DOCSLIB.ORG

A Genome-Wide Scan of Cleft Lip Triads Identifies Parent

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Genome-Wide Scan of Cleft Lip Triads Identifies Parent F1000Research 2019, 8:960 Last updated: 03 AUG 2021 RESEARCH ARTICLE A genome-wide scan of cleft lip triads identifies parent- of-origin interaction effects between ANK3 and maternal smoking, and between ARHGEF10 and alcohol consumption [version 2; peer review: 2 approved] Øystein Ariansen Haaland 1, Julia Romanowska1,2, Miriam Gjerdevik1,3, Rolv Terje Lie1,4, Håkon Kristian Gjessing 1,4, Astanand Jugessur1,3,4 1Department of Global Public Health and Primary Care, University of Bergen, Bergen, N-5020, Norway 2Computational Biology Unit, University of Bergen, Bergen, N-5020, Norway 3Department of Genetics and Bioinformatics, Norwegian Institute of Public Health, Skøyen, Oslo, Skøyen, N-0213, Norway 4Centre for Fertility and Health (CeFH), Norwegian Institute of Public Health, Skøyen, Oslo, N-0213, Norway v2 First published: 24 Jun 2019, 8:960 Open Peer Review https://doi.org/10.12688/f1000research.19571.1 Latest published: 19 Jul 2019, 8:960 https://doi.org/10.12688/f1000research.19571.2 Reviewer Status Invited Reviewers Abstract Background: Although both genetic and environmental factors have 1 2 been reported to influence the risk of isolated cleft lip with or without cleft palate (CL/P), the exact mechanisms behind CL/P are still largely version 2 unaccounted for. We recently developed new methods to identify (revision) report parent-of-origin (PoO) interactions with environmental exposures 19 Jul 2019 (PoOxE) and now apply them to data from a genome-wide association study (GWAS) of families with children born with isolated CL/P. version 1 Methods: Genotypes from 1594 complete triads and 314 dyads (1908 24 Jun 2019 report report nuclear families in total) with CL/P were available for the current analyses. Of these families, 1024 were Asian, 825 were European and 59 had other ancestries. After quality control, 341,191 SNPs remained 1. Evie Stergiakouli , University of Bristol, from the original 569,244. The exposures were maternal cigarette Bristol, UK smoking, use of alcohol, and use of vitamin supplements in the MRC Integrative Epidemiology at the periconceptional period. Our new methodology detects if PoO effects are different across environmental strata and is implemented in the R- University of Bristol, Bristol, UK package Haplin. Results: Among Europeans, there was evidence of a PoOxSmoke 2. Yongchu Pan , Nanjing Medical University effect for ANK3 with three SNPs (rs3793861, q=0.20, p=2.6e-6; (NMU), Nanjing, China rs7087489, q=0.20, p=3.1e-6; rs4310561, q=0.67, p=4.0e-5) and a PoOxAlcohol effect for ARHGEF10 with two SNPs (rs2294035, q=0.32, Any reports and responses or comments on the p=2.9e-6; rs4876274, q=0.76, p=1.3e-5). article can be found at the end of the article. Conclusion: Our results indicate that the detected PoOxE effects have a plausible biological basis, and thus warrant replication in other independent cleft samples. Our demonstration of the feasibility of identifying complex interactions between relevant environmental Page 1 of 28 F1000Research 2019, 8:960 Last updated: 03 AUG 2021 exposures and PoO effects offers new avenues for future research aimed at unravelling the complex etiology of cleft lip defects. Keywords Orofacial cleft, cleft lip with or without cleft palate, case-parent triads, gene-environment interaction, parent-of-origin, PoOxE, Haplin Corresponding author: Øystein Ariansen Haaland ([email protected]) Author roles: Haaland ØA: Conceptualization, Data Curation, Formal Analysis, Methodology, Software, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing; Romanowska J: Conceptualization, Formal Analysis, Methodology, Software, Visualization, Writing – Review & Editing; Gjerdevik M: Conceptualization, Formal Analysis, Methodology, Software, Visualization, Writing – Review & Editing; Lie RT: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Software, Supervision, Writing – Review & Editing; Gjessing HK: Conceptualization, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Software, Writing – Review & Editing; Jugessur A: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Software, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests: No competing interests were disclosed. Grant information: This research was supported by the Bergen Medical Research Foundation [807191], by the Research Council of Norway (RCN) through its Centres of Excellence funding scheme [grant 262700], and by the Biobank Norway II from the RCN [245464]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2019 Haaland ØA et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite this article: Haaland ØA, Romanowska J, Gjerdevik M et al. A genome-wide scan of cleft lip triads identifies parent-of- origin interaction effects between ANK3 and maternal smoking, and between ARHGEF10 and alcohol consumption [version 2; peer review: 2 approved] F1000Research 2019, 8:960 https://doi.org/10.12688/f1000research.19571.2 First published: 24 Jun 2019, 8:960 https://doi.org/10.12688/f1000research.19571.1 Page 2 of 28 F1000Research 2019, 8:960 Last updated: 03 AUG 2021 may also provide an opportunity to intervene on environmen- REVISE D Amendments from Version 1 tal risk factors alone, particularly in subgroups of the popula- In this version we have considered the remarks of Dr. Evie tion that are genetically more susceptible to these environmental Stergiakouli. We have addressed some limitations that were effects. pointed out and generally edited the manuscript for clarity. Abstract: Recently, we went one step further and developed new meth- Removed reference to previously published work and added ods for a genome-wide screening for PoO interactions information about the methodology. with environmental exposures (i.e., PoOxE) in the case-parent Introduction: triad setting22. We applied the new methodology, implemented Rephrased sentence that overemphasized how intriguing the in the R-package Haplin26, to isolated cleft palate only (CPO)27, problem of missing heritability is in clefting. using genotypes and exposure data from the largest pub- Methods: lished GWAS dataset on case-parent triads of orofacial clefts11. Clarified that 59 individuals of other ethnicities than Asian or European were included in the pooled sample and added a Epidemiological and embryological findings have previously sentence about the American Statistical Association’s negative shown that CL/P and CPO may have distinct etiologies. There- attitudes towards using a fixed p-value as a threshold for fore, we used the same GWAS dataset and methodology to per- statistical significance. form a genome-wide scan for PoOxE effects in the larger sample Results: of isolated CL/P. Revised titles of Table 3, Table 4 and Table 7 to include information about which analyses were conducted. Methods Discussion: Study participants Added a paragraph about genomic imprinting as a possible mechanism for PoO effects, clarified that our findings should The study participants were mainly of Asian or European be treated with caution until they have been replicated, and origin and were recruited as part of an international cleft addressed the limitation that we have not imputed genotypes. collaboration11. Information was available on genotypes as In general: well as maternal vitamin use, cigarette smoking and alcohol Corrected minor errors and slightly altered text to improve flow consumption in the periconceptional period (three months and precision. before and three months after pregnancy). The information on See referee reports environmental exposures was based on interviews and question- naires. More detailed characteristics of the study participants can be found in our recent work28. Introduction Cleft lip with or without cleft palate (CL/P) appears in Table 1 shows the distribution of the CL/P families approximately 3.4 to 22.9 per 10,000 live births1. Based on according to ethnicity, triad completeness and maternal exposure. the severity of the cleft, patients undergo varying degrees of There were 1908 families in the pooled sample (5424 individuals medical, dental, speech and psychosocial interventions over the in total), which included all the participants. Of these, 825 fami- first two decades of their lives, a long-term multidisciplinary lies were in the European sample, 1024 families were in the Asian treatment that not only imposes a heavy burden on patients and sample, and 59 families were in the sample consisting of other their families2,3, but also accounts for a substantial outlay in ethnicities (Table 1). We performed three main sets of analyses national healthcare budgets4,5. on the following samples: All participants (denoted as “pooled analysis”), only Asians (“Asian analysis”), and only Europe- Multiple genetic and environmental factors have been reported ans (“European analysis”). The 59 families with other ethnicities to influence the risk of CL/P, individually and through were not analyzed as a group due to the small sample size, but complex interactions in relevant biological pathways6–10. Major they were included in the pooled analysis. In the pooled and
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • Hormone Therapy Use and Breast Tissue DNA
    http://www.diva-portal.org This is the published version of a paper published in Epigenetics. Citation for the original published paper (version of record): Harlid, S., Xu, Z., Kirk, E., Wilson, L E., Troester, M A. et al. (2019) Hormone therapy use and breast tissue DNA methylation: analysis of epigenome wide data from the normal breast study Epigenetics, 14(2): 146-157 https://doi.org/10.1080/15592294.2019.1580111 Access to the published version may require subscription. N.B. When citing this work, cite the original published paper. Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-157445 EPIGENETICS 2019, VOL. 14, NO. 2, 146–157 https://doi.org/10.1080/15592294.2019.1580111 RESEARCH PAPER Hormone therapy use and breast tissue DNA methylation: analysis of epigenome wide data from the normal breast study Sophia Harlid a,b, Zongli Xuc, Erin Kirkd, Lauren E. Wilson c,e, Melissa A. Troesterd, and Jack A. Taylor a,c aEpigenetics & Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA; bDepartment of Radiation Sciences, Oncology, Umeå University, Umeå, Sweden; cEpidemiology Branch, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA; dDepartment of Epidemiology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA; eDepartment of Population Health Sciences, Duke University School of Medicine, Durham, NC, USA ABSTRACT ARTICLE HISTORY Hormone therapy (HT) is associated with increased risk of breast cancer, strongly dependent on Received 4 September 2018 type, duration, and recency of use. HT use could affect cancer risk by changing breast tissue Revised 21 December 2018 transcriptional programs.
    [Show full text]
  • RSU1) in Cancer Cell Metastasis: a Tale of a Tumor Suppressor
    International Journal of Molecular Sciences Review Ras Suppressor-1 (RSU1) in Cancer Cell Metastasis: A Tale of a Tumor Suppressor Maria Louca 1, Triantafyllos Stylianopoulos 1 and Vasiliki Gkretsi 2,* 1 Cancer Biophysics Laboratory, Department of Mechanical and Manufacturing Engineering, University of Cyprus, 1678 Nicosia, Cyprus; [email protected] (M.L.); [email protected] (T.S.) 2 Biomedical Sciences Program, Department of Life Sciences, School of Sciences, European University Cyprus, 1516 Nicosia, Cyprus * Correspondence: [email protected]; Tel.: +357-22-559-630 Received: 18 May 2020; Accepted: 5 June 2020; Published: 7 June 2020 Abstract: Cancer is a multifactorial disease responsible for millions of deaths worldwide. It has a strong genetic background, as mutations in oncogenes or tumor suppressor genes contribute to the initiation of cancer development. Integrin signaling as well as the signaling pathway of Ras oncogene, have been long implicated both in carcinogenesis and disease progression. Moreover, they have been involved in the promotion of metastasis, which accounts for the majority of cancer-related deaths. Ras Suppressor-1 (RSU1) was identified as a suppressor of Ras-induced transformation and was shown to localize to cell-extracellular matrix adhesions. Recent findings indicate that its expression is elevated in various cancer types, while its role in regulating metastasis-related cellular processes remains largely unknown. Interestingly, there is no in vivo work in the field to date, and thus, all relevant knowledge stems from in vitro studies. In this review, we summarize recent studies using breast, liver and brain cancer cell lines and highlight the role of RSU1 in regulating cancer cell invasion.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
    cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization.
    [Show full text]
  • Broad Poster Vivek
    A novel computational method for finding regions with copy number abnormalities in cancer cells Vivek, Manuel Garber, and Mike Zody Broad Institute of MIT and Harvard, Cambridge, MA, USA Introduction Results Cancer can result from the over expression of oncogenes, genes which control and regulate cell growth. Sometimes oncogenes increase in 1 2 3 activity due to a specific genetic mutation called a translocation (Fig 1). SMAD4 – a gene known to be deleted in pancreatic COX10 – a gene deleted in cytochrome c oxidase AK001392 – a hereditary prostate cancer protein This translocation allows the oncogene to remain as active as its paired carcinoma deficiency, known to be related to cell proliferation gene. Amplification of this mutation can occur, thereby creating the proper conditions for uncontrolled cell growth; consequently, each Results from Analysis Program Results from Analysis Program Results from Analysis Program component of the translocation will amplify in similar quantities. In this mutation, the chromosomal region containing the oncogene displaces to Region 1 Region 2 R2 Region 1 Region 2 R2 Region 1 Region 2 R2 a region on another chromosome containing a gene that is expressed Chr18:47044749-47311978 Chr17:13930739-14654741 0.499070821478475 Chr17:13930739-14654741 Chr18:26861790-27072166 0.47355172850856 Chr17:12542326-13930738 Chr8:1789292-1801984 0.406208680312004 frequently. Actual region containing gene Actual region containing gene Actual region containing gene chr18: 45,842,214 - 48,514,513 chr17: 13,966,862 - 14,068,461 chr17: 12,542,326 - 13,930,738 Fig 1. Two chromosomal regions (abcdef and ghijk) are translocating to create two new regions (abckl and ghijedf).
    [Show full text]
  • ARHGEF4 (NM 015320) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC215591 ARHGEF4 (NM_015320) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ARHGEF4 (NM_015320) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ARHGEF4 Synonyms: ASEF; ASEF1; GEF4; SMIM39; STM6 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 ARHGEF4 (NM_015320) Human Tagged ORF Clone – RC215591 ORF Nucleotide >RC215591 representing NM_015320 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCTGGGAAGAACCAGCAGGTGAGAAGCCCAGTTGCTCTCACAGTCAGAAGGCATTCCACATGGAGC CTGCCCAGAAGCCCTGCTTCACCACTGACATGGTGACATGGGCCCTCCTCTGCATCTCTGCAGAGACTGT GCGTGGGGAGGCTCCTTCACAGCCTAGGGGCATCCCTCACCGCTCGCCCGTCAGTGTGGATGACCTGTGG CTGGAGAAGACACAGAGAAAGAAGTTGCAGAAGCAGGCCCACATCGAAAGGAGGCTGCACATAGGGGCAG TGCACAAAGATGGAGTCAAGTGCTGGAGAAAGACGATCATTACCTCTCCAGAGTCTTTGAATCTCCCTAG AAGAAGCCATCCACTCTCCCAGAGTGCTCCAACGGGACTGAACCACATGGGCTGGCCAGAGCACACACCA GGCACTGCCATGCCTGATGGAGCTCTGGACACAGCTGTCTGCGCTGACGAAGTGGGGAGCGAGGAGGACC TGTATGATGACCTGCACAGCTCCAGCCACCACTACAGCCACCCTGGAGGGGGTGGGGAGCAGCTGGCTAT CAATGAGCTCATCAGCGATGGCAGTGTGGTCTGCGCTGAAGCACTCTGGGACCATGTCACCATGGACGAC
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Long, Noncoding RNA Dysregulation in Glioblastoma
    cancers Review Long, Noncoding RNA Dysregulation in Glioblastoma Patrick A. DeSouza 1,2 , Xuan Qu 1, Hao Chen 1,3, Bhuvic Patel 1 , Christopher A. Maher 2,4,5,6 and Albert H. Kim 1,6,* 1 Department of Neurological Surgery, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA; [email protected] (P.A.D.); [email protected] (X.Q.); [email protected] (H.C.); [email protected] (B.P.) 2 Department of Internal Medicine, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA; [email protected] 3 Department of Neuroscience, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA 4 Department of Biomedical Engineering, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA 5 McDonnell Genome Institute, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA 6 Siteman Cancer Center, Washington University School of Medicine in St. Louis, St. Louis, MO 63110, USA * Correspondence: [email protected] Simple Summary: Developing effective therapies for glioblastoma (GBM), the most common primary brain cancer, remains challenging due to the heterogeneity within tumors and therapeutic resistance that drives recurrence. Noncoding RNAs are transcribed from a large proportion of the genome and remain largely unexplored in their contribution to the evolution of GBM tumors. Here, we will review the general mechanisms of long, noncoding RNAs and the current knowledge of how these impact heterogeneity and therapeutic resistance in GBM. A better understanding of the molecular drivers required for these aggressive tumors is necessary to improve the management and outcomes Citation: DeSouza, P.A.; Qu, X.; of this challenging disease.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]