic phenotype of impaired

ABCA1 regulation observed db/db mice could be result from down regulation of hepatic

Tmem141 expression, indicating that Tmem141 deficiency is the reason for the impaired ABCA1 regulation, which observed in not only normal mice, but also diabetic mice. These results suggested an unrecognized role for Tmem141 in metabolic disorders, including diabetes disease type 2.

A B WT db/db Ctrl STZ

Tmem141 Tmem141

ABCA1 β-actin

β-actin

C D

8 WT 2.5 db/db 6 2.0 4 1.5

1.0 mRNA

expression 2 0.5

Relative protein Relative *** *** 0 0.0 Tmem141 ABCA1 Tmem141 Relative WT WT Ctrl STZ db/db ob/ob

Figure 3-23 Hepatic Tmem141 protein expression is reduced in db/db mice. (A-C) db/db, ob/ob, STZ treated mice and their controls were fed a chow diet, (A) and (C) protein analysis was determined by western blot (n =3 per group),( B): normalized to β-actin and quantified by image J (NIH). (D): The mRNA levels of Tmem141 were determined by QRT-PCR (n = 6 per group).

3-24 High-Fat diet selectively reduces Tmem141 expression in mouse liver:

The liver plays an essential role in regulating metabolic homeostasis and is vital for nutrient metabolism. Defining the genetic factors governing these operations could lead to a larger apprehension of how liver function responds to a high-fat diet and how that response may influence susceptibilities to obesity and metabolic syndrome. In this study, we assess the effect of dietary fat intake on hepatic gene expression of Tmem141 in both high fat-high-cholesterol (HFHC), and high-fat (HF) diet (60% kcal from fat, 0.03% cholesterol). Interestingly, HF diet mice showed significantly reduced hepatic Tmem141 protein expression level compared to mice receiving a normal chow diet (Figure 3-24 A).

However, hepatic ABCA1 protein level of these mice did not show significant differences from that in the normal diet mice. This result was not unexpected since it is consistent with previous study which showed that only long-term consumption of high fat emulsion could significantly reduce ABCA1 expression [121]. On the other hand, hepatic

Tmem141 mRNA and protein level of HFHC mice did not show significant differences from that in the normal diet mice (Figure 3-24 B). Since High fat diet is an essential risk factor in many metabolic syndromes and based upon these findings, we suggest an unrecognized role for Tmem141 in metabolic disorders including atherosclerosis and obesity.

A B

Chow HF Chow HFHC

Tmem141 Tmem141 ABCA1 β-actin

β-actin

C D Chow 10 HF 8 1.5 6 1.0 4

mRNA 0.5 expression 2

Relative protein Relative 0 * 0.0 Relative Tmem141 Relative Tmem141 ABCA1 HF ChowHFHC Chow

Figure 3-24 Hepatic Tmem141 protein expression is reduced in HF diet fed mice (A-D) C57BL/6J mice were fed high fat-high cholesterol (HFHC) or high fat diet (HF). (A) And (C) protein analysis was determined by western blot (n=3 per group). (B): a quantified protein expression which normalized to β - actin. (D): The mRNA levels of Tmem141A were determined by QRT-PCR (n = 6 per group).

3-25 Tmem141 down-regulates ABCA1 expression in human:

My previous data showed that Tmem141 down-regulate ABCA1 expression in different mouse cell lines, both in vivo and in vitro. To investigate whether human Tmem141 has the same effect, huh-7 cells (human Hepatocytes cell line) were infected with adenovirus expressing shRNA against human Tmem141 (shTmem141). We got a significant knockdown of Tmem141 protein expression (~70% reduction) in those cell compared to control group (Figure 3-24) ,whereas ABCA1 activity was reduced to ~60% of control group (compared to 80% residual activity in mouse cell lines). In the absence of T09-1317 (LXR Ligand to stimulate ABCA1 expression) loading, levels were consistently as low as to be undetectable from huh-7 cells; T09-1317 loading succeeded to up regulate ABCA1 expression in the control group. The increase in

ABCA1 protein levels following T09-1317 loading was blunted in Tmem141 deficient- cell. These results indicated that Tmem141 deficiency reduces ABCA1 expression in

Huh-7 cells Huh7 cells

Ad-shLacZ Ad-sh-hTmem141 Tmem141

ABCA1

β-actin

Figure 3-25 Tmem141 regulates ABCA1 expression in human: Western blot (n=2 per group) showing expression of Tmem141 and ABCA1 in cell lysates of huh-7 cells treated with TO-901317 (10 μg).

Chapter Four: Discussion

The metabolic syndrome (MS) represents a public health problem which takes epidemic proportions worldwide. MS increases the risk of development cardiovascular diseases, particularly heart failure and diabetes. The nuclear receptor Farnesoid X receptor (FXR) is a potential pharmacological target, because of its broad spectrum of function and possibility of modulating the transcription of many genes involved not only in lipid metabolism, but also liver regeneration, Atherosclerosis and tumor suppression.

As part of a systematic effort to identify FXR target genes, we performed DNA microarray experiments on mice with liver from wild-type mice treated with the synthetic

FXR agonist GW4064. Among the genes regulated by GW4064 was Tmem141. It was observed that Tmem141 is a possible candidate FXR target gene.

Tmem141 is a protein that, in humans, is encoded by the TMEM141 gene.

TMEM141 gene belongs to the large family of genes encoding uncharacterized predicted transmembrane (TMEM) proteins. Tmem141 has not even been described in any subject area to date, therefore, the physiological role of Tmem141 remains largely obscure. There are two Tmem141 isoforms have been proposed in mice; the longest isoforms Tmem141A, which is a12 KDa protein and the smallest Tmem141B which is merely a 9 KDa protein. The alignment of TMEM141 sequences from various eukaryotic organisms showed that TMEM141 is highly evolutionarily conserved; indeed, The

Tmem141A protein resembles that in humans. Human Tmem141 (12 KDa) shares 89%

amino acid‘s homology with murine Tmem141A. In this work, we decided to study

Tmem141A because it is the most abundant isoform in mouse liver and moreover, resembles Tmem141 in human, thereby, all positional information in this thesis refers to transcript 1 and isoform1 of Tmem141. In our study, we confirmed the results of the microarrays experiment, and we found that activation of FXR in wild-type mice induces hepatic Tmem141 mRNA and protein levels, we further show that Tmem141 expression is significantly reduced in FXR −/− mice compared to the wild- type mice. Therefore, our data identified Tmem141 as a novel transcriptional target gene for FXR.

Luciferase reporter assay with plasmid constructs containing different promoter fragments of Tmem141 gene demonstrated that the luciferase activities were increased upon FXR agonist treatment. However, the precise sequence of FXR response element was not recognized, There is one candidate FXR element that resembled FXR response element and located in the promoter region of 40 bp downstream the transcriptional site of Tmem141 gene. These result shows that the FXR response element is located within 80 bp upstream of the Tmem141 transcription start site.

Since the discovery of the transmembrane super family, the biological roles some of TMEM members have been extensively investigated, even so, the biological function of Tmem141 has not even been identified. For Tmem141 not even the most basic information about it sub cellular localization and tissue distributions patterns were available, therefore, in this study, we examined the sub cellular localization of Tmem141, and we found that is located in the late endosomes / lysosomes' compartment. We analyzed the dispersion patterns of Tmem141 in different mouse tissues, which indicate it was distributed constitutively and broadly but at different levels in diverse tissues,

Tmem141 is highly expressed BAT, WAT, brain, stomach and kidney, where its expression is moderately in liver, pancreas and heart, and it is low expressed in skeletal muscle, intestine and spleen, Thus, Tmem141 likely plays an significant role in maintaining normal cell homeostasis.

In this work, we have utilized loss of function and over-expression approaches to define the role of Tmem141 in lipid metabolism. We show that acute loss of Hepatic

Tmem141 results in striking phenotypes, including very low plasma total cholesterol, which reduced approximately 8 folds compared with that in controls. Plasma lipoprotein cholesterol profiles revealed that the amount of cholesterol was a much lower degree in

HDL-C fraction (< 80 %) and low LDL-C fraction (< 40-50 %) compared to control group.

The huge reduction in plasma total cholesterol most probably accounted for decreased cholesterol in HDL particles; therefore, we hypothesized that hepatic Tmem141 likely to have a significant impact on HDL biogenesis and LDL uptake.

To understand the mechanism by which hepatic Tmem141 deficiency results in low blood cholesterol and impaired HDL biogenesis, we analyzed hepatic gene expression by quantitative real-time PCR (QRT-PCR). These experiments revealed that the knockdown of Tmem141 resulted in the specific down regulation of genes mostly involved in cholesterol homeostasis, including those encoding the hepatic cholesterol efflux ( ABCA1 and ApoA-1 ) or cholesterol uptake ( LDLR, SR-B1) are reduced significantly and there are no changes either in genes involved in de- novo cholesterol biosynthesis( HMGCR, CYP7A1) or sterol biliary excretion ( ABCG5, ABCG8 ), we then analyzed the hepatic protein from mice have knockdown Tmem141, and we found a high significant reduction in ABCA1 protein level ( < 80 % ) compared to the

control group. Thus, these data and consistent with the plasma lipoprotein profile indicating that loss of hepatic Tmem141 has profound effects on HDL biogenesis and

LDL uptake, mainly through regulating hepatic ABCA1 transporter, a crucial factor mediating the initial efflux of cellular cholesterol and phospholipids to lipid poor ApoA-1 to assembly HDL and promoting cholesterol efflux [99]. Our data are consistent with other previous studies which show liver specific ABCA1-knockout mice decreases plasma HDL-C by 80 % and LDL-C by 50 % [122]. Considered together, Tmem141 seems to be a hepatic player affecting the cholesterol efflux fated to HDL, via regulation of ABCA1 with a subsequent reduction in HDL biogenesis and increased LDL uptake.

To gain further insight into the hepatic Tmem141, we have over-expressed

Tmem141 in C/Bl6 mice by adenovirus mediated gene transfer. Interestingly, augmentation of Tmem141 in the liver has no significant impact on plasma lipid levels and hepatic gene expression involved in cholesterol homeostasis. Furthermore, over- expression of Tmem141 in mice had no significant effects on the ABCA1 protein expression. This observation explained the lack of effect of Tmem141 over expression on plasma total cholesterol, whereas, Tmem141 knockdown mice promoted impaired total cholesterol and ABCA1 down regulation.

The striking effect of Tmem141 on cholesterol metabolism in wild-type mice led us to investigate, whether Tmem141 deficiency would ameliorate development in low- density lipoprotein (LDL) receptor (LDLR−/−) knockout mice using an atherogenic diet for two weeks. The lipid profile of LDLR−/− mice with a higher percentage of cholesterol carried in IDL/LDL particles– more closely resembles that in dyslipidemic humans. The purpose of this study is also to test our hypothesis of involvement of Tmem141 in

decreasing hepatic HDL biogenesis with a subsequent increasing in LDL uptake.

Because LDLR is required for LDL uptake and LDLR−/− mice carry most of their cholesterol in the LDL particles. Our data indicate that absence of Tmem141 in LDLR−/− mice fed western diet for two weeks significantly reduced plasma total cholesterol level by two folds. Therefore, it is likely that knockdown of Tmem141 down regulates ABCA1 expression and HDL biogenesis in both mouse models by a similar mechanism. Though not as severely as in normal mice, Tmem141 knockdown in LDL_ receptor deficient mice reduced plasma cholesterol by only two folds compared to the mice having intact

LDL receptor. One possible explanation for this observation could be the low HDL-C fraction in the LDLR deficient mice compared with wild-type mice since LDLR-/- mice carry most of their cholesterol in LDL particles. This is consistent and reinforced by the findings of Brunham et al [123] , indicating that hepatic ABCA1 deficiency, leading to

50 % decreased HDL levels, and only 30% decrease in LdL levels. These data suggest that Tmem141 deficiency reduces plasma cholesterol levels, partially via increasing the hepatic clearance of LDL through a mechanism that may involve the, the LDLr related protein (LRP) but is independent of LDLr, and the VLDL secretion rate.

To investigate this further and to support our hypothesis of an involvement of hepatic Tmem141 in the HDL biogenesis pathway that involves ABCA1 in the liver, we utilized ApoE−/− background mice model infected with Ad–shTmem141 and fed a western diet for two weeks. In wild-type mice, ≈90% of plasma cholesterol circulates in high-density lipoproteins (HDL). In ApoE−/− mice, the cholesterol is predominantly in the very low-density lipoproteins (VLDL) and in the intermediate-density lipoprotein fractions

(IDL) [124]. Expectedly, it appears that the knockdown of hepatic Tmem141 in these

mice models fails to reduce total plasma cholesterol, since ApoE deficient mice carry most of their plasma cholesterol on VLDL particles compared to the normal mice that carry 90 % of their total cholesterol on HDL fraction. In concert with the current information, the absence of Tmem141 in the liver resulted in ABCA1 down-regulation, leading to impaired hepatic cholesterol efflux to lipid-poor apoA-1-mediated HDL assembly with a subsequent increasing in LDL uptake, resulted in decreased total cholesterol in the plasma. Ultimately, these findings implicate Tmem141 as an important player in the hepatic cholesterol efflux pathway in vivo and may have a regulative role in

ABCA1 expression and abundance.

According to a number of population studies, it has been shown that plasma levels of HDL and its major Apo lipoprotein ApoA-I are inversely associated with the risk of atherosclerosis. One of the most broadly conventional mechanisms to explain HDL’s cardioprotective effect is its role in reverse cholesterol transport process (RCT), whereby HDL promotes the elimination of accumulated toxic cholesterol from peripheral cells, including macrophage foam cells in the vessel wall by ATP-binding membrane cassette transporter A1 (ABCA1), and delivery of cholesterol to the liver for excretion.

Thereby, there is strong evidence that macrophage ABCA1 a play a pivotal role in the removal of cellular cholesterol by efflux cholesterol to HDL, which can prevent foam cell formation. Since our data indicated a dysregulation of ABCA1 and thereby total plasma cholesterol in hepatic Tmem141 deficient mice, we next set out to investigate the impact of Tmem141 Knockdown on the RCT pathway in macrophages cell line. To acquire an insight into the modulation of macrophage ABCA1 expression by Tmem141 deficiency,

RAW 264.7 macrophages were transfected with ad-shtmem141 in the presence of LXR

agonist T091317 in order to increase the expression of ABCA1 in this cell line.

Interestingly, we found that the ABCA1 protein level was highly repressed by knockdown of Tmem141 compared to the control group. The next step is to examine the role of Tmem141 in ABCA1-mediated cholesterol efflux. Therefore, efflux was obtained by measuring the release of radio-labeled cholesterol into the medium. We found that cholesterol efflux to ApoA-1 was reduced significantly in Tmem141 deficient cells.

Collectively, these data demonstrate that Tmem141 deficiency impairs the ability of macrophages to down regulate the levels of key ATP-binding cassette (ABC) transporters and cholesterol efflux in response to LXR activation.

To gather further insight into the transcriptional regulation of Tmem141 in the liver and macrophages, In addition to FXR, we examined whether the nuclear receptor LXR could regulate Tmem141 expression in vitro, since Liver X receptor (LXRs) is the key regulator of cholesterol homeostasis. Surprisingly, we found that Tmem141 protein expression was not affected by the LXR activity in vitro.

In the present study, since we reported Tmem141 was highly expressed in BAT and

WAT and plays a role in metabolism; we decided to examine whether the level of

Tmem141 expression changes in the liver of obese mouse models. Surprisingly,

Tmem141 expression is significantly decreased in db/db and HFD-induced diabetic mice compared with wild-type mice. Under diabetic conditions, ABCA1 expression in the liver from db/db mice is also highly decreased. Therefore, the metabolic phenotype of impaired ABCA1 regulation observed db/db mice could be result from down regulation of hepatic Tmem141 expression in diabetic mice, indicating that Tmem141 deficiency is the reason for the impaired ABCA1 regulation, which observed in not only normal mice,

but also diabetic mice. These results suggested an unrecognized role for Tmem141 in metabolic disorders, including diabetes.

Given Tmem141 depletion reduces the expression of ABCA1, we next explored whether Tmem141 interacts with ABCA1 in vitro. Co -immunoprespitatin assay was performed and showed a possible specific interaction between Tmem141 and ABCA1.

Recently, Klammt et al determined the facile backbone structure of human Tmem141 proteins by NMR spectroscopy. This study shows that TMEM141 remarkably elongated transmembrane helices of 34 and 33 amino acids. The two-helical bundles of TMEM141 were more loosely packed with inter helical distances exceeding 8 Å and relatively few inter helical van der Waals contacts localized close to the ends of the helices. They predict that integral membrane proteins with loosely packed helixes, including

Tmem141 could be involved in signal transduction across the membrane [125].

Furthermore, several previous studies have demonstrated that the binding of ApoA-I with ABCA1 could activate signaling molecules that modulate posttranslational ABCA1 activity and cholesterol efflux. The main signaling molecules in these processes include protein Kinas A (PKA), protein kinase C (PKC), Janus kinase 2 (JAK2), Rho GTPases and Ca2+ . These signaling reactions eventually lead to ABCA1 phosphorlation and subsequent protection of ABCA1 from its degradation by calpain and increasing lipidation of ApoA-I [126]. Here, we predict that there is potential contribution of the

Tmem141 on the posttranslational regulation of ABCA1 expression through a signal transduction pathway that mediates ABCA1 protection from degradation through the lysosomal pathways because ABCA1 is known to localize to both cellular membrane and late endosome/lysosome and our current study show that Tmem141 is co-localize

and interacts with ABCA1. Therefore, TMEM141 may be important for stabilization of

ABCA1 protein. This explains the reason why over the expression of Tmem141 has no effect on modulating ABCA1 expression while Tmem141 knockdown lead to ABCA1 down regulation.

In conclusion, this study shows that hepatic Tmem141 expression is induced by

FXR and repressed in db/db or high fat diet-fed mice. Loss of hepatic Tmem141 results in a marked reduction in plasma HDL-C and LDL-C levels and hepatic ABCA1 expression whereas over-expression of hepatic Tmem141 has no effects on lipid or

ABCA1 expression. Tmem141 deficiency reduces ABCA1 expression of ABCA1 in Huh-

7 cells (human hepatocytes), macrophages and mouse hepatocytes, and causes impaired cholesterol efflux in both macrophages and hepatocytes. Tmem141 is ubiquitously expressed and localizes to endocytic compartments. Tmem141 physically interacts with ABCA1 and may regulate ABCA1 degradation/recycling. This novel posttranslational regulation role of Tmem141 on ABCA1 expression may be part of the complex mechanism developed by the cell to ensure the tight regulation of cholesterol homeostasis.

Chapter Five: References

1. Chawla, A., et al., Nuclear receptors and lipid physiology: opening the X-files. Science, 2001. 294(5548): p. 1866-70.

2. Hollman, D.A., et al., Anti-inflammatory and metabolic actions of FXR: insights into molecular mechanisms. Biochim Biophys Acta, 2012. 1821(11): p. 1443-52.

3. Kumar, R. and E.B. Thompson, The structure of the nuclear hormone receptors. Steroids, 1999. 64(5): p. 310-9.

4. Calkin, A.C. and P. Tontonoz, Liver x receptor signaling pathways and atherosclerosis. Arterioscler Thromb Vasc Biol, 2010. 30(8): p. 1513-8.

5. Altucci, L., et al., RAR and RXR modulation in cancer and metabolic disease. Nat Rev Drug Discov, 2007. 6(10): p. 793-810.

6. Chinetti, G., et al., Activation of proliferator-activated receptors alpha and gamma induces apoptosis of human monocyte-derived macrophages. J Biol Chem, 1998. 273(40): p. 25573-80.

7. Sonoda, J., L. Pei, and R.M. Evans, Nuclear receptors: decoding metabolic disease. FEBS Lett, 2008. 582(1): p. 2-9.

8. Calkin, A.C. and P. Tontonoz, Transcriptional integration of metabolism by the nuclear sterol- activated receptors LXR and FXR. Nat Rev Mol Cell Biol, 2012. 13(4): p. 213-24.

9. Parks, D.J., et al., Bile acids: natural ligands for an orphan nuclear receptor. Science, 1999. 284(5418): p. 1365-8.

10. Kemper, J.K., Regulation of FXR transcriptional activity in health and disease: Emerging roles of FXR cofactors and post-translational modifications. Biochim Biophys Acta, 2011. 1812(8): p. 842-50.

11. Wang, Y.D., et al., FXR: a metabolic regulator and cell protector. Cell Res, 2008. 18(11): p. 1087-95.

12. Fiorucci, S., et al., Targeting farnesoid X receptor for liver and metabolic disorders. Trends Mol Med, 2007. 13(7): p. 298-309.

13. Modica, S. and A. Moschetta, Nuclear bile acid receptor FXR as pharmacological target: are we there yet? FEBS Lett, 2006. 580(23): p. 5492-9.

14. Goodwin, B., et al., A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell, 2000. 6(3): p. 517-26.

15. Lu, T.T., et al., Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell, 2000. 6(3): p. 507-15.

16. Fiorucci, S., et al., Bile-acid-activated receptors: targeting TGR5 and farnesoid-X-receptor in lipid and glucose disorders. Trends Pharmacol Sci, 2009. 30(11): p. 570-80.

17. Lefebvre, P., et al., Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev, 2009. 89(1): p. 147-91.

18. Russell, D.W., The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem, 2003. 72: p. 137-74.

19. Trauner, M. and J.L. Boyer, Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev, 2003. 83(2): p. 633-71.

20. Suchy, F.J. and M. Ananthanarayanan, Bile salt excretory pump: biology and pathobiology. J Pediatr Gastroenterol Nutr, 2006. 43 Suppl 1: p. S10-6.

21. Moschetta, A., A.L. Bookout, and D.J. Mangelsdorf, Prevention of cholesterol gallstone disease by FXR agonists in a mouse model. Nat Med, 2004. 10(12): p. 1352-8.

22. Mano, N., et al., Characterization of rat liver bile acid acyl glucuronosyltransferase. Steroids, 2002. 67(3-4): p. 257-62.

23. Lambert, G., et al., The farnesoid X-receptor is an essential regulator of cholesterol homeostasis. J Biol Chem, 2003. 278(4): p. 2563-70.

24. Sinal, C.J., et al., Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell, 2000. 102(6): p. 731-44.

25. Horton, J.D., et al., Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest, 1998. 101(11): p. 2331-9.

26. Niesor, E.J., et al., The nuclear receptors FXR and LXRalpha: potential targets for the development of drugs affecting lipid metabolism and neoplastic diseases. Curr Pharm Des, 2001. 7(4): p. 231-59.

27. Ong, T.P., et al., Farnesol and geraniol chemopreventive activities during the initial phases of hepatocarcinogenesis involve similar actions on cell proliferation and DNA damage, but distinct actions on apoptosis, plasma cholesterol and HMGCoA reductase. Carcinogenesis, 2006. 27(6): p. 1194-203.

28. Claudel, T., et al., Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest, 2002. 109(7): p. 961-71.

29. Mencarelli, A., et al., Antiatherosclerotic effect of farnesoid X receptor. Am J Physiol Heart Circ Physiol, 2009. 296(2): p. H272-81.

30. Zhang, Y., et al., Activation of the nuclear receptor FXR improves hyperglycemia and hyperlipidemia in diabetic mice. Proc Natl Acad Sci U S A, 2006. 103(4): p. 1006-11.

31. Cariou, B., et al., The farnesoid X receptor modulates adiposity and peripheral insulin sensitivity in mice. J Biol Chem, 2006. 281(16): p. 11039-49.

32. Hirokane, H., et al., Bile acid reduces the secretion of very low density lipoprotein by repressing microsomal triglyceride transfer protein gene expression mediated by hepatocyte nuclear factor-4. J Biol Chem, 2004. 279(44): p. 45685-92.

33. Maxfield, F.R. and I. Tabas, Role of cholesterol and lipid organization in disease. Nature, 2005. 438(7068): p. 612-21.

34. Rezen, T., et al., Interplay between cholesterol and drug metabolism. Biochim Biophys Acta, 2011. 1814(1): p. 146-60.

35. Goldstein, J.L. and M.S. Brown, Regulation of the mevalonate pathway. Nature, 1990. 343(6257): p. 425-30.

36.Rodwell, V.W., J.L. Nordstrom, and J.J. Mitschelen, Regulation of HMG-CoA reductase. Adv Lipid Res, 1976. 14: p. 1-74.

37. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet, 1994. 344(8934): p. 1383-9.

38. Horton, J.D., J.L. Goldstein, and M.S. Brown, SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest, 2002. 109(9): p. 1125-31.

39. Wang, X., et al., SREBP-1, a membrane-bound transcription factor released by sterol- regulated proteolysis. Cell, 1994. 77(1): p. 53-62.

40. McPherson, P.A., et al., High density lipoprotein subfractions: isolation, composition, and their duplicitous role in oxidation. J Lipid Res, 2007. 48(1): p. 86-95.

41. Tall, A.R., Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins. J Intern Med, 2008. 263(3): p. 256-73.

42. Kontush, A. and M.J. Chapman, Functionally defective high-density lipoprotein: a new therapeutic target at the crossroads of dyslipidemia, inflammation, and atherosclerosis. Pharmacol Rev, 2006. 58(3): p. 342-74.

43. Tall, A.R., Functions of cholesterol ester transfer protein and relationship to coronary artery disease risk. J Clin Lipidol, 2010. 4(5): p. 389-93.

44. Duffy, D. and D.J. Rader, Update on strategies to increase HDL quantity and function. Nat Rev Cardiol, 2009. 6(7): p. 455-63.

45. Bandeali, S. and J. Farmer, High-density lipoprotein and atherosclerosis: the role of antioxidant activity. Curr Atheroscler Rep, 2012. 14(2): p. 101-7.

46. Cockerill, G.W., et al., High-density lipoproteins inhibit cytokine-induced expression of endothelial cell adhesion molecules. Arterioscler Thromb Vasc Biol, 1995. 15(11): p. 1987-94.

47. Nicholls, S.J., et al., Reconstituted high-density lipoproteins inhibit the acute pro-oxidant and proinflammatory vascular changes induced by a periarterial collar in normocholesterolemic rabbits. Circulation, 2005. 111(12): p. 1543-50.

48. Brooks-Wilson, A., et al., Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet, 1999. 22(4): p. 336-45.

49. McNeish, J., et al., High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc Natl Acad Sci U S A, 2000. 97(8): p. 4245-50.

50. Singaraja, R.R., et al., Both hepatic and extrahepatic ABCA1 have discrete and essential functions in the maintenance of plasma high-density lipoprotein cholesterol levels in vivo. Circulation, 2006. 114(12): p. 1301-9.

51. Singaraja, R.R., et al., Increased ABCA1 activity protects against atherosclerosis. J Clin Invest, 2002. 110(1): p. 35-42.

52. Yokoyama, S., Assembly of high-density lipoprotein. Arterioscler Thromb Vasc Biol, 2006. 26(1): p. 20-7.

53. Asztalos, B.F., M. Tani, and E.J. Schaefer, Metabolic and functional relevance of HDL subspecies. Curr Opin Lipidol, 2011. 22(3): p. 176-85.

54. Basso, F., et al., Role of the hepatic ABCA1 transporter in modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res, 2003. 44(2): p. 296-302.

55. Timmins, J.M., et al., Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest, 2005. 115(5): p. 1333-42.

56. Nagata, K.O., et al., ABCA1 dimer-monomer interconversion during HDL generation revealed by single-molecule imaging. Proc Natl Acad Sci U S A, 2013. 110(13): p. 5034-9.

57. Oram, J.F. and A.M. Vaughan, ATP-Binding cassette cholesterol transporters and cardiovascular disease. Circ Res, 2006. 99(10): p. 1031-43.

58. Koldamova, R., N.F. Fitz, and I. Lefterov, ATP-binding cassette transporter A1: From metabolism to neurodegeneration. Neurobiol Dis, 2014.

59. Vaughan, A.M. and J.F. Oram, ABCA1 redistributes membrane cholesterol independent of apolipoprotein interactions. J Lipid Res, 2003. 44(7): p. 1373-80.

60. Vedhachalam, C., et al., Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles. J Biol Chem, 2007. 282(34): p. 25123-30.

61. Neufeld, E.B., et al., Cellular localization and trafficking of the human ABCA1 transporter. J Biol Chem, 2001. 276(29): p. 27584-90.

62.Neufeld, E.B., et al., The ABCA1 transporter modulates late endocytic trafficking: insights from the correction of the genetic defect in Tangier disease. J Biol Chem, 2004. 279(15): p. 15571-8.

63. Chen, W., N. Wang, and A.R. Tall, A PEST deletion mutant of ABCA1 shows impaired internalization and defective cholesterol efflux from late endosomes. J Biol Chem, 2005. 280(32): p. 29277-81.

64. Chisholm, J.W., et al., ApoA-I secretion from HepG2 cells: evidence for the secretion of both lipid-poor apoA-I and intracellularly assembled nascent HDL. J Lipid Res, 2002. 43(1): p. 36-44.

65. Chan, D.C., P.H. Barrett, and G.F. Watts, Recent studies of lipoprotein kinetics in the metabolic syndrome and related disorders. Curr Opin Lipidol, 2006. 17(1): p. 28-36.

66. Chen, W., et al., Preferential ATP-binding cassette transporter A1-mediated cholesterol efflux from late endosomes/lysosomes. J Biol Chem, 2001. 276(47): p. 43564-9.

67. Linder, M.E. and R.J. Deschenes, Palmitoylation: policing protein stability and traffic. Nat Rev Mol Cell Biol, 2007. 8(1): p. 74-84.

68. Lv, Y.C., et al., Posttranscriptional regulation of ATP-binding cassette transporter A1 in lipid metabolism. DNA Cell Biol, 2013. 32(7): p. 348-58.

69. Guay, S.P., et al., ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia. Epigenetics, 2012. 7(5): p. 464-72.

70. Janowski, B.A., et al., An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature, 1996. 383(6602): p. 728-31.

71. Lehmann, J.M., et al., Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem, 1997. 272(6): p. 3137-40.

72. Lawn, R.M., et al., The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest, 1999. 104(8): p. R25-31.

73. Laffitte, B.A., et al., LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc Natl Acad Sci U S A, 2001. 98(2): p. 507-12.

74. Huang, Z.H., et al., Sterol efflux mediated by endogenous macrophage ApoE expression is independent of ABCA1. Arterioscler Thromb Vasc Biol, 2001. 21(12): p. 2019-25.

75. Schmitz, G., T. Langmann, and S. Heimerl, Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res, 2001. 42(10): p. 1513-20.

76. Wang, N., et al., ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci U S A, 2004. 101(26): p. 9774-9.

77. Repa, J.J., et al., Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem, 2002. 277(21): p. 18793-800.

78. Yu, L., et al., Expression of ABCG5 and ABCG8 is required for regulation of biliary cholesterol secretion. J Biol Chem, 2005. 280(10): p. 8742-7.

79. Tontonoz, P. and D.J. Mangelsdorf, Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol, 2003. 17(6): p. 985-93.

80. Miao, B., et al., Raising HDL cholesterol without inducing hepatic steatosis and hypertriglyceridemia by a selective LXR modulator. J Lipid Res, 2004. 45(8): p. 1410-7.

81. Schwartz, K., R.M. Lawn, and D.P. Wade, ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun, 2000. 274(3): p. 794- 802.

82. Costet, P., et al., Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem, 2000. 275(36): p. 28240-5.

83. Tang, C. and J.F. Oram, The cell cholesterol exporter ABCA1 as a protector from cardiovascular disease and diabetes. Biochim Biophys Acta, 2009. 1791(7): p. 563-72.

84. Nicholls, S.J. and S.E. Nissen, New targets of high-density lipoprotein therapy. Curr Opin Lipidol, 2007. 18(4): p. 421-6.

85. Wang, Y. and J.F. Oram, Unsaturated fatty acids inhibit cholesterol efflux from macrophages by increasing degradation of ATP-binding cassette transporter A1. J Biol Chem, 2002. 277(7): p. 5692-7.

86. Arakawa, R. and S. Yokoyama, Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation. J Biol Chem, 2002. 277(25): p. 22426-9.

87. Wang, N., et al., A PEST sequence in ABCA1 regulates degradation by calpain protease and stabilization of ABCA1 by apoA-I. J Clin Invest, 2003. 111(1): p. 99-107.

88. Munehira, Y., et al., Alpha1-syntrophin modulates turnover of ABCA1. J Biol Chem, 2004. 279(15): p. 15091-5.

89. Okuhira, K., et al., Purification of ATP-binding cassette transporter A1 and associated binding proteins reveals the importance of beta1-syntrophin in cholesterol efflux. J Biol Chem, 2005. 280(47): p. 39653-64.

90. Wellington, C.L., et al., ABCA1 mRNA and protein distribution patterns predict multiple different roles and levels of regulation. Lab Invest, 2002. 82(3): p. 273-83.

91. Nagao, K., M. Tomioka, and K. Ueda, Function and regulation of ABCA1--membrane meso- domain organization and reorganization. FEBS J, 2011. 278(18): p. 3190-203.

92. Haidar, B., et al., Apolipoprotein A-I activates cellular cAMP signaling through the ABCA1 transporter. J Biol Chem, 2004. 279(11): p. 9963-9.

93. Martinez, L.O., et al., Phosphorylation of a pest sequence in ABCA1 promotes calpain degradation and is reversed by ApoA-I. J Biol Chem, 2003. 278(39): p. 37368-74.

94. Iwamoto, N., et al., Calmodulin interacts with ATP binding cassette transporter A1 to protect from calpain-mediated degradation and upregulates high-density lipoprotein generation. Arterioscler Thromb Vasc Biol, 2010. 30(7): p. 1446-52.

95. Mizuno, T., et al., Ubiquitination is associated with lysosomal degradation of cell surface- resident ATP-binding cassette transporter A1 (ABCA1) through the endosomal sorting complex required for transport (ESCRT) pathway. Hepatology, 2011. 54(2): p. 631-43.

96. d'Azzo, A., A. Bongiovanni, and T. Nastasi, E3 ubiquitin ligases as regulators of membrane protein trafficking and degradation. Traffic, 2005. 6(6): p. 429-41.

97. Ogura, M., et al., Proteasomal inhibition promotes ATP-binding cassette transporter A1 (ABCA1) and ABCG1 expression and cholesterol efflux from macrophages in vitro and in vivo. Arterioscler Thromb Vasc Biol, 2011. 31(9): p. 1980-7.

98. Marquart, T.J., et al., miR-33 links SREBP-2 induction to repression of sterol transporters. Proc Natl Acad Sci U S A, 2010. 107(27): p. 12228-32.

99. de Aguiar Vallim, T.Q., et al., MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor. Circ Res, 2013. 112(12): p. 1602-12.

100. Schroder, B., et al., Molecular characterisation of 'transmembrane protein 192' (TMEM192), a novel protein of the lysosomal membrane. Biol Chem, 2010. 391(6): p. 695-704.

101. Brady, O.A., X. Zhou, and F. Hu, Regulated Intramembrane Proteolysis of the Frontotemporal Lobar Degeneration Risk Factor, TMEM106B, by Signal Peptide Peptidase-like 2a (SPPL2a). J Biol Chem, 2014. 289(28): p. 19670-19680.

102. Xu, D., et al., Transmembrane protein 106A is silenced by promoter region hypermethylation and suppresses gastric cancer growth by inducing apoptosis. J Cell Mol Med, 2014.

103. Dettmer, U., et al., Transmembrane protein 147 (TMEM147) is a novel component of the Nicalin-NOMO protein complex. J Biol Chem, 2010. 285(34): p. 26174-81.

104. Hu, F., et al., Analysis of promoters and CREB/AP-1 binding sites of the human TMEM174 gene. Exp Ther Med, 2013. 6(5): p. 1290-1294.

105 Li, C., et al., Transmembrane Protein 214 (TMEM214) mediates endoplasmic reticulum stress-induced caspase 4 enzyme activation and apoptosis. J Biol Chem, 2013. 288(24): p. 17908-17.

106. Yu, C., et al., TMEM74, a lysosome and autophagosome protein, regulates autophagy. Biochem Biophys Res Commun, 2008. 369(2): p. 622-9.

107. Szymanska, K., et al., Founder mutations and genotype-phenotype correlations in Meckel- Gruber syndrome and associated ciliopathies. Cilia, 2012. 1(1): p. 18.

108. Woo, I.S., et al., TMEM14A inhibits N-(4-hydroxyphenyl)retinamide-induced apoptosis through the stabilization of mitochondrial membrane potential. Cancer Lett, 2011. 309(2): p. 190-8.

109. Ullrich, S., et al., The novel membrane protein TMEM59 modulates complex glycosylation, cell surface expression, and secretion of the amyloid precursor protein. J Biol Chem, 2010. 285(27): p. 20664-74.

110. Hejzlarova, K., et al., Nuclear genetic defects of mitochondrial ATP synthase. Physiol Res, 2014. 63 Suppl 1: p. S57-71.

111. Houstek, J., S. Kmoch, and J. Zeman, TMEM70 protein - a novel ancillary factor of mammalian ATP synthase. Biochim Biophys Acta, 2009. 1787(5): p. 529-32.

112. Hanein, S., et al., TMEM126A is a mitochondrial located mRNA (MLR) protein of the mitochondrial inner membrane. Biochim Biophys Acta, 2013. 1830(6): p. 3719-33.

113. Maloney, P.R., et al., Identification of a chemical tool for the orphan nuclear receptor FXR. Journal of Medicinal Chemistry, 2000. 43(16): p. 2971-4.

114. Pellicciari, R., et al., 6alpha-ethyl-chenodeoxycholic acid (6-ECDCA), a potent and selective FXR agonist endowed with anticholestatic activity. J Med Chem, 2002. 45(17): p. 3569-72.

115. Bligh, E.G. and W.J. Dyer, A rapid method of total lipid extraction and purification. Can J Biochem Physiol, 1959. 37(8): p. 911-7.

116. Yin, L., et al., Hepatic hepatocyte nuclear factor 4alpha is essential for maintaining triglyceride and cholesterol homeostasis. Arterioscler Thromb Vasc Biol, 2011. 31(2): p. 328-36.

117. Zhang, Y., et al., Peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha) regulates triglyceride metabolism by activation of the nuclear receptor FXR. Genes Dev, 2004. 18(2): p. 157-69.

118. Moghadasian, M.H., et al., Pathophysiology of apolipoprotein E deficiency in mice: relevance to apo E-related disorders in humans. FASEB J, 2001. 15(14): p. 2623-30.

119. Laffitte, B.A. and P. Tontonoz, Orphan nuclear receptors find a home in the arterial wall. Curr Atheroscler Rep, 2002. 4(3): p. 213-21.

120. Repa, J.J. and D.J. Mangelsdorf, The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu Rev Cell Dev Biol, 2000. 16: p. 459-81.

121. Wang, C., et al., Celastrol suppresses obesity process via increasing antioxidant capacity and improving lipid metabolism. Eur J Pharmacol, 2014.

122. Dong, Y., et al., Small-animal PET demonstrates brain metabolic change after using bevacizumab in a rat model of cerebral ischemic injury. Neurosci Bull, 2014. 30(5): p. 838-44.

123. Brunham, L.R., et al., Tissue-specific roles of ABCA1 influence susceptibility to atherosclerosis. Arterioscler Thromb Vasc Biol, 2009. 29(4): p. 548-54.

124. Zhang, S.H., et al., Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science, 1992. 258(5081): p. 468-71.

125. Klammt, C., et al., Facile backbone structure determination of human membrane proteins by NMR spectroscopy. Nat Methods, 2012. 9(8): p. 834-9.

126. Yamauchi, Y., et al., Apolipoprotein A-I activates protein kinase C alpha signaling to phosphorylate and stabilize ATP binding cassette transporter A1 for the high density lipoprotein assembly. J Biol Chem, 2003. 278(48): p. 47890-7.

127. Durrington PN (2007). Hyperlipidaemia. Diagnosis and Management. Hodder Arnold, London.