Chmod: Changes Access Permissions • When You Own a File, You Can Use the Chmod (Change Mode) Utility to Change Access Permissions for That File
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
DC Console Using DC Console Application Design Software
DC Console Using DC Console Application Design Software DC Console is easy-to-use, application design software developed specifically to work in conjunction with AML’s DC Suite. Create. Distribute. Collect. Every LDX10 handheld computer comes with DC Suite, which includes seven (7) pre-developed applications for common data collection tasks. Now LDX10 users can use DC Console to modify these applications, or create their own from scratch. AML 800.648.4452 Made in USA www.amltd.com Introduction This document briefly covers how to use DC Console and the features and settings. Be sure to read this document in its entirety before attempting to use AML’s DC Console with a DC Suite compatible device. What is the difference between an “App” and a “Suite”? “Apps” are single applications running on the device used to collect and store data. In most cases, multiple apps would be utilized to handle various operations. For example, the ‘Item_Quantity’ app is one of the most widely used apps and the most direct means to take a basic inventory count, it produces a data file showing what items are in stock, the relative quantities, and requires minimal input from the mobile worker(s). Other operations will require additional input, for example, if you also need to know the specific location for each item in inventory, the ‘Item_Lot_Quantity’ app would be a better fit. Apps can be used in a variety of ways and provide the LDX10 the flexibility to handle virtually any data collection operation. “Suite” files are simply collections of individual apps. Suite files allow you to easily manage and edit multiple apps from within a single ‘store-house’ file and provide an effortless means for device deployment. -
UNIX Commands
UNIX commands ls list the contents of a directory ls -l list the content of a directory with more details mkdir <directory> create the directory <directory> cd <directory> change to the directory <directory> cd .. move back one directory cp <file1> <file2> copy the file <file1> into <file2> mv <file1> <file2> move the file <file1> to <file2> rm <file> remove the file <file> rmdir <directory> delete the directory <directory> man <command> display the manual page for <command> module load netcdf load the netcdf commands to use module load ferret load ferret module load name load the module “name” to use its commands vi <file> read the content of the file <file> vimdiff <file1> <file2> show the differences between files <file1> and <file2> pwd show current directory tar –czvf file.tar.gz file compress one or multiple files into file.tar.gz tar –xzvf file.tar.gz extract the compressed file file.tar.gz ./name execute the executable called name qsub scriptname submits a script to the queuing system qdel # cancel the submitted job number # from the queue qstat show queued jobs qstat –u zName show only your queued jobs Inside vi ESC, then :q! Quit without saving ESC, then :wq Quit with saving ESC, then i Get in insert mode to edit text ESC, then /word Search content for word ESC, then :% Go to end of document ESC, then :0 Go to beginning of document ESC, then :set nu Add line numbers ESC, then :# Go to line number # N.B.: If inside vimdiff, you have 2 files opened, so you need to quit vi twice. -
LATEX for Beginners
LATEX for Beginners Workbook Edition 5, March 2014 Document Reference: 3722-2014 Preface This is an absolute beginners guide to writing documents in LATEX using TeXworks. It assumes no prior knowledge of LATEX, or any other computing language. This workbook is designed to be used at the `LATEX for Beginners' student iSkills seminar, and also for self-paced study. Its aim is to introduce an absolute beginner to LATEX and teach the basic commands, so that they can create a simple document and find out whether LATEX will be useful to them. If you require this document in an alternative format, such as large print, please email [email protected]. Copyright c IS 2014 Permission is granted to any individual or institution to use, copy or redis- tribute this document whole or in part, so long as it is not sold for profit and provided that the above copyright notice and this permission notice appear in all copies. Where any part of this document is included in another document, due ac- knowledgement is required. i ii Contents 1 Introduction 1 1.1 What is LATEX?..........................1 1.2 Before You Start . .2 2 Document Structure 3 2.1 Essentials . .3 2.2 Troubleshooting . .5 2.3 Creating a Title . .5 2.4 Sections . .6 2.5 Labelling . .7 2.6 Table of Contents . .8 3 Typesetting Text 11 3.1 Font Effects . 11 3.2 Coloured Text . 11 3.3 Font Sizes . 12 3.4 Lists . 13 3.5 Comments & Spacing . 14 3.6 Special Characters . 15 4 Tables 17 4.1 Practical . -
How to Find out the IP Address of an Omron
Communications Middleware/Network Browser How to find an Omron Controller’s IP address Valin Corporation | www.valin.com Overview • Many Omron PLC’s have Ethernet ports or Ethernet port options • The IP address for a PLC is usually changed by the programmer • Most customers do not mark the controller with IP address (label etc.) • Very difficult to communicate to the PLC over Ethernet if the IP address is unknown. Valin Corporation | www.valin.com Simple Ethernet Network Basics IP address is up to 12 digits (4 octets) Ex:192.168.1.1 For MOST PLC programming applications, the first 3 octets are the network address and the last is the node address. In above example 192.168.1 is network address, 1 is node address. For devices to communicate on a simple network: • Every device IP Network address must be the same. • Every device node number must be different. Device Laptop EX: Omron PLC 192.168.1.1 192.168.1.1 Device Laptop EX: Omron PLC 127.27.250.5 192.168.1.1 Device Laptop EX: Omron PLC 192.168.1.3 192.168.1.1 Valin Corporation | www.valin.com Omron Default IP Address • Most Omron Ethernet devices use one of the following IP addresses by default. Omron PLC 192.168.250.1 OR 192.168.1.1 Valin Corporation | www.valin.com PING Command • PING is a way to check if the device is connected (both virtually and physically) to the network. • Windows Command Prompt command. • PC must use the same network number as device (See previous) • Example: “ping 172.21.90.5” will test to see if a device with that IP address is connected to the PC. -
Integrated Voice Evacuation System Vx-3000 Series
SETTING SOFTWARE INSTRUCTIONS For Authorized Advanced End User INTEGRATED VOICE EVACUATION SYSTEM VX-3000 SERIES Tip In this manual, the VX-3004F/3008F/3016F Voice Evacuation Frames are collectively referred to as "VX-3000F." Thank you for purchasing TOA’s Integrated Voice Evacuation System. Please carefully follow the instructions in this manual to ensure long, trouble-free use of your equipment. TABLE OF CONTENTS 1. SOFTWARE OUTLINE ................................................................................... 3 2. NOTES ON PERFORMING SETTINGS .............................................. 3 2.1. System Requirements .......................................................................................... 3 2.2. Notes .................................................................................................................... 3 3. SOFTWARE SETUP ........................................................................................ 4 3.1. Setting Software Installation ................................................................................. 4 3.2. Uninstallation ....................................................................................................... 6 4. STARTING THE VX-3000 SETTING SOFTWARE ....................... 7 5. SETTING ITEMS ................................................................................................ 8 5.1. Setting Item Button Configuration ........................................................................ 8 5.2. Menu Bar ............................................................................................................. -
What Is UNIX? the Directory Structure Basic Commands Find
What is UNIX? UNIX is an operating system like Windows on our computers. By operating system, we mean the suite of programs which make the computer work. It is a stable, multi-user, multi-tasking system for servers, desktops and laptops. The Directory Structure All the files are grouped together in the directory structure. The file-system is arranged in a hierarchical structure, like an inverted tree. The top of the hierarchy is traditionally called root (written as a slash / ) Basic commands When you first login, your current working directory is your home directory. In UNIX (.) means the current directory and (..) means the parent of the current directory. find command The find command is used to locate files on a Unix or Linux system. find will search any set of directories you specify for files that match the supplied search criteria. The syntax looks like this: find where-to-look criteria what-to-do All arguments to find are optional, and there are defaults for all parts. where-to-look defaults to . (that is, the current working directory), criteria defaults to none (that is, select all files), and what-to-do (known as the find action) defaults to ‑print (that is, display the names of found files to standard output). Examples: find . –name *.txt (finds all the files ending with txt in current directory and subdirectories) find . -mtime 1 (find all the files modified exact 1 day) find . -mtime -1 (find all the files modified less than 1 day) find . -mtime +1 (find all the files modified more than 1 day) find . -
PS TEXT EDIT Reference Manual Is Designed to Give You a Complete Is About Overview of TEDIT
Information Management Technology Library PS TEXT EDIT™ Reference Manual Abstract This manual describes PS TEXT EDIT, a multi-screen block mode text editor. It provides a complete overview of the product and instructions for using each command. Part Number 058059 Tandem Computers Incorporated Document History Edition Part Number Product Version OS Version Date First Edition 82550 A00 TEDIT B20 GUARDIAN 90 B20 October 1985 (Preliminary) Second Edition 82550 B00 TEDIT B30 GUARDIAN 90 B30 April 1986 Update 1 82242 TEDIT C00 GUARDIAN 90 C00 November 1987 Third Edition 058059 TEDIT C00 GUARDIAN 90 C00 July 1991 Note The second edition of this manual was reformatted in July 1991; no changes were made to the manual’s content at that time. New editions incorporate any updates issued since the previous edition. Copyright All rights reserved. No part of this document may be reproduced in any form, including photocopying or translation to another language, without the prior written consent of Tandem Computers Incorporated. Copyright 1991 Tandem Computers Incorporated. Contents What This Book Is About xvii Who Should Use This Book xvii How to Use This Book xvii Where to Go for More Information xix What’s New in This Update xx Section 1 Introduction to TEDIT What Is PS TEXT EDIT? 1-1 TEDIT Features 1-1 TEDIT Commands 1-2 Using TEDIT Commands 1-3 Terminals and TEDIT 1-3 Starting TEDIT 1-4 Section 2 TEDIT Topics Overview 2-1 Understanding Syntax 2-2 Note About the Examples in This Book 2-3 BALANCED-EXPRESSION 2-5 CHARACTER 2-9 058059 Tandem Computers -
Lecture 17 the Shell and Shell Scripting Simple Shell Scripts
Lecture 17 The Shell and Shell Scripting In this lecture • The UNIX shell • Simple Shell Scripts • Shell variables • File System commands, IO commands, IO redirection • Command Line Arguments • Evaluating Expr in Shell • Predicates, operators for testing strings, ints and files • If-then-else in Shell • The for, while and do loop in Shell • Writing Shell scripts • Exercises In this course, we need to be familiar with the "UNIX shell". We use it, whether bash, csh, tcsh, zsh, or other variants, to start and stop processes, control the terminal, and to otherwise interact with the system. Many of you have heard of, or made use of "shell scripting", that is the process of providing instructions to shell in a simple, interpreted programming language . To see what shell we are working on, first SSH into unix.andrew.cmu.edu and type echo $SHELL ---- to see the working shell in SSH We will be writing our shell scripts for this particular shell (csh). The shell scripting language does not fit the classic definition of a useful language. It does not have many of the features such as portability, facilities for resource intensive tasks such as recursion or hashing or sorting. It does not have data structures like arrays and hash tables. It does not have facilities for direct access to hardware or good security features. But in many other ways the language of the shell is very powerful -- it has functions, conditionals, loops. It does not support strong data typing -- it is completely untyped (everything is a string). But, the real power of shell program doesn't come from the language itself, but from the diverse library that it can call upon -- any program. -
Learning Objectives ECHO Commands. Command. 10. Explain
. SA Learning Objectives After completing this chapter you will be able to: 1. List commands used in batch files. 2. List and explain batch file rules. 3. Use a batch file with a shortcut. 3. Explore the function of the REM, 4. Use the SHIFT command to move param- ECHO commands. eters. 4. Explain the use of batch files with shortcuts. 5. Use the IF command with strings for condi- 5. Explain the purpose and function of the tional processing. GOTO command. 6. Test for null values in a batch file. 6. Explain the purpose and function of the 7. Use the IF EXIST /IF SHIFT command. test for the existence of a file or a 7. Explain the purpose and function of the IF subdirectory. command. 8. Use the SET command. 8. Explain the purpose and function of the IF 9. Use the environment and environmental EXIST /IF variables in batch files. 9. Explain the purpose and function of the IF 10. Use the IF ERRORLEVEL command ERRORLEVEL command. XCOpy to write a batch file for testing exit 10. Explain the purpose and function of writing codes. programs. 11. Use the FOR...IN...OO command for repeti- 11. Explain the purpose and function of the tive processing. environment and environmental variables. 12. Use the CALL command in a batch file. 12. Explain the use of the SET command. 13. Explain the purpose and function of the Chapter Overview FOR...IN...OO command. You learned in Chapter 10 how to write simple 14. Explain the purpose and function of the batch files and use replaceable parameters. -
RECEIPTS and CONTRACTS Bureau of Driver Training Programs Commissioner Regulations Part 76.8, Records and Contracts — Highlights Regarding
RECEIPTS AND CONTRACTS Bureau of Driver Training Programs Commissioner Regulations Part 76.8, Records and Contracts — Highlights Regarding RECEIPT [Section 76.8 (a)(3) and (d)] A receipt is to be issued each time money is paid. Every receipt must show: u Name and address of the school u Amount paid u Duration of each lesson u Receipt number u Service rendered u Signature of an authorized representative of u Name of student u Contract number, if any the school u Date of payment The name and address of the school, and the receipt number, must be preprinted. Receipt numbers must be in sequence. The original receipt is given to the student; the duplicate is retained by the school in numeric order. Each contract or, if no contract is used, each receipt issued to a student, must include the following statement concerning refunds: (1) Except for contracts executed by schools licensed by the New York State Education Department and subject to the refund provisions of regulations promulgated by that Department, prepayment for lessons and other services shall be subject to refund as follows: if the student, having given prior notice of at least 24 hours, withdraws from or discontinues a prepaid course of instruction or series of lessons before completion thereof, or from any other service for which prepayment has been made, or if the school is unable or unwilling to complete such prepaid course of instruction, or series of lessons, or to provide such other prepaid service, all payments made by the student to the school shall be refunded except: (i) an amount equal to the enrollment fee, if any, specified in the contract or expressly receipted for, not to exceed the sum of $10 or 10 percent of the total, whichever is greater, specified cost of such course of instruction or series of lessons; and (ii) the school’s per-lesson tuition charge for each lesson already taken by the student which charge shall be determined by dividing the total cost of such course of instruction or series of lessons by the number of lessons included therein. -
Linux Shell Script to Find Kernel Version from Multiple Servers Linux Shell Script That Will Login to Server Via Ssh and Get Kernel Version Via Uname -R Command
Linux Shell Script To Find Kernel Version From Multiple Servers Linux shell script that will login to server via ssh and get kernel version via uname -r command. List of all the servers are in server_list.txt file, script will take name by name and try to ssh with the root user and run uname -r command. Output will be written to variable and after into file with servername. This script helps system administrator who manage large linux servers , to take reports of what linux versions running. Here I have used uname -r but you can edit and use your own command as per your requirements. Source : http://linoxide.com/linux-shell-script/kernel-version-multiple/ Linux Shell Script #!/bin/bash #we user variable serverlist to keep there path to file with server names serverlist=’server_list.txt’ #we write in variable all server list servers=`cat $serverlist` #we use variable result to keep there path to file with result result=’result.txt’ #this print header to file with resilt using \t\t to add 2 tab symbols echo -e “Servername \t\t kernel version”> $result #this get each line of serverlist one by one and write to server variable for server in $servers do #this login to server by ssh and get uname -r kernel=`ssh root@${server} “uname -r”` #this write server name and kernel version separated by 2 tab to result file echo -e “$server \t\t $kernel” >> $result #end of for loop. done server_list.txt file # cat server_list.txt dev Linux Shell Script To Find Kernel Version From Multiple Servers 1 www.linoxide.com web1 svn Shell Script Output ./kernel_version.sh centos_node1@bobbin:~/Documents/Work/Bobbin$ cat result.txt Servername kernel version dev 3.3.8-gentoo web1 3.2.12-gentoo svn 3.2.12-gentoo Linux Shell Script To Find Kernel Version From Multiple Servers 2 www.linoxide.com. -
Command $Line; Done
http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA