• Abstract and Figures
• Public Full-text

View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institute of Hydrobiology, Chinese Academy Of Sciences Arch Virol (2007) 152: 1457–1465 DOI 10.1007/s00705-007-0971-8 Printed in The Netherlands Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China Y. Teng1;Ã, H. Liu2;3;Ã,J.Q.Lv2,W.H.Fan2, Q. Y. Zhang3, and Q. W. Qin1 1 State Key Laboratory of Biocontrol, College of Life Sciences, Sun Yat-sen University, Guangzhou, P.R. China 2 The Key Laboratory of Aquatic Animal Diseases, Shenzhen Exit & Entry Inspection and Quarantine Bureau, Shenzhen, P.R. China 3 State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, P.R. China Received November 15, 2006; accepted March 14, 2007; published online April 20, 2007 # Springer-Verlag 2007 Summary the first report of a complete genome sequence of The complete genome of spring viraemia of carp SVCV isolated from cultured carp in China. Phylo- virus (SVCV) strain A-1 isolated from cultured genetic analysis indicates that SVCV A-1 is closely common carp (Cyprinus carpio) in China was se- related to the members of the genus Vesiculovirus, quenced and characterized. Reverse transcription- family Rhabdoviridae. polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 con- Introduction sists of 11,100 nucleotide base pairs, the predicted Spring viraemia of carp (SVC) is a viral disease size of the viral RNA of rhabdoviruses. However, that causes outbreaks in common carp (Cyprinus the additional insertions in bp 4633–4676 and carpio) and several other freshwater fish species like bp 4684–4724 of SVCV A-1 were different from koi carp (C. carpio koi), crucian carp (Carassius the other two published SVCV complete genomes. carassius), big head (Hypophthalmichthys moli- Five open reading frames (ORFs) of SVCV A-1 trix), silver carp (Aristichthys nobilis) and sheatfish were identified and further confirmed by RT-PCR (Silurus glanis). The disease was initially identified and DNA sequencing of their respective RT-PCR in European countries, and recently has been re- products. The 5 structural proteins encoded by the ported in the Middle East area and America as an 0 0 viral RNA were ordered 3 -N-P-M-G-L-5 . This is emerging viral disease [2, 6, 10, 20]. SVC outbreaks often occur at water temperatures à between 10 and 18 C, and mostly in the spring. The These authors contributed equally to this work. major clinical signs in common carp are hemor- Author’s address: Dr. Qi Wei Qin, State Key Laboratory of Biocontrol, College of Life Sciences, Sun Yat-sen Univer- rhages of the gills and skin, abdominal distension sity, 135 West Xingang Road, Guangzhou 510275, P.R. and an inflamed vent, internal ascites, peritonitis China. e-mail: [email protected] and petechial hemorrhages of the internal swim- 1458 Y. Teng et al. bladder wall and in skeletal muscle [2]. Mortality Virus propagation, purification and RNA extraction caused by SVC in juvenile carp can reach up to SVCVA-1 virus was propagated and purified as described by 70% during spring outbreaks. It has been reported Hoffmann et al. [10] with minor modifications. Briefly, con- that the disease has a significant impact on yearling fluent monolayers of CO cells were inoculated with the virus at a MOI of approximately 0.1 for 1 h. The inoculum was carp in Europe, with estimated losses of 10–15% removed and the monolayer cells were incubated in fresh for 1-year-old carp, equivalent to approximately culture medium supplemented with 10% FBS. When CPE 4,000 metric tons annually [15]. became significant, virus-infected cultures were harvested The causative agent of SVC is spring viraemia of and treated by 3 cycles of rapid freezing=thawing and ultra- carp virus (SVCV), which exhibits a typical bullet sonication, and then centrifuged at 4000Âg for 20 min at 4 C. The supernatant was collected and layered onto a 5-ml shape with size about 80–180 nm in length and 60– cushion of 10% sucrose in STE (0.15 M NaCl, 0.01 M Tris– 90 nm in diameter and is closely related to members HCl, pH 8.3, 0.01 M EDTA, pH 7.0), and then centrifuged in of the genus Vesiculovirus, family Rhabdoviridae a Beckman SW41 rotor at 24,000 rpm for 120 min at 12 C. [3, 6]. SVCV contains a linear, negative-sense and The virus pellet was loaded onto 10–40% (w=v) sucrose single-stranded RNA genome, which encodes 5 gradients and centrifuged at 21,000 rpm for 60 min at 12 C structural proteins: nucleoprotein (N), phosphopro- in a SW40 rotor. Resulting virus bands were collected by puncturing the centrifuge tubes with a needle, diluted with tein (P), matrix protein (M), glycoprotein (G), and STE buffer, and repelleted in a SW41 rotor at 42,000 rpm for viral RNA-dependent RNA polymerase (L) in the 60 min at 12 C. The purified virus pellet was resuspended in order 30-N-P-M-G-L-50 [5, 18]. To date, only two 200 ml STE buffer and stored at À20 C. The genomic RNA complete nucleotide sequences, representing the was extracted with phenol:chlorophorm:isoamyl alcohol and genome of an American Type Culture Collection precipitated in 70% ethanol. The precipitated RNA was re- suspended in diethypyrocarbonate (DEPC)-treated water. (ATCC) reference strain of SVCV VR-1390, have been published: SVCV NC_002803 [5] and SVCV AJ318079 [10]. Cloning of the SVCV genome Recently, a novel SVCV strain was isolated from In order to clone the 30-terminal region of the genomic RNA, cultured common carp at our laboratory in China, the 30 poly(A) tail was synthesized with poly(A) polymerase. and the virus isolate was able to infect and cause Tailing was catalyzed by 10 ml of poly(A)-tailing mixture, significant mortality in young carp. To our knowl- which contained 2 mlof5 reaction buffer, 0.5 mlof100mM ATP, 0.5 ml of RNasin (40 U=ml), 1 ml of yeast poly(A) poly- edge, this is the first isolation of pathogenic SVCV merase (Promega, USA), and 10 ng of SVCV A-1 genomic from fish in Asia, and we tentatively designated it RNA. The cDNA synthesis and polymerase chain reaction as SVCV Asia-1 (SVCV A-1). In order to under- were conducted by the method of Kima et al. [13], using the stand SVCV A-1 at the molecular level, the entire ODT-M13 primer (50-ACG ACG GCC AGT TTT TTT TTT genome of the virus was cloned and sequenced. The TTT TT-30) for the first-strand synthesis, in combination with 0 authenticity of the genomic open reading frames the SVCV N primer (5 -ATG AGT GTC ATT CGG ATC AA-30) for PCR. (ORFs) was further confirmed by reverse trans- The 50-end of the genomic RNA was cloned by poly(G)- cription-PCR (RT-PCR). The gene and deduced and poly(C)-tailing of the cDNA, followed by polymerase amino acid sequences of the 5 structural proteins chain reaction. The first strand was synthesized using the were compared with other known representative Access RT-PCR System (Promega, USA), with 1 mgofpur- 0 fish rhabdoviruses. ified genomic RNA and 50 pM of SVCV-L8 (5 -TCT GGG ACA TGG GTA GAA TAG-30) primer located at nucleotides 11041–11061 on the genomic RNA. The cDNA was treated with RNase H, extracted with phenol=chloroform, and pre- Materials and methods cipitated with ethanol. The cDNA was divided into two aliquots, which were tailed separately with poly(G) or Cell line and virus poly(C) as described previously [1, 7], using terminal deox- Grass carp ovary (CO) cells were used for propagation of ynucleotidyl transferase (TdT; TaKaRa, Japan). The tailed the SVCV A-1 strain. The CO cells were cultured in M199 cDNA was amplified with the internal primer SVCV-t2 medium containing 10% fetal bovine serum (FBS) at 24 C. (50-GTA AAC ATC CAG TTT TTT TC-30), together with The viral pathogen SVCV A-1 was originally isolated from the SVCV-Rt (50-ATC AAT AGA AGG GGG GGG GG-30) virus-infected common carp in China. and SVCV-Ft (50-CCT GTC AGT ACC CCC CCC CC-30) Characterization of the SVCV A-1 genome 1459 Table 1. Oligonucleotide primers used for genome sequencing of SVCV A-1 Clone Primer name Sense Sequence (50 –30) Remark pGT-GL SVCV-C Genomic AGAGTAAACGGCCTGCAACA AvaI SVCV-N Antigenomic CCAAAATGCTTCAATGTGAG EcoRI pGT-L1 SVCV-FL1 Genomic GAGAGCCATACCATCGTTAT NcoI SVCV-RL1 Antigenomic TCAGTATTGTTCACTAGTGA pGT-L2 SVCV-FL2 Genomic AGATATACAGCTGATATTGACC PstI SVCV-RL2 Antigenomic AGATGAGACTCGACTCAAAG EcoRI pGT-L3 SVCV-FL3 Genomic ACTACAACGGGAGGCCAGAC SVCV-RL3 Antigenomic CAATCATCATAAGGCAAAAA pGT-L4 SVCV-FL4 Genomic CAATGCACAATCCTGCCATT EcoRI SVCV-RL4 Antigenomic TGCTAGAGCATTCCCAGATG pGT-L5 SVCV-FL5 Genomic CTCAAGCAGATTTGCTTCGA SVCV-RL5 Antigenomic TCTCAATTCTCCAGTTGTCA pGT-L6 SVCV-FL6 Genomic GAGAATTCGACAAATTCTACAG EcoRI SVCV-RL6 Antigenomic AATTTCTGATCAGGTACCCC EcoRI pGT-L7 SVCV-FL7 Genomic ATCTGAAAAGATCTTTGAAA AvaI SVCV-RL7 Antigenomic GACACGACAGTGTTTATTTT HindIII pGT-L8 SVCV-FL8 Genomic ATCTTTAACAGTCTTTTGGAGC EcoRI SVCV-RL8 Antigenomic CTATTCTACCCATGTCCCAG ClaI primers, which are complementary to the poly(G) and mum of 40 codons was considered to be a putative gene. poly(C) tails, respectively. These ORFs were searched in the NCBI nucleotide database The primers for the N, P, M, G, and L genes of SVCV for identity analysis. The nucleotide and deduced amino acid A-1 were derived from the published sequences of SVCV sequences were analyzed using Vector NTI Suite 9.0, and AJ318079 and are listed in Table 1.

Load more

  9

Copy Link