P53 Overexpression Represses Androgen-Mediated Induction of NKX3.1 in a Prostate Cancer Cell Line
Total Page：16
File Type：pdf, Size：1020Kb
EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 38, No. 6, 625-633, December 2006 p53 overexpression represses androgen-mediated induction of NKX3.1 in a prostate cancer cell line Anli Jiang1*, Chunxiao Yu1*, NKX3.1 protein, human; prostate neoplasms; p53 Pengju Zhang1, Weiwen Chen1, 1 1 Wenwen Liu , Xiaoyan Hu and Introduction Jianye Zhang1,2 NKX3.1 is an androgen regulated prostate-specific 1Department of Biochemistry homeobox gene (Prescott et al., 1998) that is Medical School of Shandong University thought to be involved in prostate development and Jinan 250012, China carcinogenesis (Bhatia-Gaur et al., 1999). Several 2Corresponding author: Tel, 86-531-88382092; different mouse models with Nkx3.1 dificiency have E-mail, [email protected] demonstrated abnormal ductal morphogenesis, *These authors contributed equally to this work. hyperplasias, and PIN-like lesions in the prostate (Abdulkadir et al., 2002; Kim et al., 2002). Human Accepted 11 October 2006 NKX3.1 has been mapped to human chromosome 8p21, a locus that is frequently deleted in prostate Abbreviations: AR, androgen acceptor; ARE, androgen responsive cancer (Cher et al., 1996; Vocke et al., 1996; Dong, element; CCS, charcoal-treated fetus cattle serum; EMSA, 2001; Asatiani et al., 2005). Loss of NKX3.1 Electrophoresis mobility shift assay; p53 RE, p53 response element; expression has been shown to be associated with p53mt, mutation type p53; p53wt, wild type p53; PIN, prostatic hormone-refractory prostate cancer and advanced intraepithelial neoplasia tumor stage (Bowen et al., 2000); however, over- expression of NKX3.1 in prostate cancer also has been reported (Xu et al., 2000). No mutations in the Abstract NKX3.1 coding region have been found (Voeller et al., 1997; Ornstein et al., 2001). So far, the function Prostate cancer is a disease involving complicated of NKX3.1 in prostate cancer has been shown to be multiple-gene alterations. Both NKX3.1 and p53 are complicated and the regulatory mechanisms of related to prostate cancer and play crucial roles in NKX3.1 expression are not well known. prostate cancer progression. However, little is The p53 tumor suppressor gene encodes a known about the relationships and interactions nuclear transcription factor that is activated and between p53 and NKX3.1 in prostate cancer. We accumulates in cells in response to a variety of found that NKX3.1 expression is down-regulated by stresses inducing growth arrest or apoptosis. In prostate cancer, alterations in the p53 gene are over-expression of wild type (wt) p53 in prostate clearly associated with a progressive disease, in- cancer LNCaP cells. NKX3.1 is down-regulated at cluding metastases to bone and androgen-inde- both the mRNA and protein levels by p53 over- pendent growth (Navone et al., 1993; Aprikian et al., expression due to either transient transfection of 1994; Eastham et al., 1995; Meyers et al., 1998; exogenous p53 or induction of endogenous p53. p53 Burchardt et al., 2001). Recent evidence suggests over-expression represses androgen-induced trans- that p53 is involved in androgen signaling. Cronauer activation of NKX3.1 by inhibiting the promoter of the et al. analyzed the effect of p53 on androgen androgen acceptor (AR) gene and by blocking signaling in 22Rv1 and LNCaP prostate cancer cells. AR-DNA binding activity. In addition, transfection Overexpression of p53 diminished the androgenic with the p21 expression vector (pPSA-p21) showed response in both cell lines. AR, p53 and NKX3.1 are that p21 does not reduce NKX3.1 expression, all related to prostate cancer and play crucial roles in indicating that NKX3.1 expression is not the result of prostate cancer progression. However, little is nonspecific effects of cell growth arrest. Our results known about their relationships and interactions in provide biochemical and cellular biologic evidence prostate cancer. We report that NKX3.1 expression that NKX3.1 is down-regulated by p53 over-ex- is regulated by over-expression of wild type (wt) p53 pression in prostate cancer cells. in prostate cancer LNCaP cells and we provide evidence for the mechanisms that control down Keywords: androgens; gene expression regulation; regulation of NKX3.1 by p53 over-expression in 626 Exp. Mol. Med. Vol. 38(6), 625-633, 2006 Table 1. Primers used in PCR for mutagenesis analysis. 10-8 mol/l of the synthetic androgen analog R1881 (New England Nuclear, Germany). Names Sequences of primers PF + 8 5'GGCCTCGAGCGCACCGCTTTCACTTTC3' Transient transfection PR-1032 5'CGCGAGCTCAAGGCAGGAGGATCACTTG3' For a luciferase reporter assay, LNCaP cells were ID-507 5'TGCACCTACTCTTTGAGGTCGTAGATA 3' seeded in 24-well plates and transfected at appro- ximately 90% cell confluence. pGL3 constructs were ID-518 5'GACCTCAAAGAGTAGGTGCAGCCAGAC 3' cotransfected with pCMV-p53 (BD Biosciences, USA), with pCMV-p53 plus AR-expressing plasmid (Dr. Charles Young, Mayo Clinics, USA), with AR- LNCaP cells. expressing plasmid, or with vector lacking cDNA (as a control). The pRL-TK vector (Promega) was used to correct for the transfection efficiency. Transfection Materials and Methods was performed using lipofectimineTM 2000 (Invetri- gen) according to the manufacturer's instructions. Construction of luciferase reporter plasmids After an incubation period of 6 h in RPMI-1640 without serum and antibiotics, the medium was The pGL3-1040 bp NKX3.1 promoter was originally changed to RPMI-1640 containing 2% CCS, with or constructed by Jiang et al. (2004). -8 There is a 5' half site of the p53 response element without 10 mol/l of R1881. The reporter activity was (p53 RE) between -517 and -508 upstream of the assessed after a 48 h incubation period using the NKX3.1 gene. A p53 RE internal deletion from -517 Dual-Luciferase Reporter Assay System (Promega, to -508 was performed by a modified inverse PCR Germany). For RT-PCR and western blot analysis, LNCaP method. pGL3-1040 was used as the template and two pairs of primers (sequences shown in Table 1) cells were seeded in 25 ml bottles and transfected were required for inverse PCR. The 5' flanking with pCMV-p53, with pPSA-p21 (kindly provided by fragment was amplified using the primers PR-1032 Dr. Charles Young, Mayo Clinics, USA), or with and ID-518, and the 3' flanking fragment was pCMV-p53 plus AR-expressing plasmid. Vectors amplified using the primers PF + 8 and ID-507. lacking p53 cDNA were used as a control. Cells Inverse PCR was performed using pyrobest poly- were harvested for RT-PCR and western blot merase (TaKaRa, Japan) with denaturation at 94oC analysis 48 h after transfection. for 2 min, followed by 35 cycles at 94oC for 30 s, o o 62 C for 30 s, and 72 C for 1 min. The amplified 5' Dual-luciferase reporter assay and 3' flanking fragments were purified and then The activities of firefly luciferase in pGL3 and of ligated by PCR using pyrobest polymerase and the Renilla luciferase in pRL-TK were determined primers PR- 1032 and PF + 8 with denaturation at o o following the dual-luciferase reporter assay protocol 94 C for 2 min, annealing at 55 C for 30 s, and recommended by Promega. The cells were rinsed extension at 72oC for 2 min, followed by 35 cycles at o o o twice with PBS buffer and cell lysates were prepared 94 C for 30 s, 63 C for 30 s, and 72 C for 1 min. The by manually scraping the cells from culture plates in resultant fragment was purified and cut with XhoI and the presence of 1 × PLB (passive lysis buffer). SacI, then inserted into the equivalent site of the Twenty l of cell lysate was transferred into a pGL -basic vector (Promega) to generate the p53 RE 3 luminometer tube containing 100 l of LAR II, and internal deletion mutant designated as pGL3-p53id. the firefly luciferase activity (M1) was measured first. The Renilla luciferase activity (M2) was then mea- Cell culture sured after adding 100 l of Stop & Glo Reagent. The human prostate cancer cell line LNCaP was The results were calculated and expressed as the obtained from the American Type Culture Collection ratio of M1/M2. Analyses were carried out twice or (ATCC). The line, which was established from lymph three times with double replicates. Data are pre- node metastasis of a prostate cancer patient, sented as mean ± S.D. expresses the AR, NKX3.1 and the wild type p53 genes. LNCaP cells were routinely maintained in Electrophoresis mobility shift assay (EMSA) RPMI-1640 supplemented with 10% fetal bovine Nuclear extracts from LNCaP cells were prepared serum (Gibco) and antibiotics. Cells were cultured in according to the instructions for the nuclear extract RPMI-1640 containing 2% charcoal-treated fetus kit (ACTIVE MOTIF) and quantified following the cattle serum，CCS (Gibco), and supplemented with BCA method. Double-stranded ARE probes (sense p53 overexpression represses NKX3.1 627 sequence TGCAGAACAGCAAGTGCTAGC) were except that the protein extracts were incubated with generated by annealing equimolar complementary the probe in the presence of a 125-fold molar excess oligonucleotides in TEN buffers at 95oC for 10 min of unlabeled double-stranded oligonucleotides as a with a slow cool-down period to room temperature. competitor. Subsequently, the DNA-protein comple- The double-stranded probes were labeled with digo- xes were separated from the free probes by xigenin (Roche, Germany) using terminal transfera- electrophoresis on 5% non-denaturing polyacry- se (Roche, Germany). For EMSA, 32 pmol of lamide gel (Sigma). Electro-blotting and chemilu- labeled probes were incubated for 20 min at 25oC minescent detection were performed according to with 20 g of nuclear extract in the presence of 1 g the instructions for the DIG Gel Shift Kit (Roche, of poly (dI-dC), 0.1 g of poly L-lysine, 30 mmol/l Germany). KCl, 20 mmol/l HEPES, 10 mmol/l (NH4)2SO4, 1 mmol/l DTT, 0.2% v/v Tween 20, and 1 mmol/l EDTA.