Traceability of Transgenic Soybean from Forage Trough Animal Tissue Till the Food Product

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

TRACEABILITY OF TRANSGENIC SOYBEAN FROM FORAGE TROUGH ANIMAL TISSUE TILL THE FOOD PRODUCT

OANA-MARIA BOLDURA1, C. BALTĂ3, MIRELA AHMADI1, CAMELIA TULCAN1, I. HUȚU1, C. MIRCU1, SORINA POPESCU2

1Banat University of Agricultural Sciences and Veterinary Medicine ―King Mihai I of Romania‖ Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street, No. 119, Timisoara, Romania 2Banat University of Agricultural Sciences and Veterinary Medicine ―King Mihai I of Romania‖ Timisoara, Faculty of Horticulture and Forestry 3“Vasile Goldis” Western University of Arad, Romania, Institute of Life Sciences E-mail: [email protected]

Summary

In recent years, there has been a notable concern on the safety of genetically modified (GM) foods/plants, an important and complex area of research, which demands rigorous standards. Molecular methods of GMO detection in food products are based on a short DNA sequence identification. Those sequences can be found in any type of product more or less processed. Even though it was demonstrated by numerous studies that those transgenic sequences will be found in the tissue of any animal that is fed with and were it does not have any metabolic function, there is a lack of studies concerning them crossing in the alimentary products. The European legislation outlines labeling as GMO any food or feed product that contains equal or over 0.9 % GMO material. The presence of remaining DNA sequences in the tissues could easily contribute in reaching and even overcoming of this threshold. Starting from those suppositions, different types of tissues becoming from pigs that were fed with transgenic soybean, were analyzed. GMO detection was accomplished in respect of current specific legislation, following the European standards that were implemented in laboratory, by using PCR type analysis. In the frame of this experiment, sequences of transgenic DNA were identified in fresh but also after a simulation of processing tissues in order to prove the detection all along the technological process. This study emphasizes the necessity of considering those aspects in the process of legally labeling GMO products. Also, there is a need of a better communication for informing the producers and consumers concerning the detection methods and the labeling legislation. Key words: GM soybean, GM food, GM feed, detection, farm pig

In recent years, genetically modified (GM) plants, whose DNA has been changed using genetic engineering techniques, are used as foods for human and feeds for farm animals. The majority of GM crops currently produced, like soybean, corn, cotton and canola, have been engineered to enhance agronomic performance by adding transgenic genes for herbicide tolerance and pest resistance. GM soybean is tolerant to the glyphosate family of herbicides by

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA expressing transgenic DNA that encodes 5-enolpyruvylshikamate-3-phosphate synthase (CP4 EPSPS). Roundup Ready (RR) soybean is the present principal biotech crop. About 90% of the compound feed produced in the EU contains GM soybean. Based on the European food and feed regulation, since 2003 all foods and feeds containing or derived from approved GM products in amounts that pass the 0.9% threshold are compulsory labeled. However, products such as meat, milk, and eggs, that are derived from livestock fed transgenic feeds are exempt from EU-labeling laws (5). The safety of genetically modified organisms regarding the introduced DNA and protein, is based on strong scientific and market regulatory assessments (4, 8, 9, 13) Moreover, the United Nations World Health Organization (WHO) and Food and Agriculture Organization (FAO) have all stated that DNA, is a safe and natural component of food and feed. Highly sensitive detection technologies such as PCR (Polymerase Chain Reaction) can be used to assess the fate of foreign DNA in animal products ( such as meat, milk, and eggs) becoming from farm animals fed with GMO containing forage. The PCR is the most used DNA-based technique, representing the method of choice for GMO detection in most laboratories. Naturally, the digestive process includes the exposure of the gastrointestinal tract to foreign DNA becoming from digested foods or feeds. Ingested food is mechanically disrupted; the DNA is released and cleaved through acid hydrolysis and enzymatic digestion into small DNA sequences and free nucleotides (12). The activity of various phosphatases and deaminases is further affecting the structural integrity of free DNA. It has been shown that plant DNA is progressively degraded through the digestive tract. Over 50% is degraded in the first third of the intestine and 80% is lost when digesta reaches the terminal ileum (11). More over Schubbert et al. (1997) suggested that approximately 0.1% of purified M13 circular phage DNA ingested by mice could be detected as small fragments in white blood cells 2 to 8 h after feeding. The detected DNA was most likely present within the white cells as part of a normal immune system scavenger process. The digestive fate of transgenic DNA was studied since the advent of recombinant DNA methodologies (10, 14) and continues till present time, raising more issues about traceability and precision of detection. The actual trend is to detect small traces of transgenic DNA in different tissues of GM feed animals (1, 2, 3; 6, 15, 16, 19), in attempts to detect the position and the time that passes till the complete disappearing. The overall conclusion is that the transgenic DNA can be detected in organs of animals up to one month but the presence is somehow hazardous, probably carried by body fluids along with any fed becoming exogenous DNA and is not interfering with any metabolic pathways. However, there are no studies designed to follow the sequences of transgenic DNA from tissue trough the processing till the final product.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

The biological material was represented by five pigs, noted A, B, C, D, E, grown in a local farm for slaughtering, normally fed with GM soybean containing forage. In the moment of slaughtering the fresh tissue samples were collected: liver, muscle and stomach. Also, a sample of forage was collected and analyzed along with the animal tissues. Certified reference material (CRM) - Roundup Ready™ soybean 1% produced by the Institute for Reference Materials and Measurements (IRMM) was used as control for GMO. Samples preparation For the detection of exogenous DNA in fresh tissue, 50 mg of biological material was sampled. The remaining tissue was minced in sterile condition and boiled in autoclave at 121º C, for 30 minutes. After draying, the tissues were grinded and homogenized. 50 mg of each homogenate were sampled and subjected to DNA extraction. DNA extraction Total DNA was isolated and purified from all samples using CTAB method (ISO 21571, 2005). The quality and quantity of DNA obtained was assessed using NanoDrop8000 spectrophotometer (Thermo Scientific, USA). Primers used in this study Amplificable quality of DNA was confirmed by PCR technique, using pork specific primers, designed for the mitochondrial region 12S rRNA-tRNA Val generating an amplicon of 290 bp length. The primers had the following sequences F 5‘CTACATAAGAATATCCACCACA3‘, R 5‘ACATTGTGGGATCTTCTAGGT3‘.(7) The presence of plant DNA in the samples was assessed by PCR, targeting the chloroplast gene RuBiSco, specific to vegetal genome, with the primersproposed by Rudi et al: CW:5CGTAGCTTCCGGTGGTATCCACGT3', and CX: 5'GGGGCAGGTAAGAAAGGGTTTCGTA3' expected to generate an amplicon of 150 bp. For soybean detection the primers were designed for the lectin gene, with the following sequences: GMO3: 5‘GCCCTCTACTCCACCCCCATCC3‘ and GMO4: 5‘GCCCATCTGCAA GCCTTTTTGTG3‘ and the amplified fragment was 118 bp. Primers HA-nos118-f and HA-nos118-r were used for the detection of the nos terminator, present in the RR soybean having the sequences: nos-f: 5‘GCATGACGTTATTTATGAGATGGG3 ‘and the reverse primer nos-r: 5‘GACACCGCGCGCGATAATTTATCC3‘. The length of the amplified fragment was 118 bp (ISO 21569:2005). PCR amplification The four PCR reactions were run in a final volume of 25 μl using Go Taq Green Master Mix PCR kit from Promega according to producer instructions, 20

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA pmol of primers and 50 ng/µl DNA template and were performed on a Mastercycler ProS (Eppendorf U.S.) thermalcycler. The amplification program for pork specific primers follows the steps: denaturation 94ºC, 10 min, 35 cycles: denaturation 94ºC, 30 sec, primer annealing 60ºC, 1 min, DNA synthesis 72ºC, 1 min and the final extension 72ºC, 5 min. For RuBiSco primers the PCR program consisted of an initial denaturing step for 3 min at 95°C, followed by 30 cycles of denaturation at 95°C for 20 sec, annealing at 63°C for 45 sec and extension at 72°C for 1 min, with a final step at 72°C for 3 min. The PCR program for lectin primers was: denaturation 95°C - 3 min; 40 cycles: denaturation 95°C -25 sec; primer annealing 62°C - 30 sec, DNA synthesis 72°C - 45 sec; final extension 72°C - 7 min and for the T-nos primers: denaturation 95°C - 3 min; 40 cycles: denaturation 95°C -30 sec; primer annealing 63°C - 30 sec, DNA synthesis 72°C - 30 sec; final extension 72°C - 3 min. The resulting PCR products were separated on 2 % agarose gels in TAE buffer at room temperature at a constant voltage of 100 V for 40 minutes. The PCR products were visualized and photographed under UV light (PhotoDocumentation System, UVP, England).

Results and discussions

In the first stage of the study, total genomic DNA was isolated and purified from the raw and processed biological samples. DNA of good quality and quantity was obtained and serial dilutions were prepared in the attempt to equalize the genes of interest copies number that may be present in the samples. As expected, the quantity and quality of isolated DNA from processed samples was lower but considered suitable for PCR analysis. For confirming the Sus scrofa specie and the amplifiable quality of extracted DNA, PCR with pork specific primers were run and presence of the specific amplicon was detected in samples of animal origin, whreas the vegetal samples were negative (Figure 1). In animal tissues fragments of chloroplast DNA were detected. The reason why chloroplast DNA is frequently detected in animal tissues is the involved genes copy number and the sensitivity of the PCR method. When considering GM plants, every cell contains hundreds chloroplast genes, but only one copy of transgenic gene (4). The presence of vegetal DNA was confirmed by PCR amplification, targeting chloroplastic DNA sequences (Figure 1). All the samples were positive for ribulose-bisphosphate carboxylase-1.5 (RuBisCo) gene. The detection of this DNA sequence is a proof of vegetal DNA remanence in animal tissues. Since the vegetal DNA was precisely detected in all pork samples, the next PCR analyses aimed to identify whether soybean specific DNA sequence, is present and detectable. In this purpose, the target gene is represented by a single copy gene – lectin, so the performance of reaction must be higher than in case of a target such chloroplast DNA (Figure 2).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

A B

Fig.1. PCR confirmation of tissue origin (panel A) by detecting pork specific sequences. Liver tissue: 1.A; 2. B; 3. C; 4. D; 5. E; Muscle tissue: 6. A ; 7. B; 8. C; 9. D; 10. E; Stomach tissue: 11. A; 12.B; 13. C; 14. D; 15. E; 16. Forage sample ; 17. Negative control, soybean flour; 18. Positive control, pork DNA; 19. Reagents control; M - DNA ladder, PCR marker (Promega). PCR detection of vegetal DNA in pork tissue samples: Liver tissue: 20. A; 21. B; 22. C; 23. D; 24. E; Muscle tissue: 25. A ; 26. B; 27. C; 28. D; 29. E; Stomach tissue: 30. A; 31.B; 32. C; 33. D; 34. E; 35. Forage sample ; 36. Soybean flour; 18. Positive control, vegetal DNA; 19. Reagents control

A B

Fig. 2. PCR detection of soybean DNA (panel A) by detecting lectin specific sequence. Liver tissue: 1.A; 2. B; 3. C; 4. D; 5. E; Muscle tissue: 6. A ; 7. B; 8. C; 9. D; 10. E; Stomach tissue: 11. A; 12.B; 13. C; 14. D; 15. E; 16. Forage sample ; 17. Negative control, non-soy fed fish; 18. Positive control, soybean CRM; 19. Reagents control; M - DNA ladder, GeneRuler 50bp (Fermentas). PCR detection of transgenic DNA: Liver tissue: 20. A; 21. B; 22. C; 23. D; 24. E; Muscle tissue: 25. A ; 26. B; 27. C; 28. D; 29. E; Stomach tissue: 30. A; 31.B; 32. C; 33. D; 34. E; 35. Forage sample ; 36. Positive control, 1% MG soybean CRM; 18., Negative contol, non GM soybean CRM ; 19. Reagents control

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The presence of an amplification product with a molecular weight of 118 bp, is confirming the presence of soybean DNA sequences in all analyzed samples. Differences among bands intensity can be analyzed. Even in low number, compared with positive control intensity of amplicon, there are differences among samples for each analyzed organ. The highest number of residual lectin sequences was detected in liver tissue, followed by muscle tissue and slightly observable in stomach tissue. It can be noticed that a certain degree of homogeneity exist among same tissue samples, proving that the accurate detection of an ingested plant DNA is not promiscuously. At this point, it was proved that the soybean from the diet can be detected in fed animals therefore, the next objective of the study was to identify whether the transgene sequence can be detected by PCR screening method, targeting the most common sequences present in GM soybean, nopaline synthase terminator (T–Nos) (Figure 2). Presence of a 118 bp amplicon indicate that the residues of transgenic DNA are still present in the animal tissue. Analyzing the quality of PCR product it can be noticed that there are differences when comparing the samples from homolog tissues. The copy number of transgenic sequences is lower than lectin and even absent in case of stomach tissue for sample A and B. This result is suggesting that T-nos detection in animal tissue is possible but hazardous. In presented case most probably the soybean present in the forage was not 100% genetically modified, so the number of transgenic DNA sequences is lower than soybean specific ones, however present in detectable quantities.

Fig. 3. PCR detection of transgenic DNA in processed samples: Liver tissue: 1.A; 2. B; 3. C; 4. D; 5. E; Muscle tissue: 6. A ; 7. B; 8. C; 9. D; 10. E; Stomach tissue: 11. A; 12.B; 13. C; 14. D; 15. E; 16. Forage sample ; 17. Positive control, 1% MG soybean CRM 18. Negative control, soybean CRM; 19. Reagents control; M - DNA ladder, GeneRuler 50bp (Fermentas)

Next objective was to identify the remanence of transgenic DNA sequence in the processed animal product. Therefore, the tissues were minced and boiled

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA and homogenized, in order to simulate the processing of a slaughtered pork product. The DNA was isolated from processed samples and used as matrix in PCR screening for detection of GM soybean, following the same protocol as in case of fresh tissues samples. The obtained result are emphasizing that the sequences that were present in fresh tissue are not lost during the processing protocol. The result of PCR amplification was not considerable affected through mechanical interventions and the transgenic DNA was still detectable in the samples that were positive in fresh estate. Samples of stomach tissue of A and B were also negative as in case of fresh tissue samples. The obtained results proved that if a farm animal is fed with GM plants, it is very likely to detect some traces of transgenic genes in tissues, even after processing leading to an important, yet not discussed issue. If for example, a meat product is prepared from the tissue of an animal that was fed with GM material, the transgenic sequence will probably be present in that product. The producer is not labeling as GMO containing according to EU legislation, but with a simple control test he can be suspected of fraud. Moreover, it is a common practice to add material of soybean origin (usually non GM) in meat product how it will be proved what is the source of detected transgenic sequences, the meat or the soybean? Also, at this moment it is impossible to quantify those traces of DNA, because of proper standards and validation methods are completely missing from the EU regulation.

Conclusions

The present study had as main goal to determine whether the transgenic DNA sequences can be detected in the tissues of farm animals that are fed with GM containing forage and what is the fate of those sequences once the animal is slaughtered and the tissues are processed. By following the GMO detection standardized and validated procedures small amounts of transgenic DNA were detected in fresh but also, more importantly, in samples that were physically processed. In order to establish standard operation procedures an validation methods, more complex experiment are needed. Those experiments should integrate large number of farm animals and well developed experimental procedures. Also, the public especially the producers must be informed about the regulations and the gaps that are currently noticed in the GMO regulation process.

References

1. Aeschbacher, K., Messikommer, R., Wenk, C., Physiological characteristics of Bt 176 corn in poultry and destiny of recombinant plant DNA in poultry products. Annals of Nutr. And Metab. 2001, 45(Suppl. 1),376.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

2. Aeschbacher, K., Messikommer, R., Meile, L., Wenk, C., Bt176 corn in poultry nutrition, Physiological characteristics and fate of recombinant plant DNA in chickens. Poultry Sci. 2005. 84(3),385-394. 3. Alexander, T.W., Reuter, T., Aulrich, K., Sharma, R., Okine, E.K., Dixon W.T., McAllister, T. A., A review of the detection and fate of novel plant molecules derived from biotechnology in livestock production. Anim. Feed Sci. and Tech. 2007, 133,31-62. 4. Aumaitre, A., Aulrich, K., Chesson, A., Flachowsky, G., Piva, G., New feeds from genetically modified plants, substantial equivalence, nutritional equivalence, digestibility, and safety for animals and the food chain. Livestock Prod. Sci, 2002, 74, 223-238. 5. Carpenter, Janet, Gianessi, L., Herbicide tolerant soybeans, why growers are adopting roundup ready varieties, AgBioForum , 1999, Volume 2, Number, Pages 65-72. 6. Chainark, P., Satoh, S., Hino, T., Kiron, V., Hirono, I., Aoki, T., Availability of genetically modified soybean meal in rainbow trout Oncorhynchus mykiss diets. Fisheries Science, 2006, 72,1072-1078. 7. Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati S., Bottero, M.T., A multiplex PCR assay for the identification of animal species in feedstuffs, Molecular and Cellular Probes 18, 2004, 81–87. 8. Food and Agriculture Organisation and the World Health Organisation of the United Nations., Biotechnology and Food Safety. Report of a Joint FAO/WHO Expert Consultation. 1996. FAO Food and Nutrition, Paper 61. 9. Food and Agriculture Organisation and the World Health Organisation of the United Nations.. Strategies for assessing the safety of food produced by biotechnology. Report of Joint FAO/WHO Consultation. 1991, World Health Organisation Geneva. 10. Maturin, Sr.L., Curtiss, I. Degradation of DNA by Nucleases in Intestinal Tract of Rats. Science 1977, 196, 216-218. 11. McAllan, A. B. The degradation of nucleic acids and the removal of breakdown products from the small intestines of steers. Br. J. Nutr., 1980, 44, 99-112. 12. McAllan, A. B. The fate of nucleic acids in ruminants, Prac. Nutr. Soc. 1982, 41, 309-317. 13. OECD, Report of the OECD Workshop on the Toxicology and Nutritional Testing of Novel Foods, 1997, Aussois, France, 5–8 March 1997, OECD, Paris. 14. Rasche, E. Rapeseed with tolerance to the nonselective herbicide glufosinate ammonium. Pages 211–221 in Plant Oils and Fuels, Present State of Science and Future Developments. N. Martini and J. Schell, 1998, ed. Springer, New York. 15. Rehout, V, Hanusova, L., Kadlec, J., Citek, J., B. Hosnedlova, Detection of DNA fragments from genetically modified Roundup Ready

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

soya and Bt maize in organs of broilers. Journal of Agrobiology ,2008, 25, 141-144. 16. Reuter, T., Aulrich, K., Investigations on genetically modified maize (Bt- maize) in pig nutrition, Fate of feed ingested foreign DNA in pig bodies. Eur. Food Res. Technol. 2003, 216,185-192. 17. Rudi, K., Skulberg, O.M., and Jakobsen, K.S. Evolution of cyanobacteria by exchange of genetic material among phyletically related strains. Journal of Bacteriology, 1998. 180, 3453–3461. 18. Schubbert, R., Renz, D., Schmitz, B., Doerfler, W., Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA. Proceedings of the National Academy of Sciences, USA, 1997, 94, 961- 966. 19. Tudisco, R., Cutrignelli, M.I., Calabrò, S., Guglielmelli, A., Infascelli, F.. Investigation on genetically modified soybean (roundup Ready) in goat nutrition, DNA detection in suckling kids. Ital. J. Anim. Sci. 2007, 6 (Suppl. 1),380-382.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

MOLECULAR FINGERPRINTING BASED ON DNA MARKERS AS A METHOD OF BROWN BEAR (URSUS ARCTOS) EXEMPLARS IDENTIFICATION - A CASE STUDY

OANA-MARIA BOLDURA1, GABRIELA POPA1, C. MIRCU1, MIRELA AHMADI1, CAMELIATULCAN1, I. HUȚU1, SORINA POPESCU2

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Horticulture and Forestry E-mail: [email protected]

Summary

The population size of Brown bear in Romania represents about 40 % of total number from Europe, except Russian territory, reaching to about 6000 individuals so being the biggest European population of this species, according to IUCN report ―Brown Bear Conservation Action Plan for Europe‖ - 1999. An approved limited harvesting quota for this species is needed in order to control the level of possible damages that can be caused. The hunting is allowed only for certain bears in conditions, places, and periods, and with the means established by the law. Hunting of brown bears is done only in the limit of the maximum number of individuals allowed by the law. Deduction of this maximum number of individuals for each administrator and game management unit is approved by ministerial order of the specific central public authority. Even so, it is estimated that the real number of brown bear individuals is lower than the proposed one. Annually, a bigger number of exemplars is declared in order to obtain an increased number of hunting permits that are illegally sold to foreign hunters. Up to date in our country, there is no program of brown bear identification and even the existing traceability methods can be easily defeated by poachers. In this study we propose a DNA molecular markers based system of fingerprinting that can lead to a data base construction. The DNA fingerprint is impossible to defeat and can be traced even in small remains of the body. Based on brown bear biological samples, by using the PCR technique and two types of molecular markers ISSR (inter-simple sequence repeat) and DAMD (Direct amplification of minisatellite DNA) a set of DNA fingerprints was established. Those fingerprints are accurate in distinguishing individuals and reproducible in time. Key words: Brown bear, molecular markers, DNA fingerprinting

The Ursidae family includes eight species of bears, the brown bear (Ursus arctos), the american black bear (Ursus americanus), the asiatic black bear (Ursus thibetanus), the polar bear (Ursus maritimus), the sun bear (Heleractos malayanus), the sloth bear( Melursus ursinus), the spectacled bear (Tremarctos ornatus) and the giant panda (Ailuropoda melanoleuca) (8) .

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

According to the ICUN - International Union for Conservation of Nature Version 2014.3., the brown bear is considered as being of least concern on the red list of threatened species along with the American black bear. Romania is considered to be the second country in the world after Russia when it comes to brown bear population, with around 6000 brown bears. However, the numbers presented by the authority in this matter, Institute of research and forest design (ICAS) have been constantly disputed by the organizations like WWF (world wildlife fund) and WSPA (world society for protection of animals), including several other coordinators of projects regarding the big carnivores in Romania. The methods used nationally to keep track of bears consist of foot tracking on the ground, method that can give important errors when it comes to evaluating the bear population each year. Nonetheless after considering the bear populations numbers, the annually quota is decided, in the last 10 year there have been constantly hunted around 350 bear each year according to Ovidiu Ionescu head of the ICAS . Despite official data, the reality is different and pouching is very often reported in our country. To date, there is no reliable method to track and identify the hunted exemplars. Neutral genetic markers have become an important tool for examining demographic histories of introduced species. For DNA fingerprinting by PCR method, in order to establish a particular genotype, two types of VNTR (Variable Number of Tandem Repeats) molecular markers systems: ISSR (Inter simple sequence repeats) and DAMD (directed amplification of minisatellite region DNA) are recommended (3) Inter simple sequence repeats (ISSRs) are dominant markers located between microsatellite sites in the genome, are often highly polymorphic at the species level and require no prior sequence information. Minisatellites are tandem repeated DNA regions of genomes, many of which showed high levels of allelic length variation due to differences in the number of repeated units (4). These loci are highly informative genetic markers that have been used extensively in many areas of genetics. Heath et al. (1993) described a technique, called directed amplification of minisatellite region DNA (DAMD) to direct the PCR mediated amplification of minisatellite DNA region. DNA markers can be used to assess the genetic structure and to estimate the level of genetic diversity and differentiation of populations (1). Particularly, using STR markers, information about the population structure can be obtained and also spatial distribution, parentage, and movements of brown bear individuals (2). In Europe there are some common guidelines for the genetic study of brown bears, especially to compare the genetic diversity and to differentiate among Southeastern Europe populations (6). In our country there is a lack of information about genetic diversity, inbreeding, gene flow or isolation of the brown bear populations. Only few studies were conducted, mainly in order to determine mitochondrial DNA lineages (10, 7, 11, 2). The DNA fingerprinting method can be used to construct a data base and along with another tracking device it will help to identify the hunted individuals,

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA moreover, if the artificial tracking device is lost or destroyed a molecular fingerprint can be obtained from small amounts of even altered tissue.

Materials and methods

Biological samples consisted of frozen testicular tissue, collected through orchiectomy from three brown bear exemplars, with known origin (Table 1) provided by Libearty Bear Sanctuary , Zarnesti, Romania.

Table 1 Provenience of biological samples used in this study Individ Provenience A Zoological Garden from Resita, Caransebes county B Zoological Garden from Baia Mare, Maramures county C Zoological Garden from Baia Mare, Maramures county

DNA was isolated and purified from approximately 50 mg tissue using CTAB method (ISO 21571, 2005). The quality and quantity of DNA was assessed by specrophotometric measurement (NanoDrop 8000, Thermo Scientific). ISSR and DAMD molecular markers were chosen for the genetic diversity assessment. For the initial screening a set of 13 ISSR and seven DAMD primers (Table 2) were used.

Table 2 ISSR and DAMD primers sequences used in initial screening primer code Sequence 5’...3’ ISSR markers UBC808 AGAGAGAGAGAGAGAGC UBC810 GAGAGAGAGAGAGAGAT UBC829 TGTGTGTGTGTGTGTGC UBC834 AGAGAGAGAGAGAGAGYT UBC836 AGAGAGAGAGAGAGAGYA UBC841 GAGAGAGAGAGAGAGAYC UBC851 GTGTGTGTGTGTGTGTYG UBC854 TCTCTCTCTCTCTCTCRG UBC857 ACACACACACACACACYG UBC867 GGCGGCGGCGGCGGCGGC UBC873 GACAGACAGACAGAC A UBC880 GGAGAGGAGAGGAGA UBC885 HBHAGAGAGAGAGAGAG DAMD markers URP2F GTGTGCGATCAGTTGCTGGG URP2R CCCAGCAACTGATCGCACAC 16

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

URP6R GGCAAGCTGGTGGGAGGTAC URP9F ATGTGTGCGATCAGTTGCTG 33.6 GGAGGTGGGCA 14C2 GGCAGGATTGAAGC M13 GAGGGTGGCGGCTCT Single letter abbreviations for mixed-base positions: Y = (C, T), R = (A, G), B = (non A), H = (non G).

PCR was carried out in volumes of 25 µl containing 75 ng of DNA template. The composition of amplification mixture was carried out following the producer instructions for GoTaq Green Master Mix (Promega, USA). The reaction was performed on a DNA Engine Peltier Thermal Cycler (MJ Research, U.S.A.) and the PCR program consisted of a first denaturing step for 5 min at 94°C, followed by 45 cycles of denaturation at 95°C for 45 sec, annealing at 48°C- 55°C for 45 sec and extension at 72°C for 2 min, the final step of extension at 72°C for 5 min., according to literature data (9). The resulting PCR products were run on 1.8 % agarose gels in TAE buffer at room temperature at a constant voltage of 100 V for 90 minutes. The PCR products were visualized and photographed under UV light (PhotoDocumentation System, UVP, England). The obtained data were analyzed with VisionWorksLC software. The dendrogram was assessed from a set of variables by using DendroUPGMA (12), software. The program calculates a similarity matrix and transforms similarity coefficients into distances and makes a clustering using the Unweighted Pair Group Method with Arithmetic mean (UPGMA) algorithm.

Results and discussions

To date, there are no literature data recordings to state that VNTR markers systems were used in scoring genetic diversity and to molecular fingerprint the brown bear population in our country. A set of 13 ISSR and seven DAMD primers were chosen for an initial screening, in order to select polymorphic primers suitable to be used further in the experiment. A bulked sample consisting of 10 µl of each individual DNA was used as template. For this screening experiment, a Gradient- PCR program, with annealing temperatures ranging from 57°C- 53°C was used. Based on the obtained screening result, 7 ISSR and 7 DAMD primers were selected to be used in the first step of the experiment (Figure 1, Table 3). Only the primers that yielded a DNA fingerprint of good quality in terms of amplified sequences number and well defined PCR product (Figure 1), were considered as a valuable choice for further studies. Primers that yielded faint or low number of amplicons were eliminated from the experiment. Seven of ISSR molecular markers were selected to be used further in the DNA fingerprinting experiment, while all seven DAMD molecular markers presented good

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA fingerprinting quality. Therefore, the DNA fingerprinting study was developed on the basis of 14 markers system (Figure 2 and 3, Table 3).

Fig. 1. PCR based screening with 13 ISSR ( panel A) and seven DAMD ( panel B) primers:1 –UBC808, 2 –UBC810, 3 –UBC829, 4 - UBC834, 5 - UBC836, 6 - UBC841, 7 - UBC851, 8 - UBC854, 9 - UBC857, 10 - UBC867, 11 - UBC873, 12 - UBC880, 13 - UBC885, 14 –URP 2F,15 - URP 2R, 16 - URP 9F, 17 - URP 6R , 18 - 33.6, 19 - M13 ,7 - 14 C2 , M- Molecular weight marker - GeneRuler Express DNA Ladder (Fermentas)

Table 3 Molecular markers and data collected in DNA fingerprinting experiment Primer Sequence 5’…3’ Fragment Fraction polymorphic size range fragments (bp) UBC808 AGAGAGAGAGAGAGAGC 1250 - 215 9/18 UBC810 GAGAGAGAGAGAGAGAT 950 - 215 11/17 UBC829 TGTGTGTGTGTGTGTGC 1260 - 165 13/17 UBC836 AGAGAGAGAGAGAGAGYA 1090 - 160 17/22 UBC851 GTGTGTGTGTGTGTGTYG 1460 - 280 14/18 UBC857 ACACACACACACACACYG 2450 -275 15/22 UBC867 GGCGGCGGCGGCGGCGGC 1170 - 140 16/21 URP2F GTGTGCGATCAGTTGCTGGG 1425 - 110 13/19 URP2R CCCAGCAACTGATCGCACAC 1660 - 203 12/20 URP6R GGCAAGCTGGTGGGAGGTAC 1380 - 145 18/24 URP9F ATGTGTGCGATCAGTTGCTG 1450 - 140 15/21 33.6 GGAGGTGGGCA 1650 - 153 20/29 14C2 GGCAGGATTGAAGC 1220 - 220 19/27 M13 GAGGGTGGCGGCTCT 1405 - 118 20/25 212/300 (70.56 %)

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

In this experiment, using 14 VNTR markers system, a binary matrix of 299 scored PCR products, from which 211 were polymorphic, was developed. ISSR primers yielded a reduced number of amplicons, compared to DAMD primers, but overall they exceeded in terms of polymorphic band percentage.

Fig. 2. DNA fingerprint obtained using ISSR primers: UBC 808: 1 – Individual A, 2- Individual B, 3- Individual C, UBC 810: 4 - Individual A, 5 - Individual B, 6 - Individual C, UBC 829: 7- Individual A, 8 - Individual B, 9- Individual C, UBC 836: 10 - Individual A, 11- Individual B, 12 - Individual C, UBC 851: 13 - Individual A, 14 - Individual B, 15 - Individual C, UBC 857: 16 - Individual A, 17 - Individual B, 18 – Individual C, UBC 867: 19 – Individual A, 20 – Individual B, 21 – Individual C M - Molecular weight marker - GeneRuler Express DNA Ladder (Fermentas)

Those differences easily predicted to occur because of their different sequence and DNA specific target. Nevertheless, when those two sets of data are combined the result is more accurate than in the case of using a single marker system. From data resulted from the analyses of PCR results, as were given by the analysis software, a binary matrix for each individual was developed. The binary matrix was used in assessing the similarity matrix and the genetic distance matrix using the Jaccard similarity coefficient (Figure 4). Considering the genetic similarity it can be noticed that individual A is less similar with the others two, scoring 0.372 with individual B and 0.360 with individual C. Between individual B and C there is a high similarity degree of 0.733. Similar, the genetic distance matrix revealed that individual A is distant from individuals B and C, having the indexes 0.628 and 0.640 respectively. Also, between individuals B and C the scored distance is reduced to 0.267. On the basis of resulted matrix an UPGMA dendrogram was designed. (Figure 5).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig. 3. DNA fingerprint obtained using DAMD primers: URP2F: 1 – Individual A, 2- Individual B, 3- Individual C, URP2R: 4 - Individual A, 5 - Individual B, 6 - Individual C, URP6R: 7- Individual A, 8 - Individual B, 9- Individual C, URP9F: 10 - Individual A, 11- Individual B, 12 - Individual C, 33.6: 13 - Individual A, 14 - Individual B, 15 - Individual C, 14C2: 16 - Individual A, 17 - Individual B, 18 – Individual C, M13: 19 – Individual A, 20 – Individual B, 21 – Individual C, M - Molecular weight marker - GeneRuler Express DNA Ladder (Fermentas)

Fig. 4. Similarity and distance matrixes as resulted from DendroUPGMA software

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig. 5. Genetic distance Dendrogram of Ursus arctos individuals created by DendroUPGMA program using data from 14 VNTR markers: 1 – Individual A, 2 - Individual B, 3 - Individual C

Dendrogram analyses revealed that the three individuals are grouped in two different clusters. As expected, individual A, becoming from Zoological Garden from Resita, Caransebes County is clearly distinct from individuals B and C, becoming from Zoological Garden from Baia Mare, Maramures County. Individuals B and C, most share a common origin, more likely being blood related, but since no other information being available about them (such as age and place of birth), based on genetic data on can only speculate about the origin.

Conclusions

This paper presents a case study with the goal of developing a molecular markers system that can become an important tool of tracking brown bear exemplars, thus combating pouching but also, if applied on a larger number of individuals, can be used in scoring genetic diversity and phylogeny studies. The proposed markers were proved to be reliable and provided accurate information in terms of establishing an individual molecular fingerprint but also in clustering individuals according to their origin. The developed similarity and genetic distance matrixes clearly differentiated among studied individuals according to their origin. In order to develop the proposed method, a higher number of biological samples must be analyzed in similar studies.

References

1. Cotovelea, A., N. Şofletea, G. Ionescu, O. Ionescu, Genetic approaches for romanian brown bear (Ursus arctos) conservation, Bulletin of the

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Transilvania University of Braşov Series II: Forestry, Wood Industry, Agricultural Food Engineering, 2013, Vol. 6 (55) No.1. 2. Cotovelea, A., O. Ionescu, N. Şofletea, G. Ionescu, R. Jurj, G. Sîrbu, M. Popa, M. Fedorca, C. Mariş, A.L. Curtu, Testing the influence of habituation on genetic structure of brown bear (Ursus arctos), Annals of Forest Research, 2015, 58(1): 81-90, 2015 DOI: 10.15287. 3. Chambers, G.K., Curtis, Caitlin, Millar, C.D., Huynen, L., Lambert, D.M., DNA fingerprinting in zoology: past, present, future, Investigative Genetics, 2014, 5, 3. 4. Claes, Ramel, Mini- and Microsatellites, Environmental Health Perspectives , 1997, Vol 105, Supplement 4. 5. Heath, D.D., Iwama, G.K., Devlin, H., PCR primed with VNTR core sequence yields species specific patterns and hypervariable probes. Nucleic Acids Res., 1993, 21, 5782-5785. 6. Karamanlidis, A.A., De Barba, M., Georgiadis, L., Groff, C., Jelinčić, M., Kocijan, I., Kruckenhauser, L., Rauer, G., Sindičić, M., Skrbinšek, T., Huber D., Common guidelines for the genetic study of brown bears (Ursus arctos) in southeastern Europe. Athens. Published by the Large Carnivore Initiative for Europe, 2009, 1-45. 7. Kohn, M. H., Knauer, F., Stoffella, A., Schröder, W., Pääbo, S., Conservation genetics of the European brown bear – a study using excremental PCR of nuclear and mitochondrial sequences. Molecular Ecology, 1995, 4, 95–103. 8. Martin, L.D., Fossil history of the terrestrial Carnivora. Pages 536-568 in J.L. Gittleman, ed. Carnivore behavior, ecology, and evolution. Comstock Publ. Assoc. Ithaca, N.Y. ,1989. 9. Pharmawati, M., Yan, G., Finnegan, P.M., Molecular Variation and Fingerprinting of Leucadendron Cultivars (Proteaceae) by ISSR Markers, Annals of Botany, 2005, 95, 1163–1170. 10. Taberlet, P., Bouvet, J., Mitochondrial DNA polymorphism, phylogeography, and conservation genetics of the brown bear (Ursus arctos) in Europe. Proceedings of the Royal Society of London, Series B, 1994, 255, 195–200. 11. Zachos, F.E., Otto, M., Unici, R., Lorenzini, R., Hartl, G.B., Evidence of a phylogeographic break in the Romanian brown bear (Ursus arctos) population from the Carpathians. Mammalian Biology, 2008, 73, 93–101. 12. http://genomes.urv.cat/UPGMA/index.php.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

ASPECTS REGARDING TO RESPIRATORY DISEASES IN POULTRY FARMS FROM ROMANIA DURING 2013 - 2014 DETERMINED BY ELISA AND PCR ASSAYS

DANIELA BOTUŞ1, VIRGILIA POPA1, LEIGH NOGY2, J. COTTER2, M. CULCESCU1, E. CAPLAN1, JENICA BUCUR3, G. STRATULAT1

1NS Pasteur Institute SA, 333, Calea Giuleşti Str., Bucharest, Romania, 060269 2Affinitech Ltd, USA 3Farmavet SA, Romania E-mail: [email protected]

Summary

In the Department of Diagnostic within NS Pasteur Institute, Bucharest, during January 2013 - September 2014 there were carried out 5386 serological tests by ELISA and 373 molecular tests by PCR assay for six specific agents associated with respiratory diseases in poultry (chicken and / or turkey): infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILT), avian pneumovirus (AMPV), Ornithobacterium rhinotracheale (ORT), Mycoplasma gallisepticum (MG), Mycoplasma synoviae (MS), and in addition, E. coli (APEC) strains were pathotyped by PCR assays. Samples were from chicken industrial farms (commercial) (parents, broilers, layers) and turkey farms, located in 9 counties in the central and southern Romania. The applied vaccination schemes were different from farm to farm but also depending on the age of poultry. They included in a non unitary manner vaccinations for IB prophylaxis (mostly with strains derived from CR / FR / Qx pathotype), applied to youth and adults poultry, ILT, ART (AMPV subtype B) applied to youth and adults poultry, and mycoplasmosis with MG and MS applied to adults. The ELISA tests were performed with commercial kits (Affinitech, Pasteur, CIVTest Hipra and Biocheck) and PCR assays, real-time or classic, were made in house and with primers selected from the literature or on-line designed, based on the genetic sequences registered in GenBank. For IBV there were recorded very high antibody titers in adult poultry, and PCR tests revealed the circulation of strains derived from CR / FR / Qx pathotype and the absence of Mass or It-02 strains in all chicken ages. ILTV was present in unvaccinated layers and broilers of 42 days old, as the ELISA and PCR tests were positive. The molecular analysis registered negative results for broilers of 31 days old. For avian pneumovirus (AMPV/ART/TRT) the serological analysis showed positive results for broilers, chickens of 8 weeks and layers. AMPV type A was present in young turkeys of 61 days old, types A and C were found simultaneously in layers of 31-36 weeks old, whereas the types B and C were concomitantly detected in broilers of 42 days old. The ORT presence was showed both by ELISA and PCR in broilers of 42 days old, and adult hens and turkeys of all ages. MG and MS were present in farms without specific vaccination, both in chicken and turkey of all ages, but also in farms with vaccinated poultry, but reached at higher ages.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The APEC strains were present in young chicken, starting from one day old, and also in sanitation control samples and, curiously, at a swan from a hunting area in southern Romania. The PCR tests proved to be appropriate for the diagnosis of avian diseases, reporting the presence of strains of infectious bronchitis virus, Mycoplasma synoviae and M.gallisepticum, avian metapneumovirus, types A, B and C, and those of Ornithobacterium rhinotracheale and E.coli APEC epidemic clones in chicken industrial farms frorm Romania. The ELISA kits used proved to be highly reliable to control the efficiency of vaccines, and in combination with PCR assays, to detect infectious agents with respiratory tropism in poultry. Key words: respiratory avian diseases, ELISA, PCR

The incidence and severity of respiratory disease in commercial poultry flocks increased worldwide in recent times due to their growing practice in the intensive industrial system. The etiology of respiratory diseases is complex, often involving several viral agents simultaneously (5). Avian infectious bronchitis virus, avian infectious laryngotracheitis virus, avian pneumovirus and Mycoplasma gallisepticum were recognized as being among the most important pathogens for poultry (14). Avian infectious bronchitis virus (IBV, Gamacoronavirus) has a global spread and multiple serotypes / pathotypes / protectotypes were described whose practical importance is given by the fact that often post infectious or post vaccine immunity induced by one serotype is not protective against another serotype (1). The commercially available vaccines do not always provide protection against the new wild strains. Vaccination programs are constantly adjusted, trying to improve the protection against this disease. Being an unstable RNA virus, a part of its viral genome encoding the glycoprotein S1 can undergo recombinations and mutations, therefore new antigenic variants may occur beyond the protection induced by existing vaccines. While conventional vaccines provide good protection against homologous types, new strategies are needed to counteract the genetic instability of IBV. Infectious laryngotracheitis (ILT) is an acute respiratory disease of chickens, highly contagious, spread worldwide, which induces severe economic losses due to lower growth rate, decrease in egg production and mortality. The disease is caused by an alphaherpesvirus, Gallid herpesvirus 1. Mild or severe forms of disease, especially in layers, have been described worldwide, but in recent years in many countries, more cases were recorded with moderate symptoms of disease in broiler, frequently associated with strains derived from live vaccines (8). Recent works showed molecular differences between vaccine strains and circulating field isolates, although the vaccine ones may even be a cause of the disease. The vaccines have remained unchanged for many years, but new ones are emerging to prevent / counteract the side effects of vaccines and the reversion and reactivation of latent virus (3).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Avian mycoplasmosis caused by Mycoplasma gallisepticum (MG) and Mycoplasma synoviae (MS) are the only diseases associated with Mycoplasma listed by World Organisation for Animal Health (OIE). MG causes chronic respiratory diseases associated with stress factors and other pathogens (pneumoviruses, paramyxoviruses, infectious bronchitis virus, Ornithobacterium rhinotracheale etc). MS causes synovitis, silent infections and, also in young chickens, respiratory disease associated with stress factors (aerosol vaccination against Newcastle disease and infectious bronchitis) and other pathogens (pneumoviruses, paramyxoviruses, infectious bronchitis virus, Ornithrobacterium rhinotracheale, Escherichia coli pathogenic for poultry - APEC etc). The diagnosis of avian mycoplasmosis is mainly based on serology and detection of Mycoplasma genome by PCR. To note that avian mycoplasmosis produced by MG and MS, avian infectious bronchitis and avian infectious laryngotracheitis are included in the OIE Listed Diseases and Other Diseases of Importance to International Trade. According to OIE database, in Romania, infectious bronchitis was not diagnosed recently, avian mycoplasmosis associated to M. synoviae has never been diagnosed, and the last outbreaks of avian mycoplasmosis produced by M. gallisepticum and avian infectious laryngotracheitis were diagnosed in 2004 and respectively 1999. The virus involved in avian infectious rhinotracheitis (ART), or turkey infectious rhinotracheitis (TRT), or swollen head syndrome in chickens (SHS) is a single-stranded RNA virus, Avian metapneumovirus (AMPV), Paramyxoviridae family. The disease is manifested by respiratory syndromes in chickens, turkeys and ducks, and decreases in egg production. The disease is included in the OIE Listed Diseases and according to OIE database, in Romania was not diagnosed until June 2012. The AMPV strains have antigenic and molecular variants, being classified into four groups: A, B, C and D. Types A and B are spread around the world, and type C is very close to the human metapneumovirus involved in respiratory diseases in children (2,6). The new vaccines aim to eliminate the reversal and possibly counteract the new strains that could exceed the post vaccine protection (3). Avian ornithobacteriosis (ORT) is a respiratory disease caused by Ornithobacterium rhinotracheale, in poultry of all ages and potentially fatal. The bacteria can also cause the decrease of eggs production and joints lesions. The disease is not included in the OIE List and there are no records in the OIE database concerning its diagnosis in Romania. Avian pathogenetic E. coli (APEC) is one of the extraintestinal pathotypes of E. coli (ExPEC) (15). In poultry, APEC strains are involved in respiratory infections, often associated with some viruses, with losses that can reach 20-40% or cellulitis infection, leading to degradation of the poultry carcasses (11). Some vaccinations by aerosol can induce also episodes of colisepticemia / chronic respiratory disease (7).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The high prevalence of respiratory diseases in poultry reported worldwide in the last years has led to reassessment of control strategies and introduction of specific monitoring programs. These include diagnostic activity mainly based on serology and molecular techniques (PCR). This paper presents the enzyme immunoassays and PCR techniques developed under projects funded by the Ministry of Education and Research, Ministry of Agriculture and Rural Development and Pasteur Institute, for the etiological diagnosis of respiratory infections in poultry caused by E. coli (APEC), M. gallisepticum, M. synoviae, infectious bronchitis virus, infectious laryngotracheitis virus, avian pneumovirus and O. rhinotracheale.

Materials and methods

In the Department of Diagnostic within NS Pasteur Institute, Bucharest, during January 2013 - September 2014, 5386 serological tests by ELISA and 373 molecular tests by PCR assays were carried out for six specific agents associated with respiratory diseases in poultry (chicken and / or turkey): infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILT), avian pneumovirus (AMPV), Ornithobacterium rhinotracheale (ORT), Mycoplasma gallisepticum (MG), Mycoplasma synoviae (MS), and in addition, E. coli (APEC) strains were pathotyped by PCR assays. Samples (originated?) were from chicken industrial farms (commercial) (parents, broilers, layers) and turkey farms, located in 9 counties in the central and southern Romania. The applied vaccination schemes were different from farm to farm but also depending on the age of poultry. They included in a non unitary manner vaccinations for IB prophylaxis (mostly with strains derived from CR / FR / Qx pathotype), ILT, ART (AMPV subtype B) applied to youth and adults poultry, and mycoplasmosis with MG and MS applied in adults. The ELISA (indirect) tests were performed with commercial kits: „CIV-Test TRT‖ - chicken (Hipra), „M. gallisepticum antibodies test kit‖ - chicken, „M. synoviae antibodies test kit‖ – chicken, „Infectious bronchitis antibodies test kit‖ (Affinitech Ltd), ELI-LTI (I. Pasteur), „BioChek Poultry Immunoassay M. gallisepticum Antibody Test Kit‖ – turkey, „BioChek Poultry Immunoassay M. synoviae Antibody Test Kit‖ – turkey, „BioChek Poultry Immunoassay Ornithobacterium rhinotracheitis Antibody Test Kit‖ – chicken and turkey, andi „BioChek Poultry Immunoassay Avian Rhinotracheitis Antibody Test Kit‖ – turkey (BioChek UK Ltd. Co). The methods applied in laboratory are RENAR ISO17025 certified. The level of specific antibody was estimated in respect to control sera of each kit. The results interpretation was done by means of UNIVET software which permitted to calculate the positivity ratio (S/P), ELISA units (EU) and titer for each sample, as well as the mean titer/flock. The positive cut-off values are shown in Table 1 (according to instructions for use provided by manufacturer, lower titers than cut-off values indicating a negative result).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 1 ELISA cut-off values Cut-off Titer Value Sample IBV ILT MG MS ART/TRT ORT Chicken 400 400 400 400 195 1431 Turkey - - 668 594 1655 1431

The scale of results interpretation is applied in the Pasteur Institute, following the epidemiological data recorded over several years for poultry grown in Romania, for which specific vaccination programs were applied. Thus, mean titers of antibodies in the range of 2000-5000 for IBV and 3000 - 4000 for MG are considered protective when applying live vaccines, Mass type for IBV, or F for MG immunoprophylaxis. In the case of inactivated vaccines, normal responses are placed in the range of 7000-11000 for IBV and 6000-7500 for MG. In exchange, in the case of an inactivated vaccine applied shortly after or while the flock were exposed to infection, the immune response tends to reach higher levels than those normally expected (>15000 for IBV, respectively > 9000 for MG). For molecular techniques, organ fingerprints were collected with swabs from trachea or lung, as sample pools from two - three birds (maximum 5), which were then suspended in 1 ml phosphate saline buffer (pH 7.2 - 7.4) in the case of viruses or Ornithobacterium rhinotracheale, or in pre-enrichment medium and cultivation 1 h at 37°C for MG and MS (12). The medium used for the cultivation step (pre-enrichment) for MG / MS analysis was: Mycoplasma synoviae Medium Base (Himedia M624) supplemented with 10% pig serum inactivated at 56oC, penicillin G 100,000 IU% and 0.025% thallium acetate. DNA samples were obtained by extractions with commercial reagents: QIAamp Viral RNA Mini Kit (Qiagen 52906) for IBV and AMPV, or QIAamp DNA Mini Kit, (Qiagen 51304)) for LTI and ORT. For MG, MS and APEC the DNA samples were obtained by thermal lyses (10,13). The PCR assays, classic or real-time, were made in house, with primer from literature or online designed (Primer3 / Primer BLAST), based on genetic sequences from GenBank, and commercially synthesized (Generic Biotech, Czech Republic) (Table 2).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 2 Primers used during this study and results of amplifications Reference s/ No. Primer Amplicon Agent Gene acces 5'-3' sequences GeneBank Size (bp) Tm IBV S1 Qx: F-tgg ggg tgc tta tgc agt aga; R- 190 77.53 – AJ619609.1; gtc tga gaa gtt aca atg gca tgt; (Qx/CR/FR/4/9 78.08 DQ901377.1 1) (CR88121) It02:F-taa tgc gca agg aac cag ct; ; 376; 434 (It02) AY561713.1 R-tgt agg tta tgg gac cgc ca; Mass:F-gca ggc tct tca tct ggg tg; R- 212 (Mass) 77.95-78.60 tgc tgt tga agc atg cca gt (Ma5) ILT UL15a F-ttg ctg tgc tat ttc gcg tg; 113 79.10-79.65 (4) R-gta aat cgt tta gtg cgg cat MG/MS pMGA1. MG:F- cgc acc aag aga agg tga tt; 163 (MG) NA U90714.1 9 R-tgc aga ggt gtc aaa ggt tc; 300 (MS) (13) 23s Ms: F-taa aag cgg ttg tgt atc gc; RNA R-cgc agg ttt gca cgt cct tca tcg AMPV G A: F-gga cat cgg gag gag gta ca; 116 (A) 79.08-79.60 (3) (AMPV- (A) R-cac tcc tct aac act gac tgt tca act; 135 (B) A, B, D) B: F-aat agt cct caa gca agt cct cag 76.40-76.50 82 (C) SH a; R-ctg tcg taa ttt gac ctg ttc tac (B) (AMPV- act;C: F-aga cca gtt tca agg acc act 63 (D) 78.58-78.60 C) c; R-cat tta gct gtg ata ttc tgg cac tt; (C) D: F-aac ttg tgc caa act gct tga a; R- agt gca att gtg gtt gta cct gtt 75.35 (D*) ORT 16s F-tag ttg aag gta cca tac gaa taa g; 197 NA DQ195239 ARNr R-agc tac ttc aat atc act caa gac t APEC ompA, ompA: F-ctt gcg gag gct tgt ctg ag; 1421 (ompA) NA (9,10) iss, fimH R-agg cat tgc tgg gta agg aa 737 (iss) iss: F-gtg gcg aaa act agt aaa aca 670 (fimH) gt; R-cgc ctc ggg gtg gat aa fimH: F-caa aac ctg gtc gtg gat ct; R-ttg ccg tta atc cca gac tc * field sample, with confirmation by TBE 2.5% gel-electrophoresis; NA – not applicable

The concentration of the primers in each type of reaction, the volume of the reactions and the cycling programs applied are reproduced in Table 3. 28

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 3 Cycling programs,controls, reagents and sample volumes used during this study Primers Volume (µl) PCR Agent Control Gene concentratio Program Reaction / method Sample n (pmole) mix IBV Gallivac rPCR S1 12.5 42oC, 30 min + 25 / Brilliant 2 IB88 95oC, 15 min – 1x; II Sybr (CR88121, 94oC, 45 sec + Green qRT- 10-4, 50oC, 45 sec + PCR Master Merial,) 72oC, 1 min – 40x; Mix, Agilent Nobilis IB 72oC, 10 min – 1x; Ma5 (10-4, 25oC, 1 min – 1x ; MSD) dissociation curve of MxPro v01/2007 program (95oC, 1 min, 55oC, 30 sec and slope at 95oC) ILT Cover (CR rPCR UL15a 15 50oC, 2 min – 1x; 20 / Brilliant 5 Spafas) 95oC, 10 min – 1x; II Sybr 95oC, 15 sec + Green qPCR 60oC, 1 min – 40x; Master Mix, 60oC, 5 min – 1x; Agilent 25oC, 1 min – 1x MG/MS* MG A5969 multipl pMGA1. 30 80oC, 30min – 1x; 25 / illustra 5 MS ex 9 94oC, 15 sec + PuReTaq WVU1853 PCR 23s 55oC, 30 sec + Ready-To- (CR Spafas ARN 72oC, 1 min – 5x; Go PCR - Affinitech) 94oC, 15 sec + Beads, GE 55oC, 30 sec + Healthcare 72oC, 1 min – 30x, 2 sec increment at each cycle; 72oC, 10 min – 1x; 4oC, 10 min (for ever) – 1x AMPV EPCAPV- rPCR G 12.5 42oC, 30 min + 25 / Brilliant 2 012 (10-2, (AMPV- 95oC, 10 min – 1x; Sybr Green LSI) A, B, D) 95oC, 15 sec + qRT-PCR SH 60oC, 1 min – 45x; Master Mix (AMPV- 60oC, 10 min – 1x; with low C) 25oC, 1 min – 1x; Rox, Agilent dissociation curve of MxPro v01/2007 program (95oC, 1 min, 55oC, 30 sec. and slope at 95oC) ORT DSMZ PCR 16s 30 95oC, 10min – 1x; 25 / illustra 2 15997 ARNr 95oC, 45 sec + PuReTaq (A1208525- 50oC, 45 sec + Ready-To- 1, 10-2, 72oC, 1,5 min – Go PCR 1 ul) 45x; 72oC, 10 min Beads, GE – 1x; 4oC – 10 min. Healthcare 29

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

APEC* E.coli multiplex ompA, 25 94oC, 10min – 1x; 25 / Ilustra 1 PIB4293 PCR iss, fimH 94oC, 1 min + 55oC, PuReTaq 1,5 min + 72oC, 2,5 Ready-To-Go min – 30x; 72oC, 10 PCR Beads, min – 1x; 4oC –for ever GE Healthcare * bacterial cultures / isolates obtained from biological samples

As thermal cyclers GeneAmp PCR System 9600 (Applied Biosystems) or iCyler (Biorad) for PCR and multiplex PCR and Mx3005P (Stratagene) were used for rPCR. The molecular tests performed for IBV were developed based on S1 sequences from GenBank, in order to discriminate three categories of avian bronchitis virus strains: Massachusetts (Mass) strains and derived classical vaccine strains (H120, H52, MA5), Qx, CR / FR, 4/91 type strains (predominantly nefropathogenic / enteropathogenic strains, with north Asian and European distribution) and It02 type strains (variant originally isolated in Italy in the 90s, with southern, western and central European distribution). A rPCR technique based on genetic sequence UL15a was used for ILT. The molecular detection of AMPV was based on the amplification of sequences specific to each AMPV groups: the G gene for types A, B and D, and the SH gene for type C. The rPCR results were confirmed by TBE 2.5% gel electrophoresis and dissociation curves. The samples were considered positive when the amplicon of estimated size was visualised and the Tm values were recorded within ± 4Tm of positive control. The molecular detection of MG and MS was made by a multiplex PCR assay, which simultaneously detects the two species by the same amplification reaction, after a pre-enrichment step in growth medium specific to mycoplasma. In the reaction of amplification, The MgCl2 was added to the concentration of 2 mM. For ORT, the molecular test used in I.Pasteur is based on amplification of a fragment of 16s rRNA gene, encoding the 16S subunit of rRNA. APEC pathotyping tests were carried out on isolates of Escherichia coli, by multiplex PCR for ompA, iss and fimH genes, as previously published (10). The primers designed in house were tested for specificity on other agents (data not shown).

Results and discussions

The ratios of serological tests during 2013-2014 performed for avian respiratory infectious agents were: 31% IBV, 26%MG, 23% MS, 10% AMPV, 7% and 3% ORT ILT, and for molecular analysis: 37% MG / MS, 15% IBV, 15% ILT, 12% E. coli APEC, 11% ORT and 10% AMPV. For avian infectious bronchitis were analyzed serum samples from breeder flocks as follow: chicken of 1-42 days old, youth of 8-18 weeks days and

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA adult poultry of 22-53 weeks old. Samples were collected from youth and adult poultry of 8-53 weeks old vaccinated against avian infectious bronchitis, from chicken descending from vaccinated parents and from chicken flocks of 22-42 days old for which no information regarding the vaccination programs was provided. For broilers of 1-4 days old, significant levels of maternal antibodies specific to IBV were recorded, with a relatively uniform distribution within the titers groups, suggesting a uniform immunization of the parents‘ flocks. The mean titer values showed an adequate protection of progeny flocks (eg. Tavg= 6915). For broilers of 22-42 days old, a wide range of IBV antibody titer values was recorded, from 630 (without protection for vaccinated flocks) to 11500 (good protection in the case of vaccination programs). If these flocks were not vaccinated, the antibodies detection suggested a possible infection with IBV. In the case of the adult flocks, very high levels of IBV antibody titers (> 16,000) were recorded, with a distribution mostly irregular, which suggested that the immunizations were not performed uniformly or infections with wild strains have evolved simultaneously with the applied vaccination programs. PCR tests revealed the circulation of IBV strains derived from CR / FR / Qx pathotype in broilers and the absence of Mass or It-02 strains in chicken of all ages. The serological tests performed for infectious laryngotracheitis virus were positive for unvaccinated layer flocks and broilers of 42 days old. In the case of broilers, the antibody mean titer value (~3000) suggests the seroconversion following exposure to wild strains circulating in the field, facts supported as well by the positive results of molecular tests. However, the molecular analysis showed a negative result for the broilers of 31 days old. For avian pneumovirus (AMPV/ART/TRT), the serological analysis showed positive results both in broilers of 8 weeks old and also in layers (27-52 weeks old). Very high antibody levels were recorded for turkeys of 1-5 days old (14000), and also for youth of 6 weeks (18000) and 18 weeks old (20000). The molecular tests showed that the AMPV type A was present in young turkeys of 61 days old, the viral types A and C were found simultaneously in layer hens of 31-36 weeks old, whereas the types B and C were concomitantly detected in broilers of 42 days old. For M. gallisepticum and M. synoviae no maternal antibodies were registred in broilers of 1-4 days old. In contrast, in the case of the young poultry of 4-6 weeks old low levels of MG antibodies (~900) were recorded, suggesting an exposure to the infectious agent. Moderate levels of MG antibodies were detected in adult flocks, fact which suggested an adequate protection if the vaccination programs were applied. Occasionally, there were recorded very high levels of antibodies against MG and MS (> 15000) in other adult flocks (32 weeks old). All the tested turkeys flocks were serologically negative for MS. The antibodies against MG were reported only in

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA young turkeys of 8-10 weeks and 18-20 weeks old (high levels of antibodies with an average of ~12000). From a molecular point of view, MG and MS were present in farms without specific vaccination, both in chicken and turkey of all ages, but also in farms with vaccinated poultry, but reached at higher ages. The Ornithobacterium rhinotracheale presence was showed both by ELISA and PCR in broilers of 42 days old, and adult hens and turkeys of all ages. The APEC strains were present in young chicken, starting from one day old, and also in sanitation samples and, curiously, at a swan from a hunting area in southern Romania. The results are summarized in figures 1-5.

16000 14000 12000 IBV

Ab MeanTiter Ab 10000 MG 8000 MS 6000 ILT 4000 2000 AMPV 0 ORT 1-4 days 22-42 days 7-17 weeks 22-32 weeks 36 weeks > 40 weeks Age PCR - PCR - PCR - PCR - PCR - PCR - MG,MS,ORT IBV,MG,MS IBV,MG,MS, MG,MS,ILT IBV,MG,MS IBV,MG, ILT,ORT , MS,ILT,ORT ILT,AMPV

Fig. 1. Hen – the distribution of antibody levels on age groups and respiratory infectious agents 20000 18000 16000

14000 AMPV Ab Mean Titer AbMean 12000 ORT 10000 MG 8000 MS 6000 4000 2000 0 Age 1-5 days 2 w eeks 4 w eeks 6 w eeks 8-10 w eeks 12-14 16 w eeks 18-20 w eeks w eeks

Fig. 2. Turkey - the distribution of antibody levels on age groups and respiratory infectious agents 32

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

1 2 3 4 5 6 7 8 9 10 11 12 13

197 bp

Fig. 3. Gel-electrophoresis post- PCR 16S rRNA Ornithobacterium rhinotracheale. – lines 3, 4 and 8 – ORT positive samples (amplicon of 197 bp)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

A 190 bp Qx

212 bp Mass B

Fig. 4. Gel-electrophoresis rPCR Sybr Green – Infectious bronchitis virus: Qx serotype (CR/FR, 4/91), A, lines 1 – 7; Mass type/serotype (H120 / H52 / Ma5), B, lines 1 – 7; It02 type/serotype, B, lines 9 - 14. A: lines 3 - 6: lung pools, broiler 33 days old (Qx positive); line 7: positive control IB88, Merial for Qx (amplicon 190 bp). B: lines 3 - 6: lung pools, broiler 33 days old (negative Mass); line 7: positive control Ma5, Intervet for Mass (amplicon 212 bp). B: lines 11 - 14: lung pools, broiler 33 days old (negative It02, non-specific amplicons)

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

1 2 3 4 5 6 7 8 9 10 11

300 bp

163 bp

Fig. 5. Gel-electrophoresis post multiplex PCR (pMGA1.9 + 23s rRNA – MS) Mycoplasma gallisepticum and M. synoviae. Samples from chickens of 25 – 28 days old. Line 2: nasal pool (MS positive, amplicon 300 bp); lines 3-4: tracheal pools (MG, MS negative); line 5: tracheal pool (MS positive, amplicon 300 bp); lines 6-10: lung pools (MS positive, amplicon 300 bp; + non-specific amplicons; line 10: positive control: mix M. gallisepticum, amplicon 163 bp and M. synoviae, amplicon 300 bp

Conclusions

The PCR tests proved to be suitable for the diagnosis of avian diseases, reporting the presence of avian bronchitis virus type Qx, Mycoplasma synoviae and M.gallisepticum strains, avian metapneumovirus strains, types A, B and C, and those of Ornithobacterium rhinotracheale and some epidemic clones of avian pathogenetic E.coli (APEC) in industrial poultry farms from Romania. The used ELISA tests proved to be highly reliable to control the efficiency of vaccines, and in combination with PCR assays, to detect infectious agents with respiratory tropism in poultry. Serological and molecular monitoring of poultry, together with the provision of comprehensive data regarding to the analyzed flocks represent the correct behavior to control the infections, accompanied, where appropriate, by preventive treatments and reconfiguration of immunoprophylactic programs.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

References

1. Gelb, J. Jr., Jackwood, M. W., Infectious bronchitis, p. 169-173. In A laboratory manual for the isolation and identification of avian pathogens, 4th Ed. American Association of Avian Pathologists, D. E. Swayne Ed., Kennett Square, PA, 1998. 2. Guionie, O., Toquin, D., Sellal, E., Bouley, S., Zwingelstein, F., Allée, C., Bougeard, S., Lemière, S., Eterradossi, N., Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus, J Virol Meth, 2007, 139, 150–158. 3. Jones, R.C., Viral respiratory diseases (ILT, aMPV infections, IB): are they ever under control?, Br Poult Sci, 2010, 51(1), 1-11. 4. Mahmoudian, A., Kirkpatrick, N.C., Coppo, M., Lee, S.W., Devlin, J.M., Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus. Avian Pathol, 2011, 40, 237–242. 5. Malik, Y., Patnayak, D., Goya, S.M., Detection of three avian respiratory viruses by single-tube multiplex reverse transcription–polymerase chain reaction assay, J Vet Diagn Invest, 2004, 16, 244–248. 6. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2014, Chapter 2.3.15, http://www.oie.int/international-standard-setting/terrestrial- manual/access-online/ 7. Matthijs, M.G., van Eck, J.H., deWit, J.J., Bouma, A., Stegeman, J.A., Effect of IBV-H120 vaccination in broilers on colibacillosis susceptibility after infection with a virulent Massachusetts-type IBV strain, Avian Dis, 2005, 49, 540–545 8. Moreno, A., Piccirillo, A., Mondin, A., Morandini, E., Gavazzi, L., Cordioli, P., Epidemic of infectious laryngotracheitis in Italy: characterization of virus isolates by PCR-restriction fragment length polymorphism and sequence analysis, Avian Dis, 2010, 54(4), 1172-1177.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH REGARDING THE RESISTANCE PHENOTYPES IN STAPHYLOCOCCI ISOLATED FROM BOVINE MASTITIS

IULIA BUCUR¹, VIRGILIA POPA², N. CĂTANA¹

Summary

In cattle, mastitis is produced both of positive and negative coagulase staphylococci, with a correlation between progressive clinical forms and the pathogenicity level of strains. Local treatments improperly made, have induced the multiple resistance to antibiotics phenomenon, which is transmitted by R plasmids intraspecific and interspecific. Antibiotic resistance created difficulties in mastitis therapy, which requires the necessary antibiogram at each isolate. A total of 64 of positive and negative coagulase staphylococci strains were tested by Kirby-Bauer disk diffusimetric method using biodiscs with 15 antibiotics from several groups and the results were interpreted according to the standards. Antibiotic resistance to β-lactams varied between 7.81% and 64.06%, and resistance to methicillin was 57.81%, indicating a high proportion of strains carrying the mec gene. The resistance phenotypes of the tested strains, to the other groups of antibiotics, had a variable frequency, between 4.68% and 70.31%. Key words: antibiotic, bovine, mastitis, phenotype, resistance

Staphylococci produce in animals, as well as in humans, distinctive infectious diseases, or localized infections, either as primary infections or as secondary etiologic agents, after some viral infections (4). Bovine staphylococcal infections are common and include clinical and subclinical mastitis, septic pododermatitis and other localized infections. Mastitis is produced both by coagulase positive staphylococci and coagulase negative staphylococci, as there are a correlation between progressive clinical forms and the pathogenicity level of strains (4). Local treatments made improperly have induced the multiple resistance to antibiotics phenomenon, which is is transmitted by R plasmids intraspecific and interspecific. Antibiotic resistance created difficulties in mastitis therapy, which requires the necessary antibiogram at each isolate (1, 4). The research was made in order to identify the resistance phenotypes of both positive and negative coagulase of staphylococci strains isolated from primiparous bovines with clinical and subclinical mastitis. 36

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

Pathological samples were taken from primiparous bovines with mastitis, occurring at different periods after calving, represented by mastitis milk. Primary inseminations were made on 5% sheep defibrinated blood agar, while the isolated strains were screened based on cultural, morphological, tinctorial and biochemical characters. Isolates were tested by Kirby-Bauer disk diffusimetric method using biodiscs with 15 antibiotics from several groups (Table 1) and the results were interpreted according to the standards (5).

Results and discussions

Bacteriological examination, carried out as described, allowed the isolation of 64 positive and negative coagulase staphylococci strains. The results obtained by testing the susceptibility of antibiotics are summarized in Table 1, according to the two groups of staphylococci differentiated based on free coagulase, without taking into consideration the species they are included to. Table 1 Resistance phenotypes of staphylococci strains isolated from bovine with mastitis Antibiogram results Crt. Total Antibiotic Susceptible Intermediary Resistant no. strains No. % No. % No. % 1. Amoxicillin 14 21.87 18 28.12 32 50 64 2. Ampicillin 12 18.75 21 32.81 31 48.43 64 Ampicillin 3. 13 20.31 24 37.50 27 42.18 64 /Sulbactan Amoxicillin / 4. 31 48.43 15 23.43 18 28.12 64 Clavulanic acid 5. Cefoxitin 55 85.93 4 6.25 5 7,81 64 6. Clindamycin 49 76.56 5 7.81 10 15,62 64 7. Erythromycin 8 12.5 11 17.18 45 70.31 64 8. Gentamycin 19 29.68 13 20.31 32 50 64 9. Kanamycin 23 35.93 14 21.87 27 42.18 64 10. Lincomycin 37 57.81 12 18.75 15 23.43 64 11. Oxacillin 20 31.25 8 12.50 36 56.25 64 12. Oxytetracycline 11 17.18 14 21.87 39 60.93 64 13. Penicillin G 10 15.62 13 20.31 41 64.06 64 14. Rifampicin 49 76.56 12 18.75 3 4.68 64 15. Methicillin 18 28.12 9 14.06 37 57.81 64

The results in the tested strains show that antibiotic resistance to one or more antibiotics had a variable frequency between 0 and 70.31% antibiotic susceptibility was between 15.62% and 85.93%, while strains with intermediate behavior varied between 0 and 37.5%. 37

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The β-lactams used for testing were selected based on two criteria, firstly, on the existence of medicinal products for mastitis therapy and, secondly, on the three types of resistance to this group of antibiotics found in staphylococci, considering seven antibiotics had been selected. Analyzing the results on antibiotic resistance to this group of antibiotics, shows that this resistance was between 7.81% and 64.06%. Although there are no veterinary medicinal products made up of methicillin, oxacillin and cefoxitin, these three β-lactams were used because they reveal the methicillin resistance. Oxacillin is resistant to β-lactamase, which makes it preferable to methicillin for the stability and reproducibility of the results. Furthermore, since 2004, cefoxitin is also recommended. Antibiotic resistance to these three β-lactams was different, as a correlation was observed only between oxacillin and methicillin, while to cefoxitin only 7.81% of the tested strains were resistant. Resistance to methicillin, at the tested strains, was 57.81%, which demonstrates a high proportion of the strains carrying the mec gene that encodes resistance to this antibiotic. Methicillin-resistant strains were also resistant to other antibiotics, showing that methicillin resistance is associated with multiple resistance to antibiotics phenomenon. Positive and negative coagulase staphylococci strains showing the resistance phenotype to methicillin, are considered strains with a high zoonotic risk, thus have a complex epidemiological circuit. Mec gene encoding resistance to methicillin can be transmitted to staphylococci strains susceptible to methicillin (intraspecific transmission), but also to bacterial strains included in other species (interspecific transmission), through the R plasmid. The results show the correlation between oxacillin and methicillin resistance, but do not show the correlation between these two β-lactams and cefoxitin, to which the antibiotic resistance was very low, as reported in specialised literature (2, 3). The resistance phenotype to methicillin is very common in strains of S. aureus subsp. aureus isolated from humans and animals, which is known as MRSA strains type (Methicillin Resistant S. aureus). However, in the last years, it has also been reported in other species of staphylococci pathogenic for both humans and animals (3). In 2013, Wan Mintao et al. studied the presence of methicillin-resistant strains of S. aureus subsp. aureus, isolated from animals and humans, showing that strains possessing this character show a high zoonotic risk with a complex epidemiological circuit starting from animals. The authors have revealed the presence of genes encoding the synthesis of the main pathogenic factors, represented by enzymes and exotoxins. It has also been detected the mec gene that encodes the methicillin resistance (6). The resistance phenotypes to other antibiotic groups had a variable frequency induced by their usage in mastitis therapy. The high frequency of erythromycin resistant strains also indicates an inducible resistance to all

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA macrolides with 14 atoms. This resistance is governed both plasmid and chromosomal (1, 2). Resistance to oxytetracycline shows that staphylococci strains are usually resistant to all tetracyclines. This resistance is encoded by tet gene, present in the genetic material, both plasmid and chromosomal and very easily transmitted (1, 2). Resistance to the used aminoglycosides, gentamycin and kanamycin, was present in half of the tested strains, even though these two antibiotics are rarely used in the cattle mastitis treatment. Resistance to lincosamides was low, because this group of antibiotics is rarely used in drug production for cattle mastitis treatment.

Conclusions

At the staphylococci tested strains, the methicillin and oxacillin resistance was similar, showing a high frequency of strains carrying the mec gene, while the resistance to cefoxitin was very low. The resistance phenotypes of the tested strains, to other groups of antibiotics, had a variable frequency, between 4.68% and 70.31%. The results show that resistance phenotypes depend on the use of antiobiotics and are independent of staphylococcal species.

References

1. Aarestrup, F. M., Schwarz, S., Antimicrobial resistance in staphylococci and streptococci of animal origin, în Antimicrobial resistance in bacteria of animal origin, Ed. ASM Press, Washington, D.C., 187- 212, 2006. 2. Aarts, H. J. M., Guerra, Beatriz, Malorny, B., Molecular methods for detection of antibiotic resistance, în Antimicrobial resistance in bacteria of animal origin, Ed. ASM Press, Washington, D.C., 37-48, 2006. 3. Bardiau, M., Yamazaki, K., Duprez, J. N., Taminiau, B., Mainil, J. G., Ote, I., Genotypic and phenotypic characterization of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk of bovine mastitis, Letters in Applied Microbiology, 2013, 57 (3), 181-186. 4. Cătană, N. Infecții produse de germeni din genul Staphylococcus, In: Boli Infecțioase ale animalelor, Bacterioze, ed. Moga Mînzat R., Ed. Brumar, Timișoara, 325-346, 2011. 5. Codiţă, Irina, Buiuc, D., Determinarea sensibilităţii la antibiotice: teste calitative, In: Tratat de microbiologie clinică, ediţia a II-a, eds. Buiuc D., Neguţ M., Ed. Medicală, Bucureşti, 453-482, 2008. 6. Wan, Mintao, Lauderdale, T. L., Chou, Chincheng, Characteristics and vrirulence factors of livestock associated ST9 methicillin-resistant Staphylococcus aureus with a novel recombinant staphylocoagulase type, Veterinary Microbiology, 2013, 162, (24), 779-784.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH ON MOBILE SEROVARS FREQUENCY OF SALMONELLA SPP. AT GALLUS GALLUS SPECIES IN ROMANIA

N. CĂTANA, RAMONA CLEP, L. FLUERAȘU, IONICA FODOR, V. HERMAN

Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania E-mail:[email protected]

Summary

The globalizatin of trade with poultry material associated with changing technologies increase with the emergence of mobile Salmonella strains, contributed to the spread serovars in flocks of broiler chickens, breeding hens and chickens for egg consumption. The epidemiologic research, in the outbreaks of paratyphoid, proved the existence of vertical and horizontal transmission direct and indirect inside farms and between farms. Also, the resaerch have shown that birds and poultry products are a huge reservoir of mobile serovars with a pronounced zoonotic risk. In Romania was implemented the National Monitoring Program, Control and Eradication of Zoonotic Salmonellosis in Gallus gallus species, since 2009, and the study was carried out in 2009-2012. The research was carried out in order to establish the prevalence of mobile Salmonella serovars in the three types of farms and to follow the objectives established by Community law. Key words: mobile Salmonella, paratyphoid, prevalence

The globalization of trade with poultry material associated with changing technologies increase with the emergence of mobile Salmonella strains, contributed to the spread serovars in flocks of broiler chickens, breeding hens and chickens for egg consumption (1,2). The epidemiologic research, in the outbreaks of paratyphoid, proved the existence of vertical and horizontal transmission direct and indirect inside farms and between farms. Also, the research have shown that birds and poultry products are a huge reservoir of mobile serovars with a pronounced zoonotic risk (1,2). In Romania was implemented the National Monitoring Program, Control and Eradication of Zoonotic Salmonellosis in Gallus gallus species, since 2009, and the study was carried out in 2009-2012 (2,3). The research was carried out in order to establish the prevalence of mobile Salmonella serovars in the three types of farms and to follow the objectives established by Community law.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

The samples for bacteriological examination were taken from the three categories of farms according with the legal provisions being represented by feces taken at random from the shelter (at least one gram), five pairs of boot swabs, each cover representing 20% of the housing, dust samples collected from many places, and for livestock breeding were taken mixed fecal samples (150 grams) (3). The samples were taken and dispatched within 24 hours at the county laboratories authorized to carry out bacteriological examination and identification biochemical and serological typing final and were carried out in the National Reference Laboratory for Salmonella within the IDSA Bucharest. Isolation and typing serovars of Salmonella spp. are carried out in accordance with Amendment 1 of ISO 6579- 2002 / Amendment 1: 2007 "Microbiology of food and animal feeding stuffs - Horizontal method for the detection of Salmonella spp." / Amendment 1: Annex D : detection of Salmonella spp. in animal faeces and in the environmental samples from the primary production stage (3).

Results and discussions

During the monitoring period (2009-2012), to the production categories subject to investigations mobile Salmonella serovars isolated frequency was variable. Investigations carried out in the three categories of farms revealed significant epidemiological data, concerning the frequency of serovars that have circulated in the livestock farms. All the serovars isolated had belonged to species Salmonella enterica species subsp. enterica.

Table 1 The frequency of mobile Salmonells according to the category of production Year Growth category Total Breeding hens Broilers Lighter breeds 2009 21 400 104 525 2010 55 421 179 655 2011 42 655 303 1000 2012 31 799 147 977 Total 149 2275 733 3157

During the bacteriological monitoring, between 2009 and2012, in the three categories of farms, were isolated 3157 strains of mobile Salmonella classified into several serovars, the frequency of these being a function of category of production (Table 1). In the breeding hens category were isolated 149 strains (4.72%), classified serologically in 17 serovars were also included and three relevant serovars (S. enteritidis, S.infantis, S. typhimurium). The number of isolates was 41

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA minimal in 2009 and in maximum in 2010, minimum number of serovars was also in 2009, and in subsequent years the number of serovars was relatively constant. In the lighter breeds category , in the range monitored was isolated a number of 733 isolated strains (23.22%), classified into 33 serovars, including also two relevant serovars (S. enteritidis, S. typhimurium) and S. gallinarum - galinarum biovariant and S. gallinarum- pullorum biovariant. Isolation of immobile serovars suggests either a vertical transmission or horizontal transmission through some primary or secondary sources. In this category, the number of mobile Salmonella strains isolated in 2009 was minimum and in 2011 was maximum. In the broilers category were isolated most strains, respectively 2275 (72.06%), their number gradually increasing from 400 strains in 2009 to 799 strains in 2012. Isolated strains, in the monitored range, were classified into 35 serovars, including also two relevant serovars (S. enteritidis and S. typhimurium). It has also been isolated S. anatum, S. gallinarum- gallinarum biovariant and S. gallinarum- pullorum biovariant suggesting the existence of primary and secondary sources through which these two serovars were introduced in these herds. In the monitoring interval, 2009-2012, in the three categories of farms isolated the frequency of serovars was variable. Method of taking samples, isolation and identification methodology allowed the isolation of strains of mobile Salmonella, falling in several serovars including serovars relevant to each category of production. The frequency of serovars relevant for three categories of production was variable. S. enteritidis was isolated consistently every year, the highest frequency (45.57%) was recorded in lighter breeds and the lowest frequency of 1.25% was recorded in broilers. S. typhimurium was isolated inconsistent with a frequency of between 0.12% and 2.80%. S. hadar was absent from breeding hens and lighter breeds and in broiler frequency was between 0.76% and 8.16%. S. infantis was inconstant isolated with the highest frequency, 63.57% in broilers and breeding hens and eggs for consumption frequency was very low, in some years, being absent. The relevant serovar, S.virchow was not isolated from any one category of production.

Conclusions

Bacteriological and serological examinations allowed the biochemical identification and classification of isolates strains in several serovars whose prevalence was correlated with production category. During the monitoring period were identified only four relevant serovars in livestock from 3 categories production monitored (S. enteritidis, S. infantis, S. hadar and S. typhimurium), serovar S. virchow was absent.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

During the monitoring period strains and serovars had a varying prevalence, the maximum value of this indicator beeing in broilers. The results obtained following the monitoring of flocks, from three categories of farms have shown the effectiveness of the National Programme, as the prevalence of infected herds belonging to the three categories of production was within the values set out in European legislation.

References

1. Gast, K.R. Paratyphoid Infections In Disease of Poultry, 13th Edition, Editon in Chief: Swayne E.D., Wiley-Blackwell,2013, p.693-706. 2. Sandu, I. Manual de diagnostic al salmonelozelor, IDSA, București, 2010. 3. *** 2006- Regulamentul (UE) nr.1177/2006 al Comisiei din 1 august 2006 de punere în aplicare a Regulamentului (C.E.) nr. 2160/2003 al Parlamentului European și al Consiliului privind cerințele în vederea utilizării de metode de control specifice în cadrul programelor naționale de control al salmonelelor la păsări.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH ON THE FREQUENCY OF STAPHYLOCOCCAL SPECIES ISOLATED FROM SUBCLINICAL MASTITIS PRIMIPAROUS BOVINES

N. CĂTANA¹, IULIA BUCUR¹, VIRGILIA POPA²

1Banat‘s University of Agricultural Science and Veterinary Medicine, ―King Mihai I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street, no. 119, Timisoara, Romania 2S.N. Institutul Pasteur S.A. București E-mail: [email protected]

Summary

In the last years, several species of coagulase-negative staphylococci (CNS) have been isolated from animals but also from humans, producing different localized infections of which are distinguished in frequency and importance the subclinical mastitis of dairy cattle. Considering these aspects, research followed: cultural, morphological, tinctorial characters and biochemical profile of the isolates regarding the typification. These characters were also researched by classical methodology with API Staph system multitest. The isolated staphylococci formed on 5% defibrinated sheep blood agar, haemolytic characteristic colonies, with partial haemolysis, unhaemolytic, with different intensities of yellow pigment and white pigment. Chapman medium allowed the differentiation of positive and negative mannitol strains, while Baird-Parker medium and Difco agar with 1% maltose and blue bromocresol allowed rapid differentiation of S. aureus subsp. aureus strains. Bound coagulase was present in 18.75% of the isolates, while free coagulase was present in 15.63% of the isolates. The API Staph multitest was used for biochemical differentiation of 64 strains of isolated staphylococci from bovines with subclinical mastitis and, based on the results of this system, 19 species of staphylococci were identified. Key words: dairy cattle, coagulase-negative staphylococci, subclinical mastitis

Staphylococci cause distinct infectious diseases, both to animals and humans, referred to as the staphylococci, as well as localized infections in different tissues and organs, which are primary or secondary infections (4). In the last years, several species of coagulase-negative staphylococci (CNS) have been isolated from animals but also from humans, causing different localized infections of which are distinguished in frequency and importance the subclinical mastitis of dairy cattle (3, 4). Having considered these aspects, the research aimed:  the cultural, morphological and tinctorial characters of the isolates;  the biochemical profile of the isolates regarding the typification.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

Mastitic milk samples were collected, in sterile tubes, from a total of 22 primiparous cows, when the subclinical mastitis started. The objective of the bacteriological examination was the isolation of staphylococci strains, in pure culture, for later identification and definitive typification, following the known methodology (1, 2). The pathological materials were inseminated in broth and on 5% sheep blood agar, and the incubation was made at 37°C, aerobically for 18-20 hours. Free coagulase was revealed with the lyophilized rabbit plasma, using the technique in tubes, while bound coagulase was revealed using the rapid kit PROLEX STAPH LATEX KIT. The mannitol fermentation test was made on Chapman selective medium, and Baird-Parker medium and Difco agar with 1% maltose and blue bromocresol were used in order to rapidly differentiate the S. aureus subsp. aureus strains (1, 2). The identification of catalase-positive and catalase-negative staphylococcal species was carried out using the API Staph multitest (5). Biodiscs with novobiocin and furazolidone were used to differentiate the pathogenic staphylococci from scavenge staphylococci and micrococci, through Kirby-Bauer method and using the MUELLER-HINTON medium (1, 2).

Results and discussions

As a result of the inseminations, cultures have been obtained, both in the liquid medium or broth, as on the solid medium, represented by 5% defibrinated sheep blood agar. In broth, primary cultures produced an intense turbidity with an uncharacteristic deposit, easy to homogenize and some of the strains formed a discrete ring at the surface. The growth of the strains in broth was visible after 16- 20 hours of incubation in thermostat. The intensity of the turbidity was based on the staphylococcal species, and S. sureus subsp. aureus was the most intense. Some of the colonies were opaque, others were creamy, with smooth and glossy surface, while the edges were irregular. Staphylococcus formed round, curved and irregular colonies, with a diameter of 1-6 mm, on the 5% sheep defibrinated blood agar. The pigmento genesis was different on this medium, depending on the staphylococcus species, and, thus, the colonies were pigmented yellow-orange, golden yellow, pale yellow or white color. On primary cultures and subcultures, staphylococci strains produced variable haemolysis, correlated with the pigment type and the morphology of the cultures. Thus, there were strains that produced a total haemolysis as circular areas around the colonies, with completely clear agar, called type β-haemolysis,

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA characteristic of S. aureus subsp. aureus species. Certain strains produced an area of incomplete haemolysis at 37°C, which became complete after the culture plates were kept at 4°C for several hours. This type of hemolysis, called the "hot-cold" type is produced by β-hemolysin. Other isolates that didn‘t produce haemolysis were considered unhaemolitic strains. In smears, Gram stained, made up from isolated characteristic colonies, Gram-positive cocci were revealed as uniform, spherically shaped and grouped in piles. These morphological characters were considered specific to staphylococci strains. Bound coagulase was present on 12 strains (18.75%), while the free coagulase was present in 10 (15.63%) from a total of 64 of staphylococci isolated strains (Table 1). Based on the free coagulase, staphylococci are classified in two groups, namely in coagulase negative and coagulase positive. Strains of S. aureus subsp. aureus synthesize free coagulase in a proportion of 97%, but other species of staphylococci have other pathogenicity factors. Mannitol fermentation was revealed on Chapman medium, which allowed the differentiation of positive mannitol staphylococci strains from the negative mannitol staphylococci strains. Also, in the case of polymicrobial samples, this medium, through its content of sodium chloride, acted as a selective medium, inhibiting the growth of other bacterial species. Positive mannitol strains grew well and fermented the mannitol, causing the pH indicator color to change, while negative mannitol strains grew, but did not ferment the mannitol and, thus, the pH indicator did not turn the color. In some strains, mannitol fermentation was delayed to 48 hours. Other staphylococci strains fermented the mannitol under anaerobic conditions, too. This biochemical character is well expressed in strains included in S. aureus subsp. aureus species, which fermented the mannitol both aerobically and in anaerobiosis. Strains belonging to some species of staphylococci have only anaerobic mannitol fermentation, while strains included in other species were mannitol negative, even if they grew on this medium. A total of 64 staphylococci strains, isolated from primiparous bovines with subclinical mastitis, were seeded on Baird-Parker medium. On this medium, after a 24 hours incubation at 37°C, strains included in S. aureus subsp. aureus formed colonies of medium size, black shiny and surrounded by a clear halo. Staphylococci strains belonging to other species, did not produce characteristic changes in this medium. This medium allowed the rapid differentiation of S. aureus subsp aureus strains from the other species of staphylococci. Difco agar with 1% maltose and blue bromocresol, as a pH indicator, was used for the rapid differentiation of S. aureus subsp. aureus strains from S. intermedius strain. S. aureus subsp.aureus strains fermented the maltose, with production of acid, turning, thus, the medium color to yellow. For most of the part, strains of S. intermedius did not ferment the maltose, while others produced weak and delayed fermentation after 48 hours.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The API Staph multitest system was used for biochemical differentiation of 64 strains of staphylococci isolated from cows with subclinical mastitis. Based on the results provided by this system, there were identified 19 species of staphylococci This system does not have S. intermedius species in the identification table, but if there are strains included in this species, API web program, based on biochemical characteristics, may notify the following message: Possibility of S. intermedius of Veterinary Origin. The strains included in this species behaved as S. aureus subsp.aureus strains, but did not produce urease, thus, urea fermentation was negative. In some cases, the API web program can also display other staphylococcal species, indicating which additional biochemical characters should be tested and which additional tests should be performed for definitive classification of the strains.

Table 1 The frequency of isolated staphylococcal species

Crt. Species CPS CNS no. No. No. 1. S aureus subsp. aureus 6 - 2. S. intermedius 2 - 3. S. hycus 2 - 4. S, xylosus - 6 5. S. chromogenes - 7 6. S. sciuri - 5 7. S. lentus - 6 8. S. epridermidis - 4 9. S. haemolyticus - 3 10. S. homnins - 2 11. S. simulans - 4 12. S. saprophyticus - 2 13. S. warneri - 3 14. S. equorum - 2 15. S. cohnii - 3 16. S. succinus - 2 17. S. fleuretti - 1 18. S. devriesei - 2 19. S. pseudintermedius - 2 20. TOTAL 10 54 Legend: CPS - coagulase positive staphylococci, CNS – coagulase negative staphylococci

Staphylococci strains were susceptible to furazolidone, in a proportion of 100%, allowing their differentiation from the strains of Micrococcus genus, which are resistant. The tested strains were susceptible to novobiocin in a proportion of

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

95.31%, this test showing the differentiation of staphylococcal strains included in saprophytic species (S. saprophyticus), which are resistant.

Conclusions

In broth, primary cultures produced a turbidity of different intensity, sediment and a surface ring, while on 5% sheep defibrinated blood agar, the isolates formed characteristic colonies with orange, yellow or white pigment, and with both complete and incomplete haemolysis. As a selective medium, Chapman medium allowed the growth of staphylococci strains in pure culture, which, based on mannitol fermentation, allows the differentiation of positive and negative mannitol strains. Baird-Parker medium allowed a rapid differentiation of S aureus subsp. aureus strains from the strains included in other species, while Difco agar with 1% maltose and blue bromocresol allowed the differentiation of S. aureus subsp. aureus strains from S. intermedius strains. Definitive biochemical typing of staphylococci isolated strains was made on API Staph multitest system. Bound coagulase was present in 18,75% of the isolates, while free coagulase was present in 15,63% of them.

References

7. Codiţă, Irina, Identificarea stafilococilor, In: Tratat de microbiologie clinică, ediţia a II-a, sub redacţia Buiuc D., Neguţ M., Ed. Medicală, Bucureşti, 2008, 563-583. 8. Ieremia, T., Genul Staphylococcus, In: Bacteriologie medicală, vol. II, sub redacţia BÎLBÎE V., POZSGI N., Ed. Medicală, Bucureşti, 1985, 17-43; 9. Răpuntean, G., Răpuntean, S., Bacteriologie specială veterinară, Ed. AcademicPres, Cluj-Napoca, 2005. 10. Velescu Elena, Tănase, Irina Oana, Stafilococii, In: Tratat de boli infecţioase ale animalelor, Bacterioze, vol. I, sub redacţia Perianu T., Ed. Universitas, Iaşi, 2010, 467-489. 11. *** Instructions for use the API Systems, www.biomerieux.com.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

A THEORETICAL APPROACH OF THE IMMUNE SYSTEM OF DANUBE HUCHEN (HUCHO HUCHO)

C. GH. CERBU1, GH. F. BRUDAȘCĂ1, R. M. GIUPANĂ2, S. GURANDA1, MIHAELA NICULAE1, ANAMARIA-IOANA PAȘTIU1, CARMEN DANA ȘANDRU1, MARINA SPÎNU1

1University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, 400372, 3-5 Mănăştur Street, Cluj-Napoca, phone: +40-264-596.384, fax: +40-264-593.792, 2Banat University of Agricultural Sciences and Veterinary Medicine Timisoara E-mail: [email protected]

Summary

The Danube huchen (Hucho hucho) represents the flagship of the Salmonidae family. The species is severely fragmented within the Danube drainage, and it is included in the IUCN Red List of Threatened Species. It is almost impossible to identify if any stocks are self-sustaining. In spite of its popularity among fisherman during the early ‗80s, to date, there is almost no scientifically supported information on this species. The aim of the paper is to establish, based on a comparison between trout and huchen in terms of habitat, water temperature, size and food type, a scheme of the immune system and its functioning in the latter. Since anthropogenic habitat alterations and pollution are major concerns affecting huchen populations, a better understanding of their immune system and a step by step approach to various immunological techniques could have a significant impact over the fish- orientated scientific community and species conservation. Furthermore, studying the immune system of huchen, a highly sensitivity species, would provide data that could make them the perfect sentinel, an indicator for the ecosystem health and for the conservation of running mountain waters, along with the species. Key words: Danube huchen, Hucho hucho, immune system, conservation

The european huchen, Hucho hucho (L.), also called Danube salmon, is one of the world‘s biggest salmonid species (12, 9), and it is endemic to the Danube drainage in central Europe. In the past, the main challenge in supportive breeding for the Danube huchen and other endangered fish species was an understanding of their biology in order to facilitate artificial propagation. The many problems in H. hucho mass propagation included maintenance of spawners, induced ovulation, controlled hatching and feeding of fingerlings (17). Most of these fundamental questions could be solved and present day management challenges for the species have shifted towards sustainable conservation. Huchen distribution within the Danube drainage is currently restricted to a small number of cool montane and submontane reaches of large streams and swift rivers (9). Extinct in many parts of its native habitat across its original range, the huchen is still present in Romania. The species was encountered in rivers like Tisa, Vișeu, Crișul Repede, Mureș, Bistrița and several lakes: Izvorul Muntelui (Bicaz), Pecineag, Vidraru and Brădișor. There is only one specialized fish farm in Romania where the full 49

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA technological process of breeding is applied in captivity. The entire facility belongs to RNP Romsilva – Râmnicu-Vâlcea Forestry Department. It is the only unit at this time that can produce biological material for stocking and restocking (29). As for 2015, the aim of the farm is to produce 40.000 alevins. The aquatic field is an almost inexhaustible reservoir of bioresources that can be exploited by man. Increasing fish production requires the control of the limiting factors that hinder welfare (19). While under natural conditions of life, disease occurrence and spreading of aquatic organisms are less common and harmful, except in cases of pollution, much more dangerous are these diseases in aquaculture facilities where artificially created life conditions favors the presence and diversity of highly pathogenic, biotic and abiotic factors (10). The study of fish diseases and fish immune system requires extensive knowledge about the constraints exerted, survival-related physiology in a peculiar environment, and the numerous agents that can cause various infections. Most of the potential pathogens found in the digestive and respiratory system range from commensal organisms to symbiotic ones. They can become pathogenic if excessive multiplication is caused by many factors such as stress, prolonged treatment with antibiotics or others. Filthy culture water and also lack of filters can lead to infections in fish whose immune system is suppressed (28). Immune specificity is just one of many factors involved in this process. The immune system represents the only defense mechanism of invertebrates and a fundamental defense framework in fish (18). In fish, and not only, the anatomical and functional integrity of the immunological defense mechanisms are extremely important and depend on the dynamics of host-aggressor interrelations.

1. Epithelial barriers

The skin, gills and gut are examples of these epithelial barriers in fish. It is of prime importance for fish to maintain the integrity of covering epithelia because they are important in defense and for osmotic regulation. Normal epithelia are covered by a layer of mucus, which is secreted by goblet cells. It has been shown that an increase of bacterial load in the surrounding water stimulates the production and release of high molecular weight glycoproteins of carp skin mucus (1, 27). Studies conducted by Savu (2007-2011) on bacteria isolated from diverse trout farms from Romania revealed more than nine agents that can cause infection (24). The most important function of mucus is probably to prevent the attachment of bacteria, fungi, parasites and viruses to epithelial surfaces. The Danube huchen (Hucho hucho) and the Brook trout (Salvelinus fontinalis) being a part of the same family (Salmonidae), share most characteristics of epithelial barriers. Variations in disease resistance between fish species can, at least in some instances, be attributed to genetic differences in the protective elements of the mucus. This is demonstrated by similar susceptibility of, for example, salmonids to an intraperitoneal injection of a particular pathogen but a different susceptibility to an

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA immersion challenge (25, 18). Fish skin mucus contains many humoral non-specific defense factors (lysozyme, complement, interferon, C-reactive protein, lectin (haemagglutinin), haemolysin and transferring, etc). These molecules of the innate immunity are especially important for fish species, playing a key role in maintaining homoeostasis in the animal (23), due to the aquatic habitat rich in pathogens (15) fish live in. The huchen body is fusiform, almost cylindrical, covered with small cycloid scales and protected by an abundant level of mucus (14). The integrity of these barriers is extremely important since their penetration even by avirulent strains can cause infections. In terms of feeding, the Danube huchen prefers live fish even in captivity. While the trout accepts the commercial food, the huchen refuses it, unless in the alevin stage the fish was feed with special artemia (Brine shrimp) cysts mixed with stage one commercial food (Cerbu, unpublished data). Bacterial load in the live feed is much higher than in the commercial food so, from this point of view the huchen is exposed to digestive infections more than the trout.

2. The cells of the innate system

The key cells of the innate immune system are the phagocytic cells (granulocytes (neutrophils) and monocytes/macrophages) as well as the non- specific cytotoxic cells (7, 21). Phagocytosis of antigenic material by macrophages is not only an activity of the non-specific innate defense system but can also be an initial step during the specific adaptive immune response. As in mammals, most probably, there are multiple subpopulations of mononuclear phagocytes, which differ in functions (27). Phagocytic activity in huchen could be evaluated using numerous tests. Carbon particle inclusion represents one of the most efficient and simple tests that can be performed. The principle of the test is that the phagocytic cells from the blood have the capacity to exert their activity not only on pathogens but also versus inert carbon particles. A reduction in the quantity of carbon particles from a mix between blood and India ink can be evaluated by spectrophotometry. Based on the results, a phagocytic activity chart can be generated (24). Since the method has been previously used in trout (24) it can be successfully used in the study of the immune system of Danube huchen. Neutrophile/lymphocyte ratio (NLR) can be calculated starting from standard blood smears, providing important information regarding the stress level, this ratio being also influenced by diseases and infections (4). NLR is strongly influenced by temperature (4) but previous studies on trout can offer important information on huchen‘s NLR, since both species prefer the same water temperature (11,12). Other cells playing an important role in the innate immune response are the epithelial and dendritic cells (22, 8, 19).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Inflammation is also important in bony fish. The response is comparable to the one in mammals (6). Previous studies show that in rainbow trout the innate and the acquired immune responses work in a perfect synergy.

3. Lectins

Lectins, an important part of the mucus, are carbohydrate-binding proteins that are neither antibodies nor enzymes, yet play important roles in innate and adaptive immunity (13). Lectins in fish can be detected as natural precipitins or agglutinins. Fletcher showed that lectins are probably important in neutralizing bacterial components (e.g. exotoxins) or in immobilizing microorganisms, hence facilitating phagocytosis (27). The high quantity of mucus present on the body of the huchen ensures a good protection. Yet, the biological relevance of lectins in H. hucho requires further investigations.

4. Lysozyme

Lysozyme (muramidase) is an important defense molecule of the innate immune system, which is important in mediating protection against microbial invasion. It is a mucolytic enzyme of leukocyte origin. Lysozyme is widely distributed in bacteriophages, microbes, plants, invertebrates and vertebrates (16) and is also found in a large variety of animal secretions such as mucus and saliva, in many tissues including blood and in the cell vacuoles of plants. In fish, lysozyme has a broader activity than in mammalians (5) and has been frequently used as an indicator of non-specific immune functions, which is of primary importance in combating infections in fish (23). Lysozyme activity in Danube huchen has not been evaluated so far.

5. C-reactive protein

C-reactive protein (CRP) is a serum component, whose concentration increases rapidly after exposure to bacterial endotoxins (15, 27) or experimental infection with bacterial pathogens (20, 27). To date, there is no scientific information regarding C-reactive protein in H. hucho.

6. Complement

The complement system is composed of more than 35 soluble plasma proteins that play key roles in innate and adaptive immunity. There are three pathways that can be involved alone or in a combination in complement activation/initiation: classical, lectin and alternative. The complement system of

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA teleost fish, similarly to that of higher vertebrates, can be activated through all three pathways of complement (2). To date, there are no studies regarding complement in Danube huchen (Hucho hucho). We can hypothesize that complement plays an important roles within the capacity of huchen‘s innate immune system to recognize and respond, although its composition and functional characterization have never been made. Understanding the functions of complement in fish and the roles of the individual proteins (including the various isoforms) in the host defense is important not only for understanding the evolution of this system but also for the development of new strategies in fish health management (3).

Fig. 1 Complement activation pathway and functions (2, 26)

7. Concluding remarks

There are multiple studies over salmonids but the scientific information regarding the Danube huchen in general and Danube huchen‘s immune system is very limmited or absent. Future studies are strongly encouraged since the species is included in the IUCN Red List of Threatened Species. The evaluation of the 53

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA health status of H. hucho under different conditions would provide important information with a great impact in species conservation, its breeding, and resistance to diseases. Also, being a highly sensitive species, extended research could provide data that would make them the perfect sentinel, an indicator for the ecosystem health and for the conservation of running mountain waters, along with the species.

References

1. Bergljot, M., Innate immunity of fish (overview), Fish & Shellfish Immunology, 2006, 20, 137-151. 2. Bosra, H., Li, J., Sunyer, J.O., Recent advances on the complement system of teleost fish, Fish & Shellfish Immunology, 20, 239-262. 3. Claire, M., Holland, H., Lambris J.D., The complement system in teleosts, Fish & Shellfish Immunology, 2002, 12, 399-420. 4. Davis, A.K., Manley, D.L., Maerz, J.C., The use of leukocyte profiles to measure stress in vertebrates: a review for ecologists, Functional Ecology, 2008, 22, 760-772. 5. Demers N.E. & Bayne C.J. The immediate effects of stress on hormones and plasma lysozyme in rainbow trout, Developmental and Comparative Immunology, 1997, 21, 363–373. 6. Finn, J.P., Nielsen,N.O., The inflamatory response in rainbow trout, J.Fish. Biol., 1971, 463-478. 7. Frøystad MK, Rode M, Berg T, Gj.en T. A role for scavenger receptors in phagocytosis of protein-coated particles in rainbow trout head kidney macrophages. Dev Comp Immunol, 1998, 22, 533-549. 8. Ganassin, R. C., Bols, N.C, Development of long-term rainbow trout spleen cultures that are haemopoietic and produce dendritic cells. Fish & Shellfish Immunology, 1996, 6, 17-34. 9. Geist, J., Kolasha M., Gum, B., Kuehn, R., The importance of genetic cluster recognition for conservation of migratory fish species: the example of the endangered European huchen Hucho hucho (L.), Journal of fish Biology, 2009, 75, 1063-1078. 10. Gyllenhammar, A., Hakanson, L., Environmental consequence analyses of fish farm emissions related to different scales and exemplified by data from the Baltic – a review, Marine Environmental Research, 2005, 60, 211–243. 11. Hari, Renata., Livingstone, D. M., Siber, R., Burkhardt_Holm, Patricia., Güttinger, H., Consequences of climatic change for water temperature and brown trout populations in Alpine rivers and streams., Global Change Biology, 2005, 12, 10-26. 12. Holcik, J., Thretened fishes of the world: Hucho hucho (Linnaeus, 1758), Environmental Biology of Fishes, 1995, 43, 105-106.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

13. Huang, Z.H., Ma, A.J., Lei, J.L., Progress in study on the skin mucus lectin in fish, Dongwuxue Ynajiu, 2013, 34, 674-679. 14. Ihuţ Andrada, Zitek, A., Weiss, S., Ratschan, C., Holzeg G., Kaufmann, T., Cocan, D., Constantinescu, R., Mireșan, Vioara, Danube salmon (Hucho hucho) in Central and Southeastern Europe: a review for the development of an international program for the rehabilitation and conservation of Danube salmon populations, Bulletin USAVM, 2014, 71, 77-85. 15. Ingram G.A., Substances involved in the natural resistance of fish to infection-a review. Journal of Fish Biology, 1980, 16, 23–60. 16. Jolles, P., Jolles, J., What's new in lysozyme research? Always a model system, today as yesterday, Molecular and Cellular Biochemistry, 1984, 63, 165–189. 17. Jungwirth, M., Kossmann, H., Schmutz, S., Rearing of the Danube salmon (Hucho hucho L.) fry at different temperatures, with particular emphasis on freeze-dried zooplankton as dry feed additive. Aquaculture, 1989, 77, 363–371. 18. Magnadottir, B., Innate immunity of fish (overview), Fish & Shellfish Immunology, 2006, 20, 137-151. 19. Mititeanu, D.,Clubul de cicloturism „Napoca‖ clubul ecologic „Transilvania", broşură Ecoaqua XXI, 2006. 20. Murai, T., Kodama, H., Naiki, M., Mikami, T., Izawa, H., Izolation and characterization of rainbow trout C-reactive protein, Dev. Comp. Immunol.,1990, 49-58 21. Neumann NF, Stafford JL, Barreda D, Ainsworth AJ, Belosevic M. Antimicrobial mechanisms of fish phagocytes and their role in host defense, Dev Comp Immunol, 2001, 25, 807-825. 22. Press McL, Dannevig BH, Landsverk T. Immune and enzyme histochemical phenotypes of lymphoid and nonlymphoid cells within the spleen and head kidney of Atlantic salmon (Salmo salar L.), Fish & Shellfish Immunology, 1994, 4, 79-93. 23. Saurabh, Shailesh, Sahoo, P.K, Lysozyme: an important defense molecule of fish innate immune system, Aquaculture Research, 2008, 39, 223-239. 24. Savu, M. M., Interrelația status imun-bioagresori microbieni în dinamica protecției antiinfecțioase la salmonide, Teză de doctorat, Facultatea de Medicină Veterinară Cluj-Napoca, 2012. 25. Secombes, C.J., Olivrier, G., Host-pathogens interactions in salmonids, Multidisciplinary fish disease research, Academic Press, 1997, 269-696. 26. Sunyer, J.O., Boshra, H., Lorenzo, G., Parra, D., Freedman, B., Bosch, N., Evolution of complement as an effector system in innate and adaptive immunity, Immunology Research, 2003, 27, 549.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

27. Van Muiswinkel, W.B., Nakao, M., A short history of research on immunity to infectious diseases in fish, Developmental and Comparative Immunology, 2014, 43, 130-150. 28. Vasiu, C., Bacterioze la animale, Ed. Mega, Cluj-Napoca, 2007. 29. Virban, I., Ionescu, O., Study on Danube salmon populations (Hucho Hucho L.) of Romania, Proceedings of the Biennial International Symposium, Forest and Sustainable Development, Brasov, Romania, 2010, 373-380.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

VACCINATION FAILURE IN CHICKENS: POOR VACCINE QUALITY, HUMAN ERROR, OR VARIABLE INDIVIDUAL IMMUNE RESPONSE?

C. GH. CERBU1, GH. F. BRUDAȘCĂ1, R. M. GIUPANĂ2, S.S FĂRTAN1, MIHAELA NICULAE1, ANAMARIA-IOANA PAȘTIU1, CARMEN DANA ȘANDRU1, MARINA SPÎNU1

1University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, 400372, 3-5 Mănăştur Street, Cluj-Napoca, phone: +40-264-596.384, fax: +40-264-593.792 2Banat University of Agricultural Sciences and Veterinary Medicine Timisoara E-mail: [email protected]

Summary

Although vaccination against certain infectious diseases in chickens represents a widespread practice, it continues to contribute to major economic losses attributed to infectious diseases by low antibody titers, and subsequently, atypical cases or even disease outbreaks. In spite of being considered an improvable procedure from which significant solutions are expected, vaccination was and still is one of the most successful ways to prevent infectious diseases, mainly on chicken farms. Since vaccines are most often incriminated for immunization failure, the aim of the paper is to present other possible factors and scenarios that could interfere with the success of the procedure and therefore need to be envisaged. Factors such as the vaccine itself, vaccination technique, individual immune response, the influence of maternal antibodies, MHC variation from a generation to another, the health status or nutrition of the chickens can lead to vaccination failures. To improve the outcome of the vaccination on chicken farms, it is utmost important to identify, describe and select the critical control points where the operators could intervene to better control the results and thus diminish the economic losses. Key words: chicken, vaccination, immune response, failure

Although vaccination against certain infectious diseases represents a widespread practice, it continues in some cases to contribute significantly to economic losses. In spite of being only a link in a complex chain of disease prevention protocols, vaccination, aa continuously improving process, remains a field of great interest, from which significant solutions are expected. One side of this phenomenon is represented by the discovery of new vaccines and vaccination techniques, adapted to the conditions of intensive poultry farming, while the other includes the correction of vaccination errors. Vaccines are neither 100% efficacious nor 100% effective (6). It is important, therefore, that vaccination is seen as a tool to maximize the impact of other control measures, especially good bio-safety practices, and never the sole method of disease control (1). Effective vaccination requires targeted manipulation of both the innate and the adaptive immune system. A successful broiler chicken vaccine should meet the following standards: (a) a

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA protective response has to be induced quickly, (b) immunity should be cross- protective comprising a great number of different serotypes of a certain agent, (c) the vaccine should be cost-effective and easy to deliver as massive numbers of chicken have to be immunized, and (d) the vaccine must be safe for chickens and humans and not leave residues (3). The main causes that lead to an uncovering protection after vaccination are presented in the following paper.

1. Vaccination failure due to vaccine- related causes

Vaccines are most often incriminated as a cause of vaccination failure. Whenever an infectious disease appears in vaccinated poultry, the first tendency is to consider that the vaccine was not appropriate. This is a problem that has several aspects that need to be carefully evaluated. It should not be overlooked that it would be ideal to avoid any disease in poultry, by implementing a comprehensive set of biosecurity measures. Vaccination is the one that tries to limit the economical damage, once the events occurred.

1.1 Vaccination failure due to improper vaccine

The use of vaccines whose effectiveness has been affected (by expiration or by improper storage conditions), inapropriate use of the vaccine (by dose or route of administration) or vaccines that contain serotypes and antigenic variants that do not correspond to those that infected the livestock and which do not cross- protect can result in vaccination failure. To date, there are identified a number of 200 serotypes of avian infectious bronchitis virus and over 2000 serotypes of Salmonella. Under these circumstances, even though the poultry were vaccinated and have developed a protective immune response against the vaccine, they can get ill. In the last years, vaccination failures were observed due to the inadequacy of the vaccine strains for infectious bronchitis, infectious bursal disease, fowlpox and Marek‘s disease. Another aspect is related to the degree of attenuation of the vaccine strain. Thus, a high degree of attenuation may entail the development of an insufficient immune response, while a low degree of attenuation is associated with an increased risk of „return‖ to the genuine, pathogenic version. Most commonly, this phenomenon is seen in the case of Newcastle disease virus (NDV). Similarly, care must be taken in making assumptions such as for how long desirable immunity is likely to last after vaccination and how frequently vaccines should be administered (1).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

1.2 Vaccination failure due to of vaccination technique - related causes

The peculiarities of vaccination techniques are those that most often go unnoticed and cause vaccination failure. Thus, although vaccination failure is most commonly attributed to the vaccine itself, it is often caused by mistakes in the vaccination technique. Each vaccination method carries a certain risk and has „critical points‖. By neglecting any of them, severe consequences on the chicken‘s immunization and on the vaccination results could result (6). The vaccination technique used for each and every vaccine type should be the one recomended by the vaccine manufacturer

2. Vaccination failure due to pacient’s individual response - related causes

These causes do not necessarily refer to the particular conditions that are affecting a specific individual, but to the intrinsic causes that can affect the health of a whole flock. A wide range of very different factors may influence the response to vaccination from this point of view, from inadequate quality of one day-old chicks, to nutritional factors or infectious diseases (13).

2.1 Vaccination failure due to the individual genome – related causes

The chickens possess two separate gene clusters both containing MHC (major histocompatibility complex) class I and class II B genes (16).The (MHC) structure may present variations from one poultry line to another. Due to these differences, which dictate whether the body will respond to an antigen, it is possible to encounter poultry lines that do not recognize one or more antigens and become susceptible to disease (6).

2.2 Vaccination failure due to maternal antibodies – related causes

At 1-3 days of age, chickens possess maternal antibody concentrations that are comparable to those that are found in the breeding flock (13). The maternal antibody titer gradually decreases until the age of 14 to 30 days, when it can no longer be detected. There is no doubt that the level of maternal antibodies has an influence on the immune response, especially during the first week of life. This happens because some of the antigens administered are blocked without being submitted to the immune system, and thus, without eliciting an immune, protective response. Therefore, it is strategical to determinate the age of vaccination in infectious bursal disease (12), where the lack of correlation of maternal antibody residues with the vaccination date can lead to failure. The type of influence and the intensity of intervention of maternal antibodies are not always as expected. Thus, vaccination for avian infectious bronchitis and ND on the first day of life will produce an immune response comparable to the one induced by vaccination at the age of

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

15-20 days (2). In this case, local tissue immunity is invoked, by involving the Harderian gland in producing immunity (4).

2.3 Vaccination failure due to herd’s health status – related causes

Three etiological agents are the most often incriminated in promoting diseases in the flock, because of the immunosuppression they cause: Marek‘s disease virus, infectious bursal disease virus and chicken infectious anemia virus (7, 18, 8). Other diseases that are associated with negative immunomodulation are salmonellosis and mycoplasmosis (7).

3. Vaccination failure due to farming conditions – related causes

A large number of factors have a direct or indirect influence on the vaccinal response, leading to the failure of this act. They will be enumerated and systematized in the following:

3.1 Vaccination failure because of the housing conditions - related causes

A relatively large number of environmental factors, like lighting (17), photoperiodism (9), too high, too low or uncontroled varaitions of temperature (7), overcrowding, inadequate bedding (15), the lack of water, polluted microclimate (5), and especially high concentrations of ammonia (14) and hydrogen sulphur can influence the immune status and the post-vaccination response.

3.2. Vaccination failure due to nutrition – related causes

Nutrition plays an important role in developing and maintaining the immune status of the birds (10). Nutrition mistakes can easily translate into inabilities of developing an immune response following vaccination (11, 7). Another aspect of nutrition is the ability to stimulate the immune response by including bioactive substances in food (probiotics and prebiotics) which, by stimulating natural resistance, could replace antibiotics or antiparasitics that are widely used in poultry (11).

4. Concluding remarks

There are multiple reasons that can lead to vaccination failure in chickens. None of the causes mentioned above should be excluded (vaccine related, individual related or environmental related causes). They all need to be carefully investigated when a disease that the chickens were vaccinated against occurs. A definition of critical control points at farm level, vaccination procedures included, with particular traits based on poultry species raised, should be defined

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA for each category of birds, ie, layers, broilers, parents, etc. and implemented before the technological cycle starts, to avoid the massive loss due to infectious diseases.

References

1. Capua, Ilaria., Alexander, D.J., Avian influenza vaccines and vaccination in birds, Vaccine, 2008, 26, 70-73. 2. Davelaar, F.G., Koumwenhoven, B., Influence of maternal antibodies on vaccination of chicks of different ages against infectious bronchitis, 1977, Avian Path, 6, 41-50. 3. De Zoete, M.R., van Putten, J.P.M., Wagenaar, J.A., Vaccination of chicken against Campylobacter, Vaccine, 2007, 25-30, 5548-5557. 4. Giambrone, J.J., Clay, R.P., Vaccination of Day-Old Broiler Chicks against Newcastle Disease and Infectious Bursal Disease Using Commercial Live and/of Inactivated Vaccines, Avian Diseases, 1986, 30, 557-561. 5. Hartung, J., The effect of airborne particles on livestock health and production, I. Ap Dewi, 1994, 55-69. 6. Heininger, U., Bachtiar, N.S., Bahri, P., Dana, A., Dodoo, A., Gidufu, J., Matos dos Santos, E., The concept of vaccination failure, Vaccine, 2012, 30, 1265-1268. 7. Hoerr, F.J., Clinical aspects of immunosuppression in poultry, Avian Diseases, 2010, 54, 2-15. 8. Jen, L., Cho, B.R., Effects of infectious bursal disease on Marek‘s disease vaccination: Suppression of antiviral immune response. Avian Diseases, 1980, 24, 896-907. 9. Karaka, T., Hasan, H.A., Yoruk, M., Cinaroglu, S., Effects of photoperiod on mast cells in lymphoid organs of the Japanease Quail Coturnix coturnix japonica, J. Anim. Vet. Advances, 2010, 9, 751-755. 10. Kidd, M.T., Nutritional modulation of immune Function in Broilers, Poultry Science, 2004, 83, 650-657. 11. Kogut, M.H., Impact of nutrition on the innnate immune response to infection in poultry, J. Appl. Poult. Res., 2009, 18, 111-124. 12. Kumar, K., Singh, K.C.P., Prasad, C.B., Immune Responses to Intermediate Strain IBD vaccine at Different Levels of Maternal Antibody in Broiler Chickens, 2000, 32, 367-360. 13. McMullin, P., Proceedings do the 1st Sta. Catarina Puoltry Symposium, 1985, 10-20. 14. Osorio, J.A., Tinoco, I.F., Ciro, H.J., Ammonia: a review of concentration and emission models in livestock structures, Dyna, 2009, 158, 89-099. 15. Thaxton-Vizzier, Y., Balzli, C.L., Tankson, J.D., Relationship of broiler flock numbers to litter microflora, J. Appl.Poult.Res., 2003, 12, 81-84.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

16. Wittzell, H., Madsen, T., Westerdahl, Helena., Shine, R., von Schantz, T., MHC variation in birds and reptiles, Genetica, 1999, 104, 301-309. 17. Xie, D., Wang, Z.X., Dong, T.L., Cao, J., Wang, J.F., Chen, J.L., Chen, Y.X., Effects of Monochromatic Light on Immune Response of Broilers, Poultry Science, 2008, 87, 1535-1539. 18. Yuasa, H., Taniguchi, T., Noguchi, T., Yoshida, I., Effect of infectious bursal disease virus infection of incidence of anaemia by chicken anaemia agent. Avian Diseases, 1980, 24, 202-209.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

IMPACT OF SOWS IN THE CARRIER STATE OF SALMONELLA SPP. IN PIGLETS

ZORIŢA MARIA COCORA, I. ŢIBRU

Summary

Infection with Salmonella spp. in pig farms is usually endemic and largely asymptomatic. It is desirable to identify and eliminate this organism in an early stage of the production phase, starting from the examination of the sows before and after gestation, piglets after birth and weaning, fattening pigs before slaughter, and from the risk factors with important role in the transmission of Salmonella spp. In this study we observed the transmission of Salmonella during the technological flow from the farm through fecal sampling from sows and their piglets until the age of weaning, and the importance of respecting disinfection between different stages of the flow. Identification and isolation of Salmonella was performed by the method: EN ISO 6579: 2002 / AC: 2007 and for the isolation of Salmonella serovars API 20E method was used. The prevalence of Salmonella spp. in fecal samples after examination of each farm under study, showed that the farm A were 50% sows and piglets carriers and in farm B, were found 27% positive samples. Key words: Identification, methods, Salmonella, piglets, sows

Regardless of the source of contamination (1), the piglets can be infected immediately after birth because the sows are carrier of Salmonella spp., or after weaning, due to contact with the carriers piglets and pigs free of Salmonella spp. (10). The carrier status of Salmonella spp. was found at piglets, usually limited to the gastrointestinal tract, less in tissue (liver, spleen), of which rarely positive cultures were obtained (12). This suggests that the protection offered by the intestinal tract is achieved by reducing the adsorption of microorganisms on account of colostrum (7). Sows plays an important role in maintain the infection with Salmonella spp. in swine farms, and in the indirect transmission of the microorganism (2, 8). Identification of carrier sows is an important factor on the dynamics of Salmonella spp. to implement specific control programs in pig farms. The purpose of this study was to determine the prevalence of Salmonella in pig farms, sows and their piglets, from birth until weaning.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

The study was conducted in two production farms (farm A and B), which used a three-stage management system (breeding, nursery, finishing), well individualized. We followed 30 sows in each farm, starting from birth and their piglets to weaning age. Eight days before farrowing, sows were moved into gestation boxes, which have been cleaned and sanitized. Piglets were weaned at 28 days, after which they were transferred to nursery boxes within the same farm. The first samples was collected after each calving of the sows and the second when changing the piglets to nursery. Samples were analyzed in the laboratory of Hygiene and analyzed using the method SR EN ISO 6579: 2003 /AC/ 2007 Annex D, and has been used to identify serovars API 20 E.

Results and discussions

The prevalence of Salmonella spp. after the examination of fecal samples (n=30) of each farm under study, showed that the farm A were 50% positive samples both in sows and their piglets. In farm B, were found 33% infected sows, which resulted in 27% positive samples in piglets. It was noted that samples of piglets from free sows, were negative for Salmonella spp. (fig. 1).

Fig. 1. Distribution of Salmonella spp. between the two farms

Statistically speaking, in the interpretation of results from samples collected from infants piglets in the two farms (farm A and B) were found highly significant

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA differences (p < 0.001) compared with results from sows and piglet from the two farms where the differences were not significant (p > 0.005). After analyzing the results obtained from samples taken from the same piglets at the age of 21 days, in both farms, there was an increase of 3% contamination, finding contamination piglets (four), which were previously free of Salmonella spp. Contamination was achieved through contact with feces from the carriers piglets from neighboring boxes and by direct contact between pigs. After analyzing samples by API 20 E method, it was found that the most common serovars isolated from feces of piglets and sows were: S. typhimurium (65%), and S. choleraesuis (36%). Sows without clinical signs, but carrier of Salmonella spp., is a hidden risk factor, but substantial for the pigs in the same herd. Cause of the illness, by maintaining the enzootic chain by carrier sows, which contaminates piglets during lactation via nipples, but also by manure (9). The existence of piglets free from Salmonella can be attribute to free sows and the resistance obtained by piglets from milk antibodies that passively protect piglets during the first weeks (Ball 2011). A similar study made by Sangvatanakul (2007), by analyzing samples of feces collected from piglets of 7 days and 21 days, shows an increase of 3% positive samples (11). According to studies conducted by Lurette et al. (2008) early infection that occurs between birth and weaning, which is a favorable period for the spread of Salmonella, if disinfection between the two series was not well done (6). In the same study, the results indicated that maternal protection reduces the possibility of infection with Salmonella spp. in the first month after calving. Serovars isolated in this study are different from other authors in different areas, such as Chen (S. saintpauland, S. heidelberg), Ethiopia (S. hadar, S. kentucky, S. and S. anatum), Africa South (S. typhimurium, S. muenchen, S. derby and S. choleraesuis), Europe (S. typhimurium and S. rissen), USA (S. agona, S. derby, S. schwarzengrund, S. typhimurium and S. senftenberg) (4, 5, 13). Geographical differences in the distribution of the main serovars of Salmonella spp. were reported by other countries (3). These differences, strengthen the argument that there may be regional differences regarding the sources and risk factors for infection.

Conclusions

The existence of a small number of Salmonella carrier sows ensures the obtaining of free of Salmonella spp. piglets at birth. The main serovars isolated by the method of the API 20 E, such at the sow and the piglets were S. thyphimurium 65% and S. choleraesuis, 36%.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/132765.

References

1. Boughton, C., Egan, J., Kelly, G., Markey, B., Leonard, N., Rapid infection of pigs following exposure to environments contaminated with different levels of Salmonella Typhimurium. Foodborne Pathogens and Disease 2007, 4, 33–40. 2. Davies, P.R., Funk, J.A., Morrow, W.E.M., Fecal shedding of Salmonella by gilts before and after introduction to a swine breeding farm. Swine Health Prod., 2000, 8, 25–29. 3. Davison, H.C., Smith, R.P., Sayers, A.R., Kidd, S.A., Davies, R.H., Evans, S.J., The diversity and geographical distribution of Salmonella serotypes obtained during a national survey of dairyfarms in England and Wales. In: Proceedings of the 10th Inter-national Symposium on Veterinary Epidemiology and Economics, 2003, http://www.sciquest. org.nz/node/63324Dorn 4. Kidanemariam, A., Engelbrecht, M., Picard, J., Retrospective study on the incidence of Salmonella isolations in animals in South Africa, 1996–2006. J. South African Vet. Assoc., 2010, 81 (1), 37–44. 5. Kikuvi, M.G., Ombui, N.J., Mitema, S.E., Serotypes and antimicro-bial resistance profiles of Salmonella isolates from pigs at slaughter inKenya. J. Infect. Dev. Ctries., 2010, 4 (4), 243–248. 6. Lurette, A., Belloc, C., Touzeau, S., Hoch, T., Ezanno, P., Seegers, H., Fourichon, C., Modelling Salmonella spread within a farrow-to-finish pig herd. Veterinary Research, 2008, 39-49. 7. Matiasovic, J., Kudlackova, H., Babickova, K., Stepanova, H., Volf, J., Rychlik, I., Babak, V., Faldyna M., Impact of maternally-derived antibodies against Salmonella enterica serovar Typhimurium on the bacterial load in suckling piglets. Veterinary Journal, 2013, 196(1): 114-115. 8. Nollet, N., Houf, K., Dewulf, J., De Zutter, L., De Kruif, A., Maes, D.J., Salmonella in sows: a longitudinal study in farrow-to-finish pig herds, Prev. Vet. Med., 2005, 36: 645-656. 9. Perianu, T., Tratat de boli infecţioase ale animalelor: bacterioze, Ed. Universitas, 2011, 270-293. 10. Proux, K., Cariolet, R., Fravalo, P., Houdayer, C., Keranflech, A., Madec, F., Contamination of pigs by nose-to-nose contact or airborne transmission of Salmonella Typhimurium. Vet. Res., 2001, 32: 591–600.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

11. Sangvatanakul, P., Prevalence of Salmonella in piglets and in the fattening period in Chiang Mai, Thailand, Master of Veterinary Public Health, Chiang Mai University And Freie Universität Berlin, 2007, 1-78. 12. Scherer, K., Szabó, I., Rösler, U., Appel, B., Hensel, A., Nöckler, K., Time course of infection with Salmonella Typhimurium and its influence on fecal shedding, distribution in inner organs, and antibody response in fattening pigs. Journal of Food Protection, 2008, 71, 699–705. 13. Vigo, G.B., Cappuccio, J.A., Pi˜neyro, P.E., Salve, A., Machuca, M.A., Quiroga, M.A., Moredo, F., Giacoboni, G., Cancer, J.L., Caffer, I.G., Binsztein,N., Pichel, M., Perfumo, C.J., Salmonella enterica subclinical infection: bacteriological, serological, pulsed-field gel electrophore-sis, and antimicrobial resistance profiles—longitudinal study in athree-site farrow-to- finish farm. Food-Borne Pathog. Dis., 2009, 6 (8), 965–972. 14. ***SR EN ISO 6579:2003/AC: 2007 (Annex D) - Detection of Salmonella spp. In animal faeces and in samples of the primary production stage – Horizontal method for the detection of Salmonella spp., International Organization for Standardization.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

ROLE OF SOWS (PREGNANT AND LACTATING) IN THE TRANSMISSION OF SALMONELLA SPP.

ZORIŢA MARIA COCORA, I. ŢIBRU

Banat‘s University of Agricultural Science and Veterinary Medicine Timisoara ―King Michael I of Romania‖, Faculty of Veterinary Medicine, 300645, Aradului Street, No. 119, Timisoara, Romania E-mail: [email protected]

Summary

Due to the significance of pigs shedding Salmonella spp. in contamination of carcasses, namely the introduction of this microorganism the food chain should begin by analyzing each stage of the production chain. It is important to consider the role of sows in the epidemiology of Salmonella spp. The purpose of this study is to determine the prevalence of Salmonella spp. in pigs at different stages of breeding status by analyzing samples taken before and after calving, respectively after weaning piglets. For the identification of Salmonella were taken (n=120) samples of feces of pigs in the two farms (A, B). All samples were analyzed by classical method SR EN ISO 6579: 2003 /AC: 2007 and API 20 E method. Analyzing the samples of the two farms in the study were found different results, as before birth prevalence of Salmonella spp. ranged from 50% (farm A) and 63% (farm B), after birth until day 10 of lactation, there was a reduction of load between 33% (farm A) and 50% (farm B), but there was a slight increase in the number of sows that were excreted microorganisms of the genus Salmonella, before and after weaning piglets, reach in a load of 53% (farm A) and 55% (farm B). After analyzing samples by API 20 E method, it was found that the most common serovars isolated from feces of sows were: S. typhimurium at a rate of 61.15%, followed by S. choleraesuis at a rate of 38.84%. Results of this study indicate that sows constitutes a source of infection in swine herds being considered further source of contamination of carcasses after slaughter them. Key words: Identification, faeces, Salmonella, serovars sows.

There are many risk factors that may influence the prevalence of Salmonella spp., due to this microorganism transmission, direct and indirect, and the capacity to survive in the environment (12), which plays an important role in their contamination. In the pig farms measures must be taken to prevent vertical and horizontal transmission of Salmonella spp. It is important to know the level of contamination of farms, to prevent contamination of piglets during lactation period (5).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Transmission of Salmonella through sows is common on farms that adopt management system from birth to fattening, where there is cross-contamination between groups of pigs (breeding and fattening) (10). In these farms, a risk factor for the spread of Salmonella is populating with gilts, to which was observed an increased excretion of Salmonella spp. (3). Based on epidemiological data, intervention strategies in the EU, is focusing mainly on preventing the introduction in to breeding farms of the microorganisms of the genus Salmonella (15). Italy is obliged to comply control measures (breeding farms) due to high seroprevalence of Salmonella spp. (between 93.8% and 100%) (9).

Materials and methods

Prevalence of Salmonella spp. was followed during the various stages of breeding sows, respectively was followed the load of sows during pregnancy, after birth until weaning piglet. The study was conducted in two breeding farms, in which were included in the study, 120 pregnant sows (60 sows in each farm) at who was predicted the calving date. With 8 days before calving, they were moved to calving boxes (with slatted floor) which were cleaned and disinfected before. Piglets were weaned at 28 days by removing sows from the boxes. Samples (feces) were transported on the same day to the laboratory of Hygiene and analyzed by the method SR EN ISO 6579: 2003/AC: 2007 Annex D, and for the serovars identification has been used API 20 E.

Results and discussions

After analyzing samples (n=120 feces) from sows, in the last stage of gestation was found in farm A 63% positive samples and in farm B, 50% positive samples with Salmonella spp. Continuing the analysis of samples taken after calving until day 10 of lactation, number of positive samples decreased from 50% in farm A and farm B was a decrease by 17% (33%) positive samples, but in the samples until the weaning period of piglets was a slight increase, reaching 53% (farm A) and 45% positive samples from farm B. After weaning the piglets, one week after the transfer of sows in the breeding boxes, prevalence of Salmonella spp. increased to 55% (farm A) and 55% in farm B (fig. 1). Following the statistical interpretation of the results for samples collected from farm A, were found insignificant differences (p > 0.005) between the four stages of the breeding cycles taken in studies, but there were significant differences (p < 0.05) after analyzing samples from sows antepartum and 10 days postpartum.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig. 1. Prevalence of Salmonella spp. during the main stages of the breeding cycle

In farm B, in statistical terms, were found significant differences (p < 0.01) after analyzing the results of the 4 categories of pigs studied. Comparing the results obtained from each category, were observed significant differences (p < 0.01) in sows before farrowing and immediately (10 days) after calving. Insignificant differences (p > 0.005) were before calving, weaning or before and after weaning piglets, the same differences were observed before and after weaning piglets. Significant differences (p < 0.05) and highly significant (p < 0.001) were observed in 10 days after farrowing and sows before and after the weaning of the piglets. After analyzing samples by API 20 E method, it was found that the most common serovars isolated from feces of sows were: S. typhimurium at a rate of 61%, followed by S. tholeraesuis in 39% (fig. 2)

Fig. 2. Distribution of Salmonella serovars in feces collected from sows 70

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

In the present study there was a variation of Salmonella excretion during breeding periods, where moving sows in the maternity boxes and the period before and after weaning of piglets, caused an increase in the excretion of Salmonella spp. This has been seen in other studies by other authors, because calving and weaning (7, 14), are known as being stress factors, which may lead to decreased immunity (1). Similar results were obtained by other authors, which Gonzales et al. (2008), after making a study found that 40% of the sows were positive at time of moving the sows into the calving boxes, 70% immediately after birth, after which it was found a decrease in the excretion of Salmonella to 9% from day 11until day 15 of lactation, after which the number of positive samples Salmonella spp. has started to grow, and this is associated with estrus (5). Chiara et al. (2), following the completion of a study, obtained a prevalence of Salmonella spp. of 0.6% in samples of feces collected from pregnant sows, 1.9% to 7 days after birth, 4.3% prior weaning, a prevalence of 26.3% after weaning (2). Similar study was conducted and by Nollet et al. (2005 b) (11), where in contrast to the study by Gonzales et al. (2008) (5), the authors found a lower prevalence than 10% before parturition and during lactation. A low prevalence has been observed in other studies (4, 8). Nollet et al. (10) found an increase in Salmonella spp. load after seven days after weaning piglets in two of the three farms studied (10). During this period, various hormonal changes occur in sows, such as follicular growth, ovulation and estrus (6) and an increase in adrenocorticotropic hormone. Due to stress, sows are more susceptible to infections with Salmonella spp., becoming carrier, sheltering these organisms in their intestine or mesenteric lymphnodes (13). Although some studies have rarely lower prevalence of 10%, the presence of Salmonella in each stage of the breeding chain is increased (4, 8), which according to the study conducted by Gonzalez et al. (2008), state that sows are a source of transmission of Salmonella spp. in piglets during lactation (5).

Conclusions

After comparing the results of the two farms studied, since the introduction of sows in gestation boxes until weaning, there was a decrease in load with Salmonella spp. in samples after pregnancy and lactation, which in statistical terms, the A farm was significant difference (p <0.05) in the analyzed samples from sows antepartum and 10 days postpartum and in farm B was observed significant differences (p <0.01) in sows before calving and immediately (10 days) after calving. After analyzing samples taken after weaning piglets, significant increases were observed regarding the load with Salmonella spp. compared to lactation

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA period, explanation for this difference is hormonal changes, contact with other sows in boxes when changing and common stress accommodation. The most common method serovars isolated by API 20 E were 61.15% S. typhimurium and S. choleraesuis at a rate of 38.84%.

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/132765.

References

1. Berends, B.R., Urlings, H.A.P., Snijders, J.M.A., Van Knapen, F., Identification and quantification of risk factors in animal management and transport regarding Salmonella spp. In pigs. International Journal of food Microbiology, 1996, 30, 37-53. 2. Chiara, F., Magistrali, N., D’Avino, F., Ciuti, L., Cucco, C., Maresca, M., Paniccià, E., Scoccia, M., Tentellini, G.P., Longitudinal study of fecal Salmonella shedding by sows , J Swine Health Prod., 2011, 19(6), 326–330. 3. Davies, P.R., Funk, J.A., Morrow, W.E.M., Fecal shedding of Salmonella by gilts before and after introduction to a swine breeding farm. Swine Health Prod. 2000, 8, 25 4. Funk, J.A., Davies, P.R., Nichols, M.A., Longitudinal study of Salmonella enterica in growing pigs reared in multi-site swine production systems. Vet. Micro, 2001, 83, 45-60. 5. González, M., Herrera, J., Láinez, M., Fecal shedding of Salmonella spp. by lactating and weaned sows in a Spanish multisite farm. preliminary results, Proceedings of the International Pig Veterinary Society Congress, 2008 - Durban, South Africa, 2008. 6. Hein, K.G., Allrich, R.D., Influence of exogenous adrenocorticotropic hormone on estrus behaviour in cattle. J. Anim. Sci, 1992, 70, 243-247. 7. Jarvis, S., Lawrence, A.B., McLean, K.A., Chirnside, J., Deans, L.A., Calvert, S.K., The effect of environment on plasma cortisol and β-endorphin in the parturient pig and the involvement of endogenous opioids. Anim. Reprod. Sci, 1998, 52, 139-151. 8. Kranker, S.L., Alban, J., Boes, Dahl, J., Longitudinal study of Salmonella enterica aerotype Typhimurium infection in three Danish farrow-to-finish swine herds, J. Clin. Microbiol., 2003, 41, 2282–2288. 9. Merialdi, G., Barigazzi, G., Bonilauri, P., Tittarelli, C., Bonci, M., D’Incau, M., Dottori, M., Longitudinal study of Salmonella infection in Italian farrow-to- finish pig herds. Zoonoses Public Health, 2008, 55, 222–226.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

10. Nollet, N., Houf, K., Dewulf, J., Duchateau, L., De Zutter, L., De Kruif, A., Maes, D.J., Distribution of Salmonella strains in farrow-to-finish pig herds, a longitudinal study. Food Prot., 2005a, 68, 2012–2021. 11. Nollet, N., Houf, K., Dewulf, J., De Zutter, L., De Kruif, A., Maes, D.J., Salmonella in sows, a longitudinal study in farrow-to-finish pig herds, Prev. Vet. Med., 2005b, 36, 645-656. 12. Sandvang, D., Jensen, L.B., Baggesen, D.L., Baloda, S.B., Persistence of a Salmonella enterica serotype Typhimurium clone in Danish pig production units and farmhouse environment studied by pulsed field gel electrophoresis. FEMS Microbiol. Lett., 2000, 187, 21-25. 13. Schwartz, K.J., Salmonellosis. In Taylor D.J., ed. Diseases of swine, Iowa State University Press, Ames, Iowa, USA, 1999, 535-551. 14. Van de Ligt, J.L.G., Lindemann, M.D., Harmon, R.J., Monegue, H.J., Cromwell, G.L., Effect of chromium tripicolinate supplementation on porcine immune response during the periparturient and neonatal period. J. Anim. Sci., 2002, 80, 456-466. 15. ***EFSA (2006) - Opinion of the Scientific Panel on Biological Hazards on the request from the Commission related to ―Risk assessment and mitigation options of Salmonella in pig production.‖ EFSA Journal, 341, 1–131. Available at, www.efsa.europa.eu/en/scdocs/ doc/341.pdf. 16. ***SR EN ISO 6579, 2003/AC, 2007 (Annex D) - Detection of Salmonella spp. In animal faeces and in samples of the primary production stage – Horizontal method for the detection of Salmonella spp., International Organization for Standardization.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

THE PREVALENCE OF POSITIVE ESBL E. COLI AND KLEBSIELLA PNEUMONIAE STRAINS IN THE DOGS IN THE IAȘI PADDOCK

ANDREEA-PAULA COZMA, M. CARP-CĂRARE, OANA-ALEXANDRA CIOCAN, C. CARP-CĂRARE, ELEONORA GUGUIANU, CRISTINA RÎMBU, M. MARES

"Ion Ionescu de la Brad" University of Agricultural Sciences and Veterinary Medicine of Iaşi, Faculty of Veterinary Medicine, Mihail Sadoveanu Alley No. 8, 700489, Iaşi, Romania E-mail: [email protected]

Summary

International organizations (WHO, OIE) warn about the circuit of cross-transmission of microbial strains multiresistant to drugs and the irrish on the public health. In Romania, the issue of stray dogs represents a regional particularity. The population of these free animals is in a continuous growth and their institutionalization in paddocks allows an easy assessment of the infectious riskfor the public health. The aim of this study was to detect the presence of E. coli and Klebsiella pneumoniae strains producing extended-spectrum beta- lactamases in the stray dogs in the Iaşi paddock and determining the antibiotic resistance of isolates. The antibiotic resistance by producing extended-spectrum beta-lactamases (ESBL) is a phenomenon that creates significant therapeutic problems in the whole medical world. In January 2015, 58 faecal samples were collectedby means of sterile buffers from approachable and clinically healthy dogs from the paddock. Of the total of samples studied, 15 (25.86%) were positive, the confirmation of certainty being achieved by means of PCR. The phenotypic confirmation of ESBL positive strains was achieved according to the protocol recommended by CLSI. This prevalence draws the attention tothe risk of cross-transmission of ESBL strains in the animal-human-animal circuit. The animals studied were not treated with antibiotics and could be a natural reservoir of positive ESBL E.coli and Klebsiela pneumoniae. Key words: ESBL, Enterobacteriaceae, antimicrobial resistance

The antibiotics resistance represents a significant public health problem that severely restricts the anti-infective therapy applied to both animals and humans. The production of AmpC/ESBL beta-lactamases represents the major mechanism of bacterial resistance to beta-lactam antibiotics, an antibiotic class with the highest use worldwide. In the last few years, the rapid growth of antibiotic resistance to isolated bacteria from animals, but having a zoonotic potential, has drawn the attention of the international scientific community. Most pathogens involved in the human enteric diseases come from animals and can be transmitted directly from animals to humans or indirectly by means of contaminated food or a common reservoir. Between people and pets, 74

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA there are several interactions and, at the microbial level, the commensal bacteria, as well as pathogens share optionally the same medium (1). The genes encoding these enzymes are mainly located on the mobile genetic elements that can be easily transferred horizontally intraspecies and interspecies to other bacteria (2,3). In Romania, the problem of stray dogs represents a regional peculiarity. The population of these free animals is continuously growing and their institutionalization in paddocks allows an easy evaluation of the infectious risk on public health. The aim of this study was to detect the presence of E. coli and Klebsiella pneumoniae strains producing ESBL in the stray dogs in the paddock from Iaşi and determine the antibiotic resistance of isolates.

Materials and methods

In January 2015, 58 faecal samples were collected rectally using sterile exudate swabs, from clinically healthy and approachable dogs, housed in a paddock in Iaşi. We specify that the animals studied were not subjected to treatments with antibiotics. After collection, rectal samples were seeded on broth and incubated at 37°C for 24 hours. Due to the low number of enteric agents per unit volume, it is recommended in advance that such a seeding should be done as in the case of some enterobacterioses, the enrichment of the incolulum by the subcultivation on selective media preferentially favoring the multiplication of enteric pathogens represents a necessary stage. After incubating the samples on broth (24 hours at 37°C), 100μl were seeded on the Oxoid Brillince ESBL Agar (4) solid chromogenic medium. This medium is supplemented with cefpodoxime and is specific for the isolation of extended-spectrum-beta-lactamase-producing Enterobacteriaceae strains. Brilliance ESBL Agar uses a new formula that enriches the selectivity of the medium for the selective inhibition of Ampc resistance mechanisms, while maintaining, at the same time, a high degree of sensitivity for the detection of Enterobacteriaceae producing ESBL (5, 6). According to the manufacturer‘s indications, the colonies of Escherichia coli are blue on this medium and the colonies of Klebsiella pneumoniae are green (Figure 1). From the Brilliance ESBL Agar medium, the colonies obtained were transplanted on the TSA medium for the taxonomic classification and the phenotypic confirmation of ESBL strains. In order to identify isolates, each colony on the TSA medium was tested on the MIU, TSI, EMBA and TBX media, which were incubated for 24 hours at 37° C and respectively, 4 hours at 44.5° C (Fig. 2, Fig. 3).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig.1. Strain of E.coli on the Brilliance ESBL Agar medium

Fig.2. Seeded strains on the MIU and TSI medium for the purpose of identification.

The phenotypic confirmation of ESBL strains isolated on the Brilliance ESBL Agar medium was achieved using the combined disc method recommended by CLSI 2014. Microtablets of (Oxoid) of cefotaxime (30μg), cefotaxime/ clavulanic acid (30/10 μg), ceftazidime (30 μg), ceftazidime/ clavulanic acid (30 / 10 μg), cefpodoxime (10 μg) and cefpodoxime/ clavulanic acid (10/10μg) were used. Dilutions were performed for each bacterial strain, dilutions whose turbidity corresponded to the 0.5 McFarland turbidity. Out of these dilutions, 500μl were inoculated on the Müller Hinton medium and the microtablets were placed at distances of 30 mm. The antibiograms performed in this way were incubated at 37° C for 24 hours. A difference in diameter ≥5mm between cephalosporin and

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA potentiated cephalosporin confirms the production of extended-spectrum beta- lactamases of the tested strain (Figure 4) (7, 8).

Fig.3. Strains of Escherichia coli and Klebsiella pneumoniae on the EMBA and TBX media

Fig.4. The phenotypic confirmation of ESBL strains using the combined disc method

The ATCC 25922 E. coli strain was used as a reference for quality control for the susceptibility testing to antibiotics. Klebsiella pneumoniae, the ATCC 700603 (blaSHV-18) strain was used as a reference for quality control for the ESBL confirmatory tests (9).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and discussions

The correlation of all the data obtained after testing that was conducted led to the results summarized in Table 1.

Table 1 Results obtained after processing the samples Collecting Collected Brilliance Negative Strains Confirmed Total of unit samples Esbl Agar samples obtained ESBL bearing Samples strains individuals Padocck 58 15 43 15 15 15 in Iaşi

Out of the 58 samples of faeces, 15 generated cultures on the Brilliance ESBL Agar selective chromogenic medium. Following the phenotypic confirmatory test, all the presumptively positive isolates on the chromogenic medium were confirmed as being ESBL-producing. Consequently, the prevalence of ESBL Enterobacteriaceae bearing in stray dogs that were analyzed was 25.86%. Based on the minimal biochemical tests conducted, out of the 15 strains of Enterobacteriaceae, 13 (86.66%) were identified as Escherichia coli and two (13.34%) as Klebsiella pneumoniae (Table 2).

Table 2 Taxonomic classification of the isolated strains Collection unit Escherichia coli Klebsiella Total pneumoniae Paddock in Iaşi 13 2 15

Although the number of the samples analyzed was low, the proportion of bacterial strains resistant to third generation cephalosporins that was registered in stray dogs is worrying. Taking into account the fact that animals were not treated with antibiotics, therefore, in the absence of selective pressure, this prevalence draws the atention to the risk related to the transmission of ―in cross‖ ESBL Enterobacteriaceae: animal-human-animal and to the fact that community animals would be a natural reservoir of resistance genes. The free movement of these animals, the poor hygiene conditions, the food waste left to chance, represent major factors contributing to the exchange of bacteria between stray animals-owned animals and humans. The situations similar to those identified by us in this study were also noticed in other developing countries. In Angola, in 2014, 19 ESBL E.coli strains were described in detail, strains from stray dogs that have never been treated with

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA antibiotics, these individuals being considered as natural reservoirs and donors of genes of antimicrobial resistance (9, 10).

Conclusions

The study of faeces collected from stray dogs revealed a prevalence of 25.86% related to the bearers of strains of extended-spectrum-beta-lactamase- producing Escherichia coli and Klebsiella pneumoniae. The fact that the samples from animals not treated with antibiotics favors the transmission of those strains from humans to animals and vice versa through the incorrect management of food waste, the non-compliace with hygiene rules, the free movement of stray dogs and through their direct or indirect contact with pets.

References

1. Albrechtova, K., Kubelova M., Mazancova J., Dolejska M., Literak I.,Cizek A., High Prevalence and Variability of CTX-M-15-Producing and Fluoroquinolone-Resistant Escherichia coli Observed in Stray Dogs in Rural Angola,Microbial Drog Resistance, 2014, 20(4), 372-375 2. Carattoli, A., Animal reservoirs for extended spectrum beta-lactamase producers, Clin. Microbiol. Infect., 2008, 14, 117–123. 3. Clinical and Laboratory Standards Institute (CLSI). 2014, Performance Standards for Antimicrobial Susceptibility Testing. 4. Harada, K., Morimoto, E., Kataoka, Y., Takahashi, T., Clonal spread of antimicrobial-resistant Escherichia coli isolates among pups in two kennels, Acta Veterinaria Scandinavica, 2011, 53, 11. 5. Huang, T.D., Bogaerts, P., Biren, C., Guisset, A., Glupczynski, Y., Evaluation of Brilliance ESBL agar, a novel chromogenic medium for detection of extended-spectrum-beta- lactamase-producing Enterobacteriaceae, J Clin Microbiol, 2010, 48, 2091–6. 6. Ibrahim, S.A., Amal, E. Ahmady, A.A.K., Phenotypic and genotypic identification of extended spectrum β-lactamases (ESBLs) among clinical isolates of Escherichia coli, African Journal of Microbiology Research, 2014, 8(19), 1974-1981. 7. Valentina, L., Subgrouping of ESBL-producing Escherichia coli from animal and human sources: An approach to quantify the distribution of ESBL types between different reservoirs, International Journal of Medical Microbiology, 2014, 304, 805-816. 8. M’Zali, F.H., Chanawong, A., Kerr, K.G., Birkenhead, D., Hawkey, P.M.., Detection of extended-spectrum beta-lactamases in members of the family Enterobacteriaceae: comparison of the MAST DD test, the double disc and the Etest ESBL., J. Antimicrob. Chemother, 2000, 45, 881–885. 9. Măciucă, I., Williams, N., Tchiluş, C., Dorneanu, O., Guguianu, E., Carp

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Cărare, C., Rîmbu, C., Timofte, D., High Prevalence of Escherichia coli- Producing CTX-M-15 Extended-Spectrum Beta-Lactamases in Poultry and Human Clinical Isolates in Romania,Microbial Drug Resistance, 2015. 10. Manojkumar Singh, R. Singh, L., Comparative evaluation of six phenotypic methods for detecting extended- spectrum beta-lactamase- producing Enterobacteriaceae, J Infec. Dev.Ctries., 2014, 8(4), 408-415. 11. Willems, E., Cartuyvels, R., Magerman, K., Verhaegen, J., Evaluation of 3 different agar media for rapid detection of extended-spectrum β-lactamase- producing Enterobacteriaceae from surveillance samples., Diagn. Microbiol. Infect.Dis., 2013, 76 (1), 16, 9. 12. www.oxoid.com

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH REGARDING IMMUNOSUPPRESSION INDUCED BY OCHRATOXIN

C. CUMPĂNĂȘOIU1, MONICA LIKER2, ILEANA NICHITA1, OLIMPIA COLIBAR1, R.V. GROS1, MONICA ȘEREȘ1, E. TÎRZIU1

Summary

The aim of this study was to establish the immunosuppressive effect of ochratoxin, using mononuclear cells separated from mice‘ spleens. 30 white miced were used, divided in three groups: control group (A), experimental group 1 (B, treated with Mycoplasma immunogen) and experimental group 2 (C, treated with ochratoxin and Mycoplasma immunogen). After two treatments (two weeks) spleen was harvested from all mice, and mononuclear cells were separated and cultured. The following paramenters were determined on the cells cultures: proliferation factor, with and without stimulation of cell cultures with phytohaemagglutinin (PHA), concanavalin (ConA) and Mycoplasma immunogen (My), and interleukin-2 synthesis in cell cultures. The results obtained showed normal values for proliferation factor in control group. The cell proliferation indexes showed changes depending on the mitogen used (3.2 - 4.0), and the cell proliferation factor was 2.6 in unstimulated samples. It was also found that stimulation with Mycoplasma immunogen, the synthesis of IL-2 was maximal. Con A and PHA had a moderate action. In cultures obtained from group C animals (treated with ochratoxin), IL-2 was absent, regardless of the mitogen used to stimulate the cells. Key words: ochratoxin, immunosuppresion, Mycoplasma immunogen, cell culture

Ochratoxin is a nephrotoxic, carcinogenic (proven in experiments on mice) and teratogenic substance, having also immunotoxic, immunosuppressant and neurotoxic effects. It is also suspected a genotoxic effect of ochratoxin, due to its intervention in the proteins‘ biosynthesis. Traces of ochratoxin acceptable in daily diet should be between zero and few nanograms/kg to not produce the effects above mentioned. Because ochratoxin is a constant presence in cereals and cereals products (the main sources of contamination both for humans and animals), we cannot eliminate completely the exposure to this toxin. It is assumed that the mechanism toxigenetic is based on the establishment of strong covalent bonds between the toxin and DNA molecules (1). Ochratoxin biotransformation is not fully elucidated, but it was found that it become bioactive in the body, turning into metabolites capable to react with DNA molecules. Its toxicity is mainly due izocumarinic type structure. The half-life of ochratoxin in the body is relatively high compared to that of its metabolites (1). 81

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Among the ochratoxin negative effects on the immune system, it can be mentioned: atrophy of primary and secondary lymphoid organs (especially the thymus, spleen and lymph nodes), reduction of humoral immune response through antibodies, numerical and functional alteration of cellular effectors and modulation of cytokines TNF-α and IL-6 synthesis (1). The experiments presented in this paper aimed to demonstrate immunotoxic action of ochratoxin both on cellular and humoral immune effectors.

Materials and methods

The research were conducted on 30 Swiss mice (weight 20-22 g), divided into three groups and treated with (Table 1): - ochratoxin (Sigma) - 2 µg/animals, inoculated intraperitoneally in a volume of 0.2 ml, twice, in day 1 and 8 of the experiment; - Mycoplasma immunogen - 0.10 µg/animal, administered twice, in day 1 and 8 of the experiment.

Table 1 Treatment scheme Group Mycoplasma immunogen Ochratoxin A - - B days 1 and 8 - C days 1 and 8 days 1 and 8

The animals were euthanized 15 days after the first administration of the products, and the spleen was sampled from each animal by splenectomy, then suspended in phosphate-buffered saline (PBS) supplemented with antibiotics. Using the samples mentioned below, the following assays were performed: - cell proliferation assay using non-adherent mononuclear cells isolated from spleen; - the determination of interleukin-2 synthesis in cell cultures; In vitro, have been used as immunomodulators prepared as follows: - Phytohaemagglutinin (PHA) - 1μg/ml culture medium; - Concanavalin A (ConA) – 0.5μg/ml culture medium - Mycoplasma extract (My) - 50μg/ml culture medium. The assays were performed on cell cultures with or without immunomodulators. Mycoplasma immunogen (My). The immunogen was obtained from the Mycoplasma agalactiae cultures, using the method recommended by Chandler and Barile (2). Briefly, the tubes with the culture medium containing mycoplasmas were frozen in a cooling bath, after which they were allowed to thaw slowly at laboratory temperature. This freeze-thaw procedure was repeated five times and after that the tubes were centrifuged at 100,000 g for 1 hour. The supernatant was dialyzed 82

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA against 40 volumes of distilled water at 4°C (6 times). Bacteria-free extract was then placed in vials, lyophilized and kept at 4°C until administration (2). Obtaining the spleen cells cultures. Sampled spleen tissue was washed three times using MEM medium (Sigma - M4655) supplemented with antibiotic and antimycotic solution 2%. The tissue cutted in small pieces, after which was triturated through the 40-mesh sieve (SIGMA CD1) of cell dissociation system. The cell deposit was taken up in MEM medium supplemented with antibiotic and antimycotic solution and was treated with nonenzimatic cell dissociation solution (SIGMA – C5789) to release the cells from the remaining tissue debris. The suspension was filtered using a 100-mesh sieve and centrifuged at 800 g for 15 minutes at 4°C; the resulting cell pellet was then washed two times with MEM medium supplemented with antibiotic and antimycotic solution 1%. The last pellet was resuspended in MEM medium and processed by centrifugation on Ficoll- density gradient (StemCell Technologies Inc, Vancouver, BC, Canada) (5).

Cell proliferation assay. The purpose of this assay was to determine the ratio between the number of cells / ml of culture at 72 hours after stimulation and the number of cells in the same culture before mitogenic or antigenic stimulation. Thus, the proliferation factor (Pf) and proliferation coefficient (Pc) was calculated according to the following formulas:

no. of cells /ml after 72 hours of incubation Pf = no. of cells/ml before stimulation

Pf of stimulated culture Pc = Pf of control culture

Fluorometric assay for quantification of interleukin-2 synthesis in cell cultures. CTLL-2 cell line was used, a line dependent of IL-2 and MTT (3- (4, 5 dimethylthiazol-2-yl) -2, 5 diphenyltetrazolium bromide). CTLL-2 cells have the capacity to cleave MTT, transforming this yellow substance in a brown precipitate - formazan. The precipitate is then dissolved using isopropyl alcohol, and the intensity of the reaction, determined using a spectrophotometer, it is directly proportional to the amount of formazan formed.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and discussions

Cell proliferation The data regarding the cell proliferation indexes reveal a normal level of proliferation for all cultures obtained from control group animals (group A). However, the proliferation factor varied depending on the mitogen used (between 3.2 and 3.6) (Table 2, fig. 1).

Table 2 Influence of ochratoxin on cell proliferation Group In vivo In vitro Proliferation Proliferation treatment stimulation factor coefficient A - Control 2.60 - ConA 3.60 1.38 PHA 3.20 1.23 My 3.30 1.27 B Mycoplasma Control 2.65 - immunogen ConA 3.85 1.45 PHA 3.80 1.43 My 4.35 1.64 C Mycoplasma Control 0.85 - immunogen ConA 1.10 1.29 + PHA 1.00 1.18 Ochratoxin My 1.20 1.41

Group A Group B Group C

Fig. 1. Dynamics of cell proliferation coefficient

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Analyzing the results for group B (treated in vivo with Mycoplasma immunogen) it was found that both in vivo and in vitro treatment with mitogens had a positive effect on cell proliferation. Thus, the administration on My in culture medium has the most important stimulatory effect, surpassing the action of ConA and PHA (Table 2, fig. 1). In animals of group C (treated with My and ochratoxin in vivo) the mononuclear cells had a significantly reduced proliferation capacity, the proliferation factor having levels between 0.85 (control cultures) and 1.20. However, My proved to be good mitogen, stimulating the cells proliferation at higher level than ConA and PHA (Table 2, fig. 1).

IL-2 synthesis As a result of quantitative determination of interleukin 2 in cultures supernatants, it was found that the cultivation of mononuclear cells taken from the animals of the control group (group A) allowed interleukin-2 synthesis both in stimulated and unstimulated cultures (Table 3, fig. 2).

Table 3 Influence of ochratoxin on IL-2 synthesis Group In vitro treatment Limiting dilution (log2) A M 1/1 Con A 1/3 PHA 1/3 My 1/4 B M 2 Con A 1/4 PHA 1/4 My 1/5 C M 0 Con A 0 PHA 0 My 0

In group B case (animals stimulated in vivo with Mycoplasma immunogen) there was an increase in the synthesis of interleukin 2, aspect confirming the onset of immune response mechanisms involving activated T cells. It was also found that stimulation with My, a specific activator of lymphocytes which has also a non- specific action, induced in the same time a maximum level of IL-2 synthesis. ConA and PHA had a moderate stimulatory action (Table 3, fig. 2). In cultures obtained from group C animals (treated in vivo with ochratoxin and My), IL-2 was absent, regardless of the mitogen used to stimulate the cells.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Group A Group B Group C

Fig. 2. Dynamics of IL-2 synthesis in animals treated with ochratoxin

Different results were reported Marin et al. (5), after the assessment of the ochratoxin effects on EL-4 cell line, respectively an increase of IL-2 synthesis compared with control cultures. However, this cell line is a tumor line (isolated from thymomas) and exposure to ochratoxin was done strictly in vitro. In the present experiment, the animals were exposed in vivo to ochratoxin (in day 1 and 8 of the experiment), after which the study was conducted in vitro. On the other hand, Harvey et al. (3) showed that ochratoxin inhibits IL-2 synthesis in cultures of stimulated pig lymphocytes (with ConA). Other authors have shown that the mycotoxin does not interfere with the production of IL-2 in stimulated murine lymphocyte cultures (6,7). However, in the case of purified and activated T cells, the synthesis of IL-2 and expression of IL-2 receptor is suppressed by ochratoxin A; this negative effect may be canceled only by pre- incubation of cells with ochratoxin B, followed by exposure to ochratoxin A (4). As can be seen, the results of studies regarding the effect of ochratoxin on cells cultures are contradictory. We believe that these differences are influenced, in addition to methodology (which plays a major role), by the species from which the cells assessed were sampled and the dose of mycotoxin.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

Ochratoxin has the ability to reduce cells proliferation in cultures and to cancel the synthesis of IL-2 activated T lymphocytes. Of mitogens used, Mycoplasma immunogen had the most positive effect on cell proliferation indexes, in both experimental groups. Regardles of the mitogens used in cell cultures, the IL-2 synthesis is inhibited by the exposure to ochratoxin of the animals that represents the source of the cells.

Acknowledgments

References

1. Alanati, L., Petzinger, E., Immunotoxic activity of ochratoxin, A. J. Vet. Pharmacol.Therap., 2006, 29, 79-90. 2. Chandler, Donna K. F., Barile M.F., Ciliostatic, Hemagglutinating, and Proteolytic Activities in a Cell Extract of Mycoplasma pneumoniae, Infection and Immunity, 1990, 29, 3 1111-1116. 3. Harvey, R.B., Elissalde, M.H., Kubena, L.F., Weaver, E.A., Corrier, D.E., Clement, B.A., Immunotoxicity of ochratoxin A to growing gilts, American Journal of Veterinary Research, 1992, 53, 1966–1970. 4. Lea, T., Steien, K., Stormer, F.C., Mechanism of ochratoxin A-induced immunosuppression, Mycopathologia, 1999, 107, 153–159. 5. Marin, L.L., Murtha, J., Pestka, J.J., Effects of mycotoxins on cytokine production and proliferation in EL-4 thymoma cells, J. Toxicol. Environ. Healts, 1996, 48(4), 379-396. 6. Thuvander, A., Breitholtz-Emanuelsson, A., Brabencova, D., Gadhas- Son, I., Prenatal exposure of Balb/c mice to ochratoxin A, effects on the immune system in the offspring. Food and Chemical Toxicology, 1996, 34, 547–554. 7. Thuvander, A., Dahl, P., Breitholtz-Emanuelsson, A., Influence of perinatal ochratoxin A exposure on the immune system in mice, Nat Toxins, 1996, 4(4), 174-80.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

PHYSICO-CHEMICAL AND MICROBIOLOGICAL CHANGES DURING RIPENING OF TELEMEA CHEESE

DAN S.D.1, M. MIHAIU1, ALINA DANA MĂGDAŞ2, G. SĂPLĂCAN3, SIMONA MIREL4, OANA REGET1, ALEXANDRA TĂBĂRAN1

1Department of Animal Production and Food Safety, University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine, 400372, 3-5 Mănăştur Street, Cluj-Napoca, Romania 2National Institute for Research and Development of Isotopic and Molecular Technologies 3S.C. Compania de Informatica Aplicata S.A. Cluj-Napoca, Romania 4Department of Pharmaceutical Chemistry, University of Medicine and Pharmacology Iuliu Hatieganu, Cluj-Napoca, Romania E-mail: [email protected]

Summary

The research material was represented by 39 samples of ripened telemea cheese (30 day) collected between February and July 2014, from a diary processing plant, located in Cluj County. In this study we aimed at the following objectives: dynamic assessment, during maturation process, of compositional parameters from ripened telemea cheese and the evaluation of microbiological risk represented by E. coli and Staphylococcus aureus. All the cheese samples were analyzed using standardized methods. Specific colonies of E. coli, respectively Staphylococcus aureus were tested regarding enterotoxigenity capacity, using specific primers. Based on the statistical interpretation of the results, in case of compositional parameters, nonconformities have been found regarding the chemical components of cheese for the proteins, solids and fat parameters. During the process of ripening a descending evolution for pH value and proteins has been found, the fat revealing a uniform evolution reported at total solids and an ascending evolution has been found for fat, total solids, salt and titrable acidity parameters. In the isolates analyzed, the PCR testing for toxicity specific genes (stx, stx2, sea, sec, sep) didn‘t reveal any positive amplification. The microbiological risk represented by the presence of E. coli and Staphylococcus aureus is reduced. Although the microbiological load was relative low, the presence of E. coli and coagulase-positive staphylococci denote deficiency regarding strict compliance of good hygiene practice. Key words: telemea cheese, chemical composition, ripening, microbiological risk

Telemea cheese is part of ripened cheese in brine category, originating in areas located in the south-eastern Mediterranean, the most famous Romanian traditional cheese. It is distinguished from other cheese types by the fact the product is subjected to technological operations like salting, wet or dry, which gives not only a special taste, but a longer shelf life. Telemea cheese quality is influenced by many factors: chemical composition and microflora of raw milk, configuration of the lactic cultures used, compliance with the technological process, especially the 88

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA maturation process (9, 10). Although this range of cheese is considered to be safe for consumers as a result of conservation by brining, however, if not complied with good hygiene practices in processing units or the microbiological quality of raw milk is poor, can cause food poisoning in consumers, in particular in the case of products obtained in the traditional system (5). The identification of pathogens such as pathogenic E. coli, for example, producing Shiga toxin is now increasing, in the case of these types of cheese. These food poisoning, although relatively rare, are mainly caused by consumption of milk products that were inappropriate heat- treated or obtained from milk that was not heat-treated (2). Microbial diversity underlying the benefits of raw milk cheese consumption depends on the initial microflora of raw milk and on the use of traditional practices. Cheese obtained from raw milk has more intense and more diversified flavour than those industrially processed. Lactic microorganisms used to obtain cheese from raw milk are more diversified in milk compared to those made from pasteurized or micro filtered, for which selected lactic cultures are used , that contain only a few microbial species (Montela, 2014). During ripening, lactic cultures help to improve sensorial characteristics as a result of complex physical, chemical, biochemical and microbiological transformation processes (10). Because of these considerations, in this study we aimed to evaluate the compositional parameters of ripened telemea processed from cow milk and microbiological risk assessment through the evaluation of E. coli, Staphylococcus aureus and staphylococcus enterotoxin during ripening stage.

Materials and methods

In order to assess in dynamic the compositional and hygienic parameters of ripened telemea cheese, 39 samples were taken under study, from the following steps of the process flow: the removal of telemea on the sieve, dressing, and reception, ripening in the first 10 days, ripening from 20 days to 30 days and packaging. The parameters analyzed by standardized methods were: fat, dry matter, protein, NaCl, pH, titratable acidity. To asses the presence of E.coli (SR EN ISO 16649-2/2007) and Staphylococcus aureus (SR EN ISO 6888/1/2/A1/2005) 39 samples were taken after packaging of the product, in batches (n = 13), yielding three samples per each batch. Specific colonies of E. coli, respectively Staphylococcus aureus were tested regarding enterotoxigenity capacity, using specific primers (stx, stx2, sea, sec, sep). Statistical interpretation of the results was performed with the program Origin 8.5, depending on the standard deviation and probability index (p≤0.05), having a 95% confidence level).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and discussions

Evaluation in dynamic of compositional and hygienic parameters of ripened cow telemea Fat showed a slight upward trend during the production process, from 20.45 ± 0.76 g% after removing of the cheese on the sieve at 21.61 ± 1.37 in the packing stage, with a slight decrease on day 10 of ripening respectively 19.85 ± 1.23 g%, without significant differences (p> 0.05). Higher values of fat were published by Mallaton et Pappa (6), which showed the first day of telemea ripening the value of 19.5 ± 0.3 fat g%, and after two months of ripening, reached the amount of fat of 24.7 ± 0.2 g%. Also, Majsova et al. (7), have reported significant increases in fat content from 25% the first day of ripening to 30% after 90 days of ripening. Higher increase is due to the fact that ripening in the case of the product analysed was only 30 days instead of 90 as in the case of the cheese analysed by Majsova et al. (7). 30 28 26 24 22 Proteins % 20 linear fit 18 16 Minimum admitted level 14 12 10 8

Proteins(g %) 6 4 2 0

Salting Packaging 0 day ripening Draining of whey 10 days ripening20 days ripening30 days ripening

Fig. 1. Average proteins values during telemea cheese manufacture

Regarding the average values of protein, there was a slightly downward trend, confirmed by simple linear regression (fig. 1). Thus, the average value of the protein decreases from 17.82 ± 0.80 w% in the whey drainage step, to 17.07 ± 1.13 wt%, no significant differences are found (p> 0.05). In the 10th day of ripening a more pronounced decrease of this parameter was observed, which was confirmed by the statistical calculations performed (p<0.05). Since protein is required to have a minimum admissible value, in accordance with normative issues (STAS 6355-

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

89), it was found that 18.68% of the examined samples showed lower individual values. Similar results for proteins, varying between 12.9 and 18.6 g% were also mentioned by Hui et Evranuz (2012) and Pappa et al. (8). Also, during the ripening was the same trend was observed, the slight decrease in the total amount of proteins, by the cleavage of the main fractions of casein. Different results were obtained by Mallaton et Pappa (6), who obtained in the first day of ripening the value of 15.03 ± 0.52% and 16.74 ± 0.13% after two months of ripening and Majsova et al. (2009), which had on the first day of ripening an average protein value of 12.43% with a 18.21% increase after three months of maturation. The dry matter during the technological process revealed a trend of slight increase from 43.38 ± 1.40 g% in the stage of leaving the cheese on the sieve at 45.92 ± 1.68 g% in the final stage of packaging (p <0.05), all evidence falling within the current regulations (S.U. minimum 42%). Similar results were noted by Pappa et al. (8) and by Mallaton et Pappa (6), who found the humidity value of 60.26 ± 0.22% on the first day of maturation and 54.34 ± 0.6% after two months of ripening. 6

4 NaCl % Maximum adimited level linear fit

2 NaCl (g%)

0 -- Salting Packaging O day ripening10 days ripening20 days ripening30 days ripening

Fig. 2. Average chlorids values during telemea cheese manufacture

Chlorides showed a significant upward trend, 2.09 ± 0.31 g% on the stage of pickling to 3.34 ± 0.24 g% in the final stage of product packaging all samples falling within the maximum allowable (4 g%), (p<0.05) (fig. 2). Similar results were found by Mallaton and Pappa (6), sodium chloride having an upward trend from 2.13 ± 0.2 g% on the first day of maturation 3.32± 0.07 g% at day 60 of ripening. Also in the work of the Pappa et al. (8), the mean sodium chloride value has a 91

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA increased from 3.22% on the first day of ripening, to 4.75% at day 60 of ripening. Also, Majsova et al. (2009) observed an upward trend of NaCl from 4.09 g% on the first day of maturation to 4.60 g% in the 90 day of ripening. Cheese ripening stage is considered one of the most important, because during this stage sensorial characteristics, physico-chemical and microbiological, biochemical reactions are finalisated, generated as a result of their milk enzymes (alkaline phosphatase, acid phosphatase, lipases, proteinases, etc.) and those of lactic acid bacteria and rennet (1, 10). In order to assess the ripening process the pH and titratable acidity values were determined. The mean pH value showed a downward trend, from 5.06 ± 0.07 in the first day, when sampling was made, from 4.59 ± 0.08 in the final stage of packaging (fig. 3).

6,0

5,5

5,0

4,5 pH 4,0 liniear fit

3,5 pH

3,0

2,5

2,0

Salting Packaging Draining of whey 1 day ripening10 days ripening20 days ripening30 days ripening

Fig. 3. Average pH values during telemea cheese manufacture

From the statistical analysis of the results was found that between pH values obtained in the step of putting the cheese on the sieve and packaging are significant differences (p <0.05), issue demonstrated by performing a simple linear regression. Different results were reported by Banu et al. (1), which showed an increase in the pH at the stage of maturation of the cheese with mould in the paste or on the surface, as a result of proteolysis processes, with the formation of alkaline compounds. Similar results were mentioned by Pappa et al. (2006), a decreasing pH value from 4.97 on the first day of maturation, to 4.23 on day 60 of ripening. Also, Mallaton and Pappa (6) and Mojsov et al., (7) showed a decrease in the pH of 4.71 ± 0.03 on the first day of ripening, to 4.51, after two months of ripening.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The average value of the titrable acidity has shown an ascendant trend from 163.07±11.03° Thorner in the first day of sampling to 269.53±17.62° Thorner in the final stage of packaging (fig. 4). From the statistical analysis of the obtained results it was revealed that among the acidity values obtained in steps of removing the telemea cheese from the sieve and packaging stage the results are significantly different (p<0.05). 300

250

200

Acidity 150 linear fit

100 Acidity (Thorner) 50

Salting Packaging Draining of whey 1 day ripening10 days ripening20 days ripening30 day ripening

Fig. 4. Average titrable acidity (°T) values during telemea cheese manufacture

Evaluation of microbiological risk at ripened cow telemea cheese

Although the telemea cheese being preserved in salted water is in general protected by microbial spoilage processes, E.coli and Staphylococcus aureus can show an elevated risk on public health, especially in the case of traditional cheese (2, Hui et Evranuz, 2005). In order to insure the safety it must be checked the milk used in the processing of cheese, the starter cultures used, the development of starter cultures, the development of lactic bacteria which grow during fabrication, the pH value, salt concentration, monitoring and control of chemical processes that occur during ripening (3). According with the legal regulation (Reg. CE 2073/2005), in the case of ripened cheese subjected to thermal treatment, it is mandatory to identify the staphylococcic enterotoxin, as safety measure, and to evaluate the hygiene criteria during the technological processing, the E. coli and Staphylococci coagulase positive load is assessed.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

E. coli 30

5 Total microbilaload (CFU/g)

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Fig. 5. Total microbial of E. coli in ripened telemea cheese

Regarding the E. coli, it was found that from the total amount of analysed samples only three were negative, respectively 7.69%. The rest of the samples had an average value of colonies number in between 8.66±1.52 - 16.33±7.76 cfu/g, values relatively low, which are acceptable by the legislation (Reg. 1441 CE/2007; max 100 cfu/g) (fig 5). Much lower values were mentioned by Suler et al., (11), with an average number of colonies number in between 0.06 and 3.33 cfu/g, values that are in conformity with the legislation. The presence of E. coli in these dairy products is due mainly to the hygiene conditions along the technological processing flow (11). Also, Geber et al., (2006), has shown a low prevalence of E. coli, which from a total of 11 samples of analysed telemea cheese, has seen that 9 samples were negative and only 2 positive for the presence of E. coli. Similar results regarding the E. coli prevalence were revealed by Khayat et al., (1987), from 250 analysed samples for coliform bacteria, 46% were negative, and the rest of au 54% have shown values in between 102 and 107 cfu/g, exceeding the maximum limit allowed, compared to our results. The Staphylococcus germ were identified in 31 samples (79.49%), with a load in between 1±1.73 - 45.66±6.02 ufc/g, values that are in conformity with the legislation (max. 100 ufc/g) (fig. 6). Similar values were reproted by Suler et al.. (11), in a study made on the microorganism configuration found in telemea cheese, high lightening the values of the coagulazo-positive staphylococci that were in between 0.48-7.08 ufc/g. Similarly, Khayat et al. (1987) has revealed that among 224 analyzed samples only 2% were positive, the rest being in confomrity with the legislation. Different results were obtained by Duminică (4), which has shown that the rippened telemea cheese has a percent of 56.57% E.coli and 11.76%

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA staphylococci coagulazo-positive from the total analyzed samples. The same author has identified the presence of coagulazo-positive staphylococci in a percent of 9.30% in the case of fresh telemea, values that were high following the inconformities found in the storage of the end product.

55 Coagulase positive staphyloccoci 50

10 Total microbial load(CFU/g)

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Fig. 6. Total microbial load of coagulaso-positive staphylococci in ripened telemea cheese

Although the load of coagulazo-positive staphylococci was in between the maximum allowed limits according to the Reg. 1441 (CE)/2007, the testing for the enterotoxin identification not being necessary, the specific colonies have been tested by PCR with specific primers for staphyloccocus enterotoxin gene (sea, sec, sep).

Conclusions

Following this study we found non-compliences regarding the compositional quality of telemea cheese at the following parameters: proteins, dry substance and fat/dry substance. During the rippening process we found a descending evolution in the case of pH and protein and a uniform evolution of the fat in regard to the dry substance. It was revealed also an upper trend within the fat, dry substance, salts and acidity parameters. The microbiological risk represented by the presence of E.coli and Staphylococcus aureus is low. Although the microbial load was relatively low, the presence of E.coli and coagulazo-positive staphylococci proves the defficiencies regarding the strict compliance of good hygiene practices within the unit studied. Taking into consideration the identification in some samples of E.coli which represents an indicator of fecal contamination, it is

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA recomended the improvement of hygiene conditions along the processing stages of the telemea cheese.

Acknowledgments

This paper was published under the frame of the Applied Research Collaborative Projects, PCCA no. 153/2014.

References

1. Banu, C., Tratat de industrie alimentară, Ed. ASAB, Bucureşti, 2009. 2. Dan, S. D., Mihaiu, M., Mihaiu, Liora, Cordea, D., I. Cordiş, Oana Reget, Alexandra Tǎbǎran, Risk Assessement Represented by Pathogenic Microorganisms Regarding the Incidence of Foodboorne Ilnesses in a Representative County During 2013, Bulletin UASVM serie Veterinary Medicine, 2014, 71(2), 418-423. 3. Donnely, C.W, Cheese chemistry, psysics and microbiology, Ed. Academis Press, Departament of nutrition and food science the universitz of Vermont, Burtington, USA, 2004. 4. Duminică, Gabriela Claudia, Cercetări privind calitatea şi igiena brânzei telemea, Teză de doctorat, Facultatea de Medicină Veterinară Iaşi, 2009. 5. Farrokh, Choreh, Kieran, J.B., Auvray, F.C., Sticla, K.D., Oppegaard, H., Raynaud, S.F., Thevenot, D.G., Condron, R.H., De Reu, K.I., Govaris, A.J., Heggum, K.K., Heyndrickx, M.I., Hummerjohann, J.M, Lindsay, D.N., Miszczycha, S.G., Moussiegt, S.O., Verstraete, K.I., Cerf, O., International Journal of Food Microbiologie, 2013, 162 (2), 190-212. 6. Mallatou, H., Pappa, E. C., Comparison of the characteristics of teleme cheese made from ewe‘s, goat‘s and cow‘s milk or a mixture of ewe‘s and goat‘s milk, International Journal of Dairy Technology, 2005, 58(3), 158–163. 7. Mojsova, Sandra, Jankuloski, D., Sekulovski, P., Angelovski, L., Ratkova, M., Prodanov, M., Microbiological properties and chemical composition of Macedonian traditional white brined cheese, Mac Vet Rev, 2013, 36 (1): 13–18. 8. Pappa, E.C., I. Kandarakis, G.K. Zerfiridis, E.M. Anifantakis, J.A. Robertson, E.N.C. Mills, Teleme White-Brined Cheese from Sheep or Goat Milk, Special Issue of the International Dairy Federation 1201, IDF International Symposium on Sheep, Goat and other non-Cow Milk, Special Issue of the International Dairy Federation, 1201, 2006, 83-86. 9. Pappa, E. C., Kandarakis, I., Mallatou, H., Effect of different types of milks and cultures on the rheological characteristics of „Telemea‖ cheese. Journal of Food Engineering, 2007, 79, 143-149.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

10. Rotaru, Gabriela, Mocanu, D., Uliescu, Mădălina, Andronoiu, Doina, Research studies on cheese brine ripening, Innovative Romanian Food Biotechnology, 2008, 2, 30 – 39. 11. Suler, Andra, Popa, Dana, Popa, R., Nicolae, Carmen, Maftei, M., Researches Regarding Microbiological Parameters Values of Telemea Cheese, Scientific Papers: Animal Science and Biotechnologies, 2010, 43 (2), 377-379.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

GENERAL PRINCIPLES REGARDING RISK ANALYSIS OF THE LOW ACIDITY CANNED FOOD MANUFACTURING

OANA-MĂRGĂRITA GHIMPEȚEANU

University of Agronomical Sciences and Veterinary Medicine of Bucharest, Faculty of Veterinary Medicine, 050097, Splaiul Independentei No.105, Bucharest, Romania E-mail: [email protected]

Summary

The main risk associated with low acidity canned food is the presence of Clostridium botulinum and its toxin, botulina, which causes botulism. After the confirmation of two cases of botulism in the 80's, the worldwide low acidity canned food manufacturers and importers have started to use the HACCP system for keeping under control the technological process, and in particular the heat treatment. The legislation of different producing canned food countries specifies own critical limits for joining boxes and for other canning parameters and the sampling plans used for products testing. Most of the manufacturers believe that altering of canned food and the presence of botulism are related to the survival of bacteria due to inefficient heat treatment and to the re- contamination that occurs after processing. Using of HACCP system, by identifying critical control points, in the low acidity canned food manufacturing has the main objective the prevention of botulism. Key words: HACCP system, low acidity canned food, Clostridium botulinum

The main risk associated with low acidity canned food is the presence of Clostridium botulinum and its toxin, botulinum toxin, which causes botulism. After the confirmation of two cases of botulism in the 80's, the worldwide low acidity canned food manufacturers and importers have started to use the HACCP system for keeping under control the technological process, and in particular the heat treatment (8). The literature presented that such diseases have occurred virtually worldwide, involving a wide range of products. One of the first measures was tightening the control applied to the closing of the canned food. The legislation of different countries states own specific critical limits for joining boxes and other parameters of canning and also the sampling plans used for testing. Also, research has shown that the sampling and microbiological testing methods are inadequate for checking the safety for consumption and preservation of cans (8,9). In 1982, Codex Alimentarius Commissionpointed out that the control over the method of manufacture, the hygiene and the handling of the cans after manufacturing is much more effective measures to protect consumer health products than an extensive examination of final products (1,2).

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Most manufacturers of canned food consider that alteration and appearance of botulism are related to bacteria survival due to inefficient heat treatment and re-contamination that occurs after processing. Using risk analysis in the manufacture of low acidity canned food mainly aims to prevent botulism (7,10). Analyzing the process of manufacturing and the risks associated with each stage of production and preventive measures that can be applied in order to control these risks, some critical control points can be identified (4): 1. production and quality of raw materials and packages; 2. processing procedures, temperatures and hold times during the technological processes applied 3. sanitation of cans 4. filling of cans (temperature and degree of filling) 5. heat treatment (status of valves, temperature and duration, F0 value, cooling methods) 6. cleaning and chlorination of cooling water 7. verification of rabbet 8. installation deficiences 9. conditions of transport and storage At first glance, some of these critical control points do not appear to have direct importance for the safety of the final products, but deviations in these critical control points may influence obtaining unsafely products (through indirect influence). Therefore,it is very important to keep under strict control of all stages mentioned above. The following critical control points are considered of great significance in the production of canned food (1,6). Production and quality of raw materials In the case of raw materials the major problems are selecting suppliers, agricultural land and the proper use of pesticides. Technological flow and filling of cans The technological flow includes an initial group of operations such as sorting, weighing and preparing of raw materials, mixing ingredients for the final product. At this stage, a significant risk is represented by peeling of knives used in cutting / portioning and penetration in the final product. In order to eliminate this risk, it can be used a magnet or a metal detector to detect and isolate contaminated with metal products. The viscosity of the product is an important critical control point due to its effect on the rate of heat penetration in the product during sterilization. The space left in the can after filling is crucial for preserved food sterilized in an autoclave with stirring. This air gap allows formation of air bubbles that will help shake the box contents during stirring autoclave. If this space is too small, the heat penetration rate will be reduced.

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Codification of cans is used for identification purposes - both in economic management purposes and for the event of a complaint or withdrawal from the market of the final products. In order to know the microbial contamination of the product before sterilization, it is important to check the condition of hygiene and to determinate the microbial load determination for certain ingredients (eg sugar or starch) (3,5). Heat treatment Sterilization is a critical control point degree 1 (CCP1), the only stage of the technological flow that can really control the risk of botulism. Determining the F0value allows the evaluation of the heat treatment in terms of destruction of non-pathogenic, heat resistant spores, heat resistant, which can germinate and grow at high storage temperature (this problem arises especially in hot climates countries, affecting selling products). In order to reduce the probability of survival of Clostridium botulinum spores to less than 10-12 / g, low acidity canned preserved only by heat treatment must have a minimum F0 value of 2.5. Most manufacturers of canned food apply a much more severe heat treatment in order to inactivate more heat resistant spores than Clostridium botulinumones. Determination of F0 can established only if the applied technology destructed theClostridium botulinum spores to an acceptable level. In addition, the following measures are required: - control of initial temperature of the product before loading in the autoclave; - complete elimination of air and filling with steam of the autoclave; - compliance of temperature / duration of sterilization process; - installation of a thermometer in order to indicate the temperature of the autoclave; - measuring and recording of temperature and time; -chlorination of cooling water of cans in order to prevent their contamination with microorganisms. The degree of loading of autoclaves is very important for effective sterilization, if the autoclaves are excessively loaded; sterilization will be incomplete and will not touch "industrial sterility" (3,5). Verification of rabbets Rabbets‘ integrity is extremely important to maintain product safety and stability. There are several ways of checking the rabbets‘ integrity, including visual check and some specific measurements of external and internal dimensions of the rabbets. In conclusion, it should be noted that the number of control points identified the manufacture of with low acidity is higher (even double) than the number of critical control points in most manufacturing processes other foodstuffs.

100

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

References

1. Buhancă, M., Ghidul national de bune practice pentru siguranta aliementelor, sistemul pentru siguranta alimentelor HACCP, produseculinare, Editura Uranus, Bucuresti, 2007. 2. Gonciarov, Magda., Popa, R.,Tudor, L.,Best practices-basic requirements of hygiene and processing, Lucrari Stiintifice - Universitatea de Stiinte Agricole si Medicina Veterinara a Banatului Timisoara, Medicina Veterinara, 2010, 43, 2, 242-245, ISSN1221-5295. 3. Gonciarov, Magda, Tudor, L., Mitranescu, Elena, Bacterial and viral hazard identification associated to alimentary products. Universitatea de Stiinte Agricole si Medicina Veterinara a Banatului Timisoara, Medicina Veterinara, 2010, 43, 2, 648-653. ISSN1221-5295 4. Gonciarov Magda, Popa R.,Tudor L., Mitrănescu Elena, Risk study key stage of the HACCP system, Lucrari Stiintifice - Universitatea de Stiinte Agricole si Medicina Veterinara Banatului Timisoara, Medicina Veterinara 2010 Vol. 43 No. 2 pp. 246-250 5. Ivana, Simona, Manual de microbiologie alimentara, Medical Sciences Publishing House, Bucharest, 2007. 6. Pişcoi, P., Rusen, Gabriela,Tudor, L., Guide to goodhygiene practicesand productionformeat processingsector. Agricultural Publishing House, Bucharest, 2006. 7. Popa, R., Gonciarov, M., Lupescu, C., Importance of official control, University of Agronomic Sciences and Veterinary Medicine of Bucharest, Scientific Works. Series C. Veterinary Medicine, LVII(1), 2011, 178-183, 8. Warne, D., Aspects of the hazard analysis critical control point, concept for the canned food industry, Food Technology in Australia, 1985, 37(2). 9. *** Council Regulation 2073(2005) Regulation establishing microbiological criteria forfoodstuff, published in the Official Journal of theEuropean Union no.L 226,25.6.2005. 10. *** Order ANSVSA no.772 to approve the Rapid Alert System for Food and Feed, published in the Official Monitor of Romania, Part I, number 959 of 29 November 2006.

101

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

OFFICIAL CONTROLS ON TRADITIONAL PRODUCTS OF ANIMAL ORIGIN SUBJECTED TO INTRACOMUNITARY EXCHANGE

OANA-MĂRGĂRITA GHIMPEȚEANU, C. SAVU

University of Agronomical Sciences and Veterinary Medicine of Bucharest, Faculty of Veterinary Medicine, 050097, Splaiul Independentei nr,105, Bucharest , Romania E-mail: [email protected]

Summary

Since 2007, Romania, as an EU State Member, is obliged to full application of European legislation on veterinary certification and official controls on products of animal origin, including traditional ones, which are subject to intracomunitary exchange. Products must come from approved establishments for intracomunitary exchange, to move freely in the Community accompanied by commercial documents and to undergo checks on origin and destination by official veterinarians. They must carry out an identity check of each shipment to ensure that the products correspond to the information given in the accompanying certificates or documents and also to fulfil a physical inspection of each batch to ensure that products meet the requirements of Community law and national and are in a form, proper to be used for the purpose specified in the accompanying certificate or document. Physical control or any other control is performed to verify compliance with food law, when required in case of suspicion, uncertainty or doubt, upon notification by the Rapid Alert System for Goods and Feed or actions based on the National Surveillance, prevention and control of animal diseases, those transmitted from animals to humans, animal protection and environmental protection Program. To ensure traceability, operators engaged in intracommunitary exchange operations with animal origin products, including traditional products, must enroll in a special register comprehensive data on consignments of products of animal origin subject to intracommunitary exchange in order to be available to veterinary services when requested. Key words: official control, traditional products, intracomunitary exchange

Animal products, including the traditional ones, which are subjected to intracomunitary exchange must: - come from establishments approved for intracommunitary exchange by the veterinary authorities of EU Member States, benefiting of the oval health mark; - move freely in the European Union accompanied by commercial documents, on which oval health mark can be applied; - be subject to offical controls at origin and destination by official veterinarians (6,8). In order to implement European Union rules on official controls on products of animal origin in the Member States, official veterinarians from destination will 102

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA carry out official controls (1,3). For this matter, the beneficiaries of the incoming products from Member States must notify the veterinarian 24 hours prior to arrival of the shipment at the destination. At the arrival of the shipment at the destination, the official representative of the unit will notify the Sanitary Veterinary and Food Safety Authority and the official veterinarian (4,8). Based on notification of the operator, the official veterinarian will fulfill the documents control and ,if necessary,physical control of the products. Physical control or any other control will be performed to verify compliance with food and traditional products law, when necessary, respectively: - in case of suspicion, uncertainty or doubt; - based on notification through the Rapid Alert System for Goods and Feed; - based on the actions under the program for surveillance, prevention and control of animal diseases, zoonosis, animal and environmental protection (5). For physical controls in order to verify the compliance with veterinary legislation target samples are collected. In case of doubt, uncertainty or doubt about the identity or correlation between transport and accompanying documents, the competent territorial veterinarian will carry out any tests to confirm or eliminate the suspicion or uncertainty. In this case, until the final results of laboratory tests are known, the animal products will be retained (8). To ensure traceability, operators involved in intracommunitary trade operations with animal products, including traditional ones, must enroll, in a special register, comprehensive data on consignments of these products. If after the controls performed at the destination, it is found that the products do not fulfill the parameters established by the legislation, Sanitary Veterinary and Food Safety Direction will notify the Sanitary Veterinary and Food Safety Authority through the Rapid Alert System for Food and Feed in order to inform the European Commission and the veterinary authority of the Member State from where the animal products come. Exporting of animal products, including traditional ones from Romania,can be done by authorized processing plants. The various animal health or public health certificatesrequired in intracommunitary exchange include: - part I, "details of the consignment" standardized; - part II "certification", designed to show the specific legislation requirements to each species, type of production and product; - part III "control" standardized, regarding the recording of the results of inspections in accordance with regulations. The identity control represents a visual inspection to ensure that the veterinary certificate or veterinary document or other document required by veterinary legislation corresponds to the product itself.

103

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Physical control of animal products Physical control represents the control on the product itself, which may include checks on packaging and temperature and also sampling and laboratory testing (7). The purpose of physical control of animal products is to ensure that products achive the specifications of veterinary certificate. This is achieved by: - sensorial analyse : smell, color, consistency, taste; - simple physical and chemical tests: slicing, thawing, cooking; - laboratory tests for the detection of residues, pathogens, obvious changes and alteration. Regardless of the type of product, the following controls must be done: - control over the conditions and means of transport to identify in particular deficiencies or interruptions in the cold chain; - controlof the real weight compared to one on the veterinary certificate; - checking of packaging materials and all markings (stamps, labels) to ensure their compliance with EU legislation; - compliance control of the temperature during transportation required by EU legislation. When the results of laboratory tests carried out by survey are not immediately available and there is no danger to public or animal health, the products can be put into circulation. However, when laboratory tests were performed on the basis of suspicion of irregularity or when previous tests had positive results, the products can not be used until the test results are negative. The means of transport can be totally downloaded in following cases: - aleatory control revealed irregularities; - previous batches showed irregularities; - the official veterinarian suspects irregularities. Once the physical control was completed, the competent authority must certify the control by closing and officially stamping all the opened packages and by resealing all containers.

Organization and effects of the official controls The National Sanitary Veterinary and Food Safety Authority must ensure that no transport from an outside country of the European Union is introduced in EU or Romania without veterinary control (9). Each consignment must be inspected and veterinary controled at border by the competent authority under the responsibility of the official veterinarian. If the transport meets the import requirements, the official veterinarian must provide a certified copy of the original certificates or documents and issue a certificate stating that the shipment meets the conditions imposed by legislation. The following procedures must be applied at the border inspection post: - if the transport is transhipped from one plane to another or from one vessel to another within the customs area of the same port or airport either directly or after

104

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA being transported on the quay or on the runway for a short period the competent authority shall be informed accordingly by the person responsible for the load. The competent authority may, in exceptional cases where there is a risk to public or animal health, perform an examination of the documents accompanying the products - if the shipment is downloaded, it must be: - stored in costumes area of the port or airport until reexpedition; - controled for the specific documents; Products that are not submitted to import conditions are: - products of animal origin belonging to passengers used for personal use; - products shiped in small amounts for personal use; - products used as commercial samples, in a specified quantity. TRAFFIC application is a system for monitoring of import and transit of live animals, animal products, animal feed and veterinary medicinal products. Organisations will designate an operator who will record details of the system organization TRAFFIC, the organization will be validated by the Sanitary Veterinary and Food Safety Directions. All economic operators of the organizations, must register in the TRAFFIC system (2). If following a review of the goods at destination, during transport or transit, presence of specific pathogens or any risk to human healthis noticed the offical veterinarian must inform the Sanitary Veterinary and Food Safety Direction, in order to apply the following measures: - seizure of products or feed, under the supervision and control of the competent authority until a decision is taken; - declaration of the products as unfit for human consumption; - reprocessing using an appropriate procedure under veterinary supervision in order to ensure their safety; - enabling the importer to use the products for other purposes after it informs the competent authority and has the approval granted; - return of the transport in the country of origin, with the approval of the competent authority of that country; - distruction ofthe whole batch transport prior announcement of the importer and the competent authority of the country of origin.

Export operation of traditional products of animal origin The exporters must request at the Sanitary Veterinary and Food Safety Direction, updated information and veterinary requirements, as follows (8): - list of countries in which export is permitted; - list of organization authorized/approved for export; - veterinary conditions of the transport in accordance with type of product; - models of veterinary certificates for each country; - list of border inspection points.

105

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The official veterinarian insures animal health objectives at the place of origin, issues the health certificate following the model set by the central veterinary authority of the recipient, only to shipments that meet the conditions established veterinary authority of the importing country. The official must notify the Sanitary Veterinary and Food SafetyDirection, by telephone, fax or e-mail, export approval or rejection.

Conditions for approval of border inspection points To obtain authorization recognized by the European Commission,the border inspection points must have (8): - staff to control the documents (certificates of public health or animal health or any other document laid down by Community law transposed into national legislation) accompanying the products; - sufficient number of veterinarians and staff specially trained to carry out controls on products correspondence with accompanying documents, verification of identity, document control and systematic control of each consignment of goods in relation to the quantity of goods that pass through stations border inspection; - sufficient staff to collect and process random samples of product consignments presented at border inspection point; - sufficient buildings, available to staff responsible for carrying out veterinary controls; - buildings and installations hygienically appropriate for carrying out routine analyzes and sampling; - contract with an authorized laboratory for special analisys; - appropriate equipment for the rapid exchange of information, particularly with other inspection points and veterinary controls at border (via the computer). The intracommunitary exchange of animal products, including the traditional ones, must be very well controled in order to ensure a minimal risk of spreading diseases and a proper consumer health.

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/132765.

References

1. Cociuban, A., European single market - the four fundamental freedoms. Ed. Essential-2, IEM, Bucharest, 2002.

106

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

2. Diaconescu, Mirela, The association ofRomaniato the European Union. Economic and commercialimplications. Economic Publishing House, Bucharest, 2003. 3. Dobrescu, E.M., European integration. Romanian Academy Publishing House, Bucharest, 2007. 4. Gonciarov, Magda, The role and place of the sanitary and veterinary services in the countries which are members of the UE. Particularities of the adderation process of Romania to the UE and the progress registered with this occasion in the veterinary field. Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Veterinary Medicine , 2008, Vol. 65 No. 1, pp. 330-335, ISSN1843-5270. 5. Gonciarov, Magda., Tudor, L., Mitrănescu, Elena, The role and contribution of the international organisation for animal wellbeing (WHO) in organizating and promoting veterinary epidemiology as a science. Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Veterinary Medicine , 2008, Vol. 65, No. 2, pp. 360, ISSN1843-5270. 6. Popa, R, Gonciarov, Magda, Community and national rules for the control inspections, Scientifica Papers USAMVB Timișoara, Veterinary Medicine, 2010, 43 (2), 276-281. 7. Popa R, Gonciarov Magda, Audit-key step in achieving formal control. Scientific papers-Universityof Agricultural Sciencesof Banat,Timisoara, Veterinary Medicine, 2010, Vol. 43 No. 2 pp. 271-275, ISSN 1221-5295. 8. ***Order ANSVSA no.256approving thesanitary veterinary normconcerning veterinary checksinintra-Community tradeanimal products, published in the Official Monitor, number 935 dated 17 November 2006. 9. ***Order ANSVSA no.206 approving the sanitary veterinary norm establishes principles governing the organization of veterinary checkson products entering the Community from third countries, published in the Official Monitor, number 752 dated 4 September 2006.

107

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

IDENTIFICATION OF PLANT EXTRACTS AS POTENTIAL ALTERNATIVE THERAPEUTIC MEANS FOR DAIRY COWS DIAGNOSED WITH SUBCLINICAL MASTITIS

R.M. GIUPANĂ1 , ANAMARIA IOANA PAŞTIU2, MIHAELA NICULAE2, EMOKE PALL2, CARMEN DANA ŞANDRU2, C. GH. CERBU2, S. GURANDA2, V. HERMAN1, MARINA SPÎNU2

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine Cluj-Napoca, Romania E-mail: [email protected]

Summary

Since bovine mastitis is an economically impacting disease of dairy animals worldwide, majority of the investigations focused on defining epidemiological indicators and also control measures. As part of the control programs, the most popular therapeutic measures in clinical and subclinical mastitis in dairy cattle is the antibiotic treatment, less and less efficient under the pressure of increasing antibiotic resistance of inducing bacteria. The aim of this study was to search for the alternative therapeutic potential of plant extracts such as Calendula officinalis, Echinacea angustifolia, E. purpurea, Hippophae rhamnoides, Urtica dioica, Allium sativum, Salvia officinalis, Mentha piperita) found on most of the Romanian pastures. The research was carried out on a group of 27 dairy cows, divided in two groups, healthy (n=10) and diagnosed with subclinical mastitis (n=17). Blood samples collected by puncturing the jugular vein were diluted with RPMI 1640 (1:4) and dispensed in 96-well plates. Duplicates of alcoholic vegetal extract treated variants (1.5 l/well) were compared to cultures treated with PHA and LPS standard mitogens (1.0 l/well). Glucose concentrations were measured by means of an orto-toluidine colorimetric test and stimulation indices (SI%) were calculated. The spontaneous SI was lower in the subclinical mastitis group (48.03+10.23) than in the healthy animals‘ group (53.44+9.34). There was no increase of SI in mastitic cows under the influence of plant extracts, that acted inhibiting (SI% from 17.54+13.97 to 39.90+7.89), when compared with the spontaneous (SI% 48.03+10.23) and alcohol induced (SI% 40.06+8.57) ones and the effects obtained in healthy animals (SI% garlic extract 56.71+12.91, SI% sage 58.26+12.31, SI% mint 54.60+15.97). The results indicated that the plant extracts used according to the described protocol failed to restore the in vitro cell-mediated immune response, suggesting the continuation of the research to establish the adequate dosage for these extracts. Key words: plant extracts, subclinical bovine mastitis, alternative therapy

Disorders such as mastitis, associated with an animal‘s inability to cope with the demands of high production also have an economic impact, leading to early culling, especially in intensively raised animals (5). The incidence of

108

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA subclinical mastitis continues to represent one of the most important disease of dairy cows and its prevalence in dairy herds remains at the forefront at international scale (12). Environmental and various genetic factors can compromise the host‘s defense mechanisms during the functional transitions of the mammary gland (13). During the bacterial infection, the local immune response is fundamental in effectively designing therapies and control measures to help eradicate bovine mastitis (10). In spite of being moderately efficient, antibiotic therapy of established mammary infection is the only proven method for the treatment of mastitis (1). In many developing countries, a large section of population relies on traditional system of medicines derived from medicinal and aromatic plants to meet not only their own healthcare needs but also those of their livestock. Traditional medicine has existed since pre-historic times and flourishes today as the primary form of human and animal medicine for perhaps as much as 80% of the world's population (11).

Materials and methods

The animals subjected to the present research were dairy cows of Romanian spotted breed and its crosses, from a dairy farm, hosting 342 animals and providing milk for local consumption. Leukocyte blast transformation test In order to observe bovine lymphocyte proliferative response of different plant extracts consecutive to stimulation, the blast transformation test was used according to the protocol proposed by Spinu et al., (14). Blood samples were colected by puncturing the jugular vein from animals diagnosed with subclincal mastitis (n=17) and healthy cows (n=10). The leukocyte blast transformation test measures the in vitro reactivity of mononuclear cells to sensitizing antigens or mitogens. Cell growth was quantified by means of the glucose consumption technique. Part of the blood sample (1·ml) was diluted with four times the amount of RPMI 1640. The mixture was distributed in the wells of a sterile 96-well plate (200·l per well). Twelve variants were tested in duplicate for each individual, namely (1) untreated control culture, (2) phytohaemagglutinin-M (PHA) (1·μl per well) treated culture, (3) LPS treated culture (1·μl per well), (4) 70% alcohol treated culture (2.5·μl per well) (5 to12) alcoholic extracts of Calendula officinalis, Echinacea angustifolia, E. purpurea, Hippophae rhamnoides, Urtica dioica, Allium sativum, Salvia officinalis, Mentha piperita (2.5·μl per well) treated cultures. The quantities of both PHA and alcoholic extracts were established when using the same technique during preliminary studies as being the most effective in vitro for the tested species. The cultures were incubated for 72·h at 37.5°C in a 5% CO2 atmosphere. Glucose concentrations were measured in the initial culture medium and in all variants at the end of the incubation period, using a standard (100·mg/dl– 1) glucose solution, by means of an orto-toluidine colorimetric test. For this, 12.5·l of the cultural supernatant were transferred to 0.5·ml of orto-toluidine reagent,

109

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA boiled for 8·min, cooled suddenly in cold water and read in a spectrophotometer (SUMAL PE2, Karl Zeiss, Jena) at a wavelength of 610·nm, using the reagent as a blank. The stimulation index (SI) was calculated as follows: SI%=[(MG– SG)/MG]x100, where SI=blast stimulation index, MG=glucose concentration in the initial culture medium and SG=glucose concentration in the sample after incubation.

Results and discussions

Resistance to diseases is a multigenic trait governed mainly by the immune system and its interactions with many physiologic and environmental factors (9). The interaction of disease resistance with production characteristics and the environment is crucial, and therefore thorough studies aim to find ways to clarify the mechanisms and means of control. Vegetal extracts could be easy-to-obtain, biologically available help in this direction. A number of immunomodulatory effects have been attributed to the medicinal plants, however, little is known about whether treatment with these plants can enhance local antigen-specific immunity. Nevertheless, there are investigations that pointed out that the Echinacea treatment significantly increased the primary and secondary IgG responses to the antigen, which could suggest a potential enhancement by increased immunoglobulin production (4, 6). In this context the stimulation of the oxidative burst as well as the modulation on monokine secretion were reviewed (Attele et al., 1999). Polysaccharide fractions with variable molecular weights were obtained from aqueous or alcaline-water extracts of Calendula officinalis L. which, according to the granulocytes- and carbon clearance tests, showed significant immune stimulating activities (8). Nevertheless, the influence of vegetal extracts on the immune system are contradictory, under various conditions, no effects on the immune system being found by use of the carbon clearance test (7). The aim of the study was that of establishing the role played by Calendula officinalis and Echinacea angustifolia extracts, containing mainly carotenoids, in the augmentation of the immune response to Newcastle disease virus in primed hens.The aim of this study was to search for the alternative therapeutic potential of plant extracts such as Calendula officinalis, Echinacea angustifolia, E. purpurea, Hippophae rhamnoides, Urtica dioica, Allium sativum, Salvia officinalis, Mentha piperita) found on most of the Romanian pastures. These herbal products, especially Calendula officinalis extract was found to possess significant anti- inflammatory activity (2) while Echinaceea angustifolia was mentioned in literature for its intense immune modulating potential. Similarly, the methanol extract of C. officinalis exhibited antibacterial activity and both the methanol and the ethanol extracts showed antifungal activities (3). Leukocyte blast transformation test which is based on the use of mitogens such as phytohemagglutinin (PHA), concanavalin A (Con A) and the pokeweedmitogen (PWM) stimulate transformation and mitosis of lymphocytes.

110

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Some of those mitogenic substances like PHA M (obtained from Phaseolus vulgari) and concanavalin A (produced by Canavalia ensiformis) stimulate only T lymphocytes, while pokeweed mitogen (PWM, lyophilized crude extract of Phytolakka americana) activates both T and B lymphocytes. was used, allowing to establish of stimulation indices based on the values of residual glucose values for each sample and experimental variant.

Table 1 Stimulation index -Leukocyte blast transformation test

Cont E. rol PHA LPS Alc. C.o. E. a. p. H.r. U.d. A.s. S.o. M.p. Stimulation index in the subclinical mastitis group

X 48.03 44.56 45.81 40.06 17.54 39.05 37.3 37.97 37.7 39.90 36.63 37.68 stdev 10.23 10.10 8.92 8.57 13.97 14.78 10.97 7.85 7.13 7.89 9.12 11.03 Stimulation index in the healthy animals group

X 53.44 57.31 50.81 46.64 47.59 49.42 34.6 35.44 53.3 56.71 58.26 54.60 stdev 9.34 7.43 6.32 11.68 9.32 7.24 10.68 12.53 9.86 12.91 12.31 15.97 Legend: PHA – phytohemagglutinin, LPS – Lipopolysaccharides, Alc.-Alcohol, C.o. – Calendula officinalis alcoholic extract, E.a.- Echinacea angustifolia alcoholic extract, E.p.- Echinacea purpurea alcoholic extract, H.r.- Hippophae rhamnoides alcoholic extract, U.d- Urtica dioica alcoholic extract, A.s- Allium sativum alcoholic extract,S.o.- Salvia officinalis alcoholic extract,M.p.- Mentha piperita alcoholic extract.

The results obtained, shown as the mean value plus/minus the standard error, highlight the immunomodulatory potential of plant extracts tested individually and compared with the untreated control culture and 70% alcohol treated culture. These values were lower in animals suffering of subclinical mastitis versus healthy cows. It can be observed that under the influence of plant extracts there was no increase of SI in mastitic cows, most of them acting as inhibitors of blast transformation, compared with the spontaneous and alcohol induced stimulation indices. There was a difference in biological activities between the extracts in healthy versus diseased animals, standing for the modulating effect of the extracts. Thus, while all the used extracts acted inhibiting in diseased animals, with the lowest values obtained for Calendula officinalis, known as an immunologically active extract with enhancing effects in the blast transformation test in other species (9). The garlic, sage and mint extracts acted stimulating as compared to both controls (unstimulated and alcohol stimulated cultures) in healthy animals.

111

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

These results suggest that some of the plants ingested on the pasture could exert their beneficial effects on stimulating the systemic immunity in these animals as oposed to the diseased ones. This effect could be atributed to the active principles extracted by the alcohol from this plants. The therapeutic use of such extracts should also be investigated by local use, but could be limited because of the aromatic smell of all three plants.

Conclusions

The results indicated that the plant extracts used according to the described protocol failed to restore the in vitro cell-mediated immune response, suggesting the continuation of the research to establish the adequate dosage for these extracts.

References

1. Daley, M., Hayes, P. Cornell Vet ,1992, 82,1-9 2. Della-loggia, R., Tubaro, A., Sosa, S., Becke R. H., Saar, S. T, Isaac ,D. The role of triperpenoids in the topical antiinflamatory activity of Calendula officinalis flowers. Planta Med., v.60, p.516-520, 1994. 3. Efstratiou, E., Hussain, A.I., Nigam, P.S., Moore, J.E., Ayub, M.A., Rao, J.R.,Antimicrobial activity of Calendula officinalis petal extracts against fungi, as well as Gram-negative and Gram-positive clinical pathogens. Complement Ther Clin Pract, 2012, 18, 173-176. 4. El-Gengaihi, S.E., Shalaby, A.S., Agina, E.A., Hendawy, S.F., Alkylamides of Echinacea sp. purpurea L. as influenced by plant ontogony and fertilization. J Herb Spices Med Plant, 1998, 5, 35–41. 5. Goff, J. P., Major Advances in Our Understanding of Nutritional Influences on Bovine Health, J. Dairy Sci., 2006, 89, 1292–1301. 6. Kaufman, P.B., Cseke, L.J., Warber, S., Duke, J.A., Brielmann, H.L.,Natural Products from Plants. CRC Press, Boca Raton, FL, 1999. 7. Larsson, A., Balow, R.M., Lindhal, T.L., Forsberg, P.O., Chicken antibodies: taking advantage of evolution, Poultry Sci., 1993, 72 (10), 1807-12. 8. Mashaly, M.M., Heetkamp, M.J., Parmentier, H.K., Schrama, J.W., Influence of genetic selection for antibody production against sheep blood cells on energy metabolism in laying hens, Poult Sci., 2000, 79(4), 519-24. 9. Masteller, E.L., Thompson C.B., B cell development in chicken, Poultry Sci., 1994, 73(7), 998-1011 10. Oviedo-Boyso, J., Valdez-Alarcón, J.J., Cajero-Juárez, M., Ochoa- Zarzosa, A., López-Meza, J.E., Bravo-Patiño, A., Baizabal-Aguirre, V.M., Innate immune response of bovine mammary gland to pathogenic bacteria responsible for mastitis, J. Infect., 2007, 54(4), 399-409.

112

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

11. Palaniswamy, M., Pradeep, B.V., Sathya, R., Angayarkanni, J., In vitro anti-plasmodial activity of Trigonella foenum–graecum L. ECAM, 2008, 30, 1 - 5. 12. Rainard, P., Riollet, Céline, Innate immunity of the bovine mammary gland Vet. Res. 37, 2006, 369–400. 13. Sordillo, L.M., Factors affecting mammary gland immunity and mastitis susceptibility. Liv. Prod. Sci., 2005, 98, 89-99. 14. Spînu, Marina, Pop, M., Vasiu, C., Brudaşcă, Gh. F., Dobrean, V., Boldizsar E., Dumitru C. ,Effects of adaption stress on lymphocyte blast transformation test in Angora goats, African Small Ruminant Network Newsletter, 1995, 5.

113

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

QUANTIFICATION OF NONSPECIFIC IMMUNE SYSTEM MEDIATORS IN A POPULATION OF DAIRY COWS PREVIOUSLY DIAGNOSED WITH SUBCLINICAL MASTITIS

R.M. GIUPANĂ1 , ANAMARIA IOANA PAŞTIU2, MIHAELA NICULAE2, EMOKE PALL2, CARMEN DANA ŞANDRU2, A. VASIU2, C.GH. CERBU2, V. HERMAN1, MARINA SPÎNU2

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Veterinary Medicine E-mail: [email protected]

Summary

Bovine mastitis is one of the most important causes of economic loss in dairy industry with a severe human health impact. The bacterial etiology of mastitis exerts its impact on both the local and systemic immune effectors, thus quantification of the immune status of the animals can help in predicting the outcome of the disease. The investigations aimed to monitor the changes in nonspecific systemic humoral and cell-mediated immunity in Romanian Spotted and Holstein animals, aged 3 to 8 years, diagnosed with sublinical mastitis, by the use of precipitation techniques to quantify circulating immune complexes and total immunoglobulins levels from whey. Furthermore, the neutrophile/lymphocyte ratios were used to estimate the stress levels in the diseased animals and the carbon particle inclusion test to monitor the phagocytosis. The study revealed lower values of circulating immune complexes in whey of mastitic cows (0.002±0.010 optical density units, ODU) when compared with the healthy ones (0.004±0.027 ODU), while the total IgG levels were reversed (0.36±0.13 and 0.29±0.13 ODU, respectively). Stress index (N/L) values and phagocytosis were significantly higher in mastitic animals when compared to the healthy ones (N/L 1.24±0.69 and 0.48±0.15, p<0.05 and phagocytosis 1.78±0.21 and 0.44±0.23, p<0.01). The results indicated a higher clearance of the immune complexes, higher levels of stress and phagocytosis in cows with subclinical mastitis, suggesting the strong involvement of both non-specific humoral and cell-mediated systemic immunity despite the subclinical course of the disease. Key words: dairy cows, subclinical mastitis, circulating immune complexes, total immunoglobulins, N/L index

Mastitis is the most common and economically significant disease affecting dairy cattle. Mastitis is a multi-pathogenic condition of mammary gland affecting dairy cows and remains the most economically impacting disease of dairy industries around the world. It is characterized by physical, chemical and microbiological changes in the milk and pathological changes in the glandular tissues of the udder.(9) Intramammary infections (IMI) result in a typical

114

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA inflammatory response characterized by an influx of somatic cells composed primarily of neutrophils accompanied by variable numbers of macrophages and lymphocytes (11). Immune defense mechanisms can be divided into innate and acquired ones. The innate immunity, also known as non-specific immunity, is the predominant defense during early stages of the infection. As part of the innate immune system, physical barriers of the udder, including teat skin and teat sphincter muscle work together to prevent bacterial penetration. Another protective factor on the teats is the keratin plug, which is secreted by cells that border the teat. This substance has bactericidal properties, and also entraps bacteria and prevents their upward movement into the mammary gland decreasing the chance of intramammary infections, consequently decreasing somatic cell count (SCC) (7).

Materials and methods

The research was carried out on a group of animals of Romanian Spotted and Holstein breeds, aged 3 to 8 years, previously diagnosed with subclinical mastitis. The investigations aimed to monitor the changes in nonspecific systemic humoral and cell-mediated immunity, by the use of precipitation techniques to quantify circulating immune complexes and total immunoglobulin levels from whey. Polyethylene glycol even in low concentrations precipitates circulating immune complexes, and the method can be successfully used at concentrations of 4.2% of PEG, dissolved in borate buffer, pH=8.4 (1, 5). The micro method consisted of mixing in 3.3 μl of the whey samples with 196.7 μl borate buffer and PEG solution, respectively, in flat bottom plates. Afterwards, the plates were subjected to a gentle shaking on an electric stirrer, incubated at room temperature for 60 minutes, the optical density in each well being measured spectrophotometrically (λ=450nm, d=0.5 cm). The CIC concentrations were calculated by the difference in optical densities between the variants treated with borate buffer and PEG, respectively. To quantify total immunoglobulins levels from whey a precipitation method was used based on capacity of 24%o zinc sulphate (Serb reagent) to react with gammaglobulins (5). 6.6μl of whey were mixed with 193.3 μl of the reagent, and shaken on an electric stirrer for 30 minutes at room temperature The optical density was measured by a spectrophotometer at a wave length of λ=475nm, d=0.5 towards the blank (Serb reagent). The values can be read and converted in Vermes degrees by multiplying the optical density 100 times. Blood smears were stained with the panoptic methods and the cell populations were counted and their percentages calculated. The neutrophile/lymphocyte ratios were used to estimate the stress levels in the diseased animals (8). The carbon particle inclusion test was used to monitor the phagocytosis (12). 0.5·ml aliquots of heparinized blood were mixed with 2·l of supernatant of India ink, which were obtained by centrifugation at 6000 rpm for 40·min. After 30 and 45 min of incubation at 37C, respectivel, 0.15 ml of the mixture were transferred to 2 ml of saline each. All tubes containing saline, blood and ink were centrifuged at 1500 rpm and the supernatants were read

115

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA spectrophotometrically (λ=535·nm, d=1·cm). There was a decrease in absorbance with time as carbon was phagocytized. Phagocytic activity index was calculated as the difference between the natural logarithms of the optical densities of the phagocytosis at 0–30·min and 30–45·min.

Results and discussions

The immune system is responsible for recognizing, resisting, and eliminating health challenges, including pathogens, injuries, parasites, stress and the immune system should react and work fast when necessary so the productive functions of the animal are not impaired. Therefore, a competent immune system is fundamental for optimal cattle performance (2).There are two fundamentally different types of responses to invading microbes. Innate (natural) responses occur to the same extent however many times the infectious agent is encountered, whereas acquired (adaptive) responses improve on repeated exposure to a given infection. The innate responses use phagocytic cells (neutrophils, monocytes, and macrophages), cells that release inflammatory mediators (basophils, mast cells, and eosinophils), and natural killer cells (4). The changes in nonspecific systemic humoral and cell-mediated immunity in Romanian Spotted and Holstein animals have been observed by the use of humoral immunity and cell-mediated immunity techniques. Measurement of the level of circulating immune complexes (CIC) allowed evaluation of the molecular clearance capacity at a particular moment. Thus, the study revealed lower values of circulating immune complexes in whey of mastitic cows when compared with the healthy ones.

Table 1 Comparative values of circulating immune complexes in healthy and mastitic animals Values of circulating immune complexes in whey of healthy cows Sample no. TB PEG CIC med 0.013 0.017 0.004 stdev 0.022 0.012 0.027 Values of circulating immune complexes in whey of mastitic cows Sample no. TB PEG CIC med 0.015 0.017 0.002 stdev 0.009 0.015 0.010

Formation of circulating immune complexes is a way that the body agrees to use for the removal of biotic aggressors acting against it. The immune complexes also play an important role in complement activation, increasing the 116

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA purging capacity of the microorganisms (3). If these immune complexes do not exceed the physiological formation speed limit, they are eliminated and did not induce changes. Otherwise, by being deposited in the membranes they lead to complement activation, from this resulting other mediators and the corresponding autoimmune damage (due to immune complexes)(12).The determination of immune complexes concentration becomes important in the context of immunological investigation. Thereby, the determination of circulating immune complexes reflects the physiological purging capacity. Immune complexes are formed by recognizing and coupling the antibodies with the antigens (6). The formation of these aggregates is controlled on one hand by the titer of antibodies in biological fluids, the avidity of specific receptors and the purging rate of the formed complexes (14). Values obtained from animals with subclinical mastitis slightly exceed the values obtained from healthy animals, so that the determined parameter was not considered meaningful in shaping the immunological profile of subclinical mastitis. The results of the tests lead us to conclude that CICs are influenced by the growth system, the stress induced by the agglomeration of animals, microclimate and care conditions, which increase the purging rate of immune complexes. Thus, the local protection of the mammary gland can be reduced by consumption of the opsonins present at the epithelial level in the reaction of complexing.

Table 2 The total IgG levels mastitic (m)/healthy (h) cows Mastitic / Healthy Ig UDO(m) Ig UDO(h) med 0.36 0.29 stdev 0.13 0.13

Serum levels of immunoglobulin is an indicator of the reactivity of the humoral immunity. Going through changes in one way or another indicates either the initiation of an immune response or the presence of some pathological conditions accompanied by immunoglobulin hyperproduction or pathological processes accompanied by immunological reactivity or a reduced activity under the influence of external or internal factors (14).The study revealed that the total IgG levels were reversed compared with values of circulating immune complexes (13). Antibody synthesis response is followed most often by changes of total immunoglobulins concentration. The immunoglobulin level is conditioned not only by plasma cell synthesis, but also by their consumption, practically by immune complex formation rate. (6, 15). It could be observed in the present study that although differences between the two tested animal categories were not statistically significant, serum levels of immunoglobulins in mastitic animals were close to the physiological levels. The presence in the same shelter of several species, each with its own microbiota, poor hygiene leads to increased levels of bacteria which

117

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA induce an increase in total immunoglobulin concentrations by systematic stimulation.

Table 3 Stress index (N/L) values in healthy versus mastitic cows Stress index (N/L) values in mastitic cows

N/L Sample no. Neutrophils% Lymphocytes%

Media 40.19 37.94 1.24 Stdev 10.62 12.02 0.69 Stress index (N/L) values in healthy cows Media 30.17 59.33 0.48 Stdev 16.06 15.04 0.15

The neutrophil/lymphocyte ratios were used to estimate the stress levels in the diseased animals. The stress index (N/L) values were significantly higher in mastitic animals when compared to the healthy ones. Assessing leukocyte subpopulations values obtained from animals of experimental groups comparatively with the physiological values (neutrophils from 15.0 to 47.0% 2.0 to 20.0% eosinophils, basophils 0.0-2.0% 45.0 to 75.0% lymphocytes, monocytes, 2.0 or 7.0%) it could be seen that excepting the lymphocyte subpopulation, the others are stayed within normal values (5). A decrease of lymphocytes could be observed that could be attributed to stressor effects of infection, although it has a subclinical character. The N/L ratio for the mastitis cows was significantly increased (x = 1.24, p <0.05).The results suggest the importance of N/L indicator for estimating the stress degree induced by the infection. Its correlation with the cellular immune response profile can be used to assess the ability of the adaptive immune response to the antigens present in the habitat. Phagocytosis is defined as the ingestion by cells of large (≥0.5-μm) particles. Foreign bodies such as bacteria or fungi can be cleared from infection sites by professional phagocytes such as neutrophils, macrophages, and dendritic cells. Phagocytosis thereby contributes to the first line of defense against infection. It also plays a key role in the initiation of the adaptive immune response (10).

118

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig.1. Phagocytosis in the two experimental groups, healthy and mastitic cows (ln)

The phagocytosis values were significantly higher in mastitic (1.78±0.21) animals when compared to the healthy ones (0.44±0.23, p<0.01).Functional tests could detect if neutrophilic deficits secondary disturbances occurring at different stages of phagocytosis: chemotaxis, interaction with opsonized particles, ingestion, developing inhaled, destruction and digesting microorganisms. All functions depend on the integrity of membrane receptors so that their identification by applying monoclonal antibodies can be very useful. In view of the fact that the minimum optical density of the supernatants (the minimum turbidity) indicates a maximum phagocytic the carbon particles, the relative values should be interpreted in inverse proportion to the value read by spectrophotometry. The cells of the nonspecific immune system could thus be functionally monitored and direct reactive potential during microbial aggression could be quantified.

Conclusions

The results indicated a higher clearance of immune complexes and higher levels of stress in Romanian Spotted and Holstein animals as well as changes in the nonspecific systemic humoral and cell-mediated immunity, in spite of the subclinical type of the disease. These results also suggested the strong involvement of the phagocytosis in cows with subclinical mastitis.

119

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

References

1. A. Latifynia, Vojgani, M., Abofazeli, T., Jafarieh, H., Department of Immunology, School of Medicine, *Medical student, Faculty of Medicine, Medical Sciences/ University of Tehran, J Ayub Med Coll Abbottabad, 2007, 19(2). 2. Abbas, A. K., Lichtman, A. H., Cellular and Molecular Immunology, 6th edition. Saunders, Philadelphia, PA. 2007. 3. Bajaj, G., Rattan, A., Ahmad, P., Circulating immune complexes in tuberculosis-an indicator of activity. Indian Journal of Pediatrics. 1990, 57(2):203-7. 4. Delves, P. J. , Roitt, I., The immune system: first of two parts. New England Journal of Medicine, 2000, 343 (1). pp. 37-49. ISSN 0028-4793. 5. Ghergariu, S., Pop, A., Kadar, L., Spînu, M., Manual de laborator clinic veterinar, Ed. All, Bucureşti, 2000. 6. Goldsbi, R. A., Kindt, T. J., Osborne, B. A., Immunology, fourth ed. W. H. Freeman and Comp. New York, 2001. 7. Kellog, D.W., Tomlinson, D.J., Socha, M.T., Johnson, A.B., Effects of zinc methionine complex on milk production and somatic cell count of dairy cows: twelve-trial summary. 2004, Prof. Anim. Sci. 20, 295-3. 8. Ognean, L., Cernea, Cristina, „Aplicaţii practice de fiziologie medical- veterinară‖ Editura 9. Patnaik, S., Prasad, A., Ganguly,S., Mastitis, an infection of cattle udder: A Review. J. Chem. Biol. Physical Sci., 2013a Sec-B. 3(4), 2676-8. 10. R. S. Flannagan, Jaumouill´e, V., Grinstein, S., The Cell Biology of Phagocytosis Annu. Rev. Pathol. Mech. Dis. 2012, 7, 61–98. 11. Rainard P., Céline Riollet, Mobilization of neutrophils and defense of the bovine mammary gland.Reprod Nutr Dev. 2003, 43(5), 439-57. 12. Rindt, Iulia Krisztina, Evaluarea calitatilor terapeutice si imunostimulatoare ale unor produse apicole,Teza de doctorat, Facultatea de Medicina Veterinară Cluj Napoca,2011 13. Rindt, Iulia, Şandru, Carmen Dana, Brudaşcă, Gh. F., Niculae, Mihaela, Cadar, D., Ungvari, A., Spînu, Marina, Antibacterial Activity of Different Propolis Concentrations Against Staphylococcus Aureus Stains Isolated from bovine Mastitis, Lucrări ştiinţifice Medicină veterinară, Iaşi, 2009, 52, 1096-1098. 14. Roitt, I. M., Delves P. J., Essential Immunology, Blackwell Science, USA, 2001. 15. Turner, R. J., Immunology a comparative approach, Ed. Kohn Wiley Sons, Chichester, 1994.

120

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

ANTIBIOTIC RESISTANCE - AN OVERVIEW OF HORIZONTAL GENE TRANSFER MECHANISMS

S. GURANDA, ELENA MARIAN, MARINA SPÎNU

University of Agricultural Sciences and Veterinary Medicine, 400372, Mănăştur Street 3 -5, Cluj-Napoca, Romania, phone +40-264-596.384, fax +40-264-593.792, E-mail: [email protected]

Summary

Antimicrobial agents are indispensable in the control of bacterial infections in humans, animals and plants. During the past decade, antibiotic microbial resistance (AMR) has become a world-wide problem in both human and veterinary medicine. WHO warns on the dawns of a post-antibiotic era. It is generally accepted that extensive and often irrational use of antibiotics represents the main risk factor for the augmenting antibiotic resistance. Under selective pressure imposed by the use of antimicrobial agents, bacteria, having developed resistance mechanisms, can multiply and expand, while the rest of bacteria are inhibited or destroyed. The resistance genes could be passed from one bacterium to another by horizontal gene transfer (HGT). The donors and the recipients can belong to different bacterial species and genera, located in various ecosystems, human and/or animal hosts, situation reflected by the „One Health‖ concept. Nowadays, a shift in perception on the traditional paradigm of antibiotics and AMR is emerging. Antibiotics are beginning to be perceived as inter-microbial signaling agents and even as sources of nutrition to microorganisms, rather than means to fight the pathogens. The present review focuses mostly on the mechanisms of antibiotic resistance and horizontal gene transfer. Key words: Antibiotics, resistance, resistome, horizontal gene transfer.

The history of mankind was marked by a fierce struggle against infectious diseases. In spite of the progress made by science, infections were still the leading cause of death at the beginning of the 20th century. The discovery of penicillin by Alexander Fleming (1929) and the first introduction of the sulpha drugs by Domagk (1932) seemed to have opened a ―golden era‖ of antibiotics which peaked between 1940 and 1970 (15, 18). Due to the remarkable ability of bacteria to adapt to adverse environmental conditions, which is an example of the ancient law of nature of „survival of the fittest‖, the hope to have absolute control over infections proved to be only a dream, since the infectious diseases are still the second-leading cause of death worldwide (over 13 million deaths/year). Antibiotic microbial resistance (AMR) is already a world-wide problem not only in human, but also in veterinary medicine. The WHO Antimicrobial resistance global report (April 2014) warns on the dawns of a „post-antibiotic era‖ (18, 26). Given the fact that bacteria are rapidly growing organisms, the extensive and often irrational use of antibiotics put the bacteria under a constant selective pressure which in the end resulted in increased antibiotic resistance, due to various mechanisms, such as genetic mutations and horizontal gene transfer (HGT). Since the 121

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA donors and the recipients of HGT can belong to different bacterial species and genera, located in various ecosystems, the result is a dramatically increase of antibiotic (AR), which affects not only animals, but humans as well – a situation reflected in the „One Health‖ concept (9). New studies seem to support a paradigm shift from the traditional idea that antibiotics are merely weapons for fighting bacteria, to a new concept according to which antibiotics are also seen as signaling molecules that may regulate the homeostasis of microbial communities and even as sources of nutrition to microorganisms (9, 10). In our review we will focus mostly on the mechanisms of antibiotic resistance and horizontal gene transfer. 2 Antibiotics between efficacy and inefficacy Antibiotics or antibacterials are a type of antimicrobial agents used specifically against bacteria, for the treatment of bacterial infections. Their mechanisms of action are either to inhibit the growth of bacteria, or to kill the bacteria. Although antibiotics may show to be effective against a number of fungi or even protozoan, they are not effective against viruses and may even be harmful when taken inappropriately. Some antibiotics can even be toxic to humans and animals, even when given in therapeutic doses. Their toxicity level also depends on the health of internal organs, especially the liver which is directly involved in drug metabolism. The term ―antibiotic‖ reflects our anthropocentric viewpoint, since ―antibiosis‖, means ―against life‖ – a term introduced by the French bacteriologist Jean Paul Vuillemin (1889), who wanted to describe the capacity of antibacterial compounds to destroy microorganisms (13). Louis Pasteur and Robert Koch first described such a phenomenon in 1877 when they observed that an airborne bacillus could inhibit the growth of Bacillus anthracis (14). Later, in 1942, the American microbiologist Selman Waksman named these medicines antibiotics, the term reflecting the outcome of laboratory tests (2, 24). While in natural environment there are numerous low molecular compounds that in high concentrations could have an antibiotic effect, it is unlikely that in nature such substances could reach inhibitory concentrations. This led to the idea that their primary role is mostly not cross-species warfare, but cell to cell communication. The discovery of quorum sensing, which is a system of stimuli and response correlated to population density, was the cause for such change in the viewpoint regarding antibiotics. Quorum sensing is used by species of bacteria to coordinate gene expression according to the density of their local population (6). Studies have shown that subinhibitory concentrations of various antibiotic classes exert specific effects on the transcription of particular genes: genes for protein synthesis, carbohydrate metabolism, transport proteins (7, 16). There are also other mechanisms, such as competition for food, that regulate the development of mixed microbes, as Louis Pasteur, known as „the father of microbiology‖, observed: „if we could intervene in the antagonism observed between some bacteria, it would offer perhaps the greatest hopes for therapeutics‖ (12).

122

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

As shown in figure 1, after the dark ages of the preantibiotic era when infectious disease were the major of death, the sulfonamides opened the advent of chemotherapy. Quite soon after the discovery of peniciline, the penicilinase – an enzyme that prevents the action of penicillin – was discovered and again sounded the alarm that the antibiotics are not panacea. With the discovery of the antibiotic resistance plasmids, the golden years of antibioterapy, when most of the antibiotics were discovered, came to an end. The so called lean years, characterized by the lowest rates of antibiotic discovery, were also marked by an advancement of research in the area of biochemistry of antibiotic resistance, and pharmacologic attempts to understand and improve the rational use of antibiotics by dosing, administration, etc.

Fig. 1 History of antibiotic discovery and concomitant development of antibiotic resistance (adapted from Davies et al., 2010)

Efforts were made to use chemical modification of new synthesis antibiotics to avoid resistance, so that target, mode-of-action and genetic studies directed the efforts to design new antibiotic compounds. Still the evidences showed a continuously increasing antibiotic resistance, toward all class of antibiotics. In the U.S. an important milestone was the creation of the FDA Office of New Drugs which established stricter requirements for drug safety, including the use of antibiotics, after the sedative thalidomide was withdrawn from the market after thousands of mothers have born children with malformations. With the failure of the enormous investment in genome-based methods, discovery of new antibiotics programs continued, and an increasing accent on personal hygiene was put, as a prevention method for the transmission of infections, as the early pioneer of 123

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA antiseptic procedures, Ignaz Philipp Semmelweis has already recommended as early as in 1861. In its report ―Antimicrobial resistance: global report on surveillance 2014‖ World Health Organisation not only warned on the dawns of a post-antibiotic era, but provided accurate statistical data about the spread of resistance toward all classes of antibiotics. The conclusions are worrying: numerous bacterial pathogens, associated with epidemics of human and animal infectious diseases have evolved into multidrug-resistant (MDR) forms subsequent to antibiotic use (1, 16, 28). The mechanisms in which the antibiotics act against pathogens were extensively studied and taking in consideration in the synthesis of new compounds. As shown in figure 2, different classes or types of antibiotics use a certain mechanism to act upon the bacterial agent.

Fig. 2 – Mechanisms of action of antibiotics (adapted from Mărculescu, 2008)

3. Resistance to antimicrobials The oldest account of microbial drug resistance was given by Paul Ehrlich in 1907 when he came to discover such problem soon after he developed the arsenical chemotherapy against trypanosomiasis. Later, with the discovery of sulfonamides and antibiotics, which were brought into medical and veterinary practice, the same phenomenon occurred: resistance against these agents began to emerge. Nowadays the resistance to antibacterial and antimalarial drugs is widespread, while the continual increasing of resistance to antifungal and antiviral drugs also becomes a major concern (5). Bacterial cells may present two types of resistance: intrinsic and acquired resistance. In short, intrinsic antibiotic resistance refers to a cell resistant to antimicrobial agents before being exposed to them, while acquired resistance is 124

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA when a cell only becomes resistant to antimicrobials after being exposed to them or after receiving AR genes through HGT (5, 23). 3.1. Intrinsic resistance The intrinsic resistance is a natural capacity which is given by the natural insusceptibility of an organism to an antimicrobial. This passive resistance is supposed to be a consequence of general adaptive processes, but that does not mean it is necessary linked to a given class of antimicrobials, since the same mechanisms could be involved in resistance to different type of antibiotics. The determinant of bacterial response to an antibiotic is the presence or absence of the target for the action of the drug (4, 5, 23). 3.2. Acquired resistance Acquired resistance represents the major mechanism of antimicrobial resistance. This active resistance shows to be the result of a specific evolutionary pressure, in the presence of an antimicrobial, in order to develop at least one mechanism against that particular antimicrobial, which could be useful also toward an entire class of antimicrobials. In this way, bacterial populations that previously showed to be sensitive to antimicrobials, become resistant (27). The loss of sensitivity toward an antimicrobial happens most often in the presence of clinically achievable concentrations of a drug. Once some of the bacteria developed resistance, the antibiotic exerts a selective pressure which favors the resistant microorganisms and destroys the susceptible ones. Bacteria may acquire resistance by a mutation which can be passed vertically by selection to daughter cells or to other bacteria of different species or genera by horizontal transfer of genes responsible for coding the resistance mechanisms. Three are the main factors that influence the frequency of acquired resistance: the dose of antibiotic being used, the frequency of bacterial spontaneous mutations that generate resistance and the prevalence of plasmids that can transfer resistance capacities from one bacterium to another (8). 3.3 Antibiotic resistance – mechanisms and emergence factors The antibiotic resistance was studied extensively, so that now there is known there are five major mechanisms responsible for it: (a) enzymatic degradation or modification of agent, (b) decreased uptake or accumulation of agent, (c) altered target, (d) circumvention of consequences of agent, (e) uncoupling of agent-target interactions or any combination of the above mentioned. Meanwhile, emergence of antibiotic resistance is due to four main factors: (i) emergence of new genes (i.e. MRSA, VRE, VISA/GISA), (ii) spread of old genes to new hosts (i.e. PRGC, GRSA), (iii) mutations of old genes resulting in more potent resistance (i.e. ESBLs), (iv) emergence of intrinsically resistant opportunistic bacteria (i.e. Stenatrophomonas maltophilia). Studies have revealed that drug- resistant organisms genetically differ from the wild types, which led to the idea that spontaneous mutations must be investigated. It followed that these mutations could arise in four ways: damage to the genome caused by adverse environmental factors (ionization radiation, chemical mutagens etc.), base-pairing errors during

125

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

DNA replication, frameshift mutations caused by the deletion of segments of DNA which frequently occur at short DNA repeat sequences, frameshift mutations caused by the intragenic insertion of mobilizable genetic material, such as transposons, which corrupt the correct flow of information from the wild-type genome. In conclusion, the mechanisms that bacteria use in order to acquire antibiotic resistance require either the modification of existing genetic material or the acquisition of new genetic material from an external source (2, 11, 19, 20 25). 3.4 Horizontal gene transfer Various studies showed that bacteria have a remarkable ability to mobilize genes in both chromosomal and plasmid DNA and to transfer and exchange genetic information. Combined epidemiological and bacterial genetic studies gave evidence that antibiotic resistance could be transferred from resistant to sensitive bacteria. This transfer of information is most commonly realized by horizontal gene transfer (HGT) or so called lateral gene transfer. The HGT consists in unidirectional gene exchange (donor to recipient) between cellular organisms – be it related or distantly related – or between a replication competent virus and a bacteria. This information exchange may be accompanied by expression of the new introduced genetic material. The genetic material could be a fraction of the genome (DNA or RNA), most usually a gene or part of a gene. Te genetic material may or may not include coding and/or non-coding sequences (5, 21). HGT differs from other types of gene transfer such as: (a) intentional gene transfer which is the result of direct human intervention; (b) transient gene transfer which is intentionally or unintentionally transfer of genetic material to a recipient organism, that is not perpetuated in the offspring; (c) intragenomic gene transfer which is a transfer of genetic material to a different location in the genome of the same organism (transposition); (d) vertical gene transfer (VGT) which is a transfer of genetic material from parent to offspring by reproduction, be it sexual or asexual. HGT contrasts with intentional gene transfer since does not represent an intentional human intervention. It also contrast with transient gene transfer, since the result of HGT it is shown in the next bacterial generations. HGT contrasts with intragenomic gene transfer, since it transmit genetic information laterally, to other bacterial microorganisms, even to different species or genera. Similarly, HGT contrasts with vertical gene transfer in that it can result in genetic information transfer between distantly related bacteria (21, 22). By HGT the genetic material is translocated into a cell, the result being a stable integration into the recipient‘s genome. Thus, the transferred gene will be perpetuated in the offspring of the recipient organism, a process named vertical gene transfer (VGT) (23). 3.5 Mechanisms of HGT Three are the mechanisms of horizontal gene transfer in bacteria that were identified: transformation, conjugation and transduction (figure 3). Transformation is a process through which the gene is altered by introducing foreign genetic material, respectively only short DNA sequences can be exchanged through this process.

126

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conjugation is a process of genetic material exchange from cell to cell by close contact, which permits long fragments of DNA to be transferred. The genes required for conjugation are usually found on a plasmid DNA, which is a small DNA molecule within bacteria which is physically separated from chromosomal DNA and can replicate independently. The plasmids present mostly as small circular, double- stranded DNA molecules within bacteria. Transduction is a process of DNA transfer one bacterium to another by a bacterial virus, called bacteriophage. Bacteriophages are composed of proteins that encapsulate a DNA or RNA genome. Phages replicate within the bacterium following the injection of their genome into its cytoplasm, by using bacterium's machinery and energy to produce more phage. Finally the bacterium is destroyed and the phage is released to invade surrounding bacteria. A phage can acquire and transport DNA from a bacterium to another one which means that the donor and recipient share the cell surface receptors, namely they must be closely related bacteria. The length of the transferred DNA depends on the size of the bateriophage head (5).

Fig. 3 Three mechanisms of horizontal gene transfer (adapted from http://www.wiley.com/college/pratt/0471393878/instructor/activities/bacterial_drug_resistance/)

The vehicles for information transfer used in HGT are mobile genetic elements (MGEs) such as plasmids, bacteriophages, integrative conjugative elements, transposons (a DNA sequence that can change its position within the genome, sometimes creating or reversing mutations), insertion sequence (IS) elements, integrons (that carry integrase, which allows acquisition or loss of genes by homologous recombination), gene cassettes (that contain a gene and a recombination site) and genomic islands (part of a genome that has evidence of 127

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA horizontal origins). These mobile genetic elements have evolved mechanisms that enhance the potential for gene transfer between organisms (5, 21). 3.5.1 Transformation Natural transformation consists in the uptake of free macromolecular DNA by competent bacteria. Such bacteria are in such a physiological state, genetically programmed, that permits the efficient absorption and integration of DNA into their genome. This DNA can be used as a nutrient source, for DNA repair or for genetic innovation. The DNA fragment can be integrated into the bacterial genome either by recombination or by forming an autonomously replicating element. Studies have shown that high molecular weight free DNA were detected in non-sterile soil and aquatic environment. Researchers suppose that free DNA in soil is released by micro-organisms or decaying plant material and it can serve as a nutrient or as a genetic information reservoir for bacteria in that area. Under laboratory conditions artificially high levels of DNA are added, so that the frequency of transformation of genetic markers can be as high as 10-3, which means one cell in every thousand uptake and integrates a particular gene. Instead, there is not certain method to measure the extend to which transformation occurs in relevant environments (hospitals, public halls, toilettes, intestinal tract etc.) (3, 5, 21, 22). 3.5.2 Transduction Transduction consists in the transfer of a non-viral DNA from an infected host bacterium to a new host via infectious or non-infectious viruses. In the process of production of a phage, part of the host DNA is mistakenly packaged into the empty phage head. The resulting genome of the phage contains up to 10% of the bacterial DNA, meaning that the phage can carry bacterial genes for antibiotic resistance. The defective phage may be release by lysis, extrusion or even by budding (cell division at one particular site), and can be absorbed by new host cells, where the phage delivers the DNA carried in the capsid. The integration of injected bacterial DNA into the recipient genome requires the presence of homologous DNA sequences or specialized integrases (3, 21, 22). 3.5.3 Conjugation Cellular conjugation is mediated by resistance plasmids (R-plasmids) and it is the main mechanism for the spread of antibiotic resistance through Gram- negative populations of bacteria. R-plasmids presents as circular DNA in both closed and nicked forms. It is believed that the closed circular structure is adopted by R-plasmids that do not engage in replication. Bacterial cells that bear an R- plasmid (R+) have the ability to produce sex pili at their surface. If the environment permits donor cells (R+) to come in contact with sensitive receptor (R-) cells, the sex pili mediate the forming of the mating pairs. The receptor cells (R-) get a copy of the R-plasmid and becomes drug-resistant. The receptor cell can in turn conjugate with other cells, spreading the antibiotic resistance rapidly throughout the bacterial population. Even if the conjugation may superficially appear to be a fairly simple phenomenon, in fact it is a highly complex process, which complex exceeds the purpose and the dimension of this article. Bacterial conjugation is somehow

128

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA regarded as the bacterial equivalent of sexual reproduction, due to the exchange of genetic material between bacteria. During conjugation the donor cell provide a plasmid or transposon, as a vehicle for the genetic information being transferred. It is worthwhile to mention that most conjugative plasmids have specific systems ensuring that a similar element is not yet contained by the recipient cell. Gram- negative and Gram-positive bacteria use a diversity of conjugative systems, but the principle is that the pair formation complex (Mpf) is responsible for making the contact between donor and recipient, while DNA transfer and replication system (Dtr) provides the functions for processing of DNA for transport (5, 21). 3.5.4 Other mechanisms of HGT Beside transformation, transduction and conjugation there are other mechanisms of DNA uptake that occur in natural environment. One of those mechanisms is vesicle-mediated translocation, Thus, a range of Gram-negative bacteria (i.e. Neisseria gonorrheae, E. coli and Pseudomonas aeruginosa) can bud off vesicle structures that contain genetic material that can later fuse with another bacterium, giving to the receptor antibiotic resistance capacities inherited from the donor. Another mechanism of HGT involves pseudovirus particles. The pseudoviral particles can infect target cells and express effector or reporter molecules. The virus-like particles can be formed by bacteria that have genes that encode proteins capable of forming such gene transfer agents. These pseudovirus particles can trap random fragments of the genome, which later will be transferred to another bacterium (21). 3.5.5 Factors that affect the transfer of MGEs There are some factors that affect the efficiency of MGEs transfer. In spite of the fact that soil and aquatic environments provide conditions for colonization, mixing and bacterial activity, they offer limited resources for microbial growth that can severely limit bacterial population densities and activity, which, in turn, affects the efficiency of HGT mechanisms. The same is true for phytosphere. On the other side, even if HGT can increase genetic diversity, it can also lead to excessively genetic baggage and the import of deleterious genes. Organisms possess a number of barriers (physical, biochemical and genetic) to restrict the frequency of HGT: the physical integrity of the cell; restriction-modification systems that recognize and hydrolyse foreign gene sequences; sequence specificity for integration into the recipient genome by homologous recombination, natural selection etc. Generally, the efficacy of barriers to HGT increases proportionally with genetic distance between donor and receptor, which explain why the frequency of HGT is much greater within species than between unrelated or distantly related species (9, 22).

Conclusions

Bacterial genomes are open to genetic information exchange, so that there is a chance that any fragment of DNA in a large bacterial population could be

129

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA horizontally transferred to recipients belonging to different bacterial species and genera. Thus, the spread of antibiotic resistance is favored by the mechanisms of horizontal gene transfer. In order to minimize the disastrous effects of the spread of antibiotic resistance, one of the major future directions for researchers would be to further investigate selection in natural microbial habitats of bacteria possessing laterally transferred genetic material and to develop new and more efficient strategies to reduce the impact of antibiotic resistance for animals and humans, in the effort to make the paradigm of ―one world, one health, one medicine‖ become a priority for our society.

References

1. Bertrand, J-C., Caumette, P., Lebaron, P., Matheron, R., Normand, P., Sime-Ngand, T., Environmental Microbiology: Fundamentals and Applications: Microbial Ecology, Springer, New York, 2015. 2. Davies, J., Davies, Dorothy, Origins and evolution of antibiotic resistance, Microbiol. Mol. Biol. Rev., 2010, 74, 417–433. 3. Francino, M.P., editor, Horizontal Gene Transfer in Microorganisms, Caister Academic Press, Norfolk, UK, 2012. 4. Franco, Beatriz Espinosa, Martínez, Marina Altagracia, Sánchez Rodríguez, Martha, Wertheimer, A.I., The determinants of the antibiotic resistance process, Infection and Drug Resistance, 2009, 2 1–11. 5. Franklin, T.J., Snow, G.A., Biochemistry and Molecular Biology of Antimicrobial Drug Action, Springer, New York, 2005. 6. Gillings, M.R., Evolutionary consequences of antibiotic use for the resistome, mobilome, and microbial pangenome, Front Microbiol. 2013, 4, 4. 7. Goh, E.B., Yim, G., Tsui, W., McClure, J., Surette, M.G., Davies, J., Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of antibiotics, Proc. Natl. Acad. Sci. U.S.A. 99, 17025–17030. 8. Greenwood, D., Slack, R., Medical Microbiology, 18th edition, Elsevier Ltd, 2012 https://books.google.ro/books?id=QxaXTjal3-gC&pg=PA77&lpg=PA77 &dq=%22Once+resistance+has+appeared,+the+continuing+presence+of+an +antibiotic+exerts+a+selective+pressure+in+favour+of+the+resistant+organi sms.%22&source=bl&ots=wGpSISZBr3&sig=4RW9gU836Ho_xN5mkX- Y9U6rMIE&hl=ro&sa=X&ei=d-EOVefyMcn3O6_fgJAF&ved=0CB8Q6AEwAA #v=onepage&q=%22Once%20resistance%20has%20appeared%2C%20the %20continuing%20presence%20of%20an%20antibiotic%20exerts%20a%20 selective%20pressure%20in%20favour%20of%20the%20resistant%20organi sms.%22&f=false. 9. Hassan, A.A., Amin M.K., Horizontal Gene Transfer Events among Different Species of Bacteria, J Am Sci, 2010, 6(9). 10. Jayaraman, R., Antibiotic resistance: an overview of mechanisms and a paradigm shift, Current. Science, 2009, Vol. 96, No. 11.

130

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

11. Khan, A.U., Current Trends In Antibiotic Resistance In Infectious Diseases, I.K. International Publishing House Pvt. Ltd, New Dehli, 2009https://books.google.ro/books?id=TjSUQZoG2U0C&pg=PA166&dq=Anti microbial+Drug+Resistance:+Mechanisms+of+Drug+Resistance&hl=ro&sa= X&ei=-a8OVbCfKsH7av6lgCA&ved=0CFYQ6AEwCA#v=onepage&q =Antimicrobial%20Drug%20Resistance%3A%20Mechanisms%20of%20Drug %20Resistance&f=false. 12. Kingston, W., Irish contributions to the origins of antibiotics, Irish journal of medical science, 177 (2), 87–92. 13. Klein, A., Vuillemin, J.P., l‘inventeur nancéien du concept d‘antibiotique, Le Pays Lorrain, 2012, 1, 55-60 14. Landsberg, H., Prelude to the Discovery of Penicillin, Chicago Journals, Vol. 40, No. 3, Aug. 1949 15. Leavitt, J.W., Numbers, R.L., Sickness and Health in America: Readings in the History of Medicine and Public Health, The University of Wisconsin Press, 1997, 105. 16. Lin, J.T., Connelly, M.B., Amolo, C., Otani, S., Yaver, D.S., Global transcriptional response of Bacillus subtilis to treatment with subinhibitory concentrations of antibiotics that inhibit protein synthesis, Antimicrob. Agents Chemother, 49, 1915–1926. 17. Mărculescu, Anca, Antibiotics: Mechanisms of action, USAMV Cluj-Napoca, Veterinary Drug, 2008, year 2, nr. 1, 15-20 18. Marinelli, Flavia, Genilloud, Olga, Antimicrobials: New and Old Molecules in the fight against Multi-resistant Bacteria, Springer, New York, 2014, p.193- 194. 19. Mayers, D.L., Antimicrobial Drug Resistance: Mechanisms of Drug Resistance, Volume 1, Humana Press, New York, 2009https://books.google.ro/books?id=Sh_gmfk6_HgC&printsec=frontcover& dq=Antimicrobial+Drug+Resistance:+Mechanisms+of+Drug+Resistance&hl= ro&sa=X&ei=-a8OVbCfKsH7av6lgCA&ved=0CB8Q6AEwAA#v=onepage&q= Antimicrobial%20Drug%20Resistance%3A%20Mechanisms%20of%20Drug %20Resistance&f=false. 20. Ministry of Health, NSW, Infection Control Policy: Prevention & Management of Multi-Resistant Organisms (MRO), Policy Directive PD2007_084, http://www0.health.nsw.gov.au/policies/pd/2007/pdf/PD 2007_084.pdf. 21. Organisation for Economic Cooperation and Development (OECD), Guidance document on horizontal gene transfer between bacteria, Series on Harmonisation of Regulatory Oversight in Biotechnology, No.50, Paris, 2010 22. Syvanen, M., Kado, C.I., Horizontal Gene Transfer, Academic Press, London, 2002. 23. Todar, K., Todar‘s Online Textbook of Bacteriology, Antibiotic resistance, 2012, http://textbookofbacteriology.net/resantimicrobial.html.

131

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

24. Waksman, S.A., What Is an Antibiotic or an Antibiotic Substance?, Mycologia, 1947, 39 (5): 565–569 25. Wax, R.G., Lewis, Kim , Salyers, Abigail, Tabe, H., Bacterial Resistance to Antimicrobials, Second Edition, CRC Press, Boca Raton, FL, 2008https://books.google.ro/books?id=QSqEWjAptjcC&pg=PA134&dq=Anti microbial+Drug+Resistance:+Mechanisms+of+Drug+Resistance&hl=ro&sa= X&ei=-a8OVbCfKsH7av6lgCA&ved=0CFAQ6AEwBw#v=onepage&q= Antimicrobial%20Drug%20Resistance%3A%20Mechanisms%20of%20Drug %20Resistance&f=false. 26. World Health Organization, Antimicrobial resistance: global report on surveillance 2014, p. IX, http://apps.who.int/iris/bitstream/10665/112642/ 1/9789241564748_eng.pdf. 27. Wright G.D., Bacterial resistance to antibiotics: enzymatic degradation and modification, Adv. Drug Deliv. Rev., 2005, 57, 1451-1470. 28. Yadavendu, V.J., Shifting Paradigms in Public Health: From Holism to Individualism, Springer, New Dehli, 2013.

132

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

AN OVERVIEW OF THE MOLECULAR EPIDEMIOLOGY OF THE MEAT – BORNE PATHOGEN TOXOPLASMA GONDII IN PORK AND WILD BOAR– A MINI REVIEW

K. IMRE, ADRIANA MORAR, J. DÉGI, M.S. ILIE, CLAUDIA SALA

1Banat's University of Agricultural Sciences and Veterinary Medicine from Timişoara, Faculty of Veterinary Medicine, 300645, Aradului Street, no. 119, Timișoara, Romania E-mail: [email protected]

Summary

Toxoplasma gondii is considered one of the most important protozoa with zoonotic character, which can be acquired through consumption of the raw or undercooked meat. In veterinary practice of meat inspection, the presence of the tissue cysts, which if ingested by human consumer produce the diseases namely toxoplasmosis, regularly is not diagnosed. The aim of this work was to review the molecular epidemiology of the meat – borne pathogen Toxoplasma gondii in pig (Sus scrofa domesticus) and wild boar (Sus scrofa), processing twenty PubMed retrieved representative studies carried out over the last 10 years, in different geographical regions of the world. In foreground, the infection prevalence in different countries, and especially the T. gondii isolation rate from seropositive animals, risk factors providing the most reliable and accurate risk assessment for the consumer, isolation source of the pathogen and identified genotypes are presented. This update should be useful for the epidemiologists, public health workers and veterinarians. Key words: prevalence, meat, Toxoplasma, epidemiology, PCR

Background

The worldwide distributed intracellular meat-borne pathogen Toxoplasma gondii is considered one of the most studied protozoa parasite with zoonotic character (7). The disease it causes, namely toxoplasmosis, can be acquired through consumption of the undercooked or raw meat of infected intermediate hosts containing viable parasitic forms (tissue cysts). It is estimated that toxoplasmosis affects nearly one third of the world population (15), with a similar morbidity to that of some major food-borne diseases (salmonellosis, campylobacteriosis). The disease is considered a serious public health problem in immunosuppressed persons and pregnant women without any previous contact, in which the infection can be transmitted to the fetus. The most common consequences of infection include severe encephalitis, schizophrenia and abortion. In congenitally infected fetuses the hydrocephalus, intracranial calcifications and eye disorders, like chorioretinitis or strabismus have been frequently recorded (14). Usually, in immunocompetent persons toxoplasmosis evolving subclinical (7).

133

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The disease diagnosis in humans is based on serum antibodies detection and the parasite DNA quantification in body fluids (aqueous humor, cerebrospinal or amniotic fluid), especially in the acute phase of infection. In husbandry animals the post infectious serum antibody quantification has proved to be the most reliable tools. However, molecular diagnostic techniques based on the parasite DNA identification from meat and derivate products provides the most clear and reliable picture of the risk of infection for the human consumer (7, 12, 18). Domestic swine (Sus scrofa domesticus) together with wild boar (Sus scrofa) containing Toxoplasma tissue cysts, are considered one of the most important sources of human toxoplasma infections (17). The acquiring of infection is strongly related by eating habits and immune status of the consumer (18). Over the last years, several studies investigated the presence of T. gondii in pork and wild boar intended for consumption. In order to provide a complex overview of the molecular epidemiology of meat-borne pathogen T. gondii in pork and wild boar, the current paper process relevant publications from the most important database of the biomedical literature, namely PubMed, with special emphasis on the prevalence values, targeted genes and identified T. gondii genotypes, and risk factors in the acquiring of the infection. In foreground, epidemiological studies conducted at worldwide level and published over the last 10 years are processed. Thus, a total of twenty published articles were selected which, in the authors opinion, represent more than 70% out of the total PubMed available articles dedicated to this topic.

Epidemiological aspects

In Sus scrofa domesticus. A total of 15 published articles providing from different geographical regions were selected. Out of them, six studies were carried out at the European countries level including Ireland (12), Italy (1), Portugal (6; 10), Slovak Republic (18) and Switzerland (2); five investigations were conducted in South and North America in countries like Brazil (3; 8; 17), Mexico (14) and United States of America (9); and other four studies in Asian countries such as China (13; 20; 21) and Japan (19). Most of the studies, beside prevalence values of the pathogen, offer information about genetic structure of T. gondii based on multilocus restriction length polymorphism analysis (RFLP) or multilocus enzyme electrophoresis (18). Generally, a limited number of isolates were genotyped as consequence of seropositive findings. Epidemiological data on the occurrence of the meat-borne pathogen T. gondii in different counties at worldwide level based on molecular tools are summarized in Table 1. At European countries level the recorded prevalence values of T. gondii infection in pork, using molecular techniques, were 2.1% (21/970) in Slovak Republic (18), 2.2% (6/270) in Switzerland (2), 13% (3/23) in Ireland (12), 35.0 (7/20) and 40.5% (15/37) in Portugal (6; 10) and 57.1% (12/21) in Italy (1). Out of them, in only two studies, conducted in Portugal (10) and Slovak Republic (18),

134

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA have reported the presence of risk factors namely, intensive management practice and age. As a first step of the molecular approach, in most of the studies, the highly conserved β actin gene (B1) was the most frequently used polymorph biologic marker in the hemi-nested PCR diagnostic method, which repeat 35 times in the T. gondii genome. The samples of diaphragm, heart, brain or muscle were used as sources for T. gondii DNA isolation. Subsequently, in order to genotype T. gondii isolates, which is the great interest for the human consumer, different genetic markers including various nuclear loci were used: SAG1, 5′SAG2, 3′SAG2, altSAG2, SAG3, BTUB, GRA6, C22-8, C29-2, L358, PK1, APICO. Accordingly, tree clonal types have been described including clonal type I, II and III, respectively. Out of them, the highly virulent clonal type I was found in Italy (1) and as dominant subtype (85.7%) in Slovak Republic (18). Instead, the clonal type II was recorded as unique allele in Switzerland (2), dominant in Portugal (6), and in mixed infection with genotype I in Italy (1). Strains of genotype III were diagnosed in a low percentage in Italy (8.4%) (1) and Portugal (16.7%) (6). Genetic diversity of T. gondii isolates have been intensively studied in Brazil, South-America. The first isolation and molecular characterization of T. gondii was carried out in Brazil 10 years ago in finishing pigs processing heart, brain and tongue samples. RFLP on product of SAG2 locus revealed the presence of genotype I (28.6%) and genotype III (71.4%) (8). In another study conducted by Bezerra et al. (2012) in northeastern of the country, T. gondii was diagnosed in 11 out of 20 pigs intended for human consumption in brain and tongue samples. High genetic diversity of the isolates, with six different genotypes including atypical T. gondii strains were identified, using the amplification of multilocus PCR-RFLP with seven molecular markers (Table 1). The findings suggest the necessity of the development of new molecular markers in order to better group atypical isolates (3). Most recently, Samico-Fernandes et al., (2012) in State of Pernambucano (East of Brazil) demonstrate that slaughtered swine are a potential source of infection for humans. T. gondii DNA was isolated from 21 (55.2%) out of 38 heart samples targeting B1 gene, but no genotyping has been made in this study (17). In South-East of Mexico a total of 218 blood samples (50.8%) out of 429 examined has proved to be T. gondii PCR positive targeting the β actin gene (B1) (14). In this study the manual feeder was considered protective against the presence of T. gondii and farms where the population size was less than 400 individuals was identified a higher risk of infection by T. gondii (14). The prevalence of T. gondii in market pigs raised under certified organic management system has been investigated in two farms in Michigan, U.S.A (9). Hearts of 33 pigs were PCR screened, showing T. gondii positive findings in 17 pigs (51.5%). Subsequently, 16 out of 17 isolates were genetic typing using the SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1 and Apico loci. The results showed the presence of genotype II and genotype III, each in only one farm,

135

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA indicating at the same time, that the consumption of organic pork meat can pose an increased risk of transmitting T. gondii to humans (9). Table 1 Epidemiological data on the occurrence of the meat-borne pathogen T. gondii in different counties at worldwide level based on molecular tools Host County No. of Isolation Targeted Identified Reference (geographic examined/ source gene/region genotypes al region) Toxoplasma (tissue) (genotyping (%) positive /risk factor gene) samples (%prevalence) Sus Brazil (North- 11/20 (55%) brain, tongue 529 bp region six different Bezerra et al., scrofa East) (SAG1, SAG2, genotypes, 2012 domesticus SAG3, BTUB, combinations C22-8, PK1 of type I, II, III and Apico) and u-1 alleles Brazil* 7/28 (25%) heart, brain, SAG2 genotype I dos Santos, et (South – tongue (28.6%) al., 2005 East) genotype III (71.4%) Brazil* 21/38 (55.2%) heart B1 N.S. Samico – (East) Fernandes, et al., 2012 China 25/38 (65.8%) lymphnodes B1 (SAG1, 5′- toxoDB9 Jiang et al., (different SAG2, 3′- (94.1%) 2013 provinces) SAG2, SAG2, toxoDB3 SAG3, BTUB, (5.9%) GRA6, c22-8, c29-2, L358, PK1) China 34/434 (7.8%) lymphnodes B1 (SAG1, genotype I Zhou et al., (Central) SAG2, SAG3, (6.25%) 2010 BTUB, GRA6, genotype II L358, PK1, , (93.5%) c22-8, c-29-2, apico) China 56/412 (13.6%) lymphnodes, SAG3 (SAG1, ToxoDB9 Zhou et al., (South – liver SAG2, BTUB, 2011 West) GRA6, L358, PK1, c22-8, c- 29-2, Apico) Ireland 3/23 (13%) diaphragm N.S. Halová et al., 2013 Italy 12/21 (57.1%) heart 529 bp region genotype I Bacci et al., (North) SAG1, (25%) 2015 5′SAG2, genotype II 3′SAG2, (25%) altSAG2, genotype I/II SAG3, BTUB, (41.6%) GRA6, C22-8, genotype III C29-2, L358, (8.4%) PK1, APICO Japan 33/91 (36.3%) lymphnodes GRA6 genotype I Zakimi et al., (South) (44.8%) 2006 genotype II (48.3%) genotype III (6.9%) Mexico 218/429 blood / herd β actin gene N.S. Ortega- (South-East) (50.8%) size (B1) Pacheco et (<400pigs) al., 2013 Portugal* 7/20 (35%) brain, B1 N.S. Esteves et al., (Central, diaphragm / 2014 136

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

South) intensive management practice Portugal* 15/37 (40.5%) brain, heart SAG2 genotype II de Sousa et (North) (73.3%), al., 2006 genotype III (16.7%) Slovak 21/970 (2.16%) brain, muscle TGR1E, B1 genotype I Turčeková et Republic* / age (sows) (SAG 2, (85.7%), al., 2013 (countrywide ROP1) genotype II level) (14.3%) Switzerland 6/270 (2.2%) diaphragm N.S. (SAG2, genotype II Berger- (Central, SAG3, BTUB, (100%) Schoch et al., North) GRA6, c22-8, 2011 c29-2, L358, PK1, Apico) U.S.A. 17/33 (51.5%) heart SAG1, SAG2, genotype II Dubey et al., (North-East) SAG3, BTUB, (73.3%) 2012 GRA6, c22-8, genotype III c29-2, L358, (16.7%) PK1 and Apico Sus scrofa France* 21/148 (14.2%) heart SAG1, SAG2, genotype II Richomme et (North-East GRA7 (100%) al., 2009 and South TUB2, TgM-A, Island) W35, B17, B18, M33 Italy (North- 17/105 (16.2%) skeletal 529 bp region N.S. Ferroglio et West) muscle al., 2014 Malaysia* 6/30 (20%) brain, heart N.S. (3′SAG2, genotype I Puvanesuaran 5′ SAG2, (100%) et al., 2013 BTUB,cB21-4, GRA1, GRA6, SAG3 SRS1) Spain (South 9/61 (14.7%) brain, heart SAG1, genotype I Calero-Bernal –West) 3′SAG2, 5′ (28.6%) et al., 2015 SAG2, SAG3, genotype II BTUB, GRA6 (28.6%) genotype I+II (42.8%) Switzerland 1/150 (0.7%) diaphragm N. S. (SAG2, N.S. Berger- (Central, SAG3, BTUB, Schoch et al., North) GRA6, c22-8, 2011 c29-2, L358, PK1, Apico)

Within Asian countries the occurrence of the meat-borne pathogen T. gondii in pork meat based on molecular tools has been largely studied in Republic of China. Thus, low genetic diversity of T. gondii in pigs from southwestern of the country was found. In this regard, lymphnodes and liver from 412 slaughtered pigs were collected and molecular tested for T. gondii targeting the SAG3 gene, followed by genotyping of positive samples using 9 nuclear loci: SAG1, SAG2, SAG3, BTUB, GRA6, L358, PK1, c22-8, c29-2 and apicomplast locus Apico. The overall prevalence was 13.6%, and only one genotype that so called ToxoDB9 was identified (21). In another study, conducted in different provinces of the country and targeting B1 gene a prevalence value of 65.8% (25/38) was obtained and also, the toxoDB9 genotype was found to be dominant (94.1%). Another genotype namely toxoDB3 was found only in 5.9% of samples (13). The highly virulent genotype I was recorded in a small number of samples (6.25%) in Central China together with

137

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA the dominant genotype II (93.5%) in a study conducted by Zhou et al. (2010) where only 7.8% (34/434) of the processed pig lymphnodes were found to be infected with T. gondii (20). In South of Japan of the 91 molecularly examined pig lymphnodes targeting Toxo GRA6 gene, 33 (36.3%) were positive for T. gondii. According to the genotyping of positive samples three genotypes were obtained. The genotype I and genotype II were evenly distributed (44.8% and 48.3%, respectively), instead the genotype III were detected only in 6.9% of the examined samples (19). In Sus scrofa. Several studies conducted especially in the European counties level demonstrated that wild boar can be considered a valuable indicator of environmental contamination with T. gondii oocysts. In Northeastern of France and Corsica Island the results obtained by Richomme et al. (2009) underlined that wild boar meat can serve as important reservoir for transmission of T. gondii to humans (16). Out of 148 processed heart samples 21 (14.0%) were found to be PCR positive. On the basis of PCR-RFLP strain typing using three markers (SAG1, SAG2 and GRA7) and six microsatellite loci (TUB2, TgM-A, W35, B17, B18, M33) all isolates were found to belong to the type II lineage, which is considered largely predominant subtype in human congenital toxoplasmosis in France. A similar molecular prevalence value has been reported by Ferroglio et al. (2014) in Northwestern Italy (11). Seventeen (16.2 %) out of 105 examined skeletal muscles contained the T. gondii gDNA using a 200-300 fold repetitive 529 bp DNA fragment amplification. In this study the PCR-RFLP genotyping has been not carried out, thus, the clearer complex understanding of the role of wildlife in the epidemiology of T. gondii remained an open question. In a Swiss study a very low (1/150; 0.7%) Toxoplasma infection prevalence value has been obtained by Berger-Schoch et al. (2014) in the molecular examined wild boar diaphragm muscle samples, reflecting the environmental contamination in non-urban surroundings (2). High genetic variability for wild boar origin T. gondii isolates were recorded in southwestern of Spain by Calero-Bernal et al. (2015). The processed brain and heart wild boar samples showing a positivity of 14.7% (9/61) and infections with genotype I, genotype II, and genotype I+II were recorded in 28.6%, 28.6% and 42.8%, respectively (5). In another study conducted in the Peninsular Malaysia only the highly virulent clonal type I strain of T. gondii which is closely associated with human congenital toxoplasmosis were obtained in six (20%) out 30 processed wild boar brain and heart samples (15).

Conclusions

Relevant articles published over the last 10 years about the molecular epidemiology of the meat-borne pathogen T. gondii in pig and wild boar have pointed out that these species may serve as important reservoirs and source for human toxoplasma infections. Results of different studies conducted in different geographical regions indicated a different level of exposure of T. gondii, markedly influenced by the

138

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA management of the tested population and by the study design. Out of three genetically distinct genotypes, the highly virulent genotype I seem to be more prevalent in Asian countries, while the genotypes II and III have been recorded more frequently at the European countries level and North and South America. The recorded atypical strains, especially in South American countries, highlight the necessity of the development of new molecular markers to a better group and characterization of atypical isolates (3).

Acknowledgements

The study was funded by the Banat's University of Agricultural Sciences and Veterinary Medicine ―King Michael I of Romania‖ from Timişoara, Romania – Internal competition for research grants in 2015, No. 2756/2015.

References

1. Bacci, C., Vismarra, A., Mangia, C., Bonardi, S., Bruini, I., Genchi, M., Kramer, L., Briandi, F. Detection of Toxoplasma gondii in free-range, organic pigs in Italy using serological and molecular methods. Int. J. Food. Microbiol., 2015, 202, 54-56. 2. Berger-Schocha, A.E., Herrmannb, D.C., Schares G., Müller, N., Bernet, D., Gottstein, B., Freya, C.F., Prevalence and genotypes of Toxoplasma gondii in feline faeces (oocysts) and meat from sheep, cattle and pigs in Switzerland. Vet. Parasitol., 2011, 177, 290-297. 3. Bezerra, R.A., Carvalho, F.S., Guimarães, L.A., Rocha, D.S., Maciel, B.M., Wenceslau, A.A., Lopes, C.W.G., Albuquerque., Genetic characterization of Toxoplasma gondii isolates from pigs intended for human consumption in Brazil. Vet. Parasitol., 2012, 189, 153-161. 4. Calero-Bernal, R., Saugar, J.M., Frontera, E., Pérez-Martín, E., Habela, M.A., Serrano, F.J., Reina, D., Fuentes, I., Prevalence and genotype identification of Toxoplasma gondii in wild animals from Southwestern Spain. J. Wild. Dis., 2015, 51, 233-238. 5. Calero-Bernal., R., Saugar, J.M., Frontera, E., Pérez-Martín, J.E., Habela, M.A., Serrano, F.J., Reina, D., Fuentes, I., Prevalence and genotype identification of Toxoplasma gondii in wild animals from Southwestern Spain. J. Wild. Dis., 2015, 51, 233-238. 6. De Sousa, S., Ajzenberg, D., Canada, N., Freire, L., da Costa, J.M.C., dared, M.L., Thulliez, P., Dubey, J.P., Biologic and molecular characterization of Toxoplasma gondii isolates from pigs from Portugal. Vet. Parasitol., 2006, 135, 133-136. 7. Djurković-Djaković, O., Nikolić, A., Klun, I., Dupouy-Camet, J., Pork as a source for human parasitic infection. Clin. Microbiol. Infect., 2013, 19, 586- 594.

139

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

8. Dos Santos, C.B., Carvalho, A.C.F.B. Ragozo, A.M.A., Soares, R.M., Amaku, M., Yai, L.E.O., Dubey, J.P., Gennari, S.M. First isolation and molecular characterization of Toxoplasma gondii from finishing pigs from São Paulo State, Brazil. Vet. Parasitol., 2005, 131, 207-2011. 9. Dubey, J.P., Hill, D.E., Rozeboom, D.W., Rajendran, C., Choudhary, S., Ferreira, L.R., Kwok, O.C.H., Su, S., High prevalence and genotypes of Toxoplasma gondii isolated from organic pigs in northern USA. Vet. Parasitol., 2012, 188, 14-18. 10. Esteves, F., Aguiar, D., Rosado, J., Costa, M.L., de Sousa, B., Antunes, F., Matos, O., Toxoplasma gondii prevalence in cats from Lisbon and pigs from centre and south of Portugal. Vet. Parasitol., 2014, 200, 8-12. 11. Ferroglio, E., Bosio, F., Trisciuoglio, A., Zanet, S., Toxoplasma gondii in sympatric wild herbivores and carnivores: epidemiology of infection in the Western Alps. Parasites & Vectors., 7, 196. 12. Halová, D., Mulcahy, G., Rafter, P., Turčeková, L., Grant, T., de Waal, T., Toxoplasma gondii in Ireland: seroprevalence and novel molecular detection method in sheep, pigs, deer and chickens. Zoonoses Public Health., 2013, 60, 168-173. 13. Jiang, H.H., Huang, S.Y., Zhou, D.H., Zhang, X.X., Su, C., Deng, S.Z., Zhu, X.Q., Genetic characterization of Toxoplasma gondii from pigs from different localities in China by PCR-RFLP. Parasit & Vectors., 2013, 6, 227. 14. Ortega-Pacheco, A., Viana, K.Y.A., Guzmán-Marín, E., Segura-Correa, J.C., álvarez-Fleites, M., Jiménez-Coello, M., Prevalence and risk factors of Toxoplasma gondii in fattening pigs farm from Yucatan, Mexico. BioMed. Res. Int., 2013, 2013, 231497. 15. Puvanesuaran, V.R., Noordin, R., Balakrishnan, V., Genotyping of Toxoplasma gondii isolates from wild boars in Peninsular Malaysia. PlosOne, 8, e61730 16. Richomme, C., Aubert, D., Gilot-Fromont, E., Ajzenberg, D., Mercier, A., Ducrot, C., Ferté, H., Delorme, D., Villena, I., Genetic characterization of Toxoplasma gondii from wild boar (Sus scrofa) in France. Vet. Parasitol., 2009, 164, 296-300 17. Samico-Fernandes, E.F., Samico-Fernandes, M.F., Kim, P.C., de Albuguerque, P.P., de Souza Neto, O.L., de S Santos, A., de Moraes, E.P., de Morais E.G., Mota, R.A., Prevalence of Toxoplasma gondii in slaughtered pigs in the state of Pernambuco, Brazil. J. Parasitol., 2012, 98, 690-691. 18. Turčeková Ľ, Antolová D, Reiterová K, Spišák F., Occurrence and genetic characterization of Toxoplasma gondii in naturally infected pigs. Acta. Parasitol., 2013, 58, 361-366. 19. Zakimi, S., Kyan, H., Oshiro, M., Sugimoto, C., Xuenan, X., Fujisaki, K., Genetic characterization of GRA6 genes from Toxoplasma gondii from pigs in Okinawa Japan. J. Vet. Med. Sci., 2006, 68, 1105 – 1107.

140

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

20. Zhou, P., Nie, H., Zhang, L.X., Wang, H.Y., Yin, C.C., Su, C., Zhu, X.Q., Zhao, J.L., Genetic characterization of Toxoplasma gondii isolates from pigs in China. J. Parasitol., 2010, 96, 1027-1029. 21. Zhou, P., Sun, X.T., Yin, C., Yan, H.K., Zhu, X.Q., Zou, F.C., Genetic characterization of Toxoplasma gondii isolates from pigs in Soutwestern China. J. Parasitol., 2011, 97, 1193-1195.

141

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

BIOCIDE EFFECT ON BIOFILM-INTEGRATED BACTERIA ISOLATED FROM MEAT CARCASSES

ADRIANA MORAR1, K. IMRE1, A. A. MORVAY2, ILEANA NICHITA1, OLIMPIA COLIBAR1, CLAUDIA SALA1

1 Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2Victor Babes" National Institute of Research and Development in Pathology domain and Biomedical Sciences, Splaiul Independentei, no. 99-101, 050096 Bucharest, Romania E-mail: [email protected]

Summary

The aim of this paper was to evaluate the effectiveness of four disinfectants against planktonic and integrated in biofilm bacteria isolated from the meat surfaces. Disinfectant products were selected from commercial preparations commonly used for decontamination in food processing plants namely P3-oxysan and P3-topax 66 (Ecolab®), hydrogen peroxide and sodium hypochlorite. Biocide effect was evaluated against various species of Enterobacteriaceae and Pseudomonas isolated from the bacterial biofilm on meat surface (pork, beef and poultry) and against some bacterial associations from carcasses. P3 topax-66 inhibited growth of all bacterial strains and associations, both as planktonic (0.025%) and integrated into the biofilm matrix (0.05%) at the lowest concentrations tested. P3-oxysan expressed bactericidal properties starting at 0.06% on Escherichia coli isolated from pig carcasses. The most resistant strain was Enterobacter cloacae and the association between E. coli and Serratia liquefaciens, which were resistant even at concentrations of 0.15%. Microbial biofilm eradication concentration was found 0.12% product against Pseudomonas putida, but for most bacterial strains tested and associations of these effects occurred at concentrations twice as high (0.25%). The Serratia isolated strains and their associations included in biofilm were more resistant to the action of hydrogen peroxide compared to planktonic cells (1500 ppm). Bacteria in monoculture biofilms and mixt biofilms, with one exception (E. coli), were 10 times more resistant to disinfectants concentrations (15000 ppm). Microbicidal effect of sodium hypochlorite was expressed at lowest concentration tested, 75 ppm for planktonic cells and 150 ppm for the bacterial biofilm. Key words: microbial biofilm, meat, disinfectant effects, Calgary biofilm device

Biofilm is a community of microorganisms attached to a surface and usually enclosed in a matrix of polysaccharide material. These structures represent a strategy for bacteria to survive in hostile environments. Adhesion to a surface provides several advantages including easy access to nutrients and resistance against antimicrobial compounds.

142

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Bacterial adherence on inert food contact surfaces could lead to food contamination by undesirable microorganisms, resulting in food spoilage or transmission of diseases (5, 6). Microbial biofilm has become difficult to control by using disinfectants compounds that are effective against planktonic bacteria. The colonization of surfaces can be a problem and is generally controlled through cleaning and disinfection. Failure of the antimicrobial compound against microorganisms may lead to an inherent insusceptibility to the agents used, the acquisition of resistance or the emergence of pre-existing but unexpressed resistance phenotypes (4). Also, the production of excess amounts of EPS (exopolimeric substances) by the bacteria during biofilm formation may protect the innermost cells by binding with antimicrobial substances and quenching their effect as they diffuse through it (6). The purpose of this study was to evaluate the effectiveness of some disinfectants compounds against bacteria isolated from the meat surface, both planktonic cells and bacteria integrated in biofilm.

Materials and methods

Antimicrobial compounds were selected from those commonly used for decontamination in food processing plants: P3-topax 66 (Ecolab) and P3-oxysan (Ecolab). According to the information provided by the company producing P3- topax 66 has in composition sodium hypochlorite (2-5%) and sodium hydroxide (2- 5%). P3-oxysan contains: acetic acid (30-50%), peracetic acid (5-10%), hydrogen peroxide (5-10%). The bactericidal efficacy of two disinfectants was also evaluated: 30% hydrogen peroxide and 30% sodium hypochlorite. Microorganisms. The bactericidal efficacy of the above mentioned substances was evaluated against various Enterobacteriaceae and Pseudomonas species isolated from the bacterial biofilm on the meat surface (pork, beef and poultry) and against some bacterial associations. The experiments were performed both on planktonic cells and cells embedded in monoculture and mixt biofilms. The enterobacteria strains were: three strains of Escherichia coli, two strains of Serratia liquefaciens, one strain Serratia marcescens and a strain of Enterobacter cloacae. From Pseudomonas genus one strain of Ps. aeruginosa and one Ps. fluorescens were selected. In addition, three bacterial associations were tested: 1 - E. coli and Ps. aeruginosa, 2 – S. liquefaciens and Enterobater cloacae and 3 –S. liquefaciens and E. coli. Biofilm formation. Stock cultures were kept at -80°C. Before each experiment the strains were streaked on BHI (brain, heart, infusion) agar and incubated at 37°C for 24 hours. Bacterial cultures on BHI agar were used to make an inoculum that matches 1 McFarland standard. This mixture was then diluted 1:30 in BHI broth. The formation of biofilm was done using the Calgary Biofilm Device (CBD), following a similar method described by Ceri et al. (2). After dilutions from each strain 150 µl was added to each well, covered with the lid containing 96

143

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA identical pegs and incubated on a rocker (Heidolph Promax 1020 at 100 rpm, 37°C for 24 hours. After the incubation time the broth was removed from each well and the pegs were rinsed with saline solution to remove the planktonic cells. Biofilm eradication. The biofilm formed on CBD was exposed to different concentration of disinfectants for 15 minutes, washed with saline solution to neutralize the disinfectant effect, sonicated for 5 min with an Aqua Wave 9381 Barnstead Lab and then plated on BHI agar. The minimum bactericidal concentration (MBC) for planktonic bacteria was establish in a microtiter plate with bacteria culture exposed to disinfectants for 15 minutes, neutralized with saline solution and then plated on BHI agar.

Results and discussions

P3 topax-66 inhibited the growth of all bacterial strains isolated and associations between them, both as planktonic (0.025%) and integrated into the biofilm (0.05%). at the lowest concentrations tested, after 15 min. Research conducted by Laktičová et al. (7) on bacteria suspension test showed bactericidal effect of Topax 66 on E. coli at 0.1% concentration after 5 min. exposure. P3-oxysan expressed bactericidal properties starting at 0.06% on E. coli isolated from pig carcasses (table 1). The most resistant strain was Enterobacter cloacae and the association between E. coli and S. liquefaciens, which were not inhibited even at concentrations of 0.15%. Table 1 Bactericidal effect of P3-oxysan Prod. Bacterial strain conc 1 2 3 4 5 3+5 6 7 8 9 1+8 4+6 (%) 0.005 + + + + + + + + + + + + 0.01 + + + + + + + + + + + + 0.02 + + + + + + + + + + + + 0.04 + + + + + + + + + + + + 0.06 - + + + + + + + + + + + 0.12 - + + + - + + - + - - + 0.15 - - - + - + ------Note: 1, 2=E. coli from pig carcasses; 3=E. coli from poltry carcasses; 4=Ent. cloacae from beef carcasses; 5=S. liquefaciens from poltry carcasses; 3+5=association between E. coli and Ser. liquefaciens from poltry carcasses; 6=Ser. liquefaciens from beef carcasses; 7=Ser. marcescens from beef carcasses; 8=Ps. aeruginosa from pig carcasses; 9=Ps. putida from pig carcasses; 1+8=association between E. coli and Ps. aeruginosa from pig carcasses; 4+6= association between Ent. cloacae and Ser. liquefaciens from beef carcasses; += bacterial growing; -=bactericidal effect

Minimum biofilm eradication concentration of P3-oxysan against Pseudomonas putida was 0.12%. However, for most bacterial strains and

144

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA associations tested, these effects occurred at concentrations twice higher (0.25%) (Table 2). Not all strains of Pseudomonas expressed the same sensitivity to P3- oxysan product. For example, Ps. aeruginosa isolated from the surface of pig meat was resistant even at high concentrations, 0.30% P3-oxysan. It is interesting to note that the biofilm formed by the association between Ps. aeruginosa and E. coli had a high sensitivity to P3 oxysan compared to biofilm formed by Ps. aeruginosa alone. Probably is the consequence of the antibacterial proteins (colicins) produced by E. coli strain which inhibit the Ps. aeruginosa growth in biofilm. In consequences, the biofilm is formed mainly of E. coli which can explain the increase sensitivity of the mixt biofilm to the P3 oxysan product. Table 2 Microbial biofilm eradication concentration of P3-oxysan Prod. Bacterial strain conc 1 2 3 4 5 3+5 6 7 8 9 1+8 4+6 (%) 0.01 + + + + + + + + + + + + 0.02 + + + + + + + + + + + + 0.04 + + + + + + + + + + + + 0.08 + + + + + + + + + + + + 0.12 + + + + + + + + + - + + 0.25 - - - + + + + - + - - + 0.30 - - - - + + + - + - - + Note: 1, 2=E. coli from pig carcasses; 3=E. coli from poltry carcasses; 4=Ent. cloacae from beef carcasses; 5=Ser. liquefaciens from poltry carcasses; 3+5=association between E. coli and Ser. liquefaciens from poltry carcasses; 6=Ser. liquefaciens from beef carcasses; 7=Ser. marcescens from beef carcasses; 8=Ps. aeruginosa from pig carcasses; 9=Ps. putida from pig carcasses; 1+8=association between E. coli and Ps. aeruginosa from pig carcasses; 4+6= association between Ent. cloacae and Ser. liquefaciens from beef carcasses; += bacterial growing; -=bactericidal effect

Tait and Sutherland (10) stated that the coexistence of bacteriocin- producing and bacteriocinsensitive strains affect the size and sensitivity of the biofilm to antimicrobial agents. This was thought to be associated with the biofilm bacteria having to deal with a double assault, being affected by both bacteriocin and biocide. It has been suggested that production of a bacteriocin would give the organism a competitive advantage when interacting with other microbes. The production of antagonistic compounds may be beneficial in gaining a foothold in a new environment. Bacteriocins may also prevent the colonization of a pre- established microbial community by a competitive species (10). The Serratia isolated strains and their associations were more resistant to the action of hydrogen peroxide compared to planktonic cells of the same strains (1500 ppm) (Table 3). H2O2 acts as an oxidant by producing hydroxyl free radicals which attack essential cell components (lipids, proteins, and DNA). Some microorganisms have 145

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA developed intrinsic defense systems that confer tolerance to peroxide stress. The oxidative-stress response has been well studied in E. coli and Salmonella and includes the production of neutralizing enzymes to prevent cellular damage (peroxidases, catalases) and to repair DNA lesions. In both organisms, increased tolerance can be obtained by pretreatment with a subinhibitory dose of hydrogen peroxide (8).

Table 3 Bactericidal effect of hydrogen peroxide Prod. Bacterial strain conc % 1 2 3 4 5 3+5 6 7 8 9 1+8 4+6 (ppm as) 0.15 (450) + + + + + + + + - - - + 0.25 (750) - - - + + + + + - - - + 0.5 (1500) - - - - - + + + - - - + 0.75 (2250) ------1.5 (4500) ------2 (6000) ------2.5 (7500) ------Note: a. s.= active substance (hydrogen peroxide) from commercial product; 1, 2=E. coli from pig carcasses; 3=E. coli from poltry carcasses; 4=Ent. cloacae from beef carcasses; 5=Ser. liquefaciens from poltry carcasses; 3+5=association between E. coli and Ser. liquefaciens from poltry carcasses; 6=Ser. liquefaciens from beef carcasses; 7=Ser. marcescens from beef carcasses; 8=Ps. aeruginosa from pig carcasses; 9=Ps. putida from pig carcasses; 1+8=association between E. coli and Ps. aeruginosa from pig carcasses; 4+6= association between Ent. cloacae and Ser. liquefaciens from beef carcasses; += bacterial growing; -=bactericidal effect

Bacteria in monoculture biofilms and mixt biofilms, with one exception (E. coli), were 10 times more resistant to disinfectants concentrations, MBEC was obtained at a 5% concentration or 15000 ppm hydrogen peroxide (Table 4). Numerous studies have demonstrated that multi-species biofilms are generally more resistant to disinfection than mono-species biofilms. Bridier et al. (1) in their review explained the resistance of the microbial biofilm to disinfectants through the following possible mechanisms: 1) the specific nature and composition of a multi-species biofilm matrix, 2) the chemical interactions between the polymers produced by each species which may lead to a more viscous matrix and thus reduce the permeation of biocides, 3) the enzymes produced by the different species which may act synergistically against toxic compounds and non-productive species will benefit from the association through enzyme complementation. Bacteria may develop resistance to some disinfectants, and it has been suggested that different types of disinfectants should be used alternately to prevent establishment of resistant house strains (3). Unlike the results obtained in this study, Rushdy and Othman (9) found from MBC values 10 times lower (0.47% hydrogen peroxide) for biofilm formed by

146

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Ps. aeruginosa on stainless steel slides. However, differences between the results can be due to differences in working methods and between the strains tested.

Table 4 Microbial biofilm eradication concentration of hydrogen peroxide Prod. Bacterial strain conc % 1 2 3 4 5 3+5 6 7 8 9 1+8 4+6 (ppm a.s.) 0.3 (900) + + + + + + + + + + + + 0.5 (1500) + + + + + + + + + + + + 1 (3000) + + + + + + + + + + + + 1.5 (4500) - + + + + + + + + + + + 3 (9000) - + + + + + + + + + + + 4 (12000) - + + + + + + + + + + + 5 (15000) - + + + + + + + + + + + Note: a. s. = active substance (hydrogen peroxide) from commercial product; 1, 2=E. coli from pig carcasses; 3=E. coli from poltry carcasses; 4=Ent. cloacae from beef carcasses; 5=Ser. liquefaciens from poltry carcasses; 3+5=association between E. coli and Ser. liquefaciens from poltry carcasses; 6=Ser. liquefaciens from beef carcasses; 7=Ser. marcescens from beef carcasses; 8=Ps. aeruginosa from pig carcasses; 9=Ps. putida from pig carcasses; 1+8=association between E. coli and Ps. aeruginosa from pig carcasses; 4+6= association between Ent. cloacae and Ser. liquefaciens from beef carcasses; += bacterial growing; -=bactericidal effect

Antimicrobial effect of sodium hypochlorite was expressed at lowest concentration tested, 75 ppm for planktonic cells and 150 ppm for the bacterial biofilm. The active agent of sodium hypochlorite is hypochlorous acid (HOCl), which forms upon the hydrolysis of the hypochlorite ion. Hypochlorous acid is a weak acid but powerful oxidant. The bactericidal effect of this compound is due to its low molecular weight and lack of electrical charge, which enables the molecule to easy penetrate cell walls. McKenna and Davies (1988) cited by McDonnel and Russell (8) described the inhibition of bacterial growth by hypochlorous acid. At 2.6 ppm HOCl completely inhibited the growth of E. coli within 5 min.

Conclusions

Chlorine and chlorine-based products have the strongest microbicide effect, on both planktonic and biofilm integrated bacterial strains used in this study. The Serratia isolated strains and the associations between Serratia and other Enterobacteriaceae species (Enterobacter cloacae, Escherichia coli) were more resistant to the action of hydrogen peroxide as planktonic cells. Bacteria embedded in biofilm matrix are up to 10 times more resistant to hydrogen peroxide compared to planktonic cells.

147

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Aknowledgments

This research was supported by the project no. 1101/2011, financed by National University Research Center - Ministry of Educations, Research, Youth and Sport. This paper is partly supported by the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the European Social Fund and the Romanian Government under the contract number POSDRU 141531 awarded to Morvay Attila Alexandru.

References

1. Bridier, A., Briandet R., Thomas V., Dubois-Brissonnet F., Resistance of bacterial biofilms to disinfectants: a review, Biofouling, 2011, 27, 9, 1017– 1032. 2. Ceri H., Olson M. E., Stremick C., Read R. R., Morck D., Buret A., The Calgary Biofilm Device: New Technology for Rapid Determination of Antibiotic Susceptibilities of Bacterial Biofilms, Journal Of Clinical Microbiology, 1999, 37, 6, 1771–1776. 3. Doyle, M. E., Food Antimicrobials, Cleaners, and Sanitizers A Review of the Scientific Literature, http://fri.wisc.edu/docs/pdf/Antimicrob_Clean_Sanit_ 05.pdf. 4. Gilbert P., Das J., Foley I., Biofilm susceptibility to antimicrobials, Adv. Dent. Res., 1997, 11, 1, 160-167. 5. Hood S., Zottola E. A., Biofilms in food processing, Food Control, 1995, 6, 8-18. 6. Kumar C. G., Anand S. K., Significance of microbial biofilms in food industry: a review, International Journal of Food Microbiology, 1997, 34, 179- 186. 7. Laktičová, K., Ondrašovič M., Ondrašovičá O., Sasáková N., Kudriková D., Gregová G., Ondrašovičová S., Halatn M., Microbiological control of disinfection efficiency in Fish processing facilities, Folia Veterinaria, 2008, 52, 2, 77-78. 8. McDonnel G., Russell D., Antiseptics and Disinfectants: Activity, Action, and Resistance, Clinical Microbiology Reviews, 1999, 12, 1, 147–179. 9. Rushdy, A. A., Othman S. A., Bactericidal efficacy of some commercial disinfectants on biofilm on stainless steel surfaces of food equipment, Annals of Microbiology, 2010, 10, 21, 1-8. 10. Tait, K., Sutherland I.W., Antagonistic interactions amongst bacteriocin- producing enteric bacteria in dual species biofilms, Journal of Applied Microbiology, 2002, 93, 345-352.

148

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

IDENTIFICATION OF ANTIBODIES AGAINST RHODOCOCCUS EQUI IN HORSES BY USE OF THE ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA) - A REVIEW

D. A. NAGY, MARINA SPINU, GH. F. BRUDASCA

Department of Infectious Disease, University of Agricultural Sciences and Veterinary Medicine, 3-5 Mănăştur Street, 400372 Cluj-Napoca, phone +40-264- 596.384, fax +40-264-593.792 E-mail: [email protected]

Summary

Rhodococcus equi is an emerging pathogen witch causes clinical signs in young foals, from 1 to 6 months of age, expressed by pneumonia and enteritis. Foals are unable to produce their own IgG against Rhodococcus equi until 10 or 12 weeks of age, so they depend on the mare antibodies, if the mother was vaccinated before foaling. Due to clinical diagnostic difficulties, researchers have developed different serological tests to evaluate the incidence and prevalence of the disease in equine. To identify the antibodies in equine and sick foals different serological assays were used, no commercial one being available. The most used immunological method is the enzyme-linked immunosorbent assay (ELISA). Nevertheless, all of the developed testes are ―in house‖, based on other appropriate commercials ELISA assays, such as Corynebacterium. In these tests the authors have used different strains as antigens. The goal of this review is to describe and evaluate the different types of ―in house‖ ELISAs used in the diagnosis of equine rhodococcosis. Key words: ELISA, Rhodococcus equi, rhodococcosis, serology, equine

Rhodococcus equi has been recognized as a pathogen of foals for more than 70 years (2). Although R. equi is an emerging pathogen, the infection with this bacteria represents the major cause of losing foals between 1st and 6th month of age. Many studies had developed the mechanism of foals‘ immunity in rhodococcosis (42). An ill-defined proportion of foals with pulmonary infection will remain free of clinical signs and eventually clear the infection, whereas other foals might have either an insidiously progressive pneumonia or an acute onset of severe respiratory distress that is generally fatal. Considering the evolution of the disease, real measures for preventing rhodococcosis are needed (2). Rhodococcus equi, a saprophytic inhabitant of soil, is a bacteria widespread in the environment of horse – breeding farms. Although all horse farms are likely infected to various degrees, the clinical disease is unrecognized or sporadic on some farms, but can be also enzootic on others when the morbidity rates exceed 40%. On farms with an enzootic evolution of the disease the costs associated with veterinary care, early diagnosis, long-term therapy, and mortality of foals may be very high (8, 22).

149

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Immunity to R. equi in foals likely depends on both the antibody and cell- mediated components of the immune system. The presence of antibody in protection against R. equi is the protective effect of passively transferred anti-R. equi hyperimmune equine plasma (24). Because of the facultative intracellular nature of the bacteria, cell-mediated immune mechanism is thought to be of major importance in resistance to infection (43). Early diagnosis of R. equi infection in foals is very important, and usually depends on clinical signs recognizing followed by bacteriological confirmation. The examination of post-mortem lesions provides the confirmation. Bacteriological isolation is considered the standard method for confirmation of the R. equi infection (29). For microbiological diagnosis 2-3 days are needed and more than one week is required for identification of the pathogenicity of the strain using PCR or immunoblotting with monoclonal antibodies (4, 32). In the last thirty years several serological test have been develop for detection of specific antibodies against R. equi (8, 18, 19, 21, 31, 34, 42). Some serological test have been proposed for anti-R equi antibodies detection, such as indirect hemagglutination assay (IHA) or agar gel immunodiffusion (AGID), but the specific antibodies weren‘t detected probably due to a poor humoral response (4). For the identification of specific R. equi antibodies some laboratory techniques were used, one of them being the enzyme-linked immunosorbent assay (ELISA), which is considered the most sensitive. Nevertheless, all of the developed testes are ―in house‖ and are based on other appropriate commercial ELISA assays, such as Corynebacterium (34). In general, the studies confirmed that antibodies, including those specific for VapA, were present in many foals regardless of their disease status (5). Immunity to Rhodococcus equi infection Usually R. equi pneumonia was described in foal between 1 and 6 month of age. The immunological factors that predispose foals to develop R. equi pneumonia are unclear but are thought to be related to the immaturity of the immune system (5). Foals are unable to produce their own IgG antibodies against Rhodococcus equi until 10 or 12 weeks of age, thus they depend on the mare antibodies, if those were vaccinated before foaling. Once inhaled, virulent R. equi bacteria is taken up by alveolar macrophages through a process of receptor-mediated phagocytosis. The receptors used by macrophages to engulf complement opsonized R. equi are complement receptors 3 (13). Once engulfed by resident macrophages, virulent R. equi are able to modify the phagocytic vacuole to prevent acidification and subsequent fusion with lysosomes (38, 40). Uncontrolled intracellular replication of R. equi leads to necrosis of the macrophage. If opsonized with R. equi-specific antibody, presumably promoting bacterial entry via the macrophage Fc receptor, the fate of the R. equi containing phagosome is altered and lysosome fusion occurs. This might explain how the presence of R. equi antibody might aid in preventing the infection (11).

150

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The adaptive immunity in pneumonia in foals probably depends on both the antibody and cell-mediated components of the immune system, but this isn‘t completely established (7). The evidence for a role of antibody in protection against R. equi in young foals is the partially protective effect of passively transferred hyperimmune equine plasma. Although the explanation is probably more complex, it seems that the antibodies have a role in immunity against R. equi infection. Some mechanism where the antibody would contribute to immunity, stop initial stages of cellular infection, changing the bacterial fusion with macrophages and reducing bacterial ability to altere the phagosome (25, 38). Antigen specific immunoglobulin (IgG) plays an important role in opsonisation, promoting phagocytosis of virulent R. equi by alveolar macrophages and down-regulation of intracellular growth through enhanced bacterial killing capacity (11). Interferon-gamma (IFN- is a critical cytokine for innate and adaptive cell-mediated immunity against intracellular bacterial infections. It promotes T and B cell differentiation, activates cytotoxic T cell activities, and enhances microbicidal function of macrophage. However, IFN- expression is impaired in neonates of most species, including foals (3, 27, 41). This reduced expression is associated with an increased risk for intracellular bacterial infections, such as those caused by R. equi. However, the underlying regulatory mechanism of IFN- expression in foals remained to be investigated (27). Because R. equi is a facultative intracellular pathogen, cell-mediated immune mechanism is thought to be of major importance in resistance of infection (7). A large part of knowledge of cell-mediated immunity to R. equi infection comes from experimental infection of mice. Because of deficiencies in mice the complement C5 an NK cells do not impair the pulmonary clearance of virulent R. equi (43). Enzyme-linked immunosorbent assay (ELISA) The ELISA assays used until present different types of R. equi strains as VapA and VapC to VapH (28, 30). The most common ELISA tests used are ELISA- 6939, ELISA-33701, ELISA-VapA and ELISA-California (1, 4, 14). The purpose of this review was to describe the ELISA tests used for detection of antibodies against Rhodococcus equi. No commercial ELISA test used for serological diagnosis of rhodococcosis in equine exists, however, most of the ELISA tests were ―in house‖ , based on previously described methods (34, 33, 21, 12, 1, 23). ELISA-6939 and ELISA-33701. The antigen used in these two tests was prepared from non-virulent R. equi ATCC 6939 and virulent strain ATCC 33701, grown on yeast extract-casein-cystine agar. Bacteria were harvested after two days of incubation at 37°C. After that, R. equi (2g [wet weight]) was suspended in 10 ml of 0.0125 M sodium phosphate buffer (pH 7.4) containing 0.1% (wt/vol) Tween 20, incubated at 37°C for 90 min in a water bath with agitation, and centrifuged at 20,000 x g for 30 minutes at 4°C. The supernatant was used as an antigen. Antigen protein content was determined by the method of Lowry et al. and adjusted to 1.0

151

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

µg/ml in carbonate-bicarbonate buffer (pH 9.6) containing 0.02% NaN3 before use (33). The ELISA-6939 method was previously described by Takai et al. (30). Optimal dilutions of reagents were obtained by checker board titrations. Plates were washed four times between each step with phosphate-buffered saline solution (pH 7.2), containing 0.02% Tween 20 (200 µl per well). Tween 20 antigen was used to coat micro-ELISA plates. The plates were incubated at 4°C for 16 h in a humid box. Horse sera were inactivated at 56°C for 30 minutes, diluted in phosphate buffered saline (pH 7.2) containing 10% fetal bovine serum, and added to the wells after washing. The plates were incubated at 37°C for 60 minutes. Anti- horse IgG (prepared in rabbits, H- and L-chain specific; Cappel Laboratories, Cochranville, Pa.), anti-horse IgM (prepared in rabbits, α-chain specific; Cappel Laboratories), and anti-horse IgA (prepared in rabbits, α -chain specific; Cappel Laboratories) were added to each plate, and the plates were incubated at 25°C for 30 minutes. Horseradish peroxidase conjugated to anti-rabbit IgG (prepared in sheep; Cappel Laboratories) was added to each plate, and the plates were incubated at 25°C for 30 minutes. After the addition of substrate (0.4 mg of o- phenylenediamine dihydrochloride and 0.2 µl of H202 per ml in citric acid-Na2HPO4 buffer solution [pH 4.8]), the plates were incubated at 25°C for 20 minutes. The reaction was stopped with 100 µl of 3 N H2SO4. Optical density (OD) was measured by a multiscan ELISA reader at 492 nm (33). ELISA-VapA. Prescott ELISA method used like antigen a strain prepared from Rhodococcus equi 103, an isolate from the lung of a foal suffering from pneumonia. Bacteria were grown in brain heart infusion broth for 72 h at 37°C shaking at 150 rpm. Cells were harvested by centrifugation, washed with 10 mmol/l Tris-HCl, pH 7.4, 0.15 mol NaCl (TBS buffer) and centrifuged. Cells (30-50 mg wet weight) were added to 2% Triton X-114 in TBS with 1 mmol/l phenymethyl sulphonyl fluoride as a protease inhibitor and shaken overnight at 4°C. Insoluble material was removed by centrifugation at 4°C and the supernatant recovered and warmed to 37°C for ten minutes before centrifugation at 25°C at 14,400 g for 15 minutes. The detergent phase was washed once with enough TBS to make a 2% TX-114 solution and precipitated overnight at -20°C with ten volumes of acetone. The precipitate was recovered by centrifugation, the acetone decanted, the pellet air dried and 10 mmol/l Tris-HCl, pH 7.0, added to the pellet and shaken overnight at 4°C. The solution was sonicated for 30 s periods over ten minutes. Triethylamine was added to a final volume of 0.25% and the mixture shaken overnight at 4°C. The supernatant was recovered by brief centrifugation and the pellet remaining was re-extracted with Tris by repeating the steps described above and the supernatants combined. Protein content was determined by the BCA Protein Assay. The antigen, designated APTX, was frozen in aliquots at -70°C, for storing (21). Prescott’s ELISA VapA method. The APTX antigen, prepared as described, was sonicated with 30 s bursts over ten minutes before diluting in sodium carbonate bicarbonate buffer, pH 9.6 - 2 µg/ml. Overnight, 100 µl was

152

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA coated at 4°C in wells of flat-bottomed polystyrene microtitre plates (96-well Immunolon 1). Plates were washed three times with 0.05% Tween 20-0.5% gelatin in phosphate buffered saline, pH 7.2 (PBS-TG) and blocked for one hour at room temperature with the same solution. Doubling dilutions of test horse serum were made in PBS-TG, giving a final initial serum dilution of either 1:10 or 1:100 (depending on the titer of the serum). Plates were incubated at 37°C for one hour, washed three times with PBS-TG and 100 µl of horseradish-peroxidase conjugated goat anti-horse IgG (H+L) diluted 1:8000 added to each well. Plates were incubated for one hour at 37°C, then washed three times with PBS-TG and 100 µl of ABTS substrate added to each well. After incubation for 60 minutes at room temperature, the optical density of wells was read in an automated ELISA reader at 405 nm. Wells with antigen only were used as a blank. The ELISA titer was expressed as the last serum dilution giving a reading twice the optical density of a negative control serum diluted 1:10 (0.045 OD units). Seroconversion was defined as a four-fold increase in titer from the lowest titer (21). ELISA-California test used like antigen lyophilized supernatant of the culture of various R. equi strains. ELISA-California was performed by the California Animal Health and Food Safety Laboratory System (Davis, California), and results were reported as the ratio of positive serum or test serum absorbance to the negative control absorbance value (12). Vanniasinkam et al. (39) has develop one peptide-based ELISA, using the biotinylated peptides was performed, and he has used method recommended by the manufacturer with the following modifications: Neutravidin (Pierce Chemical Company) at a concentration of 0.3 mg/well was used to coat the plates. Plates were blocked for two hours at 4°C. The conjugate diluent used contained 1% casein to decrease the nonspecific binding. The secondary antibody used was caprine anti-horse immunoglobulin G (Bethyl Laboratories). The ELISA using the whole-cell antigen was prepared with R. equi ATCC 33701 (known to contain the VapA-encoding virulence plasmid) using a previously described method. Briefly, bacteria cultured on plates for 48 hours were harvested, washed with physiological saline, and fixed overnight in 1% formalin in saline. The following day the bacteria were washed three times in saline, resuspended in bicarbonate coating buffer, and used in the ELISA. The whole cell preparation was not tested for the presence of VapA or any other specific antigens. Tetramethyl benzidine was used as the chromogenic substrate in all assays, and optical density (OD) values were read in an ELISA plate reader at a wavelength of 450 nm (reference wavelength, 630 nm) (39). Rhodococcus equi was recognized as one of the most important bacterial pathogen in young foals. Infection whit R. equi was often associated with other respiratory disease or enteric syndromes, but was rarely diagnosed (4). Detection of rhodococcosis from the incipient stages may be very difficult because the onset may be insidious. A specific etiologic diagnosis was based on trans-tracheal aspiration and its bacteriology, and to confirm the virulence of isolates strains, the

153

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

PCR technique can be used (4, 35, 10). Serological tests such as AGID, complement fixation an IHA carried out on foals were considered worthless for diagnosing R. equi infection, because they sensitivity was low (4, 21, 34). The ELISA tests used to detect antibodies against R. equi seems to be efficient for diagnose this infection in foals (34). There were studies which showed that animals from endemic farms tend to be more heavily infected with virulent R. equi which typically contains the 85–90 kb virulence plasmids encoding seven closely related virulence-associated protein family – Vap family (VapA, VapC, VapD, VapE, VapF, VapG and VapH) (28, 30). There are 6 full-length vap genes, (VapA, -C, -D, -E, -G, -H) and 3-truncated vap pseudogenes (vapF, -I, and -X) (16). To date, VapA, which encodes an immunodominant, temperature inducible, and surface-expressed lipoprotein, is the only vap gene with a demonstrated role in virulence whereas Vaps C, D, E, F, G, I, and X appear to be dispensable (32, 36, 7). However, the role of these antigens in pathogenesis of R. equi infection in foals remains unclear. Among these antigens, the 15–17 kDa, VapA is essential for survival within macrophages and for development of disease in foals (9, 15). VapA has been recognized as the most immunogenic protein as pneumonic foals tend to produce significant amounts of VapA-specific antibodies (32), however, epresion of VapA alone, was shown to be insufficient to restore the virulence phenotype (9), and also this protein has been used as an epidemiological marker for indentification of virulent R. equi isolates in horses and their environment (30, 44). Furthermore, VapA has been shown to possess an immunodominant N-terminal B-cell epitope commonly recognized by serum immunoglobulin IgG antibodies of R. equi-infected foals (39, 37, 17). These findings suggested that an enzyme-linked immunosorbent assay (ELISA) based upon the N-terminal B-cell epitope of the VapA protein may be useful as a diagnostic test for R. equi disease in equine (20). There were ELISA studies which led to the insight that antibody might be important in protection of foals against the disease. since the age at which pneumonic disease occurs in foals (Zink 1986) coincides with the period when maternal antibodies to R. equi have declined or are absent and before foals have produced their own antibodies (12). The evidence reviewed above suggests that the ELISA is reacting specifically to R. equi and particularly to VapA (21). Some ELISAs developed for R. equi serology have used lyophilized supernatant antigens of washed plate cultures of several strains, Tween 20 extracts of strain ATCC 6939 (a strain that does not produce the VapA), or antigens surviving autoclaving (12, 33, 31, 6). To identify on none of these antigens has been identified were used sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE separation) and immunoblotting (21). Giguere et al. evaluated four ELISAs tests uses for serological diagnostic of R. equi in equine and the overall diagnostic performance of ELISA-California was significantly higher than that of ELISA-VapA. For each serological assay evaluated, selection of a low cut-off resulted in high sensitivity but low specificity,

154

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA increasing the cut-off value resulted in better specificity but at the detriment of sensitivity. The best diagnostic performance was achieved with ELISA-California at a cutoff of 40%, resulting in a sensitivity of 59% and a specificity of 88%. Antibody concentrations in foals with R. equi pneumonia were significantly higher than in healthy controls by ELISA-California and ELISA-6939. In contrast, antibody concentrations with ELISA-33701 were significantly lower in foals with R. equi pneumonia compared to healthy controls (8). Phumoonna‘s (20) studies were performed on 227 samples from naturally exposed foals aged between 3 weeks and 6 months. These studies have shown that ELISA-VapA-IgG obtained a sensitivity of 58.8%, a specificity of 66.7% and accuracy of 65.1% with a positive predictive value of only 31.25% for R. equi pneumonia. In comparison, the VapA-IgGb ELISA gave a sensitivity, specificity and accuracy of 82.4%, 78.8% and 79.5% respectively. The VapA-IgGb ELISA also provided a higher positive predictive value of 50% in comparison with VapA-IgG ELISA (20). Vanniasinkam‘s (39) research clearly indicate that peptide-based ELISA is superior to that based upon whole cells ELISA-33701 because of its higher sensitivity. In addition, the whole-cell assay was more time consuming and labor- intensive to perform compared to the peptide-based test. The peptide assay also has the advantage in that the target peptide antigen can be more readily quality controlled and easily produced in contrast to a whole-cell extract. Positive peptides were defined as having an OD of at least three times the standard deviation above the lowest 25% of all OD values at a 450-nm wavelength. Furthermore, using an ELISA for the detection of antibody against R. equi has demonstrated the presence of specific antibody, against presumably nonpathogenic R. equi, in healthy horses and foals (34, 12). This highlights the importance of detection of VapA-specific antibodies in order to differentiate between a clinical R. equi infection and environmental exposure to nonvirulent R. equi (12). Consequently, these assays did not specifically detect antibodies to VapA (39). A VapA-based ELISA developed previously was found to be more useful with respect to specificity. However, it was not suitable for use as a routine diagnostic test, since VapA protein extraction was laborious and possibly contained other antigens in addition to VapA (21). Therefore, an ELISA based on universally reactive synthetic peptide epitopes of the VapA protein has the potential to be used as an easy-to-perform and specific routine diagnostic test (39). In conclusion, using a more sensitive serological test such as the enzyme- linked immunosorbent assay (ELISA) for detection of antibody against R. equi, complementary with bacteriology from tracheal aspirate, in the diagnosis of rhodococcosis in foals, may have a successful of earlier confirmation of infection. The statistical analysis between ELISA tests indicates that there was no significant difference between the antigens used therefore the antigens can identify an infection of virulent R. equi in foals. The studies also confirm that ELISA test is a rapid, reliable for detecting R. equi infection in foals.

155

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The choice of the most appropriate cut-off values for a diagnostic test should include a consideration of the distribution of results in two different populations, normal animals and animals with the disease, the prevalence of disease in the population to be tested, and the consequences of false-positive and false-negative tests results (26). On a farm with enzootic R. equi infections, the consequence of missing the diagnosis of an infected animal (false-negative) may be, in the worst-case scenario, the death of the infected animal. Therefore, a very sensitive test is essential (8). The present study shows that the currently available serological assays do not allow the distinction between foals with R. equi pneumonia and clinically healthy pasture mates when performed on a single sample (8). Using serological assays for screening or diagnosis of R. equi pneumonia in foals could avoid the unnecessary therapy of many foals. Therefore, serology can be useful in various immunological studies, including evaluation of vaccine efficacy. However, the test is of no application for establishing clinical diagnosis of rhodococcosis (42).

References

1. Anzai, T., Wada, R., Nakanishi, A., Kamada, M., Takai, S., Shindo, Y., Tsubaki, S., Comparison of tracheal aspiration with other tests for diagnosis of Rhodococcus equi pneumonia in foals, Veterinary Microbiology, 1997, 56, 335-345. 2. Bell, K.S., Philp, J.C., Aw, D.W.J., Christofi, N., The genus Rhodococcus, A review, Journal of Applied Microbiology, 1998, 85, 195- 210. 3. Breathnach, C.C., Sturgill-Wright, T., Stiltner J.L., Adams, A.A., Lunn, D.P., Horohov, D.W., Foals are interferon gamma-deficient at birth, Veterinary Immunology and Immunopathology, 2006, 112, 199-209. 4. Cuteri, V., Takai, S., Moscati, L., Battistacci, L., Pieramati, C., Valente C., A serological survey of Rhodococcus equi infection in foals in central Italy: comparison of two antigens using an ELISA test, Comp Immunol Microbiol Infect Dis., 2003, 26(1), 17-23. 5. Dawson, T., Horohov, W. D., Meijer, W. G., Muscatello, G., Current understanding of the equine immune response to Rhodococcus equi. An immunological review of R. equi pneumonia, Veterinary Immunology and Immunopathology, 2010, 135, 1–11. 6. Ellenberger, M.A., Kaeberle, M.L., Roth, J.A., Equine humoral immune response to Rhodococcus (Copnebacteriuni) equi, Am. J. ver. Res., 1984, 45, 2428- 2430. 7. Giguere, S., Cohen, N.D., Chaffin, M. K., Hines, S.A., Hondalus, M.K., Prescott, J.F., Slovis, N.M., Rhodococcus equi: Clinical Manifestations, Virulence, and Immunity, J Vet Intern Med, 2011, 25, 1221–1230.

156

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

8. Giguere, S., Hernandez, J., Gaskin, J., Prescott, J. F., Takai, S., Miller C., Performance of Five Serological Assays for Diagnosis of Rhodococcus equi Pneumonia in Foals Clinical And Diagnostic, Laboratory Immunology, 2003, 10, 2, 241–245. 9. Giguere, S., Hondalus, M. K., Yager, J. A., Darrah P., Mosser D. M., Prescott J. F., Role of the 85-kilobase plasmid and plasmid-encoded virulence- associated protein A in intracellular survival and virulence of Rhodococcus equi, Infect. Immun. 67, 1999, 3548–3557. 10. Haites, R. E., Muscatello, G., Begg, A. P., Browning, G. F., Prevalence of the virulence-associated gene of Rhodococcus equi in isolates from infected foals, Journal Of Clinical Microbiology, 1997, 35 (6), 1642–1644. 11. Hietala, S.K., Ardans, A.A., Interaction of Rhodococcus equi with phagocytic cells from R. equi-exposed and non-exposed foals, Vet Microbiol, 1987, 14, 307–320. 12. Hietala, S. K., Ardans, A. A., Sansome ,A., Detection of Corynebacterium equi-specific antibody in horses by enzyme-linked immunosorbent assay, Am. J. Vet. Res, 1985, 46, 13–15. 13. Hondalus, M.K., Diamond, MS, Rosenthal, LA, The intracellular bacterium Rhodococcus equi requires Mac-1 to bind to mammalian cells, Infect Immun, 1993, 61, 2919–2929. 14. Hooper-McGrevy, K.E., Wilkie, B.N., Prescott, J.F., Virulence-associated protein-specific serum immunoglobulin G-isotype expression in young foals protected against Rhodococcus equi pneumonia by oral immunization with virulent R. equi, Vaccine, 2005, 23, 5760–5767 15. Jain, S., Bloom, B. R., Hondalus, M. K., Deletion of vapA encoding virulence associated protein A attenuates the intracellular actinomycete Rhodococcus equi, Mol. Microbiol, 2003, 50, 115–128. 16. Letek, M., Ocampo-Sosa, A.A., Sanders, M., Evolution of the Rhodococcus equi vap pathogenicity island seen through comparison of host-associated vapA and vapB virulence plasmids, J Bacteriol, 2008, 190, 5797–5805. 17. Luhrmann, A., Maude, N., Sydor, T., Necrotic death of Rhodococcus equi-infected macrophages is regulated by virulence- associated plasmids, Infect Immun, 2004, 72, 853–862. 18. Martens, R. J., Cohen, N. D., Chaffin, M. K., Takai, S., Doherty, C. L., Angulo A. B., Edwards, R. F., Evaluation of 5 serologic assays to detect Rhodococcus equi pneumonia in foals, Journal of the American Veterinary Medical Association, 2002, 221, 6, 825-833. 19. Martens, R. J., Cohen, N. D., Chaffin, M. K., Takai, S., Doherty, C. L., Angulo, A. B., Edwards, R. F., Rhodococcus equi Foal Pneumonia: Failure of Serologic Tests to Accurately Detect Disease, AAEP Proceedings, 2002, 48, 122-123.

157

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

20. Phumoonna, T., Muscatello, G., Chicken, C., Gilkerson, J. R., Browning, G. F., Barton, M. D., Heuzenroeder, M. W., Clinical evaluation of a peptide-ELISA based upon N-terminal B-cell epitope of the VapA protein for diagnosis of Rhodococcus equi pneumonia in foals, J. Vet. Med, 2006, B 53, 126–132. 21. Prescot ,J. F., Fernandezt A. S., Nicholson V. M., Patterson M. C., Yagers, J. A., Viels, L., Perklnst G., Use of a virulence-associated protein based enzyme-linked immunosorbent assay for Rhodococcus equi serology in horses, Equine Veterinary Journal Equine, 1996, 28 (5), 344- 349. 22. Prescott, J. F., Rhodococcus equi: an Animal and Human Pathogen, Clinical Microbiology Reviews, 1991, 4-1, 20-34. 23. Sanz, M. G., Oliveira, A. F., Loynachan A. , Page A., Svansson V., Giguère, S., Horohov, D. W., Validation and evaluation of VapA-specific IgG and IgG subclass enzyme-linked immunosorbent assays (ELISAs) to identify foals with Rhodococcus equi pneumonia, Equine Veterinary Journal, 2014. 24. Sellon, Debra C., Lon, M., Equine Infectious Diseases, 2013, 287-302. 25. Sellon, Debra C., Long, Maureen T., Hines, Melissa T., Equine Infectious Diseases 2007, 281-295. 26. Smith, R. D., Veterinary clinical epidemiology: a problem-oriented approach, CRC Press, Boca Raton, Fla., 1995. 27. Sun, L., Rhodococcus Equi Infection and interferon-gamma regulation in foals, Theses and Dissertations-Veterinary Science, 2012 28. Takai, S, Hines, SA, Sekizaki ,T, DNA sequence and comparison of virulence plasmids from Rhodococcus equi ATCC 33701 and 103, Infect Immun, 2000, 68, 6840–6847. 29. Takai, S., Epidemiology of Rhodococcus equi infection: a review, Vet Microbiology, 1997, 56, 167-76. 30. Takai, S., Koike, K., Ohbushi, S., Izumi, C., Tsubaki, S., Identification of 15- to 17-Kilodalton Antigens Associated with Virulent Rhodococcus equi, Journal Of Clinical Microbiology, 1991, 29-3, 439-443. 31. Takai, S., Hidaka, D., Fujii, M., Shindoha, Y., Murata, T., Nakanishi, S., Sasaki, Y., Tsubaki, S., Kamada, M., Serum antibody responses of foals to virulence-associated 15- to 17-kilodalton antigens of Rhodococcus equi, Veterinary Microbiology 1996, 52, Issues 1–2, 63–71. 32. Takai, S., Iie, M., Watanabe, Y., Virulence-associated 15- to 17-kilodalton antigens in Rhodococcus equi: Temperature dependent expression and location of the antigens, Infect Immun, 1992; 60, 2995–2997. 33. Takai, S., Kawazu, S., Tsubaki, S., Immunoglobulin and Specific Antibody Responses to Rhodococcus (Corynebacterium) equi Infection in Foals as Measured by Enzyme-Linked Immunosorbent Assay, Journal Of Clinical Microbiology, 1986, 23-5, 943-947.

158

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

34. Takai, S., Kawazu, S., Tsubaki, S., Enzyme-linked immunosorbent assay for diagnosis of Corynebacterium (Rhodococcus) equi infection in foals, American Journal of Veterinary Research 1985, 46, 2166-2170. 35. Takai, S., Vigo, G., Ikushima, H., Higuchi, T., Hagiwara, S., Hashikura, S., Sasaki, Y., Tsubaki, S., Anzai, T., Kamada, M., Detection of virulent Rhodococcus equi in tracheal aspirate samples by polymerase chain reaction for rapid diagnosis of R. equi pneumonia in foals, Vet Microbiol., 1998, 15;61(1-2), 59-69. 36. Tan, C., Prescott, J.F., Patterson, M.C., Molecular characterization of a lipid-modified virulence-associated protein of Rhodococcus equi and its potential in protective immunity, Can J Vet Res, 1995, 59, 51–59. 37. Taouji, S., Breard E., Peyret-Lacombe A., Pronost S., Fortier G., Collobert-Laugier C., Serum and mucosal antibodies of infected foals recognized two distinct epitopes of VapA of Rhodococcus equi, FEMS Immunol. Med. Microbiol, 34, 2002, 299–306. 38. Toyooka, K., Takai, S., Kirikae, T., Rhodococcus equi can survive a phagolysosomal environment in macrophages by suppressing acidification of the phagolysosome, J Med Microbiol, 2005, 54, 1007–1015. 39. Vanniasinkam, T., Barton, M. D., Heuzenroeder, M. W., B-cell epitope mapping of the VapA protein of Rhodococcus equi: implications for early detection of R. equi disease in foals, J. Clin. Microbiol, 2001, 39, 1633– 1637. 40. Von, B.K., Polidori, M., Becken, U., Rhodococcus equi virulence- associated protein A is required for diversion of phagosome biogenesis but not for cytotoxicity, Infect Immun, 2009, 77, 5676–5681. 41. Vuillermin, P.J., Ponsonby, A.L., Saffery, R., Tang, M.L., Ellis, J.A., Sly, P., Holt, P., Microbial exposure, interferon gamma gene demethylation in naive T-cells, and the risk of allergic disease, Allergy, 2009, 64, 348-353. 42. Witkowski, L., Kaba, J., Rzewuska, Magdalena, Nowicki, M., Szalu´s- Jordanowc, Olga, Kita ,J., Development of ELISA test for determination of the level of antibodies against Rhodococcus equi in equine serum and colostrum, Veterinary Immunology and Immunopathology, 2012, 149, 280– 285. 43. Yager, J.A., Prescott, C.A,. Kramar, D.P., The effect of experimental infection with Rhodococcus equi on immunodeficient mice. Vet microbiology, 1991, 28, 363-376. 44. Yuyama, T., Yusa, S., Yoshizumi, K., Yamano, S., Murata, S., Hirose, T., Osanai, R., Onishi, Y., Osato, S., Sasaki, C., Sasaki, Y., Kakuda, T., Tsubaki, S., Takai, S., Molecular epidemiology of VapA-positive Rhodococcus equi in thoroughbred horses in Kagoshima, Japan, J. Vet. Med. Sci, 64, 2002, 715–718.

159

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

IDENTIFICATION OF ANTIBODIES AGAINST RHODOCOCCUS EQUI IN HORSES FROM DIFFERENT REGIONS OF ROMANIA USING AN IN HOUSE ELISA. FIRST REPORT

D. A. NAGY1, L. WITKOWSKY2, ANAMARIA IOANA PAŞTIU1, MARINA SPÎNU1, J. KABA2, GH. F. BRUDAŞCĂ1

1University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Veterinary Medicine, Infectious Diseases Department, 3-5 Calea Mănăştur, 400372 Cluj-Napoca, Romania 2Division of Infectious Disease and Epidemiology, Department of Large Animal Disease with the Clinic, Faculty of Veterinary Medicine, Warsaw University of Live Science, Nowoursynowska 159c, 02-776 Warsaw, Poland E-mail: [email protected]

Summary

Rhodococcus equi infection occurs worldwide and is one of the major causes of foal mortality during the first six months of life. The use of serogical tests in diagnosing equine rhodococcosis is limited; however, they play crucial role in immunological studies and potential control of the outbreaks. The objective of this study was to investigate the presence and levels of the antibodies against Rhodococcus equi in equine sera in different points of Romania, using an in house ELISA test. For that, a bacterial cell lysate was used as antigen. The technique involved in establishing the anti-Rhodococcus equi antibody levels in sera from Romanian horses was previously standardized in Poland on 175 sera. The positive and negative control sera were used to establish the concentration of the antigen on the plates. Subsequently, sera from 435 horses located in different regions of Romania were tested. The tests were carried out at SGG Warsaw, Poland between May and July 2013. The results were calculated in ELISA units, as percentages of the difference between the positive and negative controls. Most of the horses tested positive (74.59%). The results supported the presence of antibodies against Rhodococcus equi in Romanian horses at different levels. This is the first alert that indicates the presence and individual variability of anti- Rhodococcus equi antibodies in equine in Romania. Key words: ELISA, Rhodococcus equi, rhodococcosis, serology, equine

Rhodococcus equi is a saprophytic soil inhabitant and is widespread in the environment. Although all horses are likely to be infected with R. equi, the degree of infection on farms may vary from sporadic to enzootic, where more than 40% of horses are infected. Rhodococcus equi is an emerging pathogen, and infection with these bacteria produce important losses in foals, in the first 6 months of life. The clinical manifestations, less common, of R. equi infection in foals include ulcerative enterocolitis, colonic or mesenteric lymphadenopathy, immune-mediated synovitis and uveitis, osteomyelitis, and septic arthritis (1).

160

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The most common diagnostic method to identify R. equi is bacteriology from tracheo-bronchial aspirate, but this technique is not recommended for foals that present severe respiratory distress, and also, this technique cannot be used for routine diagnosis in enzootic outbreaks, because several foals must be sampled. For these reasons a less invasive and more practical method of diagnosis is needed. Although several assays for detection of antibody against R. equi have been developed and these assays were commonly used by practicing veterinarians for the diagnosis of R. equi infections, the diagnostic value of these methods has never been assessed in a clinical setting of heavy natural challenge (5). In the last years numerous ELISA type serological tests have been developed for identification of antibody against R. equi (2, 3, 4, 5, 6, 7), such as: ELISA-6939, ELISA-33701, ELISA-VapA (8, 9, 10, 11) and other ELISA tests (9, 12, 13, 14). The most used serological tests were ELISA-6939, ELISA-33701 and ELISA-VapA. ELISA-6939 and ELISA-33701 were develop by Takai et al. (15) and used antigen obtained by extraction from a non-virulent strain R. equi ATCC 6939 and a virulent strain ATCC 33701. For ELISA VapA an extract of R. equi, involving Triton X 114 detergent, where the plasmid VapA was the dominant component was used as antigen (4, 10, 11, 13, 16). ELISA California used lyophilized supernatant of the culture of various R. equi strains (12). Other serological test are based on autoclave resistant antigen, recombinant VapA, soluble antigen of R. equi, synthetic Vaps: A, D, F and G, whole bacterial cells or synthetic protein PN11-14 (14, 17, 18,). However, most of the ELISA tests were used for the study of the vaccines‘ efficacy, and their application for diagnosis of equine rhodococcosis is questionable. The aim of this study was to perform and develop an enzyme-linked immunosorbent assay (ELISA), to identify the antibodies against R. equi in unvaccinated adult horses from Romania. This study was performed in SSG Warsaw, Poland.

Materials and methods

Serum samples Serum samples from 437 unvaccinated horses of different ages were collected from three different regions of Romania (284 samples from Danube Delta, 81 samples from Sibiu and 92 samples from Satu Mare) between 2011 and 2012. Most of the horses originated from the small farm system. Horses serologically positive for equine infectious anemia virus (EIAV) were also included in the study. Blood was drawn from the jugular vein and serum samples were transferred to Eppendorf tubes and kept in a freezer at -80°C until testing. Enzyme-linked immunosorbent assay (ELISA) Rhodococcus equi antibodies were detected by ELISA method, using as antigen a virulent R. equi strain (AA 15/03). The antigen was obtained from purulent pneumonia lesions of an 8 week-old Thoroughbred foal, by the method 161

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA described by Witkowski et al. (11). The antigen was produced by bacterial cell lysis, method described by Kaba et al. (19). API Coryne and API ZYM test (BioMeriuex, Marcy l‘Etoile, France) were used to isolate the strain. Similarly, CAMP (Christie, Atkins, and Munch-Peterson) test with Staphylococcus aureus strain (ATCC- 25923) was performed to detect ―equi factor‖. For detection of the VapA virulence protein, the method described by Takai et al. (16) was used. Protein detection was performed using QuantiProBCA Assay Kit (SIGMA, St. Luis, USA). The absorbance was measured by spectrophotometry at a wavelength of 562 nm (Epoch, Biotek instruments, Winooski, USA). Positive and negative controls were performed after the method described by Takai et al. (2). The positive control was obtained from a 15-weeks-old Thoroughbred foal with rodococcosis, confirmed by bacteriological exam from tracheobronchial aspirate. The negative control was obtained from a 13-weeks old Hucul breed foal from a horse farm with no history of rodococcosis in the last 10 years. PolySorp 96-well microtiter plates (Nunc, Roskilde, Denmark) were used for coating. The antigen was diluted from 1:5000 to 1:10000 (concentration of protein 11.75 µg/ml) in citrate as a coating buffer (pH 6.0) and incubated for 16-20 hours at room temperature. Plates were washed three times with PBS-T (PBS, pH 7.2, 0.05% Tween-20) using automatic plate washer (Columbus Washer, TECAN, Mannedorf, Switzerland). After coating with the antigen, the plates were sealed and stored at 4ºC. The serum samples and controls (positive and negative) were diluted 1:100 in PBS supplemented with 10% fetal bovine serum (Biomed, Lublin, Poland) and added to the plates (100µl). The sera were tested in duplicate. After serum incubation (37°C for 1 h) and washing for three times with PBS-T in the automatic plate‘s washer, the biotin-conjugate rabbit anti-horse IgG (whole molecules) (SIGMA BIOTIN, B-7515) diluted 1:5000 in PBS was added. The plates were incubated with stirring (37 ºC for 30 minutes) and washed three times with PBS-T in the automatic plate‘s washer. Horseradish peroxidase (100µl – K2) (JIR - Jackson ImmunoResearch Laboratories), diluted 1:100 in PBS was added and the plates were incubated with shaking at room temperature for 15 minutes. The plates were washed. As substrate ABTS (2,2‘-azino-di-[3-etylo-benzathiazoline-6-sulfonic acid]) º (SIGMA) with 0.002% H2O2 was used. After incubation at 37 C for 15 minutes optical density (OD) values were measured at 410 nm on a spectrophotometer (Sunrise, TECAN). The difference between positive and negative control OD was >0.5. The OD of duplicated samples was averaged (OD sample) and analyzed in relation to negative (ODnegative) and positive (ODpositive) controls according to the formula: ELISA units (EU) = (ODsample − ODnegative)/(ODpositive − ODnegative) × 100 (11, 24).

162

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and discussions

The aim of this study was to develop an ELISA technique suitable to identify the level of antibodies against R. equi in serum samples from unvaccinated horses. Due to the substantial similarity in the construction of the cell wall of R. equi and C. pseudotuberculosis the antigen was obtain by the method described by Kaba et al (19) and Witkowski et al (11). In the present research an ELISA VapA assay for detection of IgG antibodies against the highly immunogenic protein VapA was developed after the method described by Takai et al. (15) and changed by Takai et al (20, 21), Witkowski et al (11). In the majority of ELISA tests developed until now, the target antigen is unknown (4, 9, 10, 17). The electrophoretic separation showed that the 15–17 kDa antigen bands correspond to the protein VapA (11). All samples with an OD with 0.5 higher than negative control were considered positive. Because there is no standard ELISA assay for detection of antibodies against R. equi, we have set random cut-offs (25%, 35%, 40% and 50%), and then we interpreted the results (7). Using a low value of cut-off (25%), 33.87% (148/437; CI 95% 29.48-38.54) of tested samples were considered positive. The cut-off 50% indicates that in only 6.18% of tested samples were detected IgG antibodies against R. equi (27/437; CI 95% 4.19-8.97). The highest prevalence of anti- R. equi antibodies was obtained in horses samples collected form Satu-Mare County, followed by Danube Delta. Rhodococcus equi can be isolated frequently from sandy soil (22), and in Danube Delta this is the predominant type of soil. Considering that in Satu-Mare the prevalence of antibodies against R. equi is higher than in Danube Delta, we can conclude that the soil does not represent the main favorable factor for the presence of these bacteria. Moreover, by this study confirmed the natural exposure of horses to R. equi. No clinical signs were reported in these horses in our case, contrary to the reports of other authors (9, 18). Nevertheless, there is no connection between the level of antibody and the presence of clinical signs in horses (23). Rhodococcus equi is ubiquitous and seems to develop clinical manifestations only when predisposing factors co-exists (24). In young foals between 1 to 6th month of age, born from unvaccinated mares, susceptibility to contamination and clinical onset of the disease is much higher. This study demonstrated the presence of antibodies against R. equi in serum samples collected from unvaccinated horses. Moreover, the passive immunity is transmitted from mares to foals, by colostrum after foaling. The level of maternal antibodies was lower, but seemed to be high enough for the protection of young foals (11).

163

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 1 Prevalence of antibodies against R. equi at different cut-off levels Location No. of samples Frequency Prevalence % CI 95% Cut-off 25% Sibiu 92 4 4.35 1.20-10.76 Satu-Mare 81 53 65.43 54.04-75.66 Danube Delta 264 91 34.47 28.75-40.54 TOTAL 437 148 33.87 29.48-38.54 Cut-off 35% Sibiu 92 1 1.09 0.03-5.91 Satu-Mare 81 28 34.57 24.34-45.96 Danube Delta 264 46 17.42 13.05-22.55 TOTAL 437 75 17.16 13.81-21.10 Cut-off 40% Sibiu 92 0 0 100-100 Satu-Mare 81 21 25.93 16.82-36.86 Danube Delta 264 25 9.47 6.22-13.66 TOTAL 437 46 10.53 7.89-13.88 Cut-off 50% Sibiu 92 0 0 100-100 Satu-Mare 81 14 17.28 9.78-27.30 Danube Delta 264 13 4.92 2.65-8.27 TOTAL 437 27 6.18 4.19-8.97

The ELISA test could be used for the quantification of the level of specific antibodies against R. equi in sera from horses and proved to be useful in evaluation of vaccine efficacy. Still, the applicability in practice of this test is questionable because it could fail in confirming the clinical diagnosis of rhodococcosis (11).

Conclusions

The highest prevalence of anti- R. equi antibodies was obtained in horses samples collected form Satu-Mare County, followed by Danube Delta. The ELISA test could be used for the quantification of the level of specific antibodies against R. equi in sera from horses and proved to be useful in evaluation of vaccine efficacy.

164

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

References

1. Giguere, S., Hondalus, M. K., Yager, J. A., Darrah, P., Mosser, D. M., Prescott, J. F., Role of the 85-kilobase plasmid and plasmid-encoded virulence- associated protein A in intracellular survival and virulence of Rhodococcus equi, Infect. Immun. 67, 1999, 3548–3557. 2. Takai, S., Kawazu, S., Tsubaki, S., Immunoglobulin and Specific Antibody Responses to Rhodococcus (Corynebacterium) equi Infection in Foals as Measured by Enzyme-Linked Immunosorbent Assay, Journal Of Clinical Microbiology, 1986, 23-5, 943-947. 3. Takai, S., Hidaka, D., Fujii M., Shindoha, Y., Murata, T., Nakanishi S., Sasaki, Y., Tsubaki, S., Kamada M., Serum antibody responses of foals to virulence-associated 15- to 17-kilodalton antigens of Rhodococcus equi, Veterinary Microbiology 1996, 52, Issues 1–2, 63–71. 4. Prescot, J. F., Fernandezt, A. S., Nicholson, V. M., Patterson, M. C., Yagers, J. A., Viels, L., Perklnst, G., Use of a virulence-associated protein based enzyme-linked immunosorbent assay for Rhodococcus equi serology in horses, Equine Veterinary Journal Equine, 1996, 28 (5), 344- 349. 5. Martens, R. J., Cohen, N. D., Chaffin, M. K., Takai, S., Doherty, C. L., Angulo, A. B., Edwards, R. F., Evaluation of 5 serologic assays to detect Rhodococcus equi pneumonia in foals, Journal of the American Veterinary Medical Association, 2002, 221, 6, 825-833. 6. Martens, R. J., Cohen, N. D., Chaffin, M. K., Takai, S., Doherty, C. L., Angulo, A. B., Edwards, R. F., Rhodococcus equi Foal Pneumonia: Failure of Serologic Tests to Accurately Detect Disease, AAEP Proceedings, 2002, 48, 122-123. 7. Giguere, S., Hernandez, J., Gaskin, J., Prescott, J. F., Takai, S., Miller, C., Performance of Five Serological Assays for Diagnosis of Rhodococcus equi Pneumonia in Foals Clinical And Diagnostic, Laboratory Immunology, 2003, 10, no. 2, 241–245. 8. Anzai, T., Wada, R., Nakanishi, A., Kamada, M., Takai, S., Shindo, Y., Tsubaki, S., Comparison of tracheal aspiration with other tests for diagnosis of Rhodococcus equi pneumonia in foals, Veterinary Microbiology, 1997, 56, 335-345. 9. Cauchard, J., Taouji, S., Sevin, C., Duquesne, F., Bernabe, M., Laugier C., Ballet, J.J., Immunogenicity of synthetic Rhodococcus equi virulence- associated protein peptides in neonate foals, Int. J. Med. Microbiol, 2006, 6, 389–396. 10. Hooper-McGrevy, K.E., Wilkie, B.N., Prescott, J.F., Virulence-associated protein-specific serum immunoglobulin G-isotype expression in young foals protected against Rhodococcus equi pneumonia by oral immunization with virulent R. equi, Vaccine, 2005, 23, 5760–5767.

165

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

11. Witkowski, L., Kaba, J., Rzewuska, Magdalena, Nowicki, M., Szalu´s- Jordanowc, Olga, Kita, J., Development of ELISA test for determination of the level of antibodies against Rhodococcus equi in equine serum and colostrum, Veterinary Immunology and Immunopathology, 2012, 149, 280– 285. 12. Hietala, S. K., Ardans A. A., Sansome A., Detection of Corynebacterium equi-specific antibody in horses by enzyme-linked immunosorbent assay, Am. J. Vet. Res, 1985, 46, 13–15. 13. Hooper-McGrevy, K.E., Giguere, S., Wilkie, B.N., Prescott, J.F., Evaluation of equine immunoglobulin specific for Rhodococcus equi virulence-associated proteins A and C for use in protecting foals against Rhodococcus equi-induced pneumonia. Am. J. Vet. Res. 2001, 62, 1307– 1313. 14. Taouji, S., Breard, E., Peyret-Lacombe, A., Pronost, S., Fortier, G., Collobert-Laugier C., Serum and mucosal antibodies of infected foals recognized two distinct epitopes of VapA of Rhodococcus equi, FEMS Immunol. Med. Microbiol, 34, 2002, 299–306. 15. Takai, S., Kawazu, S., Tsubaki, S., Enzyme-linked immunosorbent assay for diagnosis of Corynebacterium (Rhodococcus) equi infection in foals, American Journal of Veterinary Research 1985, 46, 2166-2170. 16. Takai, S., Vigo, G., Ikushima, H., Higuchi, T., Hagiwara, S., Hashikura, S., Sasaki, Y., Tsubaki, S., Anzai, T., Kamada, M., Detection of virulent Rhodococcus equi in tracheal aspirate samples by polymerase chain reaction for rapid diagnosis of R. equi pneumonia in foals, Vet Microbiol., 1998, 15;61(1-2), 59-69. 17. Hooper-McGrevy, K.E., Wilkie, B.N., Prescott, J.F., Immunoglobulin G subisotypes responses of pneumonic and healthy exposed foals and adult horses to Rhodococcus equi virulence-associated proteins. Clin. Diagn. Lab. Immunol, 2003, 10, 345–351. 18. Phumoonna, T., Muscatello, G., Chicken, C., Gilkerson, J. R., Browning, G. F., Barton, M. D., Heuzenroeder, M. W., Clinical evaluation of a peptide-ELISA based upon N-terminal B-cell epitope of the VapA protein for diagnosis of Rhodococcus equi pneumonia in foals, J. Vet. Med, 2006, B 53, 126–132. 19. Kaba, J., Kutschke, L., Gerlach, G.F., Development of an ELISA for the diagnosis of Corynebacterium pseudotuberculosis infections in goats. Vet. Microbiol., 2001, 78, 155–163. 20. Takai, S., Koike, K., Ohbushi, S., Izumi, C., Tsubaki, S., Identification of 15- to 17-Kilodalton Antigens Associated with Virulent Rhodococcus equi, Journal Of Clinical Microbiology, 1991, 29-3, 439-443. 21. Takai, S., Iie, M., Watanabe, Y., Virulence-associated 15- to 17-kilodalton antigens in Rhodococcus equi: Temperature dependent expression and location of the antigens, Infect Immun, 1992, 60, 2995–2997.

166

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

22. Prescott, J. F., Rhodococcus equi: an Animal and Human Pathogen, Clinical Microbiology Reviews, 1991, 4-1, 20-34. 23. Cuteri, V., Takai, S., Moscati, L., Battistacci, L., Pieramati, C., Valente C., A serological survey of Rhodococcus equi infection in foals in central Italy: comparison of two antigens using an ELISA test, Comp Immunol Microbiol Infect Dis., 2003, 26(1), 17-23. 24. Dawson, T., Horohov, W. D., Meijer W. G., Muscatello, G., Current understanding of the equine immune response to Rhodococcus equi. An immunological review of R. equi pneumonia, Veterinary Immunology and Immunopathology, 2010, 135, 1–11.

167

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH REGARDING THE ANTIBACTERIAL ACTIVITY OF ACID-SOLUBLE CHITOSAN

ILEANA NICHITA1, E. TÎRZIU1, R. V. GROS1, MONICA ȘEREŞ1, ADRIANA MORAR1, DANIELA MOT2, ADRIANA POPA3, CLADIA SALA1

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Animal Science and Biotechnology 3Timisoara Chemistry Institute of Romanian Academy E-mail: [email protected]

Summary

The paper presents the results of the antimicrobial activity of chitosan. Chitosan is a copolymer of glucosamine and N-acetylglucosamine prepared from chitin by deacetylation. It is a natural and non toxic product that is widely-used in medicine and food industry. The antimicrobial effect was tested against the representative Gram-positive bacteria: Staphylococcus aureus and Bacillus cereus and Gram-negative bacteria: Escherichia coli and Pseudomonas aeruginosa and one specie of yeast: Candida albicans. Results obtained proved that chitosan exhibited a good antimicrobial effect on tested microorganisms. Key words: chitosan; antimicrobial activity

Chitosan was the subject of various researches during past few decades (1, 4, 6). Chitosan is a copolymer of glucosamine and N acetylglucosamine, prepared from chitin by deacetylation, being considered a natural and non toxic product. It has a high molecular weight, a poor solubility at neutral pH and a high viscosity in solution (7). Chitosan was considered an important source of bioactive material but its use in food, cosmetics and health industry is still limited (5, 7, 8). In different studies was reported that the antimicrobial activities of chitosan are greatly dependent on its physical characteristics, especially on molecular weight (Mv) and degree of deacetylation (DD). Chitosan with a higher degree of deacetylation tends to have a higher antimicrobial activity (1, 9). In this study, are presented the results of the tests on antimicrobial activities of chitosan against two Gram-positive bacteria (Staphylococcus. aureus - ATCC 25923 and Bacillus cereus - ATCC 11778) and two Gram-negative bacteria (Escherichia coli - ATCC 25922 and Pseudomonas aeruginosa - ATCC 27853), and one specie of yeast of Candida albicans - ATCC 10231.

168

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Materials and methods

The antimicrobial activity of the chitosan was tested on four standard bacteria strains (MediMark Europe Company, France): two Gram-positive bacteria – S. aureus (ATCC 25923) and B. cereus (ATCC 11778) and two Gram-negative bacteria – E. coli (ATCC 25922) and P. aeruginosa (ATCC 27853), and on a strain of C. albicans (ATCC 10231). Standard microbial cultures were maintained in laboratory conditions, at 4°C, in tubes with Mueller-Hinton broth (Oxoid) for bacteria and Sabouraud dextrose broth for yeasts. For this tests, active cultures (24 h old for bacteria and, respectively, 48 h for yeast) were prepared and all these cultures were diluted 1: 1000. In the first step, chitosan solution was prepared in 1 % (v/v) acetic solution acid at a concentration of 1% (w/v). After that, serial dilutions were prepared for final concentration of 0.5, 0.25, 0.1, 0.05, 0.025, 0.01, and 0.005, and autoclaved at 121 ºC for 25 min. 1 ml of bacteria nutrient broth (beef extract 5 g, peptone 10 g to 1000 ml distilled water, pH 7.0) was added in test tubes and then 0.5 ml of investigated dilution was added. Subsequently, 0.5 ml of each bacteria specie culture (diluted as was anterior described) was added to the test tubes. In the case of C. albicans was used Sabouraud dextrose broth. Tubes with different dilution of chitosan and bacteria suspension were incubated at 37 ºC for 24 hours. The inhibitory effect was estimated after the incubation period. From each tube that contained bacteria culture and different chitosan concentrations was inoculated with on loop on the surface of nutrient agar (and Sabouraud for C. albicans) purred in Petri dishes. All these were incubated at 37 ºC for 24 hours. The presence of the colony on the surface of nutrient agar and Sabouraud was considered as the absence of the inhibitory effect of chitosan for that concentration. In the same time, the acetic solution acid 1% (w/v) was tested to observe if it has antimicrobial affect.

Results and discussions

The results obtained on antimicrobial tests of chitosan are presented in table 1. The antibacterial activity of chitosan was obtained at the concentration of 0.025% for S. aureus and at 0.05% against B. cereus. Regarding the antibacterial activity of chitosan against species E. coli and P. aeruginosa were obtained results at the concentration of 0.025 %. On the yeast specie tested, chitosan manifested a good antimicrobial activity at the concentration of 0.1%. In this study chitosan had better antibacterial activity against Gram negative bacteria tested than Gram positive ones.

169

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 1 Antimicrobial results of chitosan Microbial Chitosan concentration (%) species tested 1 0.5 0.25 0.1 0.05 0.025 0.01 0.005 S. aureus + + + + + - - - B. cereus + + + + - - - - E. coli + + + + + + - - P. aeruginosa + + + + + + - - C. albicans + + + + - - - - Legend: + Presence of the antimicrobial activity; - Absence of the antimicrobial activity

The results obtained in this study are similar with others authors (2, 3). Allan and Hadwiger, 1974 (2), have found that 1% solution of chitosan in 1% of acetic acid had completely inhibited growth of Candida tropicalis. That study corresponded to our results- chitosan was highly active against Candida albicans as well. The mechanism underlying the inhibition of bacterial growth, is thought to be that the cationically charged amino-group may combine with anionic components such as N-acetylmuramic acid, sialic acid and neuraminic acid, on the cell surface, and may suppress bacterial growth by impairing the exchanges with the medium, chelating transition meal ions and inhibiting enzymes. Regarding the antimicrobial action of chitosan there are controversial results. Some authors reported stronger effects of chitosan on Gram-positive bacteria (e.g. Listeria monocytogenes, Bacillus megaterium, B. cereus, Staphylococcus aureus, Lactobacillus plantarum, L. brevis, L. bulgaris, etc.) than for Gram-negative bacteria (e.g. E. coli, Pseudomonas fluorescens, Salmonella typhymurium, Vibrio parahaemolyticus, etc.) (4). This aspect was explained by the fact that gram negative bacteria have a higher hydrophilicity than gram- positive bacteria, making them most sensitive to chitosan. This is due to the charge density on the cell surface that is a determinant factor to establish the amount of adsorbed chitosan. More adsorbed chitosan would evidently result in greater changes in the structure and in the permeability of the cell membrane (4). Also, studies done on the antimicrobial action of chitosan present that its molecular weight (MW) and the degree of acetylation (DA) of this substance are important factors in determining such activity. In general the lower the MW and the DA, the higher will be the effectiveness on reducing microorganism growth and multiplication (4). The antifungic mechanism of chitosan is explained by its interfering with the cell wall morphogenesis in case of yeast and with directly interfering with fungal growth in case of fungi. It seems that chitosan oligomers diffuse inside of hyphae and is interfering on the enzymes activity responsible for the fungus growth (4).

170

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

Chitosan had a good antimicrobial action of all tested species. The antimicrobial activity of chitosan was better against Gram negative bacteria comparatively with Gram positive ones. Chitosan had better antibacterial activity than antifungal activity.

References

1. Acharya, B., Kumar, V., Varadaraj, M. C., Lalitha, R., & Rudrapatnam, N., Characterization of chito-oligosaccharides prepared by chitosanolysis with the aid of papain and pronase, and their bactericidal action against Bacillus cereus and E. coli. Biochemical Journal, 2005, 391, 167-175. 2. Allan C.R., Hadwigar L.A., Studies on the fungistatic activity of chitosan. Exp. Mycology, 1974, 3, 258-260. 3. Balicka - Ramisz Aleksandra, Wojtasz-Pajak Anna, Pilarczyk Bogumila, Ramisz A., Laurans L., Antibacterial and antifungal activity of chitosan, ISAH - Warsaw, Poland, 2005, 2, 406-408. 4. Goy R. C., De Britto D., Assis O. B. G., A Review of the Antimicrobial Activity of Chitosan. Polímeros: Ciência e Tecnologia, 2009, 19, 3, 241- 247. 5. Khanafari, A., Marandi, R., Sanatei, Sh., Recovery of chitin and chitosan from shrimp waste by chemical and microbial methods. Iranian Journal of Environmental Health Science and Engineering, 2008, 5, 1, 19-24. 6. Kong, M., Chen, X. G., Ke Xing K, Park, H. J., Antimicrobial properties of chitosan and mode of action: A state of the art review. International Journal of Food Microbiology, 2010, 144, 1, 51–63. 7. Li, Q., Dunn, E. J., Grandmaison, E. W., Goosen, M. F. A., Applications and properties of chitosan. Journal of Bioactive and Compatible Polymers, 1992, 7(4), 370-397. 8. Limam, Z., Selmi, S., Sadok, S., El-abed, A., Extraction and characterization of chitin and chitosan from crustacean by-products: biological and physicochemical properties. African Journal of Biotechnology, 2011, (4), 640 - 647. 9. Wang, X., Du, Y., Liu, H., Preparation, characterization and antimicrobial activity of chitosan–Zn complex, Carbohydrate Polymers, 2004, 56, 21–26.

171

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CLASSICAL CHARACTERIZATION OF E. COLI ISOLATED FROM LAYING HENS

MIHAELA NICULAE, EMOKE PALL, CARMEN DANA ȘANDRU, ANAMARIA IOANA PAȘTIU, C.I. MATEȘ, C. CERBU, R. GIUPANĂ, MARINA SPÎNU

University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine, 400372, Calea Mănăștur Street, no 3-5,Cluj-Napoca, România [email protected].

Summary

Outbreaks of Escherichia coli infection in poultry are reported worldwide and the main feature of these pathologies is represented by significant economic losses associated with high morbidity and mortality, elevated costs for antimicrobial therapy and control measures. In case of laying hens, the egg production may diminish, but the most important consequence refers to the irreversible lesions affecting both the genital tract (salpingitis) and other internal organs. This paper was aimed to isolate, identify and characterize avian pathogenic Escherichia coli (APEC) responsible for two severe outbreaks of mortality in two related laying hens farms from North Transylvania, that reported sudden death (from 1 to 5% daily during one week) in spite of two distinct antimicrobial treatments using broad spectrum antimicrobials administered with the drinking water. The dead carcasses presented severe lesions of fibrinous polyserositis, perihepatitis, pericarditis, salpingitis and vitellin peritonitis, used as samples for the isolation of E. coli strains on selective agar (Brilliance™ E. coli/coliform Selective Agar, Oxoid). After the biochemical properties testing, the isolated strains were serotyped and the antimicrobial in vitro susceptibility was evaluated using Kirby- Bauer method according to CLSI guidelines. The results indicated the presence of two serotypes: O2:K1 and O1:K1, both with an extreme level of antimicrobial resistance exhibited towards: amoxicillin, amoxicillin and clavulanic acid, colistin, tetracycline, doxycycline and enrofloxacin. Susceptibility was recorded only in case of florfenicol and lincomycin with neomycin. The existence of multiple antimicrobial resistance underlines the importance of rational use of antibiotics. Keywords: E. coli, laying hens, serotyping, multiple antimicrobial resistance

E. coli associated infections in poultry are known as avian colibacillosis, a generic name including severe pathologies affecting all ages (one day old chicken, adults), breeds and productive categories (broilers, layers, parents), primarily related with lack of hygiene and poor welfare, concurrent diseases such as viral respiratory diseases and immunosuppressive diseases (bursal disease) and with varied clinical signs (neonatal septicaemia, omphalitis, enteritis, serofibrinous polyserositis, peritonitis, salpingitis, opphoritis, cellulitis, arthritis, osteomyelitis, osteonecrosis, coligranuloma (6). Given the worldwide distribution in poultry industry and the substantial economic losses linked to relatively increased morbidity and mortality of both primary and secondary pathologies determined by 172

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

E. coli, avian colibacillosis is listed among the major bacterial diseases affecting chicken (9). In the past, the recommended control measures in case of Escherichia coli outbreaks in poultry were focused on the control of the organism by the use of antimicrobials. Currently, due the reduced efficacy of the antimicrobial therapy related to the increased antimicrobial resistance level displayed by E. coli strains, other measures are considered in order to decrease the level of infection and most of them target the other two key elements of the epidemiological triangle: the host and the environment (to reduce the susceptibility of the host, live E. coli vaccine are commercially available, to reduce the environmental contamination, hygiene and disinfection are performed etc) (6). Regarding the use of antimicrobials, several scientific studies pointed out the elevated level of antimicrobial resistance developed by E. coli strains as a response to the intensive antimicrobial treatment (3,5,11,13). Thus, beside the financial consequences of various disease conditions, also public health risks are considered in the view of the potential transfer and spread of the avian E. coli multiresistant strains to human (14). This paper was aimed to isolate, identify and characterize avian pathogenic Escherichia coli (APEC) responsible for two severe outbreaks of mortality in two related laying hens farms from North Transylvania, Romania.

Materials and methods

The samples considered for the study were collected from two related laying hens farms from North Transylvania that reported severe outbreaks of mortality, with sudden death (from 1 to 5% daily during one week) in spite of two distinct antimicrobial treatments using broad spectrum antimicrobials administered with the drinking water. All these samples were collected during necropsy and consisted of organs presenting lesions of fibrinous polyserositis, perihepatitis, pericarditis, salpingitis and vitellin peritonitis. The performed microbiological methods were the isolation of bacterial strains on a selective chromogenic agar (Brilliance™ E. coli/coliform Selective Agar, Oxoid) and the in vitro antimicrobial sensitivity testing towards 9 antimicrobial drugs using Kirby-Bauer method according to CLSI guidelines. E. coli ATCC 25922 was tested as a quality control organism. Results were statistically analyzed using Student‘s t-test, with a significance level of (p <0.05) All isolated E. coli strains were serotyped using specific antiserum against antigens O and K.

173

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and discussions

The results indicated for both farms the presence of two serotypes: O2:K1 and O1:K1. Most of the tested E. coli strains exhibited antimicrobial resistance involving one or several active substances of the commercial products commonly used in poultry farms, with the highest resistance level recorded for: colistin (100%), tetracycline (90% and 100%), ampicillin (90% and 100%), amoxicillin (60% and 83.33%). Lower resistance was noticed for doxycycline (60% and 58.33%), amoxicillin and clavulanic acid combination (58.33%) (fig. 1). The level of the antimicrobial resistance and also the susceptibility were very similar when comparing the two farms, except for amoxicillin and clavulanic acid combination, florfenicol and enrofloxacin – the calculated percentages varied significantly (p <0.05) (fig. 1).

Fig. 1. Antimicrobial resistance level in case of avian E. coli strains

Multidrug resistant phenotypes (resistance to more than 4 antimicrobials) were established when analyzing the antimicrobial resistance profile of strains isolated from both farms. The number of the antimicrobials active against isolated avian E. coli strains was limited and included only fluoroquinolones (enrofloxacin), florfenicol and lincomycin/neomycin combination. Escherichia coli is regarded as one of the main inhabitants of the intestinal tract of many species of mammals and birds (3,4,7), but also as one of the most widespread pathogens worldwide, causing serious episodes of enteric or non- 174

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA enteric diseases in both animals and humans (5,8,12). For this context, the complex epidemiology of E. coli infections underlines the importance of animals as the source of infection for human, with a solid scientific proof demonstrated in case of pets (cats and dogs) (1,4,10) and most importantly – farm animals (cattle, pigs and poultry)(2,3,11,12). The last mentioned category of animals represents a key element of the human exposure with the isolation of pathogenic strains, such as Shiga toxin-producing E. coli (STEC), also called verotoxinogenic E. coli, that usually do not determine diseases in animals, while in people are associated initially with digestive pathologies that have the potential to complicate with life threatening disturbances (watery diarrhoea, haemorrhagic colitis, dehydration, and/or haemolytic uraemic syndrome) (7,8,11,12,13). Among the farm animals, cattle are generally suggested as most important reservoir of zoonotic STEC (7) and several studies indicated the positive isolation of these strains in bovine feces (2,3,13), thus the people exposure is related to the consummation of the foods (animal-derived products, vegetables) or water contaminated with animal faeces, or to direct contact with the infected animals or their environment (2, 5,7,11). Animals do not represent just the reservoir of zoonotic bacteria, but also of multiresistant bacteria and E. coli strains are currently among the most important organism able to develop antimicrobial resistance as a response to the intensive and irrational use of antimicrobials (3,5,11,13). To control E. coli associated diseases in case of farm animals, the use of antimicrobial should not be considered as the only tool, since there various epidemiological links that generate the spread and the persistence of the infections and also allow the human exposure with potential pathogenic bacteria that usually prove to manifest multiple antimicrobial resistance. Given the scientific data reporting the augmentation of the antimicrobial resistance level, the antimicrobial treatment regimen should be considered based on the results of the antimicrobial susceptibility testing and after a complex analysis of the cost-benefit ratio. The use of antibiotics in poultry was reported to be associated with increased AMR in enteric bacteria and E. coli is regarded as one of the most important pathogens from this category. Most of the Romanian poultry farms adopt and maintain an intensive antibacterial therapy regimen leading to a drug selection pressure, as the results of this study are pointing out.

Conclusions

These results indicate the presence and level of the antimicrobial resistance in case of the tested strains. The high rate of resistant E. coli strains and the multidrug- resistant pattern developed most likely as a consequence of intensive use of antibiotics. The effective antimicrobials (drug of choice) are fluoroquinolones (enrofloxacin), florfenicol and lincomycin/neomycin combination.

175

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The existence of multiple antimicrobial resistance reflects the importance of rational and responsible use of antibiotics and highlights the risk associated with human exposure in terms of possible contamination of products - carcasses imposing ensuring food hygiene throughout the chain of production process in order to minimize or eliminate the risk of contamination of the products provided by these farms.

Acknowledgements

This research was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/136893.

References

1. Costa, D., Poeta, P., Sáenz, Y., Coelho, A.C., Matos, M., Vinué, L., Rodrigues, J., Torres, C., Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets. Vet Microbiol., 2008, 127(1-2), 97-105. 2. de Been, M., Lanza, V.F., de Toro, M., Scharringa, J., Dohmen, W., Du, Y., Hu, J., Lei, Y., Li, N., Tooming-Klunderud, A., Heederik, D.J., Fluit, A.C., Bonten, M.J., Willems, R.J., de la Cruz, F., van Schaik, W., Dissemination of cephalosporin resistance genes between Escherichia coli strains from farm animals and humans by specific plasmid lineages. PLoS Genet, 2014,10(12):e1004776 3. Fairbrother, J.M., Nadeau, E., Escherichia coli: on-farm contamination of animals, Rev Sci Tech., 2006, 25(2),555-569. 4. Falgenhauer, L., Schmiedel, J., Ghosh, H., Fritzenwanker, M., Yao, Y., Bauerfeind, R., Imirzalioglu, C., Chakraborty, T., Resistance plasmids in ESBL-encoding Escherichia coli isolates from humans, dogs and cats. Berl Munch Tierarztl Wochenschr, 2014,127(11-12), 458-463. 5. Gai, W., Wang, J., Wang, J., Cui, Z., Qu, Z., Cui, J., Du, X., Huang, X., Zhao, J., Molecular classification and drug resistance analysis of Escherichia coli isolated from poultry in China. Int J Clin Exp Med., 2015,15;8(1),836-844. 6. Gingerich, E., E. coli infections in poultry. Diamond V, 2011,1–4. 7. González Garcia, E.A., Animal health and foodborne pathogens: enterohaemorrhagic O157:H7 strains and other pathogenic Escherichia coli irotypes (EPEC, ETEC, EIEC, EHEC). Pol J Vet Sci., 2002,5(2),103- 115. 8. Kazemnia, A., Ahmadi, M., Dilmaghani, M., Antibiotic resistance pattern of different Escherichia coli phylogenetic groups isolated from human

176

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

urinary tract infection and avian colibacillosis. Iran Biomed J., 2014, 18(4), 219-224. 9. Lutful Kabir, S.M., Avian colibacillosis and salmonellosis: a closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns. Int. J. Environ. Res. Public Health., 2010, 7, 89–114. 10. Nam, H.M., Lee, H.S., Byun, J.W., Yoon, S.S., Jung, S.C., Joo, Y.S., Lim, S.K., Prevalence of antimicrobial resistance in fecal Escherichia coli isolates from stray pet dogs and hospitalized pet dogs in Korea Microb Drug Resist. 2010, 16(1), 75-79. 11. Nhung, N.T., Cuong, N.V,, Campbell, J., Hoa, N.T., Bryant, J.E., Tru, V.N., Kiet, B.T., Jombart, T., Trung, N.V., Hien, V.B., Thwaites, G., Baker, S., Carrique-Mas, J., High levels of antimicrobial resistance among Escherichia coli isolates from livestock farms and synanthropic rats and shrews in the Mekong Delta of Vietnam. Appl Environ Microbiol., 2015, 81(3), 812-820. 12. Norman, K.N., Clawson, M.L., Strockbine, N.A., Mandrell, R.E., Johnson, R., Ziebell, K., Zhao, S., Fratamico, P.M., Stones, R., Allard, M.W., Bono, J.L., Comparison of whole genome sequences from human and non-human Escherichia coli O26 strains. Front Cell Infect Microbiol., 2015, 11, 5, 2. 13. Pereira, R.V., Siler, J.D., Ng, J.C., Davis, M.A., Grohn, Y.T., Warnick, L.D., Effect of on-farm use of antimicrobial drugs on resistance in fecal Escherichia coli of preweaned dairy calves. J Dairy Sci., 2014, 97(12), 7644-7654. 14. Van den Bogaard A.E., London, N., Driessen, C., Stobberingh, E.E., Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers J. Antimicrob. Chemother., 2001, 47(6), 763-771.

177

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

E. COLI SEROTYPES AND THEIR IN VITRO SENSITIVITY TO COMPLEMENT IN FARMED ANIMALS

MIHAELA NICULAE, EMOKE PALL, CARMEN DANA ȘANDRU, ANAMARIA IOANA PAȘTIU, C.I. MATEȘ, C. CERBU, R. GIUPANĂ, L. KOBOLKUTI, MARINA SPÎNU

University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine, 400372, Calea Mănăștur Street, no 3-5,Cluj-Napoca, România [email protected]

Summary

E. coli represents one of the most widespread pathogens worldwide, causing serious episodes of enteric or non-enteric diseases. Such episodes are very difficult to overcome due to the fast course of the disease and also delayed changes in the adaptive immunity. Thus, the importance of non-specific, immediately acting innate immune factors becomes important. This study was aimed to investigate the resistance/sensitivity of E. coli strains isolated from calves with clinical signs of diarrhea (n=10), piglets showing edema disease (n=9) and coligranulomatosis of hens (n=11) to the complement. Microbial samples were subjected to classical isolation techniques using MacConkey and a selective agar (Brilliance™ E. coli/coliform Selective Agar, Oxoid). The strains were confirmed and further characterized by serotyping. Their sensitivity/resistance to complement was evaluated in vitro by a serial dilution technique (1/10, 50µg of complement to 1/80, 6.25µg of complement), using freeze dried Guinea pig complement. All the tubes were inoculated with 35 µl of a 24h bacterial culture of each serotype and the optical densities were determined spectrophotometrically (d=0.5, λ=535 nm) in 96-well plates. The sensitivity of the isolated strains varied with the serotype and concentration of the complement, rather than the species of isolation. The highest efficacy of the complement was observed versus strains O1:K1 isolated from hens (0.107 optical density units, ODU at dilution 1/40) and O8:K25 (0.126 ODU) and O8:K28 (0.110 ODU) isolated from calves with diarrhea, at its highest dilution rate. The highest resistance was recorded in strains isolated from edema disease (O141(H4), 0.522 ODU at the dilution rate of 1/80). The results supported an increased resistance to complement, stressing the enhanced pathogenic potential in the isolated E. coli strains. Key words: E. coli, complement, neonatal diarrhea, edema disease, coligranulomatosis

E. coli represents one of the most widespread pathogens worldwide, causing serious episodes of enteric or non-enteric diseases (3,5,6,7), sometimes with deadly course associated with the lack of efficacy of the antimicrobial therapies in case of infections generated by multidrug-resistant strains, but also with the multiple negative effects of the virulence factors possessed by this organism (7). Such episodes of disease are very difficult to overcome also due to the fast course and also delayed changes in the adaptive immunity. Thus, the role

178

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA of non-specific, immediately acting innate immune factors may be relevant as part of the host defensive response towards the bacterial infections. Listed as an immune system constituent, the complement represents one of the key elements of the immune defense, generally regarded as the first defense line of innate immunity (2,4,8,13,14). Among the multiple roles of the complement, recognition and removal of the bacterial organisms, both Gram positive and Gram negative, are aimed to maintain host homeostasis (2,12) based on a prompt immune surveillance network involving cascade activation of biologically active proteins via three initiating pathways that will trigger other immune reactions and mechanism such as anaphylaxis, chemotaxis, and phagocytosis (1,2,11,12). This study was aimed to investigate in vitro the resistance/sensitivity of E. coli strains isolated from farm animals (calves, piglets and hens) to the complement.

Materials and methods

The evaluation of the susceptibility of E. coli strains towards complement was performed on strains isolated from the following clinical cases: calves with clinical signs of diarrhea (n=10), piglets showing edema disease (n=9) and coligranulomatosis of hens (n=11). All these isolates were obtained by microbiological methods, such as isolation of bacterial strains on a selective chromogenic agar (Brilliance™ E. coli/coliform Selective Agar, Oxoid), biochemical properties testing using API 20E system (BioMerieux SA, Marcy Etoile, France), followed by the serotyping using specific antiserum against antigens O, K and H. E. coli ATCC 25922 was also tested as a quality control organism. The isolated E. coli strains were in vitro investigated for susceptibility towards complement by a serial dilution technique (1/10, 50µg of complement to 1/80, 6.25µg of complement), using freeze dried Guinea pig complement. All the tubes were inoculated with 35 µl of a 24h bacterial culture of each serotype and the optical densities were red spectrophotometrically (d=0.5, λ=535 nm) in 96-well plates. Results were statistically analyzed using Student‘s t-test, with a significance level of (p <0.05)

Results and discussions

Analysing the results of this study (presented in figure 1), the tested E. coli serotypes displayed a reduced level of susceptiblity when exposed to complement. Also, a variation of the in vitro susceptibility of the isolated E. coli strains depending mostly on the serotype, the bacterial inoculum size (A-D) and concentration of the complement, but not on the species of isolation (animal species) was recorded.

179

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Based on the values obtained for the optic density, the highest efficacy of the complement (the lowest turbidity) was observed versus serotypes O1:K1 isolated from hens and O8:K25 and O8:K28 isolated from calves (figure 1). The ability of complement to reduce E. coli proliferation was not affected by the inoculum size (A=1010, B=1020, C=1040, D= 1080). The highest resistance was recorded in strains isolated from pigs presenting clinical signs of edema disease (O141(H4), 0.522 at the dilution rate of 1/80). Certain E. coli serotypes avian (O1:K1) were more sensitive to complement antibacterial properties compared to others and the least susceptible serotype was O141:H4 of swine origin (figure 1).

Fig.1. The in vitro susceptibility of E. coli strains towards complement (bacterial inoculum size: A=1010, B=1020, C=1040, D= 1080, *significant p <0.05)

The intact, unimpaired functionality of the immune system effectors is essential for ensuring host integrity and the complement system plays relevant roles in the innate defense (9). The importance of complement is underline by several scientific studies pointing out the crucial role of C3 activation, the central component of complement, in the host defense towards pathogens, while C3 deficiency is established in subjects with increased susceptibility to develop infections (2,8,11,13,14). However, several bacterial species, most of them with pathogenic potential, have developed complex mechanisms and strategies that allow them to escape and / or obstruct the immune system defensive response (10,13,14). Regarding this aspect, complement evasion was demonstrated for several bacteria and current studies are investigating the mechanisms related to the anti- 180

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA complement activity alone and also together with the anti-serum bactericidal activity. Such results suggest that lipopolysaccharide (LPS) composition, especially the O-antigen polysaccharide chains, increase E. coli and S. typhimurium strains susceptibility to complement-mediated serum bactericidal activity (12).

Conclusions

The sensitivity of the isolated E. coli strains varied with the serotype, the bacterial inoculum size (A-D) and concentration of the complement, rather than the species of isolation. The results supported an increased resistance to complement, stressing the enhanced pathogenic potential in the isolated E. coli strains.

Acknowledgements

This research was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/136893.

References

1. Brekke, O.L., Christiansen, D., Fure, H., Fung, M., Mollnes, T.E., The role of complement C3 opsonization, C5a receptor, and CD14 in E. coli-induced up- regulation of granulocyte and monocyte CD11b/CD18 (CR3), phagocytosis, and oxidative burst in human whole blood. J Leukoc Biol., 2007, 81(6),1404- 1413. 2. Daha, M.R., Role of complement in innate immunity and infections. Crit Rev Immunol., 2010, 30(1), 47-52. 3. de Been, M., Lanza, V.F., de Toro, M., Scharringa, J., Dohmen, W., Du, Y., Hu, J., Lei, Y., Li, N., Tooming-Klunderud, A., Heederik, D.J., Fluit, A.C., Bonten, M.J., Willems, R.J., de la Cruz, F., van Schaik, W., Dissemination of cephalosporin resistance genes between Escherichia coli strains from farm animals and humans by specific plasmid lineages. PLoS Genet, 2014,10(12), e1004776 4. Dunkelberger, J.R., Song, W.C., Complement and its role in innate and adaptive immune responses. Cell Res, 2010, 20, 34–50. 5. Falgenhauer, L., Schmiedel, J., Ghosh, H., Fritzenwanker, M., Yao, Y., Bauerfeind, R., Imirzalioglu, C., Chakraborty, T., Resistance plasmids in ESBL-encoding Escherichia coli isolates from humans, dogs and cats. Berl Munch Tierarztl Wochenschr, 2014,127(11-12),458-463. 6. Herrera-Luna, C., Klein, D., Lapan, G., Revilla-Fernandez, S., Haschek, B., Sommerfeld-Stur, I., Moestl, K., Baumgartner, W., Characterization of virulence factors in Escherichia coli isolated from diarrheic and healthy calves in Austria shedding various enteropathogenic agents. Vet Med, 2009, 54, 1–11. 181

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

7. Kaper, J.B., Nataro, J.P., Mobley, H.L. Pathogenic Escherichia coli. Nat Rev Microbiol., 2004, 2(2), 123-140. 8. Leslie, J.D., Mayor, R., Complement in animal development: unexpected roles of a highly conserved pathway. Semin Immunol., 2013, 25(1), 39-46. 9. Li, Y., Frey, E., Mackenzie, A.M.R., Finlay, B.B., Human Response to Escherichia coli O157:H7 Infection: Antibodies to Secreted Virulence Factors. Clements JD, Infection and Immunity. 2000, 68(9), 5090-5095. 10. Rautemaa, R., Jarvis, G.A., Marnila, P., Meri, S., Acquired Resistance of Escherichia coli to Complement Lysis by Binding of Glycophosphoinositol- Anchored Protectin (CD59). Infection and Immunity, 1998, 66(5),1928-1933. 11. Ricklin, D., Hajishengallis, G., Yang, K., Lambris, J.D., Complement: a key system for immune surveillance and homeostasis. Nat Immunol., 2010, 11(9), 785-797 12. Tomás, J.M., Ciurana, B., Benedí, V.J., Juarez, A., Role of lipopolysaccharide and complement in susceptibility of Escherichia coli and Salmonella typhimurium to non-immune serum. J Gen Microbiol., 1988, 134(4), 1009-1016. 13. Zipfel, P.F., Hallström, T., Riesbeck, K., Human complement control and complement evasion by pathogenic microbes--tipping the balance. Mol Immunol., 2013, 56(3),152-160. 14. Zipfel, P.F., Würzner, R., Skerka, C., Complement evasion of pathogens: common strategies are shared by diverse organisms. Mol Immunol., 2007, 44(16), 3850-3857.

182

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

THE STUDY OF THE MICROBIAL BIOFILM STRUCTURE IN VARIOUS BACTERIAL SPECIES

CLAUDIA SALA1, K. IMRE1, A.A. MORVAY2, ILEANA NICHITA1, ADRIANA MORAR1

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2National Institute of Research – Development in the Pathology Domain and Biomedical Sciences ―Victor Babeş‖, 99-101 Splaiul Independenţei, Bucharest, Romania E-mail: [email protected]

Summary

Bacteria embedded in biofilm are in various stages of growth depending on the location, depth and concentration of nutrients. Limited access within biofilm nutrients reduces the growth rate, which can affect susceptibility to antimicrobials. The aim of this study was to evaluate the characteristic of some bacterial strains and quantification and characterization of microbial biofilm structure utilizing specific programs. Stages of bacterial biofilm formation on surfaces with different levels of roughness, by bacterial strains were studied, by confocal microscopy, achieving both characterization and quantification of microbial biofilm formed through specific Comstat programs. The most suitable substrate for biofilm formation was the unpolished 304 stainless steel type, followed by 304 polished stainless steel, unpolished stainless steel 316, polished 316 stainless steel, PVC, glass and copper, respectively. The amount of biofilm formed is dependent on the type of microorganism growth and the type of culture: in monoculture or mixed biofilm. A great variability in the three-dimensional architecture of microbial species analyzed was observed. This aspect can have an essential role in the colonization of substrate tolerance substances with antimicrobial role and especially the persistence of these microorganisms in the environment. Using confocal microscopy and image analysis software offers numerous possibilities obtained thorough qualitative and quantitative analysis of biofilm in particular its architecture. Key words: microbial biofims structure, laser confocal microscopy,

Functional properties of the biofilm are closely related with its spatial architecture. In this context antimicrobial resistance is a very relevant example in terms of importance and especially the matrix form of three-dimensional cellular organization. This organization determines the existence of heterogeneous conditions inside the biofilm due to different chemical gradient (5, 9). The knowledge of the biofilm structure is the first element in understanding of the behavior and survival strategies of organisms within these structures, which allows choosing the most effective control measures (1, 2).

183

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The purpose of this research was to highlight the structure of the biofilm produced by various species of microorganisms using current applied methods in the study of microbial biofilm structure including fluorescence and confocal microscopy as well as the application of specific programs account for the quantification and characterization of biofilm structure microbial. In this regard stages of bacterial biofilm formation on surfaces with different levels of roughness, of bacterial strains isolated from meat processing units), by confocal microscopy were studied, achieving, in the same time, the characterization and quantification of the formed microbial biofilm.

Materials and methods

The materials tested were 304 and 316 polish and unpolished stainless with different dimensions: stainless steel (W 1.4301, 5CrNi) - square plates (25x25x1 mm); the 304 and 316 polish and unpolished stainless steel (10x30x1 mm). The used strains in experiments were: Gram-negative and Gram positive bacteria. Strains isolated from processing units, in areas which showed the presence of microbial biofilm: Escherichia coli - 14, Escherichia coli - 165, Pseudomonas putida - 22, Pseudomonas aeruginosa - 20 (from the surface of the pig carcass), Escherichia coli - 211, Serratia liquefaciens - 202 (of poultry carcass surface); Enterobacter cloacae – 192; Serratia marcescens – 189; Serratia liquefaciens - 195 (on the surface of beef carcass). The isolation of these strains was done on specific medium for each group. Identification of strains were performed using API 20E galleries and Vitek-2 system (BioMerieux®). Stock cultures were stored at -80 °C in brain-heart broth (Brain- Hearth Infusion - BHI broth, Oxoid) and glycerol. Prior to each experiment to obtain fresh cultures, strains were placed on BHI agar surface (Oxoid), poured into Petri dishes and incubated at 37 °C for 24 hours. The ability of these species to form the biofilm were tested using microtiter plates and stained with crystal violet according to a protocol described by Djordjevic et al. (2002) (4). The increase of biofilm was carried out in culture media with the addition of meat extract (4%) and with the addition of reconstituted milk powder (4%). On the surface of stainless steel plates was made an amount of 300 µl reconstituted milk (milk powder 4g / 1000ml) or extract of meat (meat extract 4g / 1000ml) previously inoculated with bacteria strains mentioned above. At various time intervals (6, 24, 48 and 78h, respectively) the plates were washed with saline and then stained with acridine orange (for 2 minutes) and then washed again with saline solution to remove excess dye. Examination of these plates was done with a microscope Leica DM 2500 model in fluorescence and for biofilm of 72 h examination was made with laser scanning microscope. In order to quantify the 3D structure of microbial biofilms formed on stainless steel surfaces microscopic fields presenting microcolonies arranged in several layers were chosen according to

184

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA other works (7). Microscopic fields were scanned in the x, y and z in 50 steps. Quantification was performed with the program 3D images COMSTAT 2 (DTU Copenhagen, Denmark) and image processing program BITPLANE-Imaris 7.0.

Results and discussions

A great variability in the three-dimensional architecture of microbial species analyzed what can have an essential role in the colonization of substrate tolerance substances with antimicrobial role and especially the persistence of these microorganisms in the environment was observed. The biofilm formed by strains isolated from processing units was different depending on the strain, the presence of nutrients and surface roughness (table 1, table 2). Biovolume represents the total biofilm biovolume related to the area that occupies. It can provide estimates about existing biofilm biomass. When the value of biovolume (μm3 / μm2) is higher than 1 biofilm develops more as height of the surface. If the amount is less than 1 biovolume, the development of biofilm is on the surface. On the 304 stainless steel surface in the presence of meat extract formed rough biofilm, thick with high development following species: E. coli -14, E. coli - 165, Serratia liquefaciens -202. Enterobacter cloacae – 192; and Pseudomonas aeruginosa - 20, Pseudomonas putida- 22, Serratia marcescens –195, formed thin biofilm. The E. coli strain - 211 formed a thin biofilm net-rough. Most strains grown in medium with added reconstituted milk developed a thin biofilm with a variable percentage of surface coating. On the surface of 316 stainless steel were kept approximately the same characteristics of biofilm formed by these isolates but in some cases the amount of biofilm formed was higher (ex. Serratia liquefaciens - 202) and the percentage of coverage was consistently lower for all species tested with a single exception (Serratia liquefaciens - 189). Different degree of variability in biofilm thickness for different strains of E. coli was also observed by others (3). The biofilm amount on the surface reported developed by bacterial strains isolated from the biofilm formed on the surface of the meat was different depending on the type of surface and the presence of nutrients in the medium. In terms of biovolume the formed biofilm by the tested bacterial strains can be divided into three categories: biofilm forming strains with a low biovolume in the presence of meat extract - Serratia marcescens 195, Pseudomonas aeruginosa 20, Enterobacter cloacae 192; biofilm forming strains with a medium biovolume in the presence of meat extract E.coli 211, Enterobacter cloacae 192, Serratia liquefaciens 202; biofilm forming strains with a high biovolume in the presence of meat extract E. coli 165 and E. coli 14. In the medium with the addition of reconstituted milk: the following strains were produced biofilm with low biovolume: E. coli 14, E. coli 211, Serratia liquefaciens 189, respectively; and with average

185

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA biovolume: Enterobacter cloacae 192, Pseudomonas 20, E. coli 165 and Serratia liquefaciens195, respectively.

Table 1 Characterization of biofilm formed on the surface of type 304 stainless steel by bacteria isolated from biofilm of meat surface Stainless steel Biovolu Average Roughness Surface Distance of Percent 304 me thickness coefficient /Volume diffusion of µm3/µ2 µm µm µm2/µm3 covering E. coli 14 C 2.15 2.82 0.41 0.41 2.96 70 L 0.84 1.14 0.97 0.68 0.81 42 E. coli 165 C 3.54 4.21 0.17 0.29 8.32 92 L 1.2 1.78 0.8 0.58 1.43 44 E .coli 211 C 1.55 1.8 0.51 0.52 2.21 68 Enterobacter C 1.69 1.91 0.34 0.54 2.39 82 cloacae 192 L 1.24 1.89 0.48 0.69 1.56 56 Serratia L 1.46 1.73 0.26 0.65 2.67 37 liquefaciens 202 Serratia C 0.58 0.69 1.10 0.85 0.82 86 liquefaciens 189 L 0.17 0.21 1.67 1.12 0.28 13 Pseudomonas C 0.61 0.74 0.87 0.98 0.54 49 aeruginosa 20 L 1.64 2.08 0.26 0.61 1.91 81

Pseudomonas L 2.15 2.82 0.41 0.41 2.96 70 putida 22 Serratia C 1.56 2.21 0.23 0.09 1.72 80 marcescens 195 Legend: C- meat extract ; L- milk

In terms of roughness coefficient this was higher in E. coli and Serratia liquefaciens in the presence of reconstituted milk and lower for Serratia marcescens and Pseudomonas isolates. In another study conducted on a large number of bacterial species higher values of roughness coefficient for Pseudomonas species than those found in our experiment was observed (1, 8,6). As the thickness of the biofilm formed in the presence of a meat extract on stainless steel surface type 304 E. coli 165 (4.21μm) and E. coli 14 (2.82 μm) forms the thickest biofilm. On the surface of 316 stainless steel the thickest biofilm were formed by E. coli 165 (2.37 μm) and Serratia liquefaciens 202 (2.3 μm). In the presence of reconstituted milk the thickest biofilm surface both 304 and 316 stainless steel two species showed the highest average thickness: Pseudomonas aeruginosa 20 (2.08 μm) and Enterobacter cloacae (1.91 μm). The thickness biofilm formed by the bacterial strains tested in media with the addition of the reconstituted milk was smaller than those formed in medium with the addition of meat extract.

186

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 2 Characterization of biofilm formed on the surface of type 316 stainless steel by bacteria isolated from biofilm of meat surface Stainless Biovolume Average Roughness Surface Distance of Percent steel 316 µm3/µm2 thickness coefficient /Volume diffusion of µm µm µm2/µm3 covering E. coli 14 C 1.09 1.37 0.77 0.63 1.15 53 L 0.27 0.36 1.29 1.49 0.21 20 E. coli 165 C 1.75 2.37 0.46 0.48 2.87 69 L 1.1 1.38 1.09 0.46 2.38 37 E coli 211 C 1.38 1.58 0.63 0.54 2.17 63 Enterobacter C 1.6 1.9 0.23 0.62 2.76 90 cloacae 192 L 0.56 0.63 1.39 0.59 1.11 28 Serratia L 1.99 2. 37 0.17 0.51 3.51 41 liquefaciens 202 Serratia C 0.55 0.78 0.86 1.13 0.56 91 liquefaciens L 0.38 0.59 1.4 0.89 0.36 25 189 Pseudomonas C 0.8 1.04 0.64 0.92 0.85 56 aeruginosa 20 L 1.17 1.65 0.5 0.73 1.41 60

Serratia C 1.1 1.55 0.49 0.75 1.15 61 marcescens 195 Legend: C- meat extract ; L- milk

The percent of surface coverage was different from one to another experiment and strain. Overall, the percentage of surface coverage was lower in the experiment in which the reconstituted milk was added, with one exception Pseudomonas aeruginosa 20, but in both experiments there was a large variation in the percentage of surface coverage. On the surface of Type 304 stainless steel surface coverage percentage ranged from 13 to 92% (E. coli 165 and Serratia liquefaciens, respectively), and the area coverage percentage of 316 type stainless steel was varied from 20 to 90% (E. coli 14 and Enterobacter cloacae). In a study conducted by Bridier et al. (3) on 60 bacterial strains on the quantification of biofilm architecture similar results were obtained with respect to the surface of the coating in comparison with the results of the present experiments. Also, some differences in the biovolume and thickness of biofilm, due to biofilm methods for growing and bacterial strains used, not because of analysis programs, were observed. Also some differences in the biovolume and biofilm thickness, due to biofilm methods for growing and for the used bacterial strains, not because of analysis programs, were observed.

187

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

The best substrate for biofilm formation was Unpolished stainless steel type 304, followed by 304 polished stainless steel, stainless steel Unpolished 316 , 316 polished stainless steel. There is great variability in the ability of isolates from processing units to biofilm formation. Most of these strains have developed medium biofilm with variable percentage coverage of the surface. The type of biofilm formed was dependent on the strain different surface roughness and the presence of nutrients. Using confocal microscope and programs analysis of images obtained offers ample depth qualitative and quantitative analysis of biofilm in particular for its architecture.

Acknowledgement

The paper was partially supported by POSCCE Project SMIS No. 2669. Researches were made in the Laboratory of food microbiological risk assessment founded by the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the European Social Fund and the Romanian Government under the contract number POSDRU 141531.

References

1. Beynal, H., Donovan, C., Lewandowski, Z., Harkin, G., Three- dimensional biofilm structure quantification. J. Microbiol. Meth., 2004, 59, 395-413. 2. Beynal, H., Lewandowski, Z., Harkin, G., Quantifying biofilm structure: Facts and fiction. Biofouling., 2004, 20, 1-23. 3. Bridier A., Dubois-Brissonnet F., Boubetra A., Thomas V., Briandet R., The biofilm architecture of sixty opportunistic pathogens deciphered using a high throughput CLSM method. J. Microbiol. Meth., 2010, 82, 64-70. 4. Djordjevic, D., Wiedmann, M., Mclandsborough, L.A., Microtiter Plate Assay for Assessment of Listeria monocytogenes Biofilm Formation. Appl. Environ. Microbiol., 2002, 68(6), 2950-2958. 5. Flemming, H.C., Wingender, J., The biofilm matrix. Nature Reviews, Microbiol., 2010, 8, 623-633. 6. Jee-Hoon, R., Beuchat, L.R., Biofilm formation by Escherichia coli O157:H7 on stainless steel: Effect of exopolysaccharide and curli production on its resistance to chlorine. Appl. Environ. Microbiol., 2005, 71, 247–254. 7. Lewandowski, Z., Beyenal, H., Methods for imaging and quantifying the structure of biofilms in food processing and other environments. In: Biofilms

188

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

in food and beverage industries – Fratamico, P. M., Annous, B. A., Gunther, N. W.; Editura CRC Press, New York, 2009. 8. Sauer, K., Camper, A., Ehrich, E., Costerton W, Davis, D., Pseudomonas aeruginosa 27853 display multiple phenothypes during development as a biofilm, J. Bacteriol., 2002, 184 (4) 1140 – 1154. 9. Sutherland, I.W., Biofilm exopolysaccharides: a strong and sticky framework. Microbiol., 2001, 147, 3-9.

189

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

INFLUENCE OF CLIMATIC FACTORS ON THE HYGENIC QUALITIES OF MILK OBTAINED IN THE SUBCARPATHIAN MOUNTAIN REGION

RODICA SOMEȘAN1, CRISTINA ȘTEFĂNUŢ1, ILDIKÓ BARABÁSI1, N. FIŢ1, ALINA GHIȘE2, L. OGNEAN1*

1Department of Physiology, University of Agricultural Science and Veterinary Medicine, Faculty of Veterinary Medicine, Manastur Street, No. 3-5, 400037, Cluj- Napoca, România 2Department of Physiology, Banat University of Agricultural Science and Veterinary Medicine ―King Michael I of Romania‖, Faculty of Veterinary Medicine, Timișoara, România *E-mail: [email protected]

Summary

There is a growing interest by the dairy industry in exploiting the biodiversity of the mountain grassland as the cheese obtained from the milk produced in these regions has some specific characteristics. It is thought that the specific mountain climate provides higher quality milk that is the basis of traditional dairy products. A significant role in obtaining traditional dairy products has the mountain geo-climate that greatly influences the health of the animals and the milk‘s composition. During September 2011- August 2013, ample research has been made on the influence of climate on the hygienic quality of the milk processed in the south-western region of the Oriental Carpathians. Data on temperature, humidity, atmospheric pressure and rain has been provided from a local meteorological station. The milk samples hygiene were tested by determining the total number of germs (NTG) and number of somatic cells (NCS), using Soleris and Ekoscope. Data was analyzed using MedCalc, SPSS version 20, and GRAPH Pad Prisma and the connection between these two parameters has been determined with Pearson r coefficiency correlation. Statistical analysis of the correlation between climate factor-NTG and climate factor-NCS revealed some significant results. Synthetic analysis of these correlations shows that temperature-humidity index has a great influence over NTG and NCS. NTG and NCS were greater with rising temperatures (heat stress) and low humidity. Temperature and humidity are the most important climate factors that influence biodiversity on mountain grasslands and has also a positive effect on the milk produced. Key words: mountain region, milk, NTG, NCS.

Mountain pasture biodiversity assures superior raw milk and its use in dairy making of some traditional cheese products of a better aroma and texture (7). Raw milk quality in mountain conditions depends mostly on climate factors that influence milk production as well. According to today‘s consumer trends, traditional cheese products using raw milk is on a continues rise (5). As it is known, mountain climate assures a higher wellbeing and health status of the animals that also reflects in production composition of which milk is the most common. In this context durable 190

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA animal production becomes of major importance, milk being one of the most important links between production and end product (9). To this end there have been elaborated some specific practices in this production segment to maximize production without affecting the animals wellbeing. Today, many farmers begin to realize that in order to achieve these goals they need to work with indigenous breeds that are well adapted to these climatic conditions that in the case of dairy cow have a major influence on health and production. Climate conditions affect directly the animal body or indirectly through feed biodiversity, producing major seasonal and individual variations in quantity and raw milk composition. An important effect upon dairy cows has the temperature, humidity, atmospheric pressure, light, precipitation and altitude. Farmers often monitor the temperature and humidity, these factors having a major impact on milk production and quality of dairy cows. The presented arguments fully justified this study on major climate factor influence over hygienic quality of raw milk obtained in a sub-carpathian mountain region from our country.

Materials and method

Between September 2011 and August 2013 research was aimed upon the climatic factors influence on the hygenic quality of raw milk samples processed in a comercial dairy factory in the south-west of the Oriental Carpathian Mountains. For this raw milk samples obtained in these mountain conditions mostly from indigenous breeds held in traditional husbandry and commercial farms. Small farms with a mean of 3 animals/husbandry represented the major source of raw milk. These produce milk in traditional animal husbandry conditions where milking is done predominantly by hand, the percentage of those with milking machines being insignificant. Microfarms from this region own a medium of 79 cows, held in good hygienic conditions, with automatic milking systems and proper cooling tanks. The area of study also included 2 big farms with a medium of 200 cows, held in excellent hygienic conditions and automatic milking station with a mastitis alert system. Bălţată Românească breed and its mixes continue to be the predominant breed in this region after long selection process for milk production and adaptability to the local climate. These cows stood out with a high resistance to disease and a good adaptability to the climate of the mountain region. In the region take into study, feed is provided by green mass of the areas pastures in summer and in winter by dry fibrous feed (hay) completed with concentrate (maize, forage). Research started by identifying raw milk suppliers with products within standard requirements according to legislation and set by the processing stations. During the evaluation of the region 3 suppliers have been identified: small productions (n=650), microfarms (n=11) and big farms (n=2). Milk from the small producers has been taken into one of the 10 collecting stations organized and managed by the processing plant. In the case of microfarms and big farms their own cooling tanks

191

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA have been used to collect and retrieve the milk directly from the farm. Mean milk quantity provided daily from the 3 sources reached 30.000 L/day. Investigations during the 20 months included the following 3 groups: group A milk from small producers, group B milk from microfarm, group C milk from big farms. From each group, milk was collected every month (n=10) and tested. Total number of performed analysis reached a total of 720, including 240 for every group. Every collected sample from each group was underwent microbiological (Soleris) and cytologic (Ekoscope) testing to determine the total number of germs (NTG) and the total number of somatic cells (NSC). Data from the three groups was centralized for every parameter and a mean value was also calculated for every group. Investigations were completed with the collaboration of the local weather station that supplied seasonal changes in temperature, humidity, atmospheric pressure and precipitations. This data was analyzed to quantify the influence of the major climate factors on the NTG and NSC of raw milk. Climate parameters were monitored daily and data has been provided by the Târgu-Mureş Meteorological Service. Statistical analysis of the obtained data was made with MedCalc, medical program, indicated for biomedical research, variables in our study being the climate parameters and hygiene parameters of the raw milk. Pearson r coeficent has been also determined to correlate the results of the two types of parameters. Graphical representation has been made by a scatter pattern that according to its orientation and dispersion offers a view of the relationship between the two.

Results and discussions

Seasonal evolution of NTG according to climate factors. Results of the microbiological tests a show a statistical relevant correlation between NTG (58.000- 66.000 UFC/ml) and temperature (10.7-10.95C) in spring (p=0.030) and autumn (p=0.040), indicating a rise in NTG proportional to temperature increase. On the other hand, in summer and winter, the temperature did not have any significant influence over the NTG. Comparative data between air pressure (962.9 mb) and NTG evolution (61.000 UFC/ml), indicated a positive correlation in winter (p=0.023), that revealed a proportional rise of NTG with the air pressure (Fig. 1). In spring, summer and autumn, air pressure did not have any influence over the NTG dynamics. Humidity changes (66-86%) also had a positive influence over NTG (56.000-61.000 UFC/ml) in summer (p=0.027) and winter (p=0.021), indicating a proportional rise of NTG with the humidity (Fig. 2). As for the influence of precipitation over the NTG, there has not been any significant influence in none of the four seasons.

192

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

985 R 0.169 P 0.02 980 975

970

965 960

Presiunea aerului mb aerului Presiunea 955

950 945

940 30 40 50 60 70 80 NTG

Fig. 1. Pressure-NTG correlation in winter

100

Umezeala aerului % aerului Umezeala

40 R 0.172 P 0.021 30 30 40 50 60 70 80 NTG

Fig. 2. Humidity-NTG correlation in winter

Seasonal evolution of NCS according to climate factors. Cytological analysis revealed a positive correlation between NCS (140.500-223.000 UFC/ml) evolution and temperature (10.7-21C) in summer (p=0.028) and autumn (p=0.047), that indicated a proportional rise of NCS with the temperature (Fig. 3). In winter and spring, air temperature did not have any significant influence over NCS.

193

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Humidity had a negative r=(-0.245) and statistically significant influence over NCS (140.500 UFC/ml) in summer (p=0.001), that proves that humidity decrease determines a NCS increase. Comparative data on precipitation evolution (1.40 l/m2) and NCS (140.500 UFC/ml), revealed a positive correlation (r=0.301) in summer (p=0.022), according to which intensified precipitation determinates a rise in NCS (Fig. 4). Air pressure dynamics analysis revealed no significant influence of this parameter over NCS in none of the seasons.

26 24

18 Temperatura medie a aerului °C aerului a medie Temperatura 16

14 R 0.162 P 0.02 12 100 150 200 250 300 NCS

Fig. 3. Temperature-NCS correlation in summer

20 R 0.301 P 0.022

10 l/m2 Precipitatii

0 100 120 140 160 180 200 220 240 260 NCS

Fig. 4. Precipitation-NCS correlation in summer

194

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Temperatures influenced NTG as well as NCS in spring and autumn, in summer and autumn sezoanele de vară și toamnă, the correlation being statistically insignificant at temperatures of 10.7-10.95C for NTG and 10.7-21C for NSC. Resembling influences had the air pressure over NTG in winter, but not so over the NCS. As far as humidity is concerned, significant influences have been observed at a higher level for NTG in summer and winter, statistically significant correlations have been registered in the case of NCS as well, but only in summer. Precipitation did not have a significant influence over NTG, but it did have positive and significant influence over the NCS in summer. Mean NTG values were 56.000-66.000 UFC/ml at a mean temperature of 10.7-10.95C, mean humidity of 66-86% and mean atmospheric pressure of 962.9 mb. For NCS mean values were at 140.500-223.000 UFC/ml, in mean temperatures of 10.7-21C mean humidity of 66% and precipitation of 1.40 L/m2. Synthesizing, foremost climatic condition characteristics can be described as: sunny days, moderate humidity, low or even absent precipitation. Results of microbiological and cytological tests show that NTG and NCS evolution varies according to climate conditions. The most important influence had the temperature, followed by humidity and atmospheric pressure. According to recent studies NCS score is significantly influenced by the temperature-humidity index in both extremes, having a more pronounced reaction at low values. This study reveals a influence of the temperature-humidity index in both extremes over the NTG and NCS, with more pronounced reaction in high temperatures and low humidity. High NTG and NCS values due to thermal stress not only have a negative influence over cheese production as a result of lower fat, protein and lactose and finally a compromised sensorial product (6). Using high NCS value milk in cheese production through acid coagulation may have the following effects: intensified proteolysis during depositing through refrigeration (4); reduction of expiration date in the case of pasteurized milk; increased enzymatic activity through protease and lipase activity intensification determine casein and fat fractioning and their loss in whey (1). Compositional and microbiological characteristics of milk represent basic standards for farmers, the dairy industry and consumers that are influenced by various factors such as: breed, age, mammary gland health, lactation period, season and nutritional management (2). As a response to consumer demand, the dairy industry intensified its actions destined to improve milk and dairy product quality, manage actions of the environment, ensuring animal welfare, food safety and product traceability (8).

195

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

Statistical analysis of raw milk samples in study revealed that temperature oscillations positively influenced NTG (p=0.040) and NCS (p=0.047), in autumn. On the other hand humidity hada a positive influence over NTG (p=0.027) and a negative influence over NCS (p=0.001) dynamics, in summer. Humidity had also a positive influence over NTG in winter (p=0.023), but without any influence over NCS. Precipitation dynamics had a positive influence over NCS in summer (p=0.022), without any significant effects over NTG

References

1. Barbano, D.M., Ma, Y., Santos, M.V., Influence of raw milk quality on fluid milk shelf life, J Dairy Sci, 2006, 89, E15-E19. 2. Dobranié, V., Njari, B., Samardžija, M., Mioković, B., Resanović, R., The influence of the season on the chemical composition and the somatic cell count of bulk tank cow‘s milk, Vet Arhiv, 2008, 9, 235-242. 3. Hammami, H., Bormann, J., M'hamdi, N., Montaldo, H.H., Gengler, N., Evaluation of heat stress effects on production traits and somatic cell score of Holsteins in a temperate environment, J Dairy Sci, 2013, 96(3), 1844-55. 4. Klei, L., Yun, J., Sapru, A., Lynch, J., Barbano, D., Sears, P., Galton, D., Effects of milk somatic cell count on cottage cheese yield and quality, J Dairy, 1998, 81, 1205-1213. 5. Laurenčic, M., Sulo, P., Sláviková, E., Piecková, E., Seman, M., Ebringer, L., The diversity of eukaryotic microbiota in the traditional Slovak sheep cheese bryndza, Int J Food Microbiol, 2008, 127, 176–179. 6. Malek dos Reis, C.B., Barreiro, J.R., Moreno, J.F.G., Porcionato, M.A.F., Santos, M.V., Effect of somatic cell count and mastitis pathogens on milk composition in Gyr cows, BMC Vet Res, 2013, 9, 67. 7. Martin, B., I., Verdier-MetI, S., Buchin, Hurtaud, C., Culon, J.B., How do the nature and pasture diversity influence the sensory quality of livestock products?, Anim Science, 2005, 81, 205–212. 8. Refsholt, H., Brendehaug J., Biong, A.S., Milk quality a future approach. From the dairy industry's point of view, J Anim Feed Sci, 2007, B16S, 227– 239. 9. Seabrook, M.F., Wilkinson, J.M., Stockpersons' attitudes to the husbandry of dairy cows, Vet Rec, 2000, 147(6), 157-60.

196

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

THE EFFECTS OF CLIMATIC FACTORS ON FAT AND NON-FAT DRY MATTER CONTENT OF RAW MILK OBTAINED FROM CATTLE RAISED IN CONDITIONS OF A SUBCARPATHIAN MOUNTAIN RANGE

RODICA SOMEȘAN, DIANA POPA, S. OGNEAN, L. OGNEAN

Department of Physiology, University of Agricultural Science and Veterinary Medicine, Faculty of Veterinary Medicine, Manastur Street, no. 3-5, 400037, Cluj- Napoca, Romania E-mail: [email protected]

Summary

Health, welfare and production ofcattle are significantly influenced by geo-climatic conditions, which can act either directly on livestock, or indirectly on forage sources biodiversity. It is well known that climatic factors exert a major impact on the expression of productive potential in lactating cows, and especially on the quality level of milk. In this study, focused on investigation of raw milk, we propose evaluating the influence of the main climatic factors (temperature, humidity, atmospheric pressure, precipitation) on the seasonal evolution of fat and non-fat dry matter content of raw milk, obtained in the conditions of a subcarpathian mountain range.The research was conducted on the raw milk processed, from December 2011 to July 2013, in a commercial unit in southwestern part of Eastern- Carpathians. In collaboration with a weather station in the area, it was monitored the seasonal dynamics of temperature, humidity, atmospheric pressure and rainfall. Analysis of these data was the basis for quantifying the influence of the main climatic factors on fat and non-fat dry substance content of raw milk that was submitted to physicochemical testing with the Ekomilk M semiautomatic analyzer. For statistical analysis of data obtained were used MedCalc software and the Pearson r. correlation coefficient.From statistical analysis of the values obtained from the evaluation of variables climatic factors-fat/non-fat dry matter content, there were established the following correlations, relevant to the objectives pursued: fat content and non-fat dry matter content increased in inverse proportion with the decrease of air temperature (10.7°C) and proportionally with the increase of humidity (76%) in autumn season.We considerthat, the evolution of temperature andrelative air humidity representthemain environmental factors that provide biodiversity of mountain pastures and positively influence the overall composition of milk, especiallyitsfat and non-fat dry matter content. Key words: raw milk, fat, non-fat dry matter, mountain range.

Achieving sustainable livestock production is amajor goal for any farmer in animal husbandry, because such activities provide the means necessary for subsistence and development. These have also intensified the concerns in this field of agricultural production, leading to the implementation of effective strategies for ensuring welfare and productive performances of lactating cows (4, 7, 8).

197

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Many farmers have already understood that they can increase their income by raising indigenouslivestockbreeds, adapted to the environmental conditions. These include the main climatic factors that exert a major impact on the productive performances of farm animals in general and especially of lactating cows (3). Climate – animal relationship largely reflects both the level of animal welfare, as well as theenvironmental quality, directlyinfluencingtheproduction capacityof livestock (2). Climatic factors act directly onthe animal organism, or indirectly through the flora, which constitutes forage basis, causing majorseasonal and individual variationsof thequantity and composition ofthe produced milk (6).Significant effects on lactation in cow are exerted by the following climatic factors: temperature, relative humidity, atmospheric pressure, light, rainfall, altitude. Among these, the ambient temperature appears to exert the most important influence on milk production. In this context, we remind that the thermal comfort zone for dairy cows is between 9-16° C. As long as the temperatureis between these limits, the body does not resort to physicochemical processes that require the thermoregulatory system of cattle. In cattle, resistance to thermal fluctuations is influenced by various factors, such as: species, breed, color and hair density. Relative air humidity is optimal in the range of 65-75% and is directly related to the evolution of temperature. Thus, low relative humidity associated with high temperatures intensifies the processes of thermoregulation, whereas high relative humidity diminishes it, regardless of the temperature level. It is also known that light intensifies the metabolism and, thereby, exerts a favorable effect on milk production. On the other hand, moderate altitude can positively influence oxidative processes in the body and, therefore, the milk synthesis. Negative effects are exerted by high relative humidity and especially excessive rainfall that determine decreases in milk production, by causing stress and affecting the feeding of lactating cows. We consider that the arguments presented fully justify our study, focused on assessing the influence of the main climatic factors on compositional parameters of the raw milk obtained from cattle from indigenous breeds, raised in conditions of a carpathian mountain range.

Materials and methods

Investigations consisted in monitoring and evaluation of physicochemical parameters of raw milk (fat, protein, non-fat dry matter, freezing point depression, gravity and pH), processed in a private processing unit. This was produced in the conditions of a subcarpathian mountain range, from predominantly indigenous cattle breeds, reared in traditional households and commercial farms. Small producers, with an average of 3 animals / household, represented the main source of raw milk supply. They produce milk in traditional household conditions, with predominantly manual milking, the percentage of those using mechanical milking

198

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA equipment being insignificant. Small farms in the area have an average of 79 cattle and have good hygienic conditions, being equipped with automatic milking equipment and having their own cooling tanks. The area placed under study also includes two large farms, with the average effective of 200 cattle, which have excellent hygiene conditions, with automatic milking rooms, also equippedwith automaticmastitis signaling systems. Romanian Spotted breedandits half- breedscontinue to beprevalentin the area, after a long selection new lineshave been obtained, having ahigh adaptingpotentialt o the local conditions.They prove a high level of resistance to diseases and are welladapted tothe climate andcare conditions from Valea Gurghiului area. Feeding of dairy cowsis done using natural pasturesfromdifferent areas of the mentioned geographic area, and in stabulationfeeding is done with hay and other fiber, obtained from local natural pastures, supplemented with concentrates (corn, grists). The research began by identifying producers of milk that fits into product standards, according to the legislation in effectandtotheset of rules established by the processing unit. Following the assessments carried out in theactivity area of the unit under study, we identified three sources supplying raw milk: small producers (n=650), small farms (n=11) and large farms (n= 2). In that mountain area, small producers delivered raw milk to the 10 milk collection centers, which are organized and managed by the processing unit. If case of small farms and of large farms, the use of their own cooling tanks allowed milk collection directly from the farm. These sources supplied daily, to the processing unit, an average quantity of 30.000 liters of raw milk.Over a period of 20 months (December 2011-July 2013) milk sampleswere investigated, organized in three groups corresponding to the three sources: A - milk collected from small producers; B - milk collected from small farms; C - milk collected from large farms. Monthly, from each group 16 samples were collected and subjected to laboratory analysis.The total number of analyses performed was 320 per each group, totalizing 960 samples. Analyzes consisted in physicochemicaltesting of milk samples with theEkomilkManalyzerused indetermining: fat, non-fat dry matter, protein, freezing point depression, gravity and pH. In parallel, we used classic methods for verifying the following three basic parameters, in case of the same sample: fat (butirometric method), dry matter (by drying oven) and gravity (with lactometer). After testing the milk samplesfrom the three groups, the obtained data wascentralizedon eachparameter separately. Then we calculated the average value for each parameter, as follows: we added the values obtained on producers, small farms and large farms and we divided the sum by 3. In our study we considered as being relevant thevalues obtained for fat and non-fat dry matter content. Investigations were carried out in collaboration with a weather station in the area, from which we obtained data onseasonal dynamics of temperature, relative humidity, atmospheric pressure and rainfall. These were processed in order to quantify the influence of the main climatic factors on the fat and non-fat dry

199

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA mattercontentofraw milk. Climatic parameterswere monitored daily at the Departmentof MeteorologyTârgu Mureș. From it we collected centralized data and we processed them statistically, using the MedCalc program, designed for statistics in biomedical research. At the same time, we used the Pearsonr correlation coefficient, for analyzing theconnection betweenthe two variables (the climatic factor and the indicator from milk) and its intensity. The graphical representation of this relationship was made by using the dispersion diagram (scatter), which, by the orientation and dispersion of the points cloud, gives an overview of the relationship between those two variables.

Results and discussions

Seasonal evolution of fat content, depending on climatic factors.The results obtained for this parameter revealed statistically positive correlations between fat content (3.66-3.89%) and the air temperature (10.95-21C) in spring seasons(p=0.006) and in summer season (p=0.047), indicating a proportional increase of both variables (Fig. 1). In contrast, in the autumn season (p=0.0001) the correlation between temperature (10.7C) andfat content (3.94%) was negative (r=-0.479), indicating the increase of fat content in inverse proportion with the decrease of temperature. The evolution of relative humidity (76%) significantlyinfluencedfat content (3.94%) in the autumn season (p=0.006) indicating the proportional increase of both variables. In summer season, the statistically negative correlation (p=0.001) between humidity (66%) and fat content (3.89%) indicated the increase offat content, in inverse proportion with thedecrease ofrelative humidity. Comparative dataregarding air pressure (962.9-965.5mb) andfat content (3.86-3.94%) revealed statistically negativecorrelations in autumn seasons (p=0.017) and winter seasons (p=0.047), indicating that, as thepressurewill decrease, the fat content will increase. In the spring season, the positive correlation (r=0.185) between pressure (961.2 mb) andfat content (3.66%) was statistically significant (p= 0.012), indicating that once the temperature increases, the fat content will Also increase (Fig. 2). Regarding the dynamics of rainfall, it is worth mentioning that itdid notsignificantlyinfluencethe evolution offat content, in any ofthe fourseasons. Seasonal evolution of the non-fat dry matter content depending on climatic factors. Regarding the non-fat dry matter content (NFDM), statistical analysis of data revealed statistically negative orrelations between non-fat dry matter content (8.51-8.52%) and air temperature(10.7-21C) in autumn seasons (p=0.0001) and in summer seasons (p=0.010), indicating that the non-fat dry matter content increased, in inverse proportion with the decrease of temperature (Fig. 3).

200

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

30 R 0.161 28 P 0.047 26 24 22 20 18 16 14

Temperatura medie a aerului °C 12 3,6 3,7 3,8 3,9 4,0 4,1 GRASIME %

Fig. 1. Correlation between temperature-fat content in milk, in summer season

980 R 0,185 975 P 0,012 970 965

960

955

mb aerului Presiunea 950

945

940 935 3,3 3,4 3,5 3,6 3,7 3,8 3,9 4,0 GRASIME %

Fig. 2. Correlation between air pressure – fat content in milk, in spring season

The evolution of relative humidity (66-76%) positively influenced the non-fat dry matter content (8.51-8.52%) in summer seasons (p=0.0001) and in autumn seasons (p= 0.039), indicating an increase of both variables (Fig. 4). In contrast, in the winter season (p =0.022), the correlation between relative humidity (86%) and non-fat dry matter content (8.52%) was negative r = (-0.171), indicating that the decrease of relative humidity determines the increase of non-fat dry matter content. Dynamics of atmospheric pressure (962.9mb) negatively influenced r=(- 0.191) the non-fat dry matter content (8.52%) in winter season (p = 0.010),

201

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA indicating thatthe decrease of atmospheric pressure determines the increase of non-fat dry matter content. In spring, summer andautumnseasons, the influence ofatmospheric pressure on non-fat dry matter contentwas insignificant. Also, the evolutionof rainfall (1.4 l/m2) negatively influenced r = (-0.289) non-fat dry matter content (8.52%) in summer season (p = 0.040) indicating thatthedecrease of rainfall determines the increase of non-fat dry matter content. Inspring, autumn andwinterseasons, statistical correlations were insignificant.

25 R -0.457 P 0.0001 20

Temperatura medie a aerului °C aerului a medie Temperatura 5

0 8,4 8,5 8,6 8,7 SUN%

Fig. 3. Correlation between temperature – NFDM from milk, in autumn season

100 R 0.217 P 0.039

Umezeala aerului % aerului Umezeala

0 8,4 8,5 8,6 8,7 SUN%

Fig. 4. Correlation betweenrelative humidity- NFDM from milk, in autumn season

202

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Regarding thecomparative analysis of theobtained results, they reveal, for all four seasons, an increase of 0.26-0.74% over the product standard for average fat content. Compared to the average percentage of fat reported nationally in 2012 (National Institute of Statistics, 2013), there are notable decreaseswith 0.15%, reported for the springseason. In comparison, the evolution of temperature had a higher influence on the fat content (in spring, summerand autumn seasons) than on thenon-fat dry matter content (in summer and autumn seasons), statistical correlations being signaled at temperature values between 10.7 and 21°C for both variables. Evolution of relative humidity influenced both the fat content and the non- fat dry matter content; the most significant statistical correlations were indicated for non-fat dry matter content in summer, autumn and winter seasons. Regarding thei nfluence of atmospheric pressure, the significance level of the correlations established was higher in case of fat content,regarding three seasons (autumn, winter, spring), statistically significant correlations were also registered in the case of non-fat dry matter content, but only duringoneseason (winter). Dynamics of rainfall did not significantly influence the evolution of fat content; instead, it significantly influenced statistically the evolution of non-fat dry matter content, in summer season. Taken as a whole, the results obtained indicated average levels of non-fat dry matter content, that were in the range of 8.49-8.52%, in terms of temperature average values of 10.7-21°C, relative humidity average values of 66-86% and atmospheric pressure average values of 965.2 mb (sunny days, moderate humidity and pressure, low rainfall or even lack of it). The results obtained showed the fact that the evolution of fat and non-fat dry matter content, thus milk composition, varies depending on the environmental conditions, the most important factorbeing the temperature, followed byrelative humidity and atmospheric pressure. Recent research, focused on the effects of the environmental conditions on milk composition, indicated that cows with high milk production are more sensitive to heat stress, than cows with low milk production, parity having an important role (5, 8). The effect of heat, on milk production, has also been quantified, by investigating climatic factors (temperature, relative humidity, wind speed and brightness), the results suggesting the decrease of milk production due to heat stress (1). We consider that, in practice, it is possible the reduction of negative effects of climatic factors on the health and productive performances of animals, although in large farms they can not be applied to each individual. Therefore, is necessary an intensification of concerns in this field and the implementation of effective strategies to ensure the welfare and productive performances of lactating cows.

203

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

Statistical analysisof data recorded on groups of milk samples revealed that temperature fluctuations, in autumn-summer seasons, negatively influenced the fat content (p=0.0001) and the non-fat dry matter content (p=0.0001, p=0.010). In contrast, the evolution of relative humidity exerted positive influences, both on non-fat dry matter content (p=0.0001, p=0.039), as well as on fat content (p=0.006), in autumn season. Atmotpheric pressure also exerted negative influences on the evolution of fat content (p=0.017, p=0.047) and non-fat dry matter content (p=0.010), during autumn and winter seasons, but not during spring season, which positively influenced the fat content (p=0.012). Dynamics of rainfall did not exert significant effects on the fat content of milk, but it negatively influenced the evolution of non-fat dry matter content (p=0.040), in summer season.

References

1. Bohmanova, J., Misztal,I., Cole, J.B., Temperature-humidity indices as indicators of milk production losses due to heat stress, J Dairy Sci, 2007, 90, 947–1956. 2. Broom, D.M., Animal welfare: concepts and measurement, J Anim Sci, 1991, 69 (10), 4167-75. 3. Collier, R.J., Dahl, G.E., Van Baale, M.J., Major advances associated with environmental effects on dairy cattle, 2006, 89 (4), 1244-53. 4. Lamy, E., Van Harten,S., Sales-Baptista,E., Guerra,M.M.M., Almeida, A.M., Factors influencing livestock productivity. In: Sejian V, Naqvi SMK, Ezeji T, Lakritza J, Lal R, editors. Environmental Stress and Amelioration in Livestock Production. Springer-Verlag, 2012, 19–51. 5. Liang, D., Wood, C.L., McQuerry, K.J., Ray, D.L., Clark, J.D., Bewley, J.M., Influence of breed, milk production, season, and ambient temperature on dairy cow reticulorumen temperature, J Dairy Sci, 2012, 96(8), 5072-81. 6. Machiko, Y., Hideyasu, S., Toshiki, E., Modelling temperature effects on milk production: a study on Holstein cows at a Japanese farm, Springerplus, 2014, 3, 129. 7. Ognean, L., Laura C. Cernea, Fiţ, N., Meda M. Moldovan, Rodica Someşan, Dorina Dragomir,The evaluation of the milk health and conformity level on a processing company chain with close and open circuit. Lucr. Șt.Med. Vet., Ed. ―Ion Ionescu de la Brad‖, 2012, 55 (1-2), 1-7. 8. Robert, P.R., Lance, H., Jessica Suagee, K., Sara Sanders, R., Nutritional Interventions to Alleviate the Negative Consequences of Heat Stress, Adv Nutr, 2013, 4 (3), 267-276. 9. ***National Institute of Statistics, Production of meat, milk and dairy products in the industrial units in 2012, Press Release, 2013, 151, 4-5.

204

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

ATTEMPT TO INDUCE IMMUNOLOGICAL TOLERANCE IN CHICKEN EMBRYOS USING INOCULATION OF ALLOGENEIC CELLS INTO CHORIOALLANTOIC VESSELS

MONICA ȘEREȘ1, ILEANA NICHITA1, C. CUMPĂNĂȘOIU1, DANIELA MOȚ2, R.V. GROS1, IONELA HOTEA1, CSILLA ZAMBORI3, E. TÎRZIU1

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Animal Science and Biotechnology 3National Institute of Research – Development in the Pathology Domain and Biomedical Sciences ―Victor Babes‖, Bucharest, Romania E-mail: [email protected]

Summary

The purpose of this study was the induction of intraembryonic tolerance to allogeneic antigens using mixed hematopoietic chimeras without recipient‘ conditioning. The experiments were performed on 180 embryonated eggs (Cobb 500 hybrids), obtained from S.C. AVE IMPEX SRL, Romania, and 6 donor adult birds (Rosso hybrids). Allogeneic blood and bone marrow mononuclear cells were obtained from processing of blood and bone marrow samples by centrifugation on Ficoll-density gradient and labeled with PKH2 dye and were inoculated into chorioallantoic vessels (days 9, 11 and 13 of incubation). After hatching, the following aspects were evaluated: hematopoietic mixed chimerism, donor-recipient compatibility and distribution of T cells subsets, by flow cytometry. The status of haematopoietic chimera could not be confirmed for any of the recipient birds, and mixed lymphocyte reaction shows a partial compatibility with donor of allogeneic cells only in the group obtained after inoculation of bone marrow mononuclear cells in the 9th day of incubation. Evaluation of lymphocyte profile in birds from groups obtained after blood mononuclear cells inoculation in days 9, 11 and 13 and control groups shows a higher representation of naive T cells, effector and memory subsets being less represented. In contrast, in the birds from group obtained after inoculation of bone marrow mononuclear cells in the 9th day of incubation, effector and memory phenotypes were better represented than the naive ones Key words: immunological tolerance, allogeneic cells, chorioallantoic vesels, birds

Understanding the cellular and molecular mechanisms regulating the immunological tolerance has a great importance for both basic research, and applied research. Thus, we can mention current concerns rearding transplantation (induction of immunological tolerance to non-self antigens) (2, 3, 8, 8, 11, 15, 16), autoimmune diseases (restoration of self-tolerance) (1, 5, 10, 19, 23), and tumoral diseases (eliminating tolerance to tumor antigens) (6, 12, 13), which are the subject of experiments conducted in prestigious international and national centers. 205

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Clarifying, even partially, of the issues regarding immunotolerance will reduce, or even eliminate, for the three mentioned areas, the dependence to non- specific and toxic immunosuppressive agents (17, 18, 20, 21). The purpose of this study was the induction of intraembryonic tolerance to allogeneic antigens using mixed hematopoietic chimeras without recipient‘ conditioning, by inoculation of allogeneic blood and bone marrow mononuclear cells into chorioallantoic vessels, in various stages of embryonic development.

Materials and methods

Biologic material: 180 embryonated eggs (Cobb 500 hybrid embryos, AVE IMPEX SRL, Romania), as recipients of cells transplant, and six Ross hybrids, as donor birds. Antigenic material: allogeneic blood and bone marrow mononuclear cells were used. Cellular concentrates were obtained after processing of blood samples and bone marrow samples, aspirated from tibial and femoral medullary cavity of donor birds, by centrifugation on Ficoll-density gradient (StemCell Technologies Inc, Vancouver, BC, Canada) (14). Mononuclear cells were labeled with PKH2 dye, according to PKH2 Green fluorescent cell linker mini kit (Sigma Aldrich®, St. Louis, MO, USA) protocol. Inoculation of allogeneic cells was performed into chorioallantoic vessels, resulting in six experimental groups (Table 1). Each experimental group was linked to a control group, with an equal number of birds.

Table 1 Experimental scheme of cells allotransplantion (hen to hen) Day of Antigenic material Donor No. of Groups incubation bird embryonated eggs blood mononuclear cells B1 30 E1 13 bone marrow B2 30 E2 mononuclear cells blood mononuclear cells B3 30 E3 11 bone marrow B4 30 E4 mononuclear cells blood mononuclear cells B5 30 E5 9 bone marrow B6 30 E6 mononuclear cells

At the age of three weeks, the following aspects were evaluated:

206

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

- hematopoietic mixed chimerism – by flow cytometry. All birds (experimental groups) were assessed for the persistence of donor‘s cells stained with PKH2, used to induce immunological tolerance - donor-recipient compatibility – it was assessed according to Sigma PK Linker protocol for mixed lymphocyte reaction; the test covered all experimental birds and 18 control birds; - distribution of T cells subsets - five birds/experimental and control group were assessed using flow cytometry, after marking of peripheral blood lymphocytes with anti-CD3, CD4, CD8, CD45RA, CD28, and CD25 fluorochrome- conjugated monoclonal antibodies (PickCell Laboratories). Statistical analysis was performed using the Statistical Package for Social Sciences (SPSS, version 21, Chicago, IL, USA), and mean, standard deviation, minimum and maximum values and correlation coefficient (r) were determined. Differences of the mean of various categories were analyzed using one-way ANOVA test. Differences were considered significant when P values were less than 0.05.

Results and discussions

The status of haematopoietic chimera could not be confirmed for any of the recipient birds. However these results do not suggest the absence of donor‘s leukocytes in peripheral blood of recipient birds, meaning that allogeneic cells count is so low, by their confinement in the lymphoid organs, that does not allow detection by flow cytometry (4, 7, 18). The assessment of the donor-recipient compatibility of using Sigma PK Linker protocol for mixed lymphocyte reaction, which is a standard test, revealed a 100% incompatibility between recipient birds of experimental group E1-E5 (resulting after incoculation of both types of antigenic material in days 13 and 11 of incubation and after inoculation of blood mononuclear cells in day 9) and donors. The same results were obtained in control birds. For all cultures, flow cytometry of lymphocytes marked with PKH2/PKH26, showed apoptosis and cell lysis. Data recorded for E6 group (inoculated with bone marrow mononuclear cell in the 9th day of incubation, are different. Thus, there is a substantial change in the lymphocyte reactivity in mixed cultures, with the persistence in high proportion of recipients‘ lymphocytes, and low proportion of donor‘s cells. However, even if the differences between E6 and E1-E5 groups are evident, the persistence of the double-positive events shows that the applied technique does not ensure absolute compatibility between donor and recipients, but only a delay of lythic process that most probably would be permanent in the case of an extension of the standard period of incubation (four days). After lymphocyte profile analysis using flow cytometry, the lymphocytes subsets were defined as follows: naive CD4+ helper T cells with phenotype CD3+CD4+CD45RO-CD28+; memory CD4+ helper T cells with phenotype

207

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CD3+CD4+CD45RO+CD28+; effector CD4+ helper T cells with phenotype CD3+CD4+CD45RO+CD28-; effector CD4+ helper T cells with phenotype CD3+CD4+CD45RO-CD28-; naive CD8+ cytotoxic T cells with phenotype CD3+CD8+CD45RO-CD28+; memory CD8+ cytotoxic T cells with phenotype CD3+CD8+CD45RO+CD28+; effector CD8+ cytotoxic T cells with phenotype CD3+CD8+CD45RO+CD28-; effector CD8+ cytotoxic T cells with phenotype CD3+CD8+CD45RO-CD28-; regulatory T cells with phenotype CD3+CD4+CD25+; and regulatory T cells with phenotype CD3+CD8+CD25+. Assessment of lymphocyte profile in birds from experimental groups E1-E5 and coresponding control group revealed a higher porportion of naive T cells (CD3+CD4+CD45RA+CD28+ or CD3+CD8+CD45RA+CD28+), memory T cells (CD3+CD8+CD45RA-CD28+ and CD3+CD8+CD45RA-CD28+) and effector T cells (CD3+CD8+CD45RA+ CD28- and CD3+CD8+ CD45RA-CD28) having a lower level (Table 2).

Table 2 The average percentage distribution of T cells subpopulations in birds subjected to inoculation of blood and bone marrow mononuclear cells into chorioallantoic vessels – E1-E5 groups NaiveT cells Effector T cells Memory T cells CD25+ memory Lotul * (%) (%) (%) T cells (%) X 58.16 21.54 20.11 5.49 E1 SD 3.30 3.72 1.16 0.93 CV 5 17 5 16 X 61.56 14.91 23.52 5.18 C1 SD 3.39 2.40 2.82 0.92 CV 5 16 11 17 X 59.64 19.04 21.30 5.66 E2 SD 6.13 3.59 3.24 1.11 CV 10 18 15 18 X 59.52 20.48 18.89 5.91 M2 SD 5.02 3.22 2.79 1.05 CV 8 15 14 17 X 60.05 17.31 22.62 5.09 E3 SD 4.01 3.11 3.73 0.95 CV 6 17 16 18 X 60.18 20.39 19.41 5.34 C3 SD 3.88 3.61 2.69 1.00 CV 6 17 13 18 X 60.69 17.76 21.54 5.62 E4 SD 4.69 2.61 2.87 0.91 CV 7 14 13 16 X 59.47 19.61 20.91 5.43 C4 SD 3.79 3.32 3.27 1.06 CV 6 16 15 19 208

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

X 61.91 19.24 18.84 6.01 E5 SD 3.70 2.24 3.43 1.17 CV 5 11 18 19 X 58.68 20.49 20.81 5.69 C SD 4.95 3.69 3.88 1.10 5 CV 8 18 18 19 Legend: X=average; SD=standard deviation; CV = coefficient of variation *the proportions of CD25 + memory T cells were calculated from the total values corresponding to CD28-CD45RA+memory T cells

All birds assessed had naive T lymphocytes above 50%, average values of the memory subset between 18.84% and 22.62% and between 18.84% and 21.54% for effector cells and the differences between experimental and control groups were insignificant. The levels of different lymphocytes subpopulations in birds of experimental and control groups are specific to young poultry, who were faced with a significant level of antigenic information (22), and are absolutely explicable in the context of the controlled conditions under which the birds were kept and the absence of vaccinations. The obtained coefficients of variation demonstrate the groups homogeneity especially in terms of naive T cells (CV> 10%), the biggest variations being registered in CD25 + memory T cells subset (CV values 16-19%). The differences observed in mixed lymphocyte cultures, for E6 group, are confirmed by lymphocite profile (Table 3), which is dominated by memory and effector phenotypes. Thus, it can be said that the intervention for inducing immunological tolerance by inoculating bone marrow mononuclear cells in the 9th day of incubation have important effects on the immune repertoire of recipient birds, but does not guarantee the complete compatibility between donor and recipients.

Table 3 The average percentage distribution of T lymphocyte subpopulations in birds subjected to bone marrow mononuclear cells inoculation into chorioallantoic vessels (ninth day of incubation) Group NaiveT cells (%) Effector T cells Memory T cells CD25+ memory (%) (%) T cells (%)* E6 X 19.39 37.68 46.08 11.18 SD 3.40 3.05 2.39 1.08 CV 17 8 5 9 C6 X 59.96 17.05 22.24 6.10 σ 4.80 1.99 3.09 1.15 CV 8 11 13 18 Legend: X=average; SD=standard deviation; CV = coefficient of variation *the proportions of CD25 + memory T cells were calculated from the total values corresponding to

CD28-CD45RA+memory T cells

209

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Conclusions

Bone marrow mononuclear cells are the optimal antigenic material for immunotolerance induction, as confirmed by the results of the evaluations regarding hematopoietic mixed chimera status, compatibility to allogeneic cells donor, and lymphocyte profile. The level of tolerance induced by inoculation into chorioallantoic vessels on 9th day of incubation of allogeneic bone marrow mononuclear is characterized by important changes of recipients‘ immune repertoire, but does not guarantee a complete match between donor and recipients.

Acknowledgments

This study was carried out with the support of the project Dezvoltarea infrastructurii de cercetare, educaţie şi servicii în domeniile medicinei veterinare şi tehnologiilor inovative pentru RO 05, cod SMIS-CSNR 2669 and of the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the European Social Fund and the Romanian Government under the contract number POSDRU 141531 awarded to Csilla Zambori.

References

1. Abbas, A.K., Lohr, J., Knoechel, Birgit, Nagabhushanam, V., T cell tolerance and autoimmunity, Autoimmunity Reviews, 2004, 3, 471- 475. 2. Ahmed, Emily, A., Daniel, M., Alegre, Maria-Luisa, Chong, Anita S., Bacterial infections, alloimmunity, and transplantation tolerance, Transplantation Reviews, 2011, 25, 27-35. 3. Aksu, A.E., Horibe, Elaine, Sacks, J., Ikeguchi, R., Breitinger, J., Scozio, Merissa, Unadkat, J., Feili-Hariri, Maryam,Co-infusion of donor bone marrow with host mesenchymal stem cells treats GVHD and promotes vascularized skin allograft survival in rats, Clinical Immunology, 2008, 127, 348-358. 4. Alard, P., Matriano, J.A., Socarras S., Ortega, M.A., Streilein, J.W. , Detection of donor-derived cells by polymerase chain reaction in neonatally tolerant mice, Microchimerism fails to predict tolerance, Transplantation, 1995, 60, 1125. 5. Bach, J.F., Induction of immunological tolerance using monoclonal antibodies: Applications to organ transplantation and autoimmune disease, C.R. Biologies, 2006, 329, 260-262. 6. Dissanayake, D., Gronski, M.A., Lin, A., Elford, A.R., Ohashi, P.S., Immunological perspective of self versus tumor antigens: insights from the RIP-gp model, Immunol. Rev., 2011, 241, 1, 164-179.

210

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

7. Foster, R.D., Pham, S., Li, S., Aitouche, A., Long-term acceptance of composite tissue allografts through mixed chimerism and CD28 blockade, Transplantation, 2003, 76, 6, 988-994. 8. Gill, R.G., NK cells: elusive participants in transplantation immunity and tolerance, Current Opinion in Immunology, 2010, 22, 5, 649-654. 9. Goldstein, R.S.,Transplantation of human embryonic stem cells and derivatives to the chick embryo, Methods Mol. Biol., 2010, 584, 367-385. 10. Hoyne, G.F., Mechanisms that regulate peripheral immune responses to control organ-specific autoimmunity, Clin. Dev. Immunol., 2011, doi: 10.1155/2011/294968. 11. Jiang, S.X., Zhu, L., Cui, Z.-M., Guo, D.W., Sun, W.-Y., Lin, L., Tang, Y., Wang, X., Liang, J., Transplant long-surviving induced by CD40–CD40 ligand costimulation blockade is dependent on IFN-γ through its effect on CD4+CD25+ regulatory T cells, Transplant Immunology, 2011, 24, 113-118. 12. Lee, S.Y., Choi, H.K., Lee, K.J., Jung, J.Y., Hur, G.Y., Jung, K.H., Kim, J.H., Shin, C., Shim, J.J., In, K.H., Kang, K.H., Yoo, S.H., Cancer immunotolerance: IDO links PGE2 to TREGs, J Immunother., 2009, 32(1), 22-28. 13. Mapara, M.Y., Sykes, Megan,Tolerance and cancer: mechanisms of tumor evasion and strategies for breaking tolerance, J. Clin. Oncol., 2004, 22, 6, 1136-1151. 14. McCarthy, D.A., Cell Preparation, In: Flow cytometry. Principles and Aplication, ed. Macey, Marion G., Humana Press Inc., New Jersey, 2007, 17- 58. 15. Murakami, T., Cosimi, B.A., Kawa, T., Mixed chimerism to induce tolerance: lessons learned from nonhuman primates, Transplantation Reviews, 2009, 23, 19-24. 16. Ophir, E., Reisner, Y., Induction of tolerance in organ recipients by hematopoietic stem cell transplantation, International Immunopharmacology, 2009, 9, 6, 694- 700. 17. Panaro, F., Piardi, T., Gheza, F., Ellero, B., Audet, M., Cag, M., Cinqualbre, J., Wolf, P., Causes of sirolimus discontinuation in 97 liver transplant recipients, Transplant Proc., 2011, 43, 4, 1128-1131. 18. Sykes, Megan, Wood, Katrin, Sachs, D.H., Transplantation Immunology, In: Fundamental immunology, ed.Paul, E.W., Ed. Lippincot Williams & Wilkins, Philadepphia, 2008, 1427-1478. 19. Szczepanik, M., Mechanisms of immunological tolerance to the antigens of the central nervous system. Skin-induced tolerance as a new therapeutic concept, Physiol. Pharmacol, 2011, 62, 2, 159-165. 20. Toscano, E., Cotta, J., Robles, M., Lucena, M.A., Andrade, R.J., Hepatotoxicity induced by new immunosuppressants, Gastroenterol Hepatol., 2010, 33, 1, 54-65.

211

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

21. Videla, C.O., Two-year experience with tacrolimus in renal transplantation after late conversion from cyclosporine therapy, Transplant Proc., 2009, 41, 6, 2659-2663. 22. Viertlboeck, Birgit, Göbel, T.W.F., Avian T Cells: Antigen Recognition and Lineages, In: Avian Immunology, sub red. Davison F., Kaspers B., Schat K., Elsevier Ltd., London, 2008, 91-106. 23. Wang, Y.H., Yan, Y., Rice, J.S., Volpe, B.T., Diamond, B., Enforced expression of the apoptosis inhibitor Bcl-2 ablates tolerance induction in DNA-reactive B cells through a novel mechanism, J Autoimmun., 2011, 37, 1, 18-27.

212

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CELLS INVOLVED IN ALLOGRAFT REJECTION

MONICA ȘEREȘ, ILEANA NICHITA, C. CUMPĂNĂȘOIU, R.V. GROS, E. TÎRZIU

Summary

In this paper there are described all the cells involved in the allografts rejection - antigen presenting cells (APCs), endothelial cells, T cell, B lymphocytes, NK cells, eosinophils and monocyte-macrophage system - both in mammals and birds. For individual cells are presented the origin, surface molecules and mechanisms by which they induce rejection. Most of these cells participate actively in these mechanisms, but some, such as endothelial cells of the allografts, are only targets of cellular effectors. Of all these cells, APC, T lymphocytes and monocyte-macrophage system are the most important for allotrasplant immunology. Key words: allografts, rejection, cells

Allografts‘ rejection is the result of activation of immune mechanisms, due to antigenic differences between major histocompatibility complex (MCH) molecules of the donor and recipient. In support of this assertion argues several aspects: autografts are always accepted if the conditions of asepsis and antisepsis are respected; if the antigenic differences between donor and recipient MCH are high, the allografts are rejected; from histological point of view, the tissue of a rejected graft is infiltrated with effector cells of the immune response: lymphocytes, macrophages, plasma cells; thymectomized animals have a decreased ability to reject transplanted tissues and organs, and this ability is restored after thymus transplantation; onset of rejection phenomena is delayed if the recipient is treated with antilymphocyte serum; rejection phenomena are more intense in young recipients, because of the abundance of lymphoid tissue, being more attenuated in elderly (27). In this paper there are described all the cells involved in allografts rejection, both in mamals and birds. Some of these cells are simple targets of the recipients‘ immune cells, but most of them are active effectors, involved in the main mechanisms underlying the immunological mechanisms of the tissue and organ allograft rejection.

Antigen presenting cells The main antigen presenting cells (APCs) involved in the rejection of allografts are the dendritic cells and endothelial cells (42).

213

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Dendritic cells (DC) arise from a bone marrow stem cell, then immature forms pass into the bloodstream and into most tissues and organs (except the brain, testicles and certain segments of the eye), where they will perform three major functions: ‖sentinel‖ - that activates innate immune response, processing and presentation of exogenous antigen to effector cells to initiate the adaptive immune response and regulation of both types of immune response mentioned above (45). DCs are classified in two major subpopulations – myeloid DC and plasmacytoid DC – which, although similar in terms of co-stimulatory and adhesion molecules or activation markers, shows differences in the morphology, function of surface antigens (45) . Myeloid dendritic cells (MDCs) are tisular DCs, deriving from differentiation of blood monocytes. Immature MDCs capture and process the antigens, resulting peptide fractions which are transported to regional lymph nodes or spleen, because of CCL20 chemoattractant action, where are presented to T lymphocytes. Once the MDCs reach the lymphoid organs, they maturate and secrete CCL22 chemokine, a attractant for T cells, that will accumulate around them, binding the MHC- antigen peptide complexes (45, 48). Compared to other APC, i.e. B lymphocytes and macrophages, the expression of MHC and MHC-antigen complexes on mature MDC is a hundred times higher (45). MDCs are important for acute and chronic rejection of allograft (42). On the other hand, the semimature MDCs are involved in the tolerance to donor antigens, by the activation of regulatory CD4+CD25+ T cells (13, 30). Langerhans cells (LC) are the most important accesory and antigen- presenting cell population of the skin immune system in mammals (48). Having their origin, like all other dendritic cells, in bone marrow, CL precursors migrate in the suprabasal epidermis, where they represent about 2-3% of epidermal cells (19). According to some authors, LCs are a unique population of dendritic cells (58) and are "equipped" to internalize foreign antigens that reach the skin surface (6, 48). These APC express MHC class II molecules and receptors for complement and Fc fragment of immunoglobulins (46, 47). They capture antigens that penetrate the skin and carry them in regional lymph nodes, in mammals case (6, 33, 46, 47, 48) and, in case birds, in dermal lymph nodes (15, 18) or in the spleen (18). Their major function is presentation of the antigen to T and B lymphocytes (restimulation of memory B cells) (46, 47). Langerhans cells residing in adult mice epidermis have ADP activity expressed MHC class II, CD205 and CD207 molecules (46); it was demonstrated that they play an important role in cellular acute rejection of the skin allografts (33), including those with incompatibility of H-Y antigen only (2). In birds, LC-like were initially described as MHC class II-positive and ATP- positive (9), but a recent research has shown that they express also CD45 molecule and are classified into two subpopulations - MHCII+/CD3- and MHC II- /CD3- (18).

214

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Plasmacytoid dendritic cells (CDP) derived from lymphoid precursors, and is localized in lymphoid organs and in the bloodstream (45). Recent studies showed that CDP-lymphocytes induces the generation of regulatory T-suppressor and, at the same time inhibiting the formation of subpopulations of alloreactive T cells. Also, the synthesis of type I interferons intense contributes to the occurrence of regulatory T-lymphocytes, and the installation tolerance (4, 11). Plasmacytoid dendritic cells (PDC) arise from lymphoid precursors, and can be found in lymphoid organs and in blood (45). Recent studies showed that PDCc induce the generation of regulatory and suppressor T cells, in the same time inhibiting the formation of alloreactive T cells. Also, these cells contributes to the occurrence of regulatory T lymphocytes, and the installation tolerance, through the synthesis of type I interferons (4, 11).

Endothelial cells of the graft The endothelial cells of the allografts express MHC class I and class II molecules, but also blood group antigens, thus they are a "target" for both helper and cytotoxic T cells (8).

T cells T lymphocytes arise from the lymphoid lineage cells, differentiated from pluripotent stem cells. T cell precursors from the bone marrow migrate to the thymus, an organ in which takes place the maturation and differentiation of T cells in in functional subsets (46, 47). The functions of these cells are related to membrane molecules, of which the most important are the receptors for antigen (TCR - T cell receptor). The markers of differentiation are denoted by CD initials (cluster of differentiation- class determinants) of which can be mentioned (46, 47): - CD3 expressed by all T cells (a TCR-associated protein with a role in ensuring the expression of the complex for the antigen recognition and transduction of the antigeninc signals in the cytoplasm, the initial step of cellular activation); - CD4 is a characteristic molecule of helper T lymphocytes involved in recognizing the complex MHC class II - antigen by binding the MHC molecule, with adhesion and transduction of the signal functions; - CD8, present on the surface of the cytotoxic and supressor T cells, with similar function as CD4 molecule (binds MHC class I molecules); - CD2, CD28, CD44 and others, with implicated in intercellular adhesion and signal transduction T lymphocytes can be classified, depending on the type of antigen receptor, in αβ T cells and γδ T cells. Also, the first population can be subclassified based on CD they acquire in CD4+ (helpers) and CD8+ lymphocytes (cytotoxic) (35). Studies on the structure of T cell populations showed that the latter distinction is not strict because there are other T-cell populations, such as the suppressor, which can expresses the CD4 or CD8, depending on the subsed involved (35, 39).

215

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

T cells are the pivot of the graft rejection regardless of the nature of grafted tissue/organ and most of the knowledge acquired over time regarding their physiology and function, as well as on the immunotolerance and autoimmunity, is based on observations made on the evolution of transplants (27). This assertion is supported by the fact that athymic mice or those thymectomized before the releasing of the mature T cells in bloodstream (at a young age) are absolutely unable to reject a graft (34, 40). The same phenomenon it was described in thymectomized adult mice who were subjected to irradiation to eliminate immunocompetent T lymphocytes (34). In addition, in all these cathegories of animals could be observed the restauration of their capacity to reject grafts after the inoculating of mature T cells from animals of the same line (34, 40). The involvement of T lymphocyte is due the antigen receptor (TCR) that recognize the non-self peptides bound to MHC antigens of the donor (TCR can "see" the antigenic peptides only if they are associated with MHC and this restriction is imposed by positive selection of T cells in the thymus) (27). In the mechanism of graft rejection, T helper cells (Th) play the primary role. This is demonstrated by the occurrence of acute rejection after inoculation of CD4+ T cells in athymic mice or in thymectomized and irradiate mice; this phenomenon was not reported after the inoculation of CD8+ T cells (42). Of the three subpopulations of CD4+ T cells (differentiated on the basis of the types of cytokines produced), the most relevant for graft rejection are Th1 and Th2 (42). Th1 lymphocytes are activated either directly (42) or by myeloid dendritic cells or B lymphocytes, by releasing of IL-2 or expression of CD80 costimulatory molecule (45). Cell activation results in the synthesis and secretion of IL-2, IFN-γ, TNF-α and TNF-β (lymphotoxin) (1, 45) to initiate the cellular immune response (1). Th2 lymphocytes are activated after the antigen presentation by plasmacytoid cells and macrophages, secreting IL-4, IL-5, IL-10 and IL-13. These cytokines stimulate primary B cell proliferation and differentiation into antibody- producing plasma cells (35, 45). The third category of Th lymphocytes (CD4+CD25+) intervene in the mechanisms of tolerance to donor antigens (12, 16, 17). Cytotoxic T cells induce allograft rejection through different cytotoxic mechanisms, the main participating proteins being perforin, granzymes and Fas ligand (5, 25, 37, 38).

B cells B lymphocytes are cells differentiated from lymphoid cell line, derived from hematopoietic stem cell, and their maturation process takes place in bone marrow in mammals and bursa of Fabricius in birds. Following activation, B cells differentiate into antibody-secreting plasma cells. B lymphocytes are classified into five classes depending on the isotypes of immunoglobulins produced (IgG, IgM, IgA, IgE, and IgD). The main membrane molecules present on the surface of B

216

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA lymphocytes are immunoglobulins, which play the role of antigen receptor (BCR - B cell receptor) (46, 47). Allograft rejection is mediated especially by IgG antibodies, in particular directed againts MHC class I (3, 42, 54) and class II molecules (42, 54); the only class of immunoglobulins which does not participate in this process is IgA (14).

Natural killer cells Natural killer cells (NK) originate in bone marrow (52) and represents approximately 15% of circulating lymphocytes that do not express receptors for antigen specific to T and B cells (35, 45). NK cells have some similarities with T cells (morphology, some functions and a part of surface molecules are common to both type of cells); the differences between NK and T cells are: absence of TCR and CD3 on the surface of NK cells; NK cell do not undergo maturation in thymus (they are present and have function in athymic mice) and do not require MHC class I incompatibility for the initiation of the rejection mechanisms, such as CD8+ T cells (52). Although so far was demonstrated a definite involvement of NK cells in allogeneic bone marrow rejection (29, 53), their role in the rejection of allogeneic organs and tissues is not completely elucidated (52). Thus, NK cells are a predominant cells population in infiltrate which invades skin and liver grafts, being an early source of inflammatory cytokines and initiation factors for the maturation of dendritic cells (20, 21, 31). Also, if the NK cells are a "key" element in the allografts rejection, their action depends on T lymphocytes. The murine lines with T cells deficiencies are unable to reject allogeneic organs (42). At the same time it is assumed that interaction between T cells and NK cells is important for cardiac allografts chronic rejection in mice (26, 49, 50).

Mononuclear phagocyte system The term is attributed to cell populations derived from myeloid lineage, with important functions in both natural and adaptive immune response. In ontogenesis these cells are known several stages: monoblast and promonocyte (in bone marrow), monocyte (blood) and macrophage (cells located in various tissues and organs) (46). Of these stages, macrophages are those that have a greater importance in the immune response to allografts (42). These cells act as the "sentinel", by the detection of antigens in tissues and organs, as well as effector cells, destroying foreign elements (45). In allograft transplantation, macrophages have primarily an effector role, participating in accelerated rejection (32), acute rejection (51) and chronic rejection (24). Their cytotoxic action is enhanced by CD4+ T lymphocytes that secrete IFN-γ (leading to activation of macrophages) and antibodies acting as opsonins (42, 44). In addition, macrophages secrete IL-1 responsible for the fever that accompanies the rejection of the graft (28, 44).

217

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Eosinophils Eosinophils are polymorphonuclear cell containing the intracytoplasmic granules with affinity for eosin (36, 45, 46, 47). Eosinophils leave their place of origin, bone marrow, populating the spleen where undergo maturation, then spend a short period in the circulatory system (only 30 minutes). Thereafter, the cells migrate into tissues where they live up to 12 days (45, 46, 47). For each eosinophil in blood there are 500 eosinophils in tissues (46, 47). Eosinophils have two types of cytoplasmic granules: small particles containing arylsulfatase, peroxidase and acid phosphatase, and large crystalloid granules, with the center consisting of a major basic protein (MBP) and the matrix formed by eosinophil cationic protein, eosinophilic peroxidase and eosinophilic neurotoxin (45). On the surface of these cells therea are a number of receptor molecules for the Fc fragment of IgG, IgE, and other immunoglobulins, components of the complement, cytokines (interleukins, interferons), arachidonic acid derivatives, chemotactic factors and adhesion molecules (46, 47). Currently there are evidences that eosinophils, recruited in transplanted tissue by Th2 cells (via IL-4 and IL-5), have an effective role in the rejection of skin, heart, and liver allografts, releasing cytotoxic proteins of the granules (10, 22, 23). The importance of these cells in graft rejection has been demonstrated after the neutralization of IL-5, action that stopped the rejection (7, 41). Besides proteins released after degranulation (cationic protein and peroxidase), eosinophils synthesize and release a series of cytokines: IL-1α, IL-3, IL- 4, IL-5, IL-6, granulocyte-macrophage colony-stimulating factor (GM-GSF), TNF-α, TGF-α and TGF-β. The production of a large number of cytokines (specific to Th2 lymphocytes), as well as IDO (indoleamine 2,3 dioxygenase), results in inhibition of Th1 cell response and the maintenance of optimum conditions for the local accumulation (45). All these findings bring into question the veracity of the current hypothesis that cytokines synthesized by Th1 lymphocytes promote allograft rejection and that Th2 cells produce factors favorable for grafts survival.

References

1. Amirzargar, A., Lessanpezeshki, M., Fathi, A., Amirzargar, M., Khosravi, F., Ansaripour, B., Nikbin B., Th1/Th2 Cytokine Analysis in Iranian Renal Transplant Recipients, Transplantation Proceedings, 2005, 37, 7, 2985-2987. 2. Anderson, C., Carroll, J.M., Stefania Gallucci, Ridge, J.P., Cheever, A.W., Polly Matzinger, Testing Time-, Ignorance-, and Danger-Based Models of Tolerance, The Journal of Immunology, 2001, 166, 3663-3671.

218

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

3. Aragão, E., Moura, L.A., Pacheco-Silva, A., Monitoring Anti-HLA Class I IgG antibodies in renal transplant recipients, Transplantation Proceedings, 2001, 36, 4, 836-837. 4. Arpinati, M., Chirumbolo, Gabriella, Urbini, B., Perrone, Giulia, Rondelli, D., Anasetti, C., Role of plasmacytoid dendritic cells in immunity and tolerance after allogeneic hematopoietic stem cell transplantation, Transplant Immunology, 2003, 11, 3-4, 345. 5. Bittmann, Iris, Müller, C., Behr, J., Groetzner, J., Frey, L., Löhrs, U., Fas/FasL and perforin/granzyme pathway in acute rejection and diffuse alveolar damage after allogeneic lung transplantation - a human biopsy study, Virchows Arch., 2004, 445, 345-381. 6. Bos, J.D., Teunissen, M.B.B., Innate and adaptive immunity, In: Clinical and Basic Immunodermatology, (eds.) Gaspari, A.A., Tyring, S.K., Ed. Springer-Verlog, London, 17-30, 2004. 7. Braun, M.Y., Desalle, F., Le Moine, A., Pretolani, M., Matthys, P., Kiss, R., Goldman, M., IL-5 and eosinophils mediate the rejection of fully histoincompatible vascularized cardiac allografts: regulatory role of alloreactive CD8(+) T lymphocytes and IFN-gamma, Eur. J. Immunol., 2000, 30, 5, 1290-1296. 8. Cai, J., Terasaki, P.I., Incidence and role of antibody in graft injury: how can it best be monitored? Transplantation Reviews, 2004, 18, 4, 192-203. 9. Carrillo-Farga, J., Perez Torres, A., Castell Rodriguez, A., Antuna Bizarro, S., Adenosine triphosphatase-positive Langerhans-like cells in the epidermis of the chicken (Gallus gallus), J. Anat., 1991, 176, 1-8. 10. Chan, S.Y., Debruyne, L.A., Goodman, R.E., Eichwald, E.J., Bishop, D.K., In vivo depletion of CD8+ T cells results in Th2 cytokine production and alternate mechanisms of allograft rejection, Transplantation, 1995, 59, 8, 1155-1161. 11. Chen, W., The role of plasmacytoid dendritic cells in immunity and tolerance, Current Opinion in Organ Transplantation, 2005, 10, 3, 181. 12. Dijke, I.E., Wejmar, W., Baan, C.C., The Control of Anti-Donor Immune Responses by Regulatory T Cells in Organ Transplant Patients, Transplant Proceedings, 2008, 40, 5, 1249-1252. 13. Fu, B.-M., He, X.-S-, Yu, S., Hu, A., Zhang, J., Ma, Y., Tam, N., Huang, J.-F., A tolerogenic semimature dendritic cells induce effector T-cell hypores-ponsiveness by activation of antigen-specific CD4+CD25+ T regulatory cells that promotes skin allograft survival in mice, Cellular Immunology, 2010, 261, 69-76. 14. Hrncír, Z., Erben, J., Tichy, M., – Serum levels of IgM, IgD, IgA and IgG before and during rejection of renal allotransplants, Czech Med., 1979, 2, 3, 148. 15. Igyártó, B.-Z., Lackó, Erzsebet, Oláh, I., Magyar, A., Characterization of chicken epidermal dendritic cells, Immunology, 2006, 119, 278-288.

219

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

16. Jang, J.W., Kim, J.D., Kwon, J.H., Bae, S.H., Cho, S.H., Yang, J.M., Choi, S.W., Lee, C.D., Role of circulating CD4+CD25+ and intragraft FOXP3+ regulatory T cells in a liver transplant population, Journal of Hepathology, 2010, 52, 1, S177. 17. Jiang, S., Tsang, Julia, Tam, P., Regulatory T cell immunotherapy for transplantation tolerance: Step into clinic, Intern. Immunopharm., 2010, 10, 1486-1490. 18. Kaspers, B., Kothlow, Sonja, Butter, C., Avian antigen presenting cells, In: Avian Immunology, (eds.) Davison, F., Kaspers, B., Schat, K.A., Academic Press, London, 183-195, 2008. 19. Katz, S.I., Tamaki, K., Sachs, D.H., Epidermal Langerhans cells are derived from cells originating in bone marrow, Nature, 1979, 282, 324. 20. Kondo, T., Morita, K., Watari, Y., Auerbach, M.B., Taub, D.D., Novick, A.C., Toma, H., Fairchild, R.L., Early increased chemokine expression and production in murine allogeneic skin grafts is mediated by natural killer cells, Transplantation, 2000, 15, 69, 5, 969. 21. Koskela, K., Neiminen, P., Kohonen, P., Salminen, H., Lassila, O., Chicken B cell activating factor: regulator of B cell survival in the bursa of Fabricius, Scand. J. Immunol., 2004, 59, 449. 22. Le Moine, A., Surquin, Murielle, Demoor, F.X., Noël, J.C., Nahori, Marie-Anne, Pretolani, Marina, Flamand, Véronique, Braun, M.Y., Goldman, M., Abramowicz, D., IL-5 Mediates Eosinophilic Rejection of MHC ClassII-Disparate Skin Allografts in Mice, The Journal of Immunology, 1999, 163, 3778-3784. 23. Le Moine, A., Goldman, M., Non-classical pathways of cell-mediated allograft rejection: new challenges for tolerance induction?, Am. J. Transplant., 2003, 3, 101-106. 24. Leonard, C.T., Soccal, Paola M., Singer, Lianne, Berry, G.J., Theodore, J., Holt, P.G., Doyle, Ramona L., Dendritic Cells and Macrophages in Lung Allografts. A Role in Chronic Rejection?, Am. J. Respir. Crit. Care Med., 2000, 161, p.1349-1354. 25. Li, Z.D., Deng, H, Liu, C.H., Song, Y.H., Wang, N., Wei, H., Production of Duck-Chicken Chimeras by Transferring Early Blastodermal Cells, Poultry Science, 2002, 81, 1360-1364. 26. Maier, S., Tertilt, Christine, Chambron, Nicole, Gerauer, K., Hüser, N., Heidecke, C.-D., Pfeffer, K. Inhibition of natural killer cells results in acceptance of cardiac allografts in CD28-/- mice, Nature Medicine, 2001, 7, 557-562. 27. Mihăiescu, G., Imunologie şi imunochimie, Ed. Universităţii din Bucureşti, Bucureşti, 429-439, 2001. 28. Mugea, T.T., Agresiuni termoenergetice, Editura Universităţii din Oradea, Oradea, 134-167, 2002.

220

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

29. Murphy, W.J., Kumar, Vina Y., Bennett, M., Acute rejection of murine bone marrow allografts by Natural Killer Cells And T cells. Differences in Kinetics and Target Antigens Recognized, J. ExMed., 1987, 166, 1499- 1509. 30. Natarajan, S., Thomson, A.W., Tolerogenic dendritic cells and myeloid- derived suppressor cells: Potential for regulation and therapy of liver auto- and alloimmunity, Immunobiology, 2010, 215, 698-703. 31. Piccioli, D., Sbrana, S., Melandri, E., Valiante, N.M., Contact-dependent stimulation and inhibition of dendritic cells by natural killer cells, J. ExMed., 2002, 195, 335-341. 32. Pratschke, J., Wilhelm, M.J., Kusaka, M., Beato, Francisca, Milford, E.L., Hancock, W.W., Tilney, N.L., Accelerated Rejection of Renal Allografts From Brain-Dead Donors, Ann. Surg., 2000, 232, 2, 263-271. 33. Richters, C.D., van Gelderop, E., du Pont, J.S., Hoekstra, M.J., Kamperdijk, E.W.A., Migratory Properties of Skin Dendritic Cells of the Rat, Transplantation Proceedings, 1997, 29, 1745-1747. 34. Robertson, R., Weinberg, K.I., Immunological reconstitution following bone marrow transplantation, Immunological Reviews, 1997, 157, 1, 73-78. 35. Roitt, I., Brostoff, J., Male, D., Immunology, Vth Edition, Mosby Inc., USA, 17-26, 85-92, 187-197, 1998. 36. Roitt, I.M., Delves, P.J., Roitt‘s Essential Immunology, 10th Edition, Blackwell Publishing, Massachusetts, USA, 19, 34-57, 2001. 37. Setoguchi, K., Kishimoto, H., Kobayashi, S., Shimmura, H., Ishida, H., Toki, D., Suzuki, T., Ohnuki, K., Tate, Y., Fujioka, S., Abe, R., Tanabe, K., Potential role of host effector memory CD8+ T cells in marrow rejection after mixed chimerism induction in cynomolgus monkeys, Transplant Immunology, 2010, 23, 194-203. 38. Sharma, Vijay K., Bologa, Roxana M., Li, B., Lagman, Milagros, Hiscock, W., Mouradian, Janet, Wang, J., Serur, D., Rao, W., Suthanthiran, M., Molecular executors of cell death differential intrarenal expression of Fas ligand, Fas, granzyme B, and perforin during acute and/or chronic rejection of human renal allografts, Transplantation, 1996, 62, 1860-1866. 39. Shevach, E.M., Regulatory/Suppressor T cells, In: Fundamental immunology, (ed.) Paul, E.W., Ed. Lippincot Williams & Wilkins, Philadepphia, 943-978, 2008. 40. Starzl, T.E., Acquired immunologic tolerance: with particular reference to transplantation, Immunol. Res., 2007, 38, 1-3, 6-41. 41. Surquin, Murielle, Le Moine, A., Véronique Flamand, Nathalie Nagy, Katia Rombaut, Demoor, F.X., Stordeur, P., Isabelle Salmon, Guéry, J.C., Goldman, M., Abramowicz, D., Skin Graft Rejection Elicited by β2- Microglobulin as a Minor Transplantation Antigen Involves Multiple Effector

221

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Pathways: Role of Fas-Fas Ligand Interactions and Th2-Dependent Graft Eosinophil Infiltrates, The Journal of Immunology, 2002, 169, 500-506. 42. Sykes, Megan, Wood, Katrin, Sachs, D.H.,Transplantation Immunology, In: Fundamental immunology, (ed.) Paul, E.W., Ed. Lippincot Williams & Wilkins, Philadepphia, 1427-1478, 2008. 43. Taylor, S.G., McKenzie, I.F.C., Sandrin, M.S., Characterization of the rat α(1,3)Galactosyltransferase: evidence for two independent genes encoding glycosyltransferases which synthesize Galα(1,3)Gal by two separate glycosylation pathways, Glycobiology, 2003, 13, 5, 327-337. 44. Tilney, N.L., Kupiec-Weglinski, J.W., The Biology of Acute Transplant Rejection, Ann. Surg., 1991, 214, 2, 98-106. 45. Tizard, I.R., Veterinary Immunology. An Introduction, 8th edition, Ed. Saunders Elsevier, Missouri, USA, 89-99, 139-150, 336-338, 381-389, 2009. 46. Tîrziu, E., Imunologie, Ed. Brumar, Timişoara, 57-86, 210-221, 263-268, 2004. 47. Tîrziu, E., Cumpănăşoiu, C., Monica Şereş, Imunologie veterinară – Note de curs, Ed. Waldpress, Timişoara, 2010. 48. Udey, M.C., Cutaneous dendritic cells in health and disease, In: Clinical and Basic Immunodermatology, (eds.) Gaspari, A.A., Tyring, S.K., Ed. Springer-Verlog, London, 119-130, 2008. 49. Uehara, S., Chase, Catharine M., Kitchens, W.H, Rose, H.S., Colvin. R.B., Russell, P.S., Madsen, J.C., NK Cells Can Trigger Allograft Vasculopathy: The Role of Hybrid Resistance in Solid Organ Allografts, J. Immunol., 2005, 175, 3424-3430. 50. Uehara, S., Chase, Catharine M., Colvin. R.B., Madsen, J.C., Russell, P.S., T cell depletion eliminates the development of cardiac allograft vasculopathy in mice rendered tolerant by the induction of mixed chimerism, Transplant Proc., 2006, 38, 10, 3169-3171. 51. Wyburn, Kate, Wu, H., Yin, J., Jose, M., Eris, Josette, Chadban, S., Macrophage-derived interleukin-18 in experimental renal allograft rejection, Nephrol. Dial. Transplant, 2005, 20, 699-706. 52. Yokoyama, W.M., Natural Killer Cells, In: Fundamental immunology, (ed.) Paul, E.W., Ed. Lippincot Williams & Wilkins, Philadepphia, 484-513, 2008. 53. Yoneda, O., Imai, T., Goda, S., Hiroshi, Inoue, Yamauchi, A., Okazaki, T., Imai, H., Yoshie, O., Bloom, E.T., Domae, N., Umehara, H., Fractalkine-Mediated Endothelial Cell Injury by NK Cells, The Journal of Immunology, 164, 4055-4062. 54. Zarkhin, Valerya, Chalasani, Geetha, Sarwal, Minnie M., The yin and yang of B cells in graft rejection and tolerance, Transplantation Reviews, 2010, 24, 67-78.

222

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

RESEARCH REGARDING IMMUNOSUPPRESSION INDUCED BY T-2 TOXIN

E. TÎRZIU1, MONICA LIKER2, ILEANA NICHITA1, CLAUDIA SALA1, OLIMPIA COLIBAR1, C. CUMPĂNĂȘOIU1, DANIELA MOȚ3, R.V. GROS1, CSILLA ZAMBORI4, MONICA ȘEREȘ1

1Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania 2University of Medicine and Pharmacy ―Victor Babes‖ Timisoara 3Banat‘s University of Agricultural Sciences and Veterinary Medicine ‖King Michael I of Romania‖ from Timisoara, Faculty of Animal Science and Biotechnology 4National Institute of Research – Development in the Pathology Domain and Biomedical Sciences ―Victor Babes‖, Bucharest, Romania E-mail: [email protected]

Summary

The purpose of this research was to describe the immunosuppressive effect exerted in vitro by T-2 toxin. 30 white miced were used, divided in three groups: control group (A), experimental group 1 (B, treated with Mycoplasma immunogen) and experimental group 2 (C, treated with T-2 toxin and Mycoplasma immunogen). After spleen harvesting and mononuclear cells separation, the following paramenters were determined: proliferation factor, with and without stimulation of cell cultures with phytohaemagglutinin (PHA), concanavalin (ConA) and Mycoplasma immunogen (My), and interleukin-2 synthesis in cell cultures. The results show that in cell cultures of group A (control), cell proliferation takes place within normal parameters, while in group B, cell proliferation was moderate in absence of mitogens, and higher after stimulation with PHA. The data obtained regarding the IL-2 show that treatment with mitogens has effects on the synthesis of this interleukin, but this influence varies among groups, depending on in vivo treatment. Thus, in control group, the active dilution for the stimulation with PHA was with 1/3 lower than in stimulation with My. In group B, synthesis of interleukin-2 was higher when the stimulation was carried out with Mycoplasma extract. In group C, consisting of mice receiving T-2 toxin and Mycoplasma extract, synthesis of interleukin 2 was canceled, showing that T-2 toxin has a significant immunosupresive effect. Key words: T-2 toxin, immunosuppresion, Mycoplasma immunogen, cell culture

T-2 and HT-2 toxins are produced by some Fusarium species: F. poae, F. sporotrichioides, F. armeniacum (syn. F. acuminatu subspecies armeniacum) and F. langsethiae. Toxicity of T-2 and HT-2 toxins was evaluated by Scientific Committee for Food of the European Commission, and now is generally agreed that these toxins have a significant higher toxicity, immunotoxicity and haematotoxicity comparing to other mycotoxins produced by genus Fusarium species (10). 223

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

T-2 toxin inhibits protein synthesis and, in high doses, DNA and RNA synthesis, both in vitro and in vivo. The acute toxicity of T-2 toxin is very similar to the HT-2 one; in vivo T-2 toxin is rapidly transformed in the HT-2 toxin. For this reason, in vivo toxicity of T-2 toxin can be attributed, at least in part, to HT-2 toxin. In these circumstances, it is necessary to establish tolerable daily intake, for both T-2 and HT-2 toxins. Thus, the Committee established a temporary tolerable daily intake of 0.06 mg / kg for T-2 and HT-2 toxins, taken together (10). T-2 toxin induces irreversible damage in bone marrow, reducing the total number of leukocytes (6, 7), delayed hypersensitivity, being also responsible for selective depletion of blood cell progenitors and reduced synthesis of antibodies (4). The research presented in this paper provides a detailed picture of how mycotoxins affect effector cell compartment responsible for the synthesis of two extremely important cytokines - IL-2 (involved in the maturation and differentiation T cells) and IFN-γ (extremely important in innate and adaptive immune response to infection) - also proposing a way to improve the negative effects with immunomodulatory products. Of these, we wish to emphasize the Mycoplasma immunogen (My), as potentially stimulating factor for cells isolated from animals previously exposed to T2 toxin.

Materials and methods

The purpose of this research was to demonstrate the immunosuppressive action of T-2 toxin using 30 white mice (weight 20-22 g), divided into three groups and treated with (Table 1): - T-2 toxin (Sigma) - 1.5 mg / animals, inoculated intraperitoneally in a volume of 0.2 ml, twice, in day 1 and 8 of the experiment; - Mycoplasma immunogen - 0.05 ml / animal, administered twice, in day 1 and 8 of the experiment (Table 1).

Table 1 Experimental scheme No. of Mycoplasma Group T-2 Toxin animals imunogen A (control) 10 - - B (experimental) 10 + - C (experimental) 10 + +

The animals were euthanized 14 days after the first administration of the two products (alone or in combination), and the spleen was sampled from each animal by splenectomy, then suspended in phosphate-buffered saline (PBS) supplemented with antibiotics. Using the samples mentioned below, the following assays were performed:

224

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

- cell proliferation assay using non-adherent mononuclear cells isolated from spleen; - the estimation of interleukin-2 synthesis in cell cultures; - the determination of interferon synthesis in cell cultures. In vitro, have been used as immunomodulators prepared as follows: - Phytohaemagglutinin (PHA) at a concentration of 1μg/ml culture medium; - Mycoplasma immunogen in a concentration of 50μg/ml culture medium. The assays were performed on cell cultures with or without immunomodulators. Mycoplasma immunogen (My). The immunogen was obtained from the Mycoplasma agalactiae cultures, after 72 hours incubation, using the method recommended by Chandler and Barile (2). Briefly, the tubes with the culture medium containing mycoplasmas were frozen in a cooling bath, after which they were allowed to thaw slowly at laboratory temperature. This freeze-thaw procedure was repeated five times, after which the tubes were centrifuged at 100,000 g for 60 minutes. The supernatant was dialyzed against 40 volumes of distilled water at 4°C (6 times). Bacteria-free extract was then placed in vials, lyophilized and kept at 4°C until administration (2). Spleen cells cultures. Sampled spleen tissue was washed three times using MEM medium (Sigma - M4655) supplemented with antibiotic and antimycotic solution 2%. The tissue cutted in small pieces, after which was triturated through the 40-mesh sieve (SIGMA CD1) of cell dissociation system. The cell deposit was taken up in MEM medium supplemented with antibiotic and antimycotic solution and was treated with nonenzimatic cell dissociation solution (SIGMA – C5789) to release the cells from the remaining tissue debris. The suspension was filtered using a 100-mesh sieve and centrifuged at 800 g for 15 minutes at 4°C; the resulting cell pellet was then washed two times with MEM medium supplemented with antibiotic and antimycotic solution 1%. The last pellet was resuspended in MEM medium and processed by centrifugation on Ficoll-density gradient (StemCell Technologies Inc, Vancouver, BC, Canada) (5). Cell proliferation assay. The purpose of this assay was to determine the ratio between the number of cells / ml of culture at 72 hours after stimulation and the number of cells in the same culture before mitogenic or antigenic stimulation. Thus, the proliferation factor (Pf) and proliferation coefficient (Pc) was calculated according to the following formulas:

no. of cells /ml after 72 hours of incubation Pf = no. of cells/ml before stimulation

Pf of stimulated culture Pc = Pf of control culture

225

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Interpretation: if Pc value is higher than 1, the immunomodutator agent has a stimulating effect, for values of Pc lower than 0, it is considered that the immunomodutator agent has an inhibitory effect. Determination of interleukin-2 synthesis in cell cultures by fluorometric assay. In the present experiment CTLL-2 cell line was used, a line dependent of IL-2 and MTT (3- (4, 5 dimethylthiazol-2-yl) -2, 5 diphenyltetrazolium bromide). CTLL-2 cells have the capacity to cleave MTT, transforming this yellow substance in a brown precipitate - formazan. The precipitate is then dissolved using isopropyl alcohol, and the intensity of the reaction, determined using a spectrophotometer, it is directly proportional to the amount of formazan formed. Determination of interferon synthesis in cell cultures. The method is based on the neutralizing effect of interferon gamma (IFN-γ) on viruses, such as vesicular stomatitis virus (VSV), which are cytopathogenic and affects certain cellular substrates (like Vero cell line). From the test sample, decimal dilutions are made, and a constant amount of virus (100 DICP/ml). These dilutions, together with the control sampe (VSV, 100 DICPE/ml) were inoculated into culture plates with Vero cells, then incubated at 37°C for 72 hours. After this interval, cell cultures were examined for evidence of cytopathic effect, which in Vero cell culture inoculated with control sample (virus) is 100%.

Results and discussions

Cell proliferation The data show that in the cells samples taken from control group animals (A), cell proliferation is within normal parameters (Table 2). In the case of stimulation with phytohemagglutinin (PHA), there is a moderate enhancement of cell proliferatin coefficient (1.33), while in the cultures stimulated with the extract of Mycoplasma, the coefficient was 1.42. In the case of group B (treated in vivo with Mycoplasma immunogen), the proliferation factor in unstimulated cells cultures was moderate (Pf = 2.3). After the stimulation with phytohemagglutinin, there was an increase both of proliferation factor (Pf=3.4) and proliferation coefficient (Pc = 1.48). Mycoplasma extract induced a moderate amplification cell proliferation (Pf = 3.5), but the coefficient was approximately equal to that recorded after PHA stimulation (Pc = 1.52). In mice inoculated treated in vivo both with Mycoplasma extract (group C), and toxin T-2 (Sigma), there is a drastic reduction in cell proliferation, the proliferation factor beind 1.1 in case of stimulation with PHS and 0.9 with Mycoplasma extract. These results demonstrate that T-2 toxin induces a stagnation of cell activation.

226

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 2 Values of the cell proliferation factor Lotul In vivo In vitro Proliferation factor Proliferation treatment stimulation after 72 hours coefficient

A - Unstimulated 2.4 - Pha 3.2 1.33 My 3.4 1.42 B Mycoplasma Unstimulated 2.3 - Pha 3.4 1.48 My 3.5 1.52 C Mycoplasma Unstimulated 0.5 - + toxin T-2 Pha 1.1 0.73 My 0.9 0.60

Persistence, even at a very low level, of proliferation capacity of cell cultures shows that the negative effects of mycotoxin is somewhat improved by the presence of Mycoplasma immunogen,considering that it was already demonstrated T-2 toxin's ability to induce apoptosis of cells capable of rapid proliferation both in vivo (8) and in vitro (3, 9).

IL-2 synthesis The data obtained show that treatment with mitogens (PHA and My) have effects on IL-2 synthesis, but this influence varies among groups, depending on in vivo treatment. Thus, in control group, the active dilution for the stimulation with PHA was with 1/3 lower than the My active dilution (table 3).

Table 3 Interleukin 2 synthesys Group Limiting dilution In vitro treatment (log2) A M 1 PHA 3 My 4 B M 1 PHA 3 My 5 C M 0 PHA 0 My 0

227

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

In group B (animals treated with Mycoplasma immunogen), synthesis of interleukin-2 was more intense when the in vitro stimulation was carried out with Mycoplasma extract. In group C, consisting of mice receiving T2 toxin and Mycoplasma extract, synthesis of interleukin 2 was canceled. The negative effects of T-2 toxin on the in vitro synthesis of IL-2 has been shown for other cell types, like peritoneal macrophages and lymph nodes lymphocytes - the level of this cytokine recovery from cultures being nearly zero (1).

IFN-γ synthesis The results regarding the synthesis of interferon-γ, are similar to those observed in the case of interleukin 2. Thus, in the cultures obtained from animals groups A and B (untreated with toxin T-2), normal indexes (≥2) show that interferon can be found in supernatants (table 4). The in vivo administration of Mycoplasma extract (group B) enhanced the synthesis of interferon, compared with control (group A), but in case of group C (animals treated with T-2 toxin and Mycoplasma extract) cancellation of the synthesis of interferon was observed.

Table 4 Results of IFN-γ assessment Lotul In vitro treatment Limiting dilution (log2) A M 1 PHA 2 My 3 B M 2 PHA 3 My 5 C M 0 PHA 0 My 0

Our results are similar to those reported by Ahmadi and Riazipour (1) - a significant reduction of the synthesis of IFN-γ in peritoneal macrophages and lymphocyte cultures obtained from mice. However, in this experiment the animals were not exposed to toxin T-2 in vivo. In our study, mice were challenged with T-2 toxin twice, at an interval of eight days, which was sufficient for the manifestation of all immunotoxic effects of this compound. The lymphocytes were exposed to toxin T-2 a longer time, which explains their incapacity to synthesise IFN-γ, even in the presence of mitogens. At the same time, the absence of IFN-γ and IL-2 synthesis in

228

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA mitogen-stimulated cell cultures suggests functional irreversible changes at the cellular level.

Conclusions

Toxin T-2 causes a reduction of cell proliferation capacity both in resting cells and cells stimulated with mytogens, aspect that suggests a stagnation of cell activation capacity. T-2 toxin administered in feed inhibits cytokine synthesis, i.e. IL-2 and IFN- γ, aspect that demonstrate the induction of functional irreversible changes at the cellular level.

Acknowledgments

This study was supported by the project Dezvoltarea infrastructurii de cercetare, educaţie şi servicii în domeniile medicinei veterinare şi tehnologiilor inovative pentru RO 05, cod SMIS-CSNR 2669 and by the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the European Social Fund and the Romanian Government under the contract number POSDRU 141531 awarded to Csilla Zambori.

References

1. Ahmadi, K., Riazipour, M., Effects of T-2 toxin on cytokine production by mice peritoneal macrophages and lymph node T-cells, Iran J. Immunol., 2008, 5, 3, 177-180. 2. Chandler, Donna K. F., Barile M.F., Ciliostatic, Hemagglutinating, and Proteolytic Activities in a Cell Extract of Mycoplasma pneumoniae, Infection and Immunity, 1990, 29, 3 1111-1116. 3. Chaudhary, M., Rao, P.V., Brain oxidative stress after dermal and subcutaneous exposure of T-2 toxin in mice, Food Chem. Toxicol., 2010, 48, 3436–3442. 4. Creppy, E.E., Update of survey, regulation and toxic effects of mycotoxins in Europe, Toxicology Letters, 2002, 127, 9–28. 5. McCarthy, D.A., Cell Preparation, In: Flow cytometry. Principles and Aplication, ed. Macey, Marion G., Humana Press Inc., New Jersey, 2007, p. 17-58. 6. Moss, M.O., Mycotoxin review-2. Fusarium, Mycologist, 2002, 16, 158-161. 7. Pacin, A., Reale, C., Mirengui, H., Orellana, L., Boente, G., - Subclinic effect of the administration of T-2 toxin and nivalenol in mice, Mycotoxin Research, 1994, 10, 34-46.

229

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

8. Shinozuka, J., Suzuki, M., Noguchi, N., Sugimoto, T., Uetsuka, K., Nakayama, H., Doi, K., T-2 toxin-induced apoptosis in hematopoietic tissues of mice, Toxicol. Pathol., 1998, 26, 674–681. 9. Shokri, F., Heidari, M., Gharagozloo, S., Ghazi-Khansari, M., In vitro inhibitory effects of antioxidants on cytotoxicity of T-2 toxin, Toxicology, 2000, 146, 171 – 176. 10. ***Commission Recommendation 2013/165/EU on the presence of T-2 and HT-2 toxin in cereals and cereal products - http://eur- lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2013:091:0012:0015:EN: PDF (accesed of 15.02.2015).

230

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CHANGES IN CELLULAR COMPARTMENT OF THE IMMUNE SYSTEM ASSOCIATED WITH ENZOOTIC BOVINE LEUKOSIS

E. TÎRZIU, ILEANA NICHITA, CLAUDIA SALA, C. CUMPĂNĂȘOIU, R.V. GROS, MONICA ȘEREȘ

Summary

Enzootic bovine leukosis (EBL) is a viral disease of adult cattle caused by bovine leukaemia virus (BLV) and is accompanied by a series of changes in cellular and humoral compartments of the immune system. This review describes the most important cells affected by viral infection cells B cells, T cell immune response, as well as the kinetics, turnover, recirculation, and homing of lymphocyte populations. Cellular changes induced by BLV, taken together, are important for elucidating the pathogenic mechanisms underlying EBL, for and early and certain diagnosis of this viral disease and also for establishing the most efficient therapeutic strategies. Key words: enzootic bovine leukosis, B cells, T cells

Enzootic bovine leukosis (EBL) is a disease of adult cattle caused by a retrovirus, bovine leukaemia virus (BLV). BLV is closely related to human T-cell leukemia virus types 1 and 2 (HTLV-1 and -2), agents associated with adult T-cell leukemia (ATL) and with the chronic neurological disorder tropical spastic paraparesis/HTLV-1-associated myelopathy. In addition to structural genes, BLV and HTLV have a special pX region, located between the env gene and the 3′ long terminal repeat, which contains two well-characterized open reading frames (ORFs), one encoding a transactivator protein, Tax, and another encoding the Rex protein, which is involved in promoting the expression of viral structural proteins. Tax protein activates the transcription of the viral genome and also that of many cellular genes (28). Cattle may be infected at any age, including the embryonic stage. Most infections are subclinical, but a proportion of cattle (30-70%) over 3 years old develop persistent lymphocytosis, and a smaller proportion (0.1-10%) develop lymphosarcomas (tumors) in various internal organs. Natural infection has also been recorded in buffaloes, sheep and capybaras (37).

231

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

B cells Although studies regarding the enzootic bovine leukosis (EBL) reported the possibility of bovine leukaemia virus (BLV) persistance in cells belonging the monocyte-macrophage system (12, 14), the idea that B cells expressing membrane immunoglobulin M are the main target of this virus is currently supported unanimously (15, 20, 29, 30, 31, 33, 34). The heavy chain of immunoglobulin γ is found frequently in cattle‘s lymphomas, which are composed mainly of mature B cells (31, 35). Also, the comparative assessment of infected cattle with and without persistent lymphocytosis (PL+ and PL-) demonstrates that IgM+ lymphocytes represents about 75% of B cells in animals BLV+ PL+, a significantly higher than that recorded in the second category, BLV+ PL- (20). Sequencing of the gene rearrangements in IgM producing B cells of BLV- infected cattle have shown that the immunoglobulin is functional, in the same time exhibiting polyspecific reactivity and containing an exceptionally long complementarity-determining region (CDR3H) (25). Such CDR3H region is specific in antibodies of patients with chronic leukemia, such as antibodies directed against DNA (36). In addition to the marker above mentioned, infected B lymphocytes often co-express CD5 molecule. As a result, about one-third of affected cattle develop persistent lymphocytosis, which are characterized by benign polyclonal expansion of B cells CD5+ subset (3). To this is added the increase to a lesser extent, but still significant, of the CD5- B cell subpopulation (22, 23). Opposite situation is registered in the milk of BLV-infected cows, particularly those PL+, respectively and increase of CD5−/CD11b− CD21+ cells (11). In these circumstances, the level of B cells can reach values of 20000- 80000/μl (19), CD5 + subset representing up to 80% of peripheral blood B cells (3). Impaired bone marrow induces the installation of leukemia, and the level of lymphocytes can reach 100 000 cells/μl (19). Although proviral particles were detected in both B cells subsets (CD5+ and CD5-) isolated from cattle infected with BLV, most of the cells isolated from lymphosarcoma seem to express CD5 + phenotype (35). The situation is different in sheep, tumor cells isolated from this species expressing only rarely CD5 (8). In healthy cattle, CD5 is associated with B cell antigen receptor (BCR) and this cross-link reduces susceptibility to apoptosis of B lymphocytes expressing them. Because the two membrane markers are not connected in B cells of the cattles cattle with persistent lymphocytosis, the phenomenon above mentioned is not relevant in infected animals (7). At the same time, CD5 molecule has an inhibitory effect, by preventing the activation of B cells via the BCR in the presence of weak signals, such as autoantigens (4). In cultures of blood mononuclear cells isolated from sheep infected with BLV there is a significant reduction in B-cells apoptosis as compared to non-

232

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA infected control group, and this phenomenon is a definite indication of the interference exerted by the virus which, at least in part, is dependent on caspase 8 (55). In this regard it was noted that depletion of reduced glutathione by addition of etacrynic acid to the culture medium canceled the effect of BLV, increasing the spontaneous apoptosis of B cells and addition of glutathione to cultures restored the cell viability of the infected cells (2, 5). Thus, the absence of connection between CD5 and BCR and reducing the susceptibility to apoptosis of antigen stimulated B lymphocytes are the basic mechanisms of BLV-induced persistent lymphocytosis (15). BLV can infect also the cells that express the IL-2 receptor (CD25) and major histocompatibility complex class II (MHC class II) or a related molecule, formerly known as tumor-associated antigen (TAA) (15). One of the dominant features of late stage of viral infection is the peripheral blood mononuclear cells proliferation after cultivation in the absence of antigenic or mitogenic stimulation, i.e. spontaneous proliferation. This phenomenon is present almost exclusively in B cells has as results an increased number of infected cells. The BLV-infected cattle, spontaneous proliferation is associated with expression of CD11b, CD18, CD5, MHC Class II DP, MHC class II DQ, MHC Class II DR and CD25 molecules (18). Innitially, enzootic bovine leukosis has been qualified as a lymphoproliferative disease (13) but the cell proliferation levels in asymptomatic cattle and healthy animals are not significantly different (9). In vitro it was demonstrated that the main factor responsible high levels of peripheral B lymphocytes is a reduction in apoptosis (0.057 day−1 versus 0.156 day−1) associated with a decreased proliferation (0.0046 day−1 versus 0.0085 day−1). This aspect is dependent on the experimental conditions used, the reduced ability of B lymphocytes to proliferate or undergo apoptosis in case of PL+ cattles being revealed only in the presence of some polyclonal activators. In normal culture conditions, the proportion of apoptotic cells and cells (obtained from PL+ cattle) undergoing proliferation is preserved in cultures. Also, in the absence of short- term culture, a large part of peripheral blood lymphocytes are resting in G0/G1 phase of the cell cycle, indicating that proliferation occurs in other sites (lymphoid organs) (9). In another experiment, Debacq et al. (10) administered carboxyfluorescein diacetate succinimidyl ester (CFSE) into BLV-infected sheep (one single intravenous injection) aiming to track lymphocyte migration through the lymph node in vivo. The results showed no signigicant diference between recirculation rates in BLV-infected sheep and control animals (healthy). Also, after immunophenotyping and flow cytometry, it was obvious that the peripheral blood B cells undergoes increased cell death in BLV-infected sheep. The most advanced currently available diagnostic methods allow only the detection of very few lymphocytes expressing BLV proteins, so it can be said that the number of infected cells that survive the host defense mechanisms is

233

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA extremely low. Also, the immune response will affect only in a small degree the cells that contain the virus in latent form. The main advantage of this phenomenon is the stability of viral load, with fluctuations of some cell clones, as revealed by long-term follow up of proviral integration using PCR (15). Under normal conditions, activation and proliferation of B cells depend on a variety of immune stimuli and involves BCR stimulation, expression of CD40 ligand on T cells, and a series of cytokines. It is believed that BLV replication is initiated by the classical regulatory mechanisms because viral expression may be augmented by molecules that simulate the B cells activation by immune system cells (15). Animal retroviruses, which belong to the Alpharetrovirus and Gammaretrovirus genera, induce tumors by one of two mechanisms: either by activation of the ―viral oncogene‖ or by ―insertional activation‖ of a cellular gene such as a proto-oncogene (1). BLV lacks a known oncogene and does not integrate into preferred sites in their host cell genomes, which related to the disruption of the host gene but not to the suppression of viral gene expression (24). Most studies of BLV-induced leukemogenesis have focused on the Tax protein because it is believed to be a potent transcriptional activator of viral gene expression. In addition to its function as a transcriptional activator, Tax induces immortalization of primary REFs (1). The Tax expression promotes the cell cycle entry, providing an advantage to BLV-infected cells whether they have or not viral antigens, these cells proliferating. It can be considered that in vivo expression BLV is continuous as viral transcripts are detected in whole blood immediately after incubation at 37°C in the absence of any exogenous factors. BLV+ cells will be destroyed by the immune effectors or will die by activating the intrinsic and extrinsic mechanisms of apoptosis. In addition, these cells will always stimulate the immune response of the host. Cells in which viral expression was suppressed or have not acquired viral antigens after mitosis will enter in a resting phase because of the absence Tax and / or immunological stimulation. These cells would not be destroyed by the immune system of the host and may be isolated and measured in vitro (15). According to the mechanism proposed by Gillet et al. (15), which appears to be the most complete, the virus is in a permanent transit between latent and active phase, resulting in progressive accumulation of infected but viable cells. Intervetion of somatic mutations associated with genetic instability of these cells leads, in the end, to the proliferation of transformed clones and to installation of leukemia (15).

T Cells Experimental studies in sheep have shown that cytotoxic T cell (CD8+) capable of recognizing epitopes in the structure of both Tax and capsid proteins

234

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA appear in the peripheral blood in the early phase of the seroconversion (17), while the T helper cells (CD4+) proliferate only in 1-2 weeks after the BLV inoculation (32). Compared with response to HTVL in human patients, enzootic bovine cytotoxic response belongs to γδ T cells almost completely (16). Also, BLV infection triggers an activity of CD4+ T cells, dependent and independent on the presence of the virus (17, 26). Immunizations carried out with the BLV peptides in sheep showed that BLV viral structures stimulate differentially the T lymphocyte subpopulations Thus, peptide 98 (part of the BLV envelope) stimulates the CD4+ subset, which produces type 1 cytokines, whereas peptide 61 (also in BLV envelope) promote the proliferation of CD8+ T cells. CD8+ T cells are responsible for the synthesis of type II cytokines, favoring the expansion of B cells and the humoral immune response against BLV (16). In vitro stimulation with p24 showed the major mechanism of T helper cells activation, with the participation of antigen-presenting cells (APC) MHC class II+; the APC involeved in activation process the viral antigens in a compartment sensitive to chloroquine. It was also observed that this viral structure causes a significant expansion of CD8+ T cells (21). Also, a recent study showed that the proportion of Foxp3+ CD4+ T cells from persistent lymphocytotic cattle was significantly increased compared to control and aleukemic cattle. The proportion of this subset correlated positively with the increased number of lymphocytes, virus titer and virus load, and inversely correlated with IFN-γ mRNA expression. These results suggest that Foxp3+ CD4+ cells in cattle have a potentially immunosuppressive function (27).

References

1. Aida, Y., Murakami, H., Takahashi, M., Takeshima, S-N., Mechanisms of pathogenesis induced by bovine leukemia virus as a model for human T- cell leukemia virus, Front. Microbiol., 2013, http://journal.frontiersin.org/ article/10.3389/fmicb.2013.00328/full (accessed 7.02.2015). 2. Alcaraz, Teresa S., Kerkhofs, P., Reichert, M., Kettmann, R., Willems, L., Involvement of glutathione as a mechanism of indirect protection against spontaneous ex vivo apoptosis associated with bovine leukemia virus, Journal of Virology, 2004, 78, 6180-6189. 3. Amills, M., Ramiya, V., Norimine, J., Olmstead, C.A., Lewin, H.A., Reduced IL-2 and IL-4 mRNA expression in CD4+ T cells from bovine leukemia virus-infecte cows with persistent lymphocytosis, Virology, 2002, 304, 1-9. 4. Berland, R., Wortis, H.H., Origins and functions of B-1 cells with notes on the role of CD5, Annu. Rev. Immunol, 2002, 20, 253.

235

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

5. Bouzar, A.B., Boxus, M., Florins, A., François Carole, Reichert, M., Willems, L., Reduced levels of reactive oxygen species correlate with inhibition of apoptosis, rise in thioredoxin expression and increased bovine leukemia virus proviral loads, Retrovirology, 2009, 6, 102-111. 6. Debacq, C., Asquith, B., Reichert, M., Burny, A., Kettmann, R., Willems, L., Reduced cell turnover in bovine leukemia virus-infected, persistently lymphocytotic cattle., J Virol, 2003, 77, 13073-13083. 7. Cantor, G.H., Palmer, G.H., Antisense oligonucleotide inhibition of bovine leukemia virus tax expression in a cell-free system, Antisense Res Dev, 1992, 2, 147-152. 8. Chevallier, Nathalie, Berthelemy, M., Le Rhun, D., Laine, V., Levy, D., Schwartz-Cornil, I., Bovine leukemia virus-induced lymphocytosis and increased cell survival mainly involve the CD11b+ B-lymphocyte subset in sheep, J. Virol., 1998, 72, 4413-4420. 9. Debacq, C., Asquith, B., Reichert, M., Burny, A., Kettmann, R., Willems, L., Reduced cell turnover in bovine leukemia virus-infected, persistently lymphocytotic cattle, J. Virol., 2003, 77, 13073-13083. 10. Debacq, C., Gillet, N., Asquith, B., Sanchez-Alcaraz, M.T., Florins, A., Boxus, M., Schwartz-Cornil, I., Bonneau, M., Jean, G., Kerkhofs, P., Hay, J., Thewis, A., Kettmann, R., Willems, L., Peripheral blood B-cell death compensates for excessive proliferation in lymphoid tissues and maintains homeostasis in bovine leukemia virus-infected sheep, J. Virol., 2006, 80, 9710-9719. 11. Della Libera, Alice Maria Melville Paiva, de Souza, F. N., Freitas Batista, Camila, Parapinski Santos, Bruna, de Azevedo, L.F.F., Sanchez, E.M.R., Soraia Araújo Diniz, Soraia, Silva, M.X., Haddad, J.P., Blagitz, Maiara Garcia, Effects of bovine leukemia virus infection on milk neutrophil function and the milk lymphocyte profile, Vet Res, 2015, 46, 2. 12. Domenech, Ana, Goyache, J., Llames, L., Jesus, P.M., Suarez, G., Gomez-Lucia, E., In vitro infection of cells of the monocytic/macrophage lineage with bovine leukaemia virus, J. Gen. Virol., 2000, 81, 109-118. 13. Ferrer, J. F., Marshak, R. R., Abt, D. A., Kenyon, S. J., Relationship between lymphosarcoma and persistent lymphocytosis in cattle: a review. J. Am. Vet. Med. Assoc., 1979, 175, 705-708. 14. Fulton, B.E. Jr., Portella, M., Radke, K., Dissemination of bovine leukemia virus-infected cells from a newly infected sheep lymph node, J. Virol., 2006, 80, 7873-7884. 15. Gillet, N., Florins A,. Boxus, M, Burteau, Catherine, Nigro, Annamaria, Vandermeers, F., Balon, H., Bouzar, A.-B., Defoiche, J., Burny, A., Reichert, M., Kettmann, R., Willems, L., Mechanisms of leukemogenesis induced by bovine leukemia virus: prospects for novel anti-retroviral therapies in human, Retrovirology, 2007, 4, 18, 1-32.

236

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

16. Kabeya, H., Ohashi, K., Sugimoto, C., Onuma, M., Characterization of immune responses caused by bovine leukemia virus envelope peptides in sheep, J. Vet. Med. Sci., 1999, 61, 475-480. 17. Kabeya, H., Ohashi, K., Onuma, M., Host immune responses in the course of bovine leukemia virus infection, J. Vet. Med. Sci., 2001, 63, 703- 708. 18. Konnai, S., Usui, T., Ikeda, M., Kohara, J., Hirata, T., Okada, K., Ohashi, K., Onuma, M., Tumor necrosis factor-alpha up-regulation in spontaneously proliferating cells derived from bovine leukemia virus- infected cattle, Arch Virol., 2006, 151, 347-360. 19. Lavanya, Madakasira, Kinet, Sandrina, Montel-Hagen, Amelie, Mongellaz, C., Battini, J.-L., Sitbon, M., Taylor, Naomi, Cell Surface Expression of the Bovine Leukemia Virus-Binding Receptor on B and T Lymphocytes Is Induced by Receptor Engagement, J. Immunol., 2008, 181, 891-898. 20. Levkut, M., Ponti, W., Levkutov, M., Rocchi, M.I., Poli, G., Lambertenghi Deliliers, G., Quirici, N., Leng, L., Immunoanalysis of IgG and IgM Molecules on the Surface of BLV Infected Cattle Lymphocytes, Comparative Haematology International, 1997, 7, 152-156. 21. Mager, A., Masengo, R., Mammerickx, M., Letesson, J.J., T cell proliferative response to bovine leukaemia virus (BLV): identification of T cell epitopes on the major core protein (p24) in BLVinfected cattle with normal haematological values, J. Gen. Virol., 1994, 75 (Pt 9), 2223-2231. 22. Matheise, J.P., Delcommenne, M., Mager, A., Didembourg, C.H., Letesson, J.J., CD5+ B cells from bovine leukemia virus infected cows are activated cycling cells responsive to interleukin 2, Leukemia, 1992, 6, 304- 309. 23. Meirom, R, Moss, S., Brenner, J., Bovine leukemia virus-gp51 antigen expression is associated with CD5 and IgM markers on infected lymphocytes, Vet. Immunol. Immunopathol., 1997, 59, 113-119. 24. Murakami, H., Yamada, T., Suzuki, M., Nakahara, Y., Suzuki, K., and Sentsui, H., Bovine leukemia virus integration site selection in cattle that develop leukemia. Virus Res. 2011, 156, 107–112. 25. Saini, S.S., Allore, B., Jacobs, R.M., Kaushik, A, Exceptionally long CDR3H region with multiple cysteine residues in functional bovine IgM antibodies, Eur. J. Immunol., 1999, 29, 2420-2426. 26. Stone, D.M., Norton, L.K., Chambers, J.C., Meek, W.J., CD4 T lymphocyte activation in BLV-induced persistent B lymphocytosis in cattle, Clin. Immunol., 2000, 96, 280. 27. Suzuki, S., Konnai, S., Okagawa, T., Ikebuchi, R., Shirai, T., Sunden, Y., Mingala, C.N., Murata, S., Ohashi, K., Expression analysis of Foxp3 in T cells from bovine leukemia virus infected cattle, Microbiol Immunol, 2013, 57(8), 600-604.

237

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

28. Tajima S., Ikawa, Y., Aida, Y. Complete bovine leukemia virus (blv) provirus is conserved in blv-infected cattle throughout the course of b-cell lymphosarcoma development, J. Virol., 1998, 72, 9, 7569-7576. 29. Usui, T., Konnai, S., Ohashi, K., Onuma, M., Expression of tumor necrosis factor-alpha in IgM+ B-cells from bovine leukemia virusinfected lymphocytotic sheep, Vet. Immunol. Immunopathol., 2006, 112, 296-301. 30. Usui, T., Konnai, S., Ohashi, K., Onuma, M., – Interferon-gamma expression associated with suppression of bovine leukemia virus at the early phase of infection in sheep. Vet. Immunol. Immunopathol., 2007, 15, 17-23. 31. Vernau, W., Jacobs, R.M., Valli, V.E., Heeney, J.L., The immunophenotypic characterization of bovine lymphomas, Vet Pathol, 1997, 34, 222-225. 32. Ward, W.H.,. Dimmock, C.K., Eaves, F.W., T lymphocyte responses of sheep to bovine leukaemia virus infection, Immunology Cell Biology, 1992, 70, 329-336. 33. Willems, L., Kerkhofs, P., Attenelle, L., Burny, A., Portetelle, D., Kettmann, R., The major homology region of bovine leukaemia virus p24gag is required for virus infectivity in vivo, J. Gen. Virol., 1997, 78 ( Pt 3), 637-640. 34. Willems, L., Grimonpont, C., Kerkhofs, P., Capiau, C., Gheysen, D., Conrath, K., Roussef, R., Mamoun, R., Portetelle, D., Burny, A., Adam, E., Lefebvre, L., Twizere, J.C., Heremans, H., Kettmann, R., Phosphorylation of bovine leukemia virus Tax protein is required for in vitro transformation but not for transactivation, Oncogene, 1998, 16, 2165-2176. 35. Wu, D., Takahashi, K., Murakami, K., Tani, K., Koguchi, A., Asahina, M., Goryo M, Aida Y, Okada K., B-1a, B-1b and conventional B cell lymphoma from enzootic bovine leukosis, Vet. Immunol. Immunopathol., 1996, 55, 63. 36. Yan, X.J., Albesiano, E., Zanesi, N., Yancopoulos, S., Sawyer, A., Romano, E., Petlickovski, A., Efremov, D.G., Croce, C.M., Chiorazzi, N., B cell receptors in TCL1 transgenic mice resemble those of aggressive, treatment-resistant human chronic lymphocytic leukemia, Proc. Natl. Acad. Sci. USA, 2006, 103, 11713-11718. 37. *** Enzootic Bovine Leukosis, In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2011, vol. 2, p. 729-738, http://www.oie.int/fileadmin/ Home/eng/Health_standards/tahm/2.04.11_ EBL.pdf (accesed 11.02.2015).

238

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

THE PREVALENCE OF YERSINIA SPECIES IN SLAUGHTERED PIGS

L. TUDOR1, ELENA MITRĂNESCU1, MANUELLA MILITARU1, ANETA – LAURA TUDOR2

1University of Agronomic Sciences and Veterinary Medicine of Bucharest, Faculty of Veterinary Medicine, 105, Splaiul Independentei, District 5, 050097, Bucharest, Romania 2 Faculty of Veterinary Medicine, University of ―Spiru-Haret‖ of Bucharest, Romania E-mail: [email protected]

Summary

This study follows the isolation frequency of Yersinia germs from different organs and carcasses samples collected from slaughtered pigs. The study presents a high importance because it reveals the probability of contamination with bacterial species of Yersinia genus, which are pathogen for human beings (especially for infants) through alimentary toxic infections, manifested by austere diarrhea syndrome. To determine the isolation prevalence of Yersinia bacteria, a total number of 7.258 organs and muscle samples were harvested and processed through microbiological assays; the study was developed during a period of 3 years (2012-2014). The identification-confirmation stage was realized by using API 20E galleries: the API 20E system offers the possibility of identification of Yersinia germs in 24 h, as well as other enteric bacteria. The obtained results demonstrated a low incidence at portage of bacteria belonging to Yersinia genus (maximum 0.21 %), but these low values can be determined by the inhibition of Yersinia bacteria by preferential development of other bacteria which populate the intestine. The highest isolation frequency was observed at the level of serous surfaces (pleura and peritoneum), this specific observation demonstrating the carcass post-mortem contamination either because of slaughtered pigs evisceration in improper conditions (evisceration in improper conditions and minimal techniques) or because of the carcass faecal contamination. The statistical analysis on 3 years period continues a previous study. The obtained results establish a total prevalence of 0.321. The annual variations of the isolation frequency were situated between relatively low values (between 0.19% and 0.54%). Key words: Yersinia, pig, prevalence, isolation.

The actuality and the interest exercised by the Yersinia sp. are determined by the fact that these bacterial species generate a series of morbid entities which are under the attention of many bacteriologists, epidemiologists and doctors. On the theme of the infections produces by these bacteria in the latest years have been published numerous studies, and the research in this domain acquired a special amplitude. In the last decade of the passed millennium, numerous researches pulled the attention that the bacterial species in Yersinia genus are frequently involved, in case of human beings, in production of alimentary toxic infections manifested by diarrheas acute syndrome.

239

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

From a clinical point of view these yersinioses do not present special complications and are efficiently treated, the epidemiological risk is important, being observed episodes that comprised hundreds of cases (3, 8, 11, and 12). Initially, Yersinia pestis species was considered to have the most important epidemiological risk. Afterwards, many groups of research observed that they are involved in food toxic infections in humans and other species of animals. In present days, although there have been discovered and comprised taxonomically many species of Yersinia, are considered principal pathogenic for humans 3 species: Yersinia pestis, Yersinia pseudotuberculosis and Yersinia enterocolitica. Taking into account that the contamination sources, for human beings, are represented generally by food products which are not thermally processed or subjected for short periods of time to thermic processing and at values of temperature of maximum 70oC, we considered adequate the performing of several investigation which could reveal the optimal values of temperatures for conservation and growing of Yersinia enterocolitica stems, the period of surviving of this bacterial species at low values of temperatures (in refrigerated or deep-frozen food products) or at raised values of temperature (in food products subjected to a thermal treatment).

Materials and methods

The adapted method that we used to collect and primary processing the samples include a series of differential elements concerning the biological type of products which is subjected to complex bacteriological investigations in order to diagnose the presence of bacterial species from Yersinia genus. For the prevalence isolation of Yersinia germs, there have been collected and bacteriological analyzed samples of muscle from different anatomical parts of slaughtered pigs carcasses, sanitary swabs loaded on peritoneal surfaces and parietal pleura and also different portions of organs (liver, spleen, kidney, mesenteric lymphatic centers, intestinal portions). The collection of the samples was performed mainly from recently hunted slaughtered pigs (maximum 60 minutes after the blast), obtained by authorized hunting in small groups or collective hunting. The sample collection was executed between 2012 and 2014 and gathered a total number of 7,258 samples. Each sample was transmitted to laboratory and processed followed also the work stages comprised in the ISO techniques (SR ISO 10.273, SR 12925, STAS 2356-82), and also the work techniques used actually by different microbiology laboratories in order to establish a diagnosis of this bacterial species. The work method used in this case comprised several stages: - the sampling from animal is realized in strict aseptic conditions. From each sample a quantity of 10 g of muscle tissue is taken, for meat samples or, depending on the situation, which are introduces in the tow enrichment media, obtaining a percentage of 1/10 or 1/100 (percentage mass/volume or volume/volume).

240

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

- the enrichment is realized in 2 different selective liquid media: 10 g (ml) of sample are introduced in 90 ml of PSB medium (peptone-sorbitol-biliar salts broth), obtaining a percentage of 1/10. The incubation is realized at 25oC for 5 days. Another 0.1 g (ml) of sample are introduced in 9 ml of ITC medium (irgasan- ticarcylin-potassium chlorate broth), obtaining a percentage of 1/100. The incubation is realized 25oC for 2 days. - for isolation and identification, a culture loop from the enrichment broth PSB is passed directly on the surface of CIN agar and 0,5 ml of culture from the same medium is transferred in 4,5 ml of KOH saline solution 0,25 % and is homogenized for 10-20 seconds. After the homogenization a culture loop is passed on the CIN agar surface. In parallel, a loop from the culture obtained in the enrichment broth ITC is passed on the surface of SSDC gelose (Salmonella-Shigella, with sodium desoxycholate and calcium chlorine). The incubation of the dishes is realized at 30oC, in aerobiosis (?), for 24 h. After 24 hours, the dishes are examined with a magnifying glass or using an oblique light to recognize the characteristic colonies of Yersinia enterocolitica. On the surface of CIN gelose, the characteristic colonies are small (1 mm), flat, with a red spot in the center, surrounded by a pink area, semitransparent (having the aspect of an ―ox‘s eye‖), and bile precipitate, and, after examining on oblique light, they are tiny granulated and not iridescent. On Wauters (SSDC) gelose, the characteristic colonies are small (1 mm) and grey, with a thin margin, and by examining on oblique light, they are tiny granulated and not iridescent. For confirmation, a number of 5 characteristic and/or suspect colonies are selected from the selective culture media dishes, which were reintroduced on the surface of some dishes with nutritive gelose in order to obtain pure cultures to perform the confirmation through biochemical assays. The dishes with sowed nutritive agar are incubated at 30oC for 24 h. The identification-confirmation stage was realized by using API 20E galleries.

Results and discussions

The statistical analysis of the performed research on a total number of 7,258 samples (between 2012 - 2014) permitted the conclusion of an annual incidence at relatively low values, with variations from an year to another. The number of positive samples and the isolation frequency of Yersinia germs is synthetically presented in table 1. The results obtained demonstrated a low incidence at portage of bacteria belonging to Yersinia genus (maximum 0,54 %), but these low values can be determined by the inhibition of Yersinia bacteria by preferential development of other bacteria which populate the intestine. The highest isolation frequency was observed at the level of serous surfaces (pleura and peritoneum), this specific observation demonstrating the carcass post-mortem contamination either because of slaughtered pigs evisceration in improper

241

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA conditions (evisceration in improper conditions and minimal techniques) or because of the carcass faecal contamination. Table 1 Identification of the number of positive samples and the isolation frequency of bacteria belonging to Yersinia genus, from analysed samples The number of positive samples and the isolation frequency (%) / period The type of samples 2012 2013 2014 Entire period nr. / % nr. / % nr. / % nr. / % Samples of muscle 1 0.05 0 0 1 0.05 2 0.070 from carcass

Samples of liver 1 0 0 0 0 0 1 0.030 portions

Samples of spleen 0 0 1 0.14 0 0 1 0.030 portions

Samples of 3 0.25 4 0.62 4 0.37 11 0.385 intestinal portions Samples of mesenteric 1 0.05 1 0.14 2 0.18 4 0.140 lymphatic centers Samples of kidney 0 0 0 0 0 0 0 0.000

Sanitary swabs 2 0.17 1 0.14 2 0.18 5 0.105

Total samples 8 0.37 7 0.19 9 0.54 24 0.321

There haven‘t been observed isolations from parenchimal organs, and from the muscle samples there has been made a single isolation (which we can consider accidental), the Yersinia germs which accede to the organism through contamination by oral way, arrive at the mesenteric lymphatic center as maximum level. Although the total prevalence, in the survey period, demonstrates low values (0.321), it can be concluded the possibility of these bacteria to contaminate the slaughtered pigs carcasses, these constituting contamination sources for consumers. Following this, a series of alimentary products obtained through thermal processing by using methods which involve low values of temperature applied on short periods of time, or alimentary products consumed without being processed (raw), can be involved in alimentary toxic infections episodes.

Conclusions

After collection and processing through techniques and bacteriological assays a total number of 7,258 samples of muscle, different organ parts and 242

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA sanitary swabs pleura and peritoneum, there have been isolated a number of 22 bacterial stems which were identified as belonging to the species included in Yersinia genus. The statistical analysis of the obtained results on a 3 years period permitted the establishing of a total prevalence of 0.321. The annual variations of the isolation frequency were situated between relatively low values (between 0.19% and 0.54%). From the total number of analyzed sample types, the highest value of isolation frequency was observed for the sanitary swabs of pleura and peritoneum (0.385% for the total period), the other isolations being considered accidental. The bacterial species form Yersinia genus can contaminate the slaughtered pigs carcasses, the products and by-products obtained after processing, these carcasses being considered the origin of food toxic infections.

References

1. Aulisio, C.G., Mehlman, Sanders A.C., Alkali method for rapid recovery of Yersinia enterocolitica and Yersinia pseudotuberculosis from foods, Appl. Env. Microbiology, 1980, 39(1), 135–140. 2. Bhaduri, S., Turner-Jones, C.O., Buchanan, R.L., Phillips, J.G., Response surface model of the effect of pH, sodium chloride and sodium nitrite on growth of Yersinia enterocolitica at low temperatures, International Journal of Food Microbiology, 1994, 23(3 -4),333-343. 3. Borch, E., Nesbakken, T., Christensen, H., Hazard identification in swine slaughter with respect to foodborne bacteria, International Journal of Food Microbiology, 1996, 30(1-2), 9- 25. 4. Brocklehurst, T.F., Parker, M.L, Gunning, P.A., Coleman, H.P., Robins, M.M., Growth of food-borne pathogenic bacteria in oil-in –water emulsions,II- Effect of emulsion structure on growth parameters and form of growth, Journal of Applied Bacteriology, 1995, 78(6), ,609- 615. 5. Buiuc, D., Microbiologie Medicală, Ed. Didactică şi Pedagogică, Bucureşti, 1992, 327. 6. Buiuc, D., Neguţ, M., Microbiologie clinică, Ed. Medicală, 1999. 7. El-Ziney, M.G., De Meyer, H., Debevere, J.M., Kinetics of interactions of lactic acid, pH and atmosphere on the growth and survival of Yersinia enterocolitica 383 IP O9 at 4 degrees C, International Journal of Food Microbiology, 1995, 27, (2- 3), 229 – 244. 8. Erkmen, O., Survival of virulent Yersinia enterocolitica during the manufacture and storage of Turkish Feta cheese, International Journal of Food Microbiology, 1996, 33(2 -3), 285-292. 9. Fukushima, H., Gomyoda, M., Growth of Yersinia pseudotuberculosis and Yersinia enterocolitica biotype 3B serotype O,3 inhibited on cefsulodin- irgasan-novobiocin agar, Journal of Clinical Microbiology, 1986, 24, 116–120.

243

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

10. Greer, G.G., Dilts, B.D., Lactic acid inhibition of the growth of spoilage bacteria and cold tolerant pathogens on pork, International Journal of Food Microbiology, 1995, 25, (2), 141- 151. 11. Hartung, M., Gerigk, K., Yersinia in effluents from the food- processing industry. (Review) - Revue Scientifique et Technique, 1991, 10(3), 799- 811. 12. Highsmith, A.K., Feeley, J.C., Skaliy, P., Isolation of Yersinia enterocolitica from weel water and growth in distilled water, Appl. Env. Microbiology, 34(6),745, 1977. 13. Little, C.L., Knochel, S., Growth and survival of Yersinia enterocolitica, Salmonella and Bacillus cereus in Brie stored at 4, 8 and 20 degrees C- International Journal of Food Microbiology, 1994, 24 (1- 2), 137 – 145. 14. Ramirez, E.I., Vazquez – Salinas, C., Rodas–Suarez, O.R, Pedroche, F.F., Isolation of Yersinia from raw meat (pork and chicken) and precooked meat (porcine tongues and sausages) collected from comercial establishments in Mexico City–Journal of Food Protection, 2000, 63(4), 542 – 544.

244

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

EVALUATION OF AFLATOXIN M1 INCIDENCE IN RAW MILK AND RIPENED CHEESE RETAILED IN A TRADITIONAL MARKET

G. VALASUTEAN, ALEXANDRA TĂBĂRAN, OANA REGET, S.D. DAN, M. MIHAIU

University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Veterinary Medicine, Mănăştur Street, no.3/5, Cluj-Napoca, Romania E-mail: [email protected]

Summary

Aflatoxin M1 is a metabolite of aflatoxin B1 which can occur frequently in milk and dairy products obtained from cattle that have been fed with contaminated forages. The study aimed to evaluate the incidence of aflatoxin M1 in the milk and dairy products sold on a traditional market from Transylvania area. All 60 samples of milk and 50 samples of ripened cheese were purchased during the period of September 2013 and March 2014. For the detection of M1 toxin we used Elisa method. We have found that 4 samples (8%) of milk have exceeded the European Commission regulation standard (50 ng/kg). None of the ripened cheese products have exceeded this accepted limit. Our results show that raw milk has a higher prevalence of contamination compared to processed products. In conclusion, the area studied should be monitored more carefully and the assessment of the mycological quality of raw milk obtained in small scale farms to be mandatory. Key words: Aflatoxin M1, milk, cheese, market

Aflatoxins are metabolic products of three species of Aspergillus: A. flavus, A. parasiticus, A. nomius. Aflatoxin M1 (AFM1) and M2 (AFM2) are the hydroxylated metabolites of aflatoxin B1 and B2, which are commonly found in milk and dairy products produced by animals that have ingested contaminated feed. These metabolites are not destroyed by heat treatment processes during the making of dairy products, representing a high risk of contamination. The amounts of AFM1 depend on various factors such as breed, lactation period, mammary infections etc. In can be detected in milk after 12 – 24 hours post-ingestion, the highest level being found in a few days (8, 11, 13, 14). The maximum levels of 0.05 and 0.5 µg/kg are found in milk (4). In order to reduce the concentration of aflatoxin B1 in feed it is necessary to monitor the good manufacturing practices (GMP) and good hygiene practices (GHP) along the entire chain of production. The HACCP system of dairy production units needs to have preventive measures which insure that the level of such toxins is reduced at minimum. In the case preventive measures fail, AFB1 can be reduced by applying physical or chemical treatments. One of the most used methods for chemical decontamination of feed is the ammoniation, which insures a decomposition of aproximatly 95% of AFB1 (4).

245

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

The weighted mean concentration of aflatoxin M1 in milk is 0.023 µg/kg in the European - type diet and the intake of aflatoxin M1 from milk is calculated to be 6.8 ng/person per day for the European diet (4). The methods used for the detection of Aflatoxin M1 in milk and dairy products include radioimmunoassay and ELISA methods. Previous studies on aflatoxin M1 contamination in raw milk and dairy products have shown high concentrations, some of them exceeding the limits imposed by the European regulations and Codex Alimentarius (5, 9, 12). For this reason our study aimed at evaluating the level of AFM1 in milk and dairy products produced in some traditional markets of Transylvania area.

Materials and methods

Samples A total of 415 samples of raw milk and dairy products were analyzed. These samples were gathered during January 2012 and December 2014 from the North-West area of Transylvania. The samples were represented by: 246 samples of raw milk, 34 samples of telemy cheese, 84 samples of fresh cow cheese and 51 samples of goat and sheep cheese. Sample preparation The first step in the analysis of the samples was the removal of the fat substrate, which was made by high speed centrifugation (3500 rot/min. for 10 min). For the ELISA testing 100 µl were used. ELISA procedure The technique was performed according to the kit protocol Ridascreen (R- biopharm; Germany). The ELISA protocol tested in this research is currently used in the sanitary veterinary laboratories for food control. The absorbance considered for each of the samples was 450 nm and was made with the help of an ELISA plate reader. The quantification of aflatoxin amount was made by using a standard curve performed at different concentrations. Statistical analyses The statistical analyses were made in Windows 7 program, using the Origin 8.5 software. We have applied the T-student test and ANOVA variance in order to see the possible significant differences among the samples tested according to the product and units for the samples collecting. Differences were considered significant at a P value lower than 0.05 marked *.

Results and discussions

All the samples were successfully analyzed for aflatoxin M1 residue with the ELISA technique used. The results are shown in table 1.

246

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Table 1 Occurrence of aflatoxin M1 in the milk samples analyzed

AFM1 levels (ng/l) No. of samples % Range Not detected 48 - - < 10 38 15.44 1.3 – 8.7 10 - 30 15 6.09 11.2 – 28.6 30 - 50 133 54.06 30.5 - 43 >50 12 4.87 64.8 - 103 Total samples 246 80.46 1.3 – 103

From the total amount of 246 samples of raw milk, 12 (4.87%) failed to meet the requirements of the European legislation defined as under 50 ng/l. The range of values obtained in the aflatoxin M1 concentrations within the samples analyzed were 1.3 – 103 ng/l. The highest percent of aflatoxin M1 (54.06) was in between 30.5 – 43 range, very close to the accepted limit. In the samples of dairy products analyzed the results were different, showing that all the samples were in accordance with the imposed limit (250 ng/kg). The results are shown in table 2.

Table 2 Occurrence of aflatoxin M1 in the cheese types analyzed

Types of Number of samples Contamination (ng/l) cheese Tested Positive Negative Level* Range Telemy 34 5 29 14.08 11.02 – 17.08 Fresh cheese 84 9 75 8.4 7 – 9.56 Goat cheese 30 3 27 11.23 9.07 – 15.09 Sheep cheese 21 1 20 23 17 – 23.08 Total 169 18 151 - - *Mean values for the positive samples

The highest incidence for aflatoxin M1 was found in the fresh cow cheese (Table 2). We have noticed that this toxin has lower concentrations in products than in the raw milk. We didn‘t analyze the concentrations of aflatoxin M1 in the positive samples of raw milk and after in the end products processed from the same milk like other studies have. For example, in a study made by Oruc et al. (2007) they found that concentration of the toxin is higher in cheese than in rnilk from which the cheese is manufactured. When comparing our findings with previous studies (Fallah et al., 2009; Fallah et al. 2010) we found that our concentrations were much lower. No statistical significant difference (P>0.05) was found when comparing the analyzed samples. The highest concentration was found in sheep cheese (23 ng/l) which might be concerning giving the fact that it is a highly consumed product. 247

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

In Turkey, Atasever et al. (1) have found a high frequency of positive samples. From the total amount analyzed (304 samples), 216 (71.1%) were positive. Other studies have discussed the stability of AFM1 in cheese during processing steps such as ripening and storage. Fremy et al. (7) and Dragacci et al. (6) reported that the concentrations of AFM1 in Camembert cheese were higher at the beginning time of ripening. In Parmesan cheese, the AFM1 concentrations showed a different curve, increasing at the beginning, lowering during the fifth month and then increasing again in the tenth month of storage (2). Other studies made in various countries have shown that the contamination with AFM1 of milk and milk products is influenced by geographic position and season (3, 15). It is obvious that season can influence the amount of aflatoxin M1 in milk due to the feeding regime. In warm seasons the feeding is based on fresh feed such as pasture, grass, weeds. In the cold season most of the animal diet is formed by concentrates, dry hay which if it is kept in inadequate conditions may influence the development of moulds and eventually aflatoxins. That is way the most effective way to control AFM1 within the processing of dairy products is to prevent the contamination of feed with AFB1 by surveilling and applying the good manufacturing practices and good storage practices (10).

Conclusions

The incidence of AFM1 in raw milk is high but the samples that exceed the limit imposed by the European regulations are low. Dairy products sold on the traditional market pose a risk for the consumer given the number of samples tested positive at AFM1 presence. None of the samples has exceeded the limits stated by the European legislation. Although the prevalence of AFM1 in raw milk and dairy products is not high compared to other studies we recommend the strict surveillance of feed given to dairy cattle.

Acknowledgment

This paper was published under the frame of the Applicative partnership projects, PCCA no.153/2014.

References

1. Atasever, M., Adiguzel, G., Atasever, M., Özlü, H., Özturan, K., Occurrence of Aflatoxin M1 in UHT Milk in Erzurum-Turkey., Kafkas. Univ. Vet. Fak. Derg., 2010, 16 (Suppl A), S119-S122. 2. Brackett, R. E., Marth, E.H., Fate of aflatoxin M1 in cheddar cheese and in process cheese spread. Journal of Food Protection, 1982, 45, 549–552. 3. Çelik, T.H., Sarımehmetoğlu, B. and Küplülü, Ö., Aflatoxin M1 contaminations in pasteurized milk. Veterinarski Arhiv, 2005, 75(1), 57-65.

248

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

4. Creepy, E.E., Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicology Letters, 2002, 127, 19–28. 5. Dashti, B., Al-Hamli, S., Alomirah, H., Al-Zenki, S., Abbas, A.B., Sawaya, W., Levels of aflatoxin M1 in milk, cheese consumed in Kuwait and occurrence of total aflatoxin in local and imported animal feed. Food Control, 2009, 20, 686–690. 6. Dragacci, S., Gleizes, E., Fremy, J.M., Candlish, A.A.G., Use of immunoaffinity chromatography as a purification step for the determination of aflatoxin M1 in cheeses. Food Additives and Contaminants,London, 1995,12(1), 59-65. 7. Fremy, J.M., Roiland, J.C., Gaymard A., Behavior of 14C aflatoxin M1 during Camembert cheese making, Journal of Environmental Pathology, Toxicology and Oncology, 1990, 10, pp. 95 –98. 8. Gunsen, U., Buyukyoruk, I., Aflatoxins in retail food products in Bursa, Turkey. Veterinary and Human Toxicology, 2002, 44, 289-290. 9. Hussain, I., Anwar, J., A study on contamination aflatoxin M1 in raw milk in the Punjab Province of Pakistan. Fd. Contr., 2008, 19, 393-395. 10. Kamkar, A. A study on the occurrence of aflatoxin M1 in raw milk produced in Sarab city of Iran. Food Control., 2005, 6(7), 593-599. 11. Mahdiyeh L. R, Reza, K. D, Mahya, M, Masoud, H. K, Khosro, I. & Mortiza, A.A. Determination of Aflatoxin M1 Level in Raw Milk Samples Gilan, Iran Advanced Studies in Biology, 2013, 5 (4), 151- 156. 12. Panahi, P.K., Mokhtari, S., Sharifi, A., Jangjou, A., Assessment of Aflatoxin M1 Contamination in Raw Milk by ELISA in Urmia, Iran. American Eurasian Journal of Toxicological Sciences, 2011, 3(4), 231- 233. 13. Sarimehmetoglu, B., Kuplulu, O., Celik, T.H., Detection of aflatoxin M1 in cheese samples by ELISA. Food Contr. 2004, 15, 45-49. 14. Sibanda, S., Animal Production and Management. Module 1CASD 301. Zimbabwe Open University, 1999, Harare. p. 213. 15. Tajkarimi, M., Shojaee Aliabadi, F., Salah Nejad, M., Pursoltani, H., Motallebi, A.A., Mahdavi, H., Seasonal study of aflatoxin M1 contamination in milk in five regions in Iran, International Journal of Food and Microbiology, 2007, 116(3), 346-349.

249

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

STUDY OF TOTAL AEROBIC MESOPHILIC BACTERIA DYNAMICS IN A LAYING HENS HOUSE, REARED ON DEEP LITTER

R.V. GROS, ILEANA NICHITA, MONICA ȘEREȘ, M.S. ILIE, ADELA MARCU, ALEXANDRA CUCERZAN, E. TÎRZIU

Banat‘s University of Agricultural Sciences and Veterinary Medicine „King Michael I of Romania‖ from Timisoara, 119, Calea Aradului, 300645, Timisoara, Romania Phone: 0256277192 E-mail: [email protected]

Summary

This paper presents the results obtained by studying the air's load of aerobic mesophilic bacteria from a hall with laying hens reared on permanent litter over the whole breeding cycle and exploitation period. The air\s bacterial load from the cargo hall exceeded the recommended value for our country, as well as those recommended by researchers from abroad, 2.5 x 105 CFU / m3. The mean total aerobic mesophilic bacteria number or the total plate count (TPC) value increased from 9.07 x 104 CFU / m3 in the first month of exploitation, to 1.05 x 106 CFU / m3 in the last month, noting that this growth was achieved slowly since the second month until the ninth month of growth and exploitation. Key words: total aerobic mesophilic bacteria, dynamics, hens house, deep litter

It is known that the microbial load of the air is directly proportional to the dust concentration. The total number of germs increases with the duration maintaining the birds in the shelter, counted from the last disinfection or when stocking. Microorganisms in outdoor air are not as isolated microbial bodies, but are adhering to a particular substrate (2). The nature germs found in a bird breeding house is very different, depending on numerous factors, represented by many saprophytic species and epiphytes,as well as by pathogenic microorganisms (viruses, rickettsiae, various bacteria and fungi). The highest concentrations of bacteria were found in poultry houses with deep litter, where the number of bacteria increases from about 100000 / m3 air at over 300000 colony forming units (CFU) / m3 air, according to the litter's aging. In caged poultry houses the total number of germs rarely exceeds 200000 CFU / m3 air. According to data from the literature, in bird shelters can be admitted values between 500000 and 700000 CFU / m3 air, although some researchers believe that more than 250000 CFU / m3 air installs microbial stress (2). It is important to understand the microbial load of the air from bird, because birds can affect both the birds' health and that of the employees, due to inhalation or exposure to antigens or microbial toxins (7). 250

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

According to the presented aspects and the fact that the existing data in the literature are highly variable, was considered necessary to conduct comprehensive studies on the evaluation and dynamics of air's microflora in a shelter of laying hens on deep litter.

Materials and methods

The research was conducted in a laying hens house on deep litter the course during a whole year, from December 2010 to November 2011. The determination and quantification of microclimate biological factors were made at each visit, from five points as follows: from the four corners of the hall and its center, a total of 240 samples. TPC determination was done by suction method using a PBI Air Sampler SAS Super 100 device (International PBI SpA Milano, Italy) and nutrient agar plates. The device was set to aspirate a volume of one liter of air. Samples were collected from a height of 25 - 30 cm from the litter. After aspiration, each Petri plate was identified by marking the date and place of sampling and was repackaged with the same paper used for sterilization of the plates. In maximum three hours after the sampling, the Petri plates were brought to the microbiology laboratory, where they were incubated in the thermostat at 37°C for 24 hours. After incubation, the Petri plates were examined and the colonies developed on the surface of the culture medium were counted. The number of colonies identified from each plate was equalized to the actual values, using table data, standardized by the manufacturer of the PBI Air Sampler SAS Super 100 device. TPC values, expressed in CFU / m3 air, were statistically analyzed by calculating the arithmetic average, standard deviation and the range of registred values by showing the minimum and maximum determined concentrations. The arithmetic averages were calculated for each of five sampling points at each visit. Also arithmetic averages were calculated for the values obtained in the course of a month, for each point of sampling. Raw data obtained from the investigations were processied through biostatistical methods, by using the Microsoft Excel spreadsheet. For testing the statistical significance of differences between the averages of the studied indicators, we used analysis of variance ANOVA Single Factor test, included with Microsoft Excel software. Along with the ANOVA test we also used the MANN WHITNEY (Wilcoxon) test from the MINITAB 14 program.

Results and discussions

The results of determinations carried out by the suction method for TPC (CFU / m3) from a laying hens house on deep litter, during one year of exploitation, are shown in Table 1.

251

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

In the first month of exploitation (December 2010), the TPC of the shelter's air had an average value of 9.07 x 104 ± 1.09 x 104 CFU / m3, the following two months it registered a growth of 85-117% in breathable mesophilic bacteria, reaching averages of 1.68 x 105 ± 0.5 x 105 CFU / m3 in January and 1.97 x 105 ± 0 32 x 105 CFU / m3 in February. In the second month of stocking there has been a sharp increase of the TPC in the shelter's air, twice the average value of TPC obtained this month, being significantly higher than in the previous month (p ≤ 0.01). In the third month, in the shelter, the average TPC was slightly higher than last month, but significantly higher than in the first month (p ≤ 0.05). Table 1 TPC count (CFU/m3), from a laying hens house on deep litter, during one year of exploitation.

No. MONTH ± Sx / month ± Sx / trimester

1 DECEMBER 9.07 x 104 ± 1.09 x 104 2 JANUARY 1.68 x 105 ± 0.50 x 105 1.52 x 105 ± 0.55 x 105 3 FEBRUARY 1.97 x 105 ± 0.32 x 105 4 MARCH 2.55 x 105 ± 0.96 x 105 5 APRIL 2.53 x 105 ± 0.42 x 105 2.9 x 105 ± 0.61 x 105 6 MAY 3.65 x 105 ± 0.63 x 105 7 JUNE 4.89 x 105 ± 0.71 x 105 8 JULY 5.72 x 105 ± 0.13 x 105 5.78 x 105 ± 0.91 x 105 9 AUGUST 6.72 x 105 ± 0.12 x 105 10 SEPTEMBER 8.09 x 105 ± 1.97 x 105 11 OCTOBER 8.37 x 105 ± 1.27 x 105 8.98 x 105± 1.31 x 105 12 NOVEMBER 1.05 x 106 ± 1.55 x 105 Legend: - arithmetic average, Sx – standard deviation

The average bacterial load, on the first trimester of breeding and exploitation of laying hens on deep litter, in this shelter, was 1.52 x 105 ± 0.55 x 105 CFU / m3. The airborne bacterial load rose sharply in the second half of the first month of the second trimester, and then, in the second month, it fell slightly and remained relatively constant. In the last month there have been much higher values compared to previous months. In the second trimester of exploitation, the average TPC of the shelter's air, ranged from 2.55 x 105 ± 0.96 x 105 CFU / m3 in the first month (March) to 2.53 x 105 ± 0, 42 x 105 CFU / m3 in April and 3.65 x 105 ± 0.63 x 105 CFU / m3 in May, 252

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA with differences significantly higher, about 2.4 times, compared to the last month of the previous trimester. The average bacterial load in the second trimester, in this shelter, was 2.9 x 105 ± 0.61 x 105 CFU / m3, exceeding by 16% the recommended amount for our country (2). In the first month of the third trimester of maintenance and exploitation of laying hens on deep litter was found an average TPC value of 4.89 x 105 ± 0.71 x 105 CFU / m3, more increased compared to the last month of the previous trimester. In the second month of the third trimester (July), there was an increase of this indicator, to 5.72 x 105 ± 0.13 x 105 CFU / m3, but not significantly different compared with the previous month (p˃0,05). In two of the tests carried out by the chosen working method (suction method), the bacterial load has exceeded the maximum value, which can be obtained using this device (SAS 100), of 1307000 germs / m3 (over 1,31x106) and as a result, the samples could not be interpreted. This was also found in the third month of the trimester (August), in which the average number of breathable bacteria had increasing values. The average bacterial load in the last month of the trimester was 6.72 x 105 ± 0.12 x 105 CFU/m3, with a distinctly significant difference between this month and June (p˂0,01), and significant compared to July (p˂0,05). It can be observed that, during this trimester, there was an average TPC of 5.78 x 105 ± 0 91 x 105 CFU / m3, which exceedes 2.3 times the recommended value for our country (2). In the fourth trimester, the microbial load of the first month (September) had average value of 8.09 x 105 ± 1.97 x 105 CFU / m3, and in the second month (October) of 8.37 x 105 ± 1.27 x 105 CFU / m3, with significant differences between them (p˂0,01). In the last month (November) TPC had an average value of 1.05 x 106 ± 1.55 x 105 CFU / m3, significantly higher than the previous month (p˂0,01). During the whole trimester, the average microbial load was 8.98 x 105 ± 1.31 x 105 CFU/m3, which exceeds about 3.6 times the recommended amount for our country, to which most of the research relates (2). Figure 1 shows the dynamics of TPC/m3 air, on trimesters, highlighting the averages. Studying the dynamics of bacterial load in the air of the laying hens house on deep litter, where this study was conducted, it was found that in this period of maintenance and exploitation, TPC had a fluctuating dynamic, but ascending. At the end of the second trimester the bacterial load of the shelter almost doubled, but growth being relatively slow. In the second trimester of exploitation we had a fluctuating evolution of TPC, completed with signifficant increase in the last month. In the third trimester of the growth cycle and exploitation in the shelter TPC reached values of approximately four times higher than in the first trimester, and in the last part (the fourth trimester) TPC values were six times higher.

253

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Fig. 1 - Dynamics of total aerobic mesophilic bacteria in the air of breeder hens raised on permanent litter, during the whole period

According to this study it can be said that in the shelter where the study was carried out, during the breeding and exploitation cycle of laying hens on deep litter, TPC showed values that exceeded the recommended value for our country and those recommended by researchers from abroad, ie 2.5 x 105 CFU/m3 air (2, 8). Thus, except for the first trimester and the first weeks of the second trimester, average monthly values of the air's TPC exceeded by 1.2 to 3.6 times the reported values. Furthermore, during the study, it was found in some sampling points in some weeks, the existence of values that exceeded more than five times the reference value, with values of 106 CFU/m3. These values are based on the determination of TPC through the gravitational sedimentation method, which usually ensures lower values compared to the working method used in this study, because it counts only microorganisms that settle and exclude those that are small and those which remain airborne. Taking into account the opinions of the authors, it can be considered that in this period, the bacterial load in the shelter's air fall within the range considered permissible. In our country, there is no maximum limits on air microbial load in animal shelters, but recommendations for the maintenance of values, which are considered to be harmless to humans and animals. In this respect, it is recommended to maintain the concentration of mesophilic bacteria in animal shelters at 2.5 x 105 CFU / m3 of air (2). Also Szejniuk and Kluckzek, Kolacz and Dobrzanski, quoted by Woijcik (8), consider that the maximum allowable microbial contamination in poultry houses to be 2.5 x 105 CFU/m3 of air. Opinions are however different in terms of maximum microbial load, which must be upheld in the air of bird shelters. Krysztofik, quoted by the same author (8), believes that the load of bacteria and fungi, in shelters for 254

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA birds, should not to exceed 100000 CFU/m3 air, respectively 2,000 CFU/m3. Based on numerous proposals in this regard, the Interdepartmental Commission for the Maximum Allowable Concentrations of Harmful Sources on Human Health determined that, in workplaces, maximum permissible concentration of bacteria must not exceed 100000 CFU/m3, and the fungal concentration must be under 50000 CFU/m3. As stated by most authors, poultry shelters meet the highest amount of pollutants compared to other species of animal shelters. Reports in the literature regarding microorganical air loads in poultry houses, are extremely varied, depending mainly of farming systems and working methods used to determine them. The values obtained in this study are comparable to those reported by other authors. Thus, in Romania, Popescu and contributors (3) found values of TPC/m3 air of 4.17 x 106 m3 air CFU/m3 in laying hens houses on deep litter, compared with 3.88 x 106 CFU/m3, in caged houses. These increased levels of airborne bacteria indicates the presence of constant contamination sources and an increased risk of respiratory or allergic diseases, since areas with high relative humidity ensures the decomposition of organic matter in the litter and manure, which creates favorable conditions for the growth of bacteria and fungi, and therefore increase their concentration in the air. For example, Radon and contributors (4) have determined a TPC from 5,7 x 105 to 1,6 x 109 CFU/m3 air in poultry houses and a concentration of fungi from 1,4 x 104 to 1,1 x 108 CFU/m3. In another study, conducted in Sweden, Bakutis and contributors (1) reported an average TPC in shelters for birds of 4.66 x 105 CFU/m3. Also, Saleh and contributors (5, 6) examined the bacterial load of the air in different farming systems for egg consumption and found average values of 2.2 x 106 CFU/m3 in shelters with free rearing and 0.1 x 106 CFU/m3 in caged systems. Extremely varied values reported by different researchers, concerning microbial air load from shelters for birds, can be influenced by sampling devices of the air samples. The microbial air load, expressed by TPC, is influenced primarily by stocking density and age of the birds, plus the quality of feed, manure lasting stagnation, growth and exploitation system, the presence of deep litter, environmental conditions, etc. Also, it has to be noted that an increased TPC value in the air of bird shelters is caused largely by poor ventilation.

Conclusions

In the studied shelter, the TPC determined during the cycle of breeding and exploitation of laying hens on deep litter recorded values that exceeded the recommended value for our country, and those recommended by researchers from abroad, respectively 2.5 x 105 CFU/m3. The average TPC value increased from 9.07 x 104 CFU/m3 in the first month of exploitation, to 1.05 x 106 CFU/m3 in the last month, noting that this

255

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA growth was achieved slowly starting with the second month until the ninth month of growth and exploitation. The number of airborne bacteria increased sharply in the second half of the first month of the second trimester, and then, in the second month, to fall slightly and remain relatively constant. In the last month there have been much higher values compared to those of the previous months. The microbial air load, expressed by TPC, is influenced primarily by the age of the birds, also by the quality of feed, manure lasting stagnation, growth and exploitation system, the presence of deep litter, environmental conditions.

References

1. Bakutis, B., Monstviliene, E., Januskeviciene, G., Analyses of airborne contamination with bacteria, endotoxins and dust in livestock barns and poultry houses, Acta Vet. Brno, 2004, 73, 283–289. 2. Decun, M., – Igiena veterinară şi protecţia mediului, Editura Helicon, Timişoara, pp. 74–85, 237–260, 1997. 3. Popescu, Silvana, Borda, C., Diugan, Eva, Microbiological Air Contamination In Different Types Of Housing Systems For Laying Hens, ProEnvironment, 2013, 6, 549-555. 4. Radon, K., Danuser, B., Iversen, M., Monso, E., Weber, C., Hartung, J., Donham, K.J., Palmgren, U., Nowak, D., Air contaminants in different European farming environments, Ann. Agric. Environ. Med., 2002, 9, 41– 48. 5. Saleh, M., Untersuchungen zur Luftqualität in verschiedenen Systemen der Geflügelhaltung mit besonder Berücksichtigung von Staub und Luftkeimen, Hannover, 2006. 6. Saleh, M., Seedorf, J., Hartung, J., Total count of bacteria in the air of three different laying hen housing systems, Dtsch. Tierärztl. Wochenschr., 2003, 110, 394–397. 7. Small, B. M., Indoor air pollutants in residential settings: Respiratory Health Effects and Remedial Measures to Minimize Exposure – A Review for The Ontario Lung Association, 2002, 13–28. 8. Woijcik, Anna, Chorazy, L., Mituniewicz, T., Witkowska, D., Iwanczuk- Czernik, K., Sowinska, J., Microbial Air Contamination in Poultry Houses in the Summer and Winter, Polish J. of Environ. Stud., 2010, 19, 5, 1045- 1050.

256

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

STUDY OF THE FUNGI DYNAMICS IN A POULTRY HOUSE WITH PERMANENT LITTER

R.V. GROS, ILEANA NICHITA, MONICA ȘEREȘ, M.S. ILIE, ADELA MARCU, ALEXANDRA CUCERZAN, E. TÎRZIU

Banat‘s University of Agricultural Sciences and Veterinary Medicine „King Michael I of Romania‖ from Timisoara, 119, Calea Aradului, 300645, Timisoara, Romania, Phone: 0256277192 E-mail: [email protected]

Summary

The paper presents the results of a study done on the fungi load dynamics in the air from a hall for hens reared on permanent litter, over the cycle and exploitation. Fungal load in the air has reached high level values. Mean of TNF increased from 1.43 x 104 CFU / m3 in the first month of operation to 9.99 x 104 CFU / m3 in the last month. This growth was achieved slowly since the second month until the last month of hens growing period. Key words: fungi, dynamics, hens‘ house, deep litter

Fungi are organisms like plants that extract energy from the environment, but they are lack of chlorophyll. In the air of poultry houses were identified nine types of fungi, and from these more than half were represented by species from Aspergillus and Penicillium genera (14). The most common types of fungi inside the poultry houses are molds from genera: Aspergillus, Scopulariopsis, Penicillium, Geotrichum, Mucor and Fusarium, and some yeasts from genera Candida, Cryptococcus, Toruopsis, Trichosporon, Rhodotorula and Hansenula (12). In numerous studies regarding bioaerosols of poultry houses have been identified fungal species from Absidia, Alternaria, Aspergillus, Botrytis, Cladosporium, Eurotium, Candida, Mucor, Penicillium, Trichoderma, Ulocladium, and some thermophilic fungi (12). Fungi species discovered in animals houses are characterizing the climatic conditions of these. Aspergillus spp. and Eurotium spp. (part of the group Aspergillus glaucus) have the highest frequency in pigs houses because these species find best conditions of temperature and humidity, typical in these type of closed buidings (2, 11, 15). Aspergillus fumigatus airborne levels increase 11 times if the building is closed (10). Many diseases are caused by inhaling fungal spores during agricultural activities: aspergillosis, histoplasmosis, blastomycosis, and coccidioidomycosis adiaspiromicosis (1). Fungal spores may cause allergic syndromes. Spores large of Puccinia spp., Alternaria spp., are retained in nasal passages and those of Cladosporium spp., are retained in large bronchi and could produce immediate type sensitivity. 257

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Spores of less than 5 micrometers, from Actinomyces spp. (1 micrometer diameter), Aspergillus spp., and Penicillium spp. (3-5 micrometers in diameter), induce delayed type hypersensitivity (3, 8, 15). Exposure to high levels of organic dusts contaminated with various kinds of fungi can cause hypersensitivity pneumonitis, but it is not known with certainty that the condition is due to toxic or allergic effects of these agents (3).

Materials and methods

The research was conducted in a house for hens, reared for breeding, on ground system, with permanent litter, over a year, from December 2013 to November 2014. At each visit, determination and quantification of total number of fungi were performed. Air samples were collected from five points as follows: from the four corners of the hall and in its center, a total of 240 samples. Determining the total number of fungi was achieved by aspiration method using the device PBI Air Sampler SAS Super 100 (International PBI SpA Milano, Italy) and Petri dishes with Sabouraud medium. The device was set to aspirate a volume of five air liter for each sample. Samples were collected from a height of 25- 30 cm above the ground. After aspiration, each Petri plate was identified by marking the date and place of which sample was taken. Petri plates were brought to the microbiology laboratory where they were incubated in the thermostat at 37 °C for 24 hours. After incubation, the Petri dishes were examined and developed colonies were counted. The number of colonies obtained on each plate was fitted to the real values, using the tabular data, standardized by the manufacturer of PBI Air Sampler SAS Super 100. Raw data obtained from the conducted researches were processed through biostatistical methods, using Microsoft Excel application. The values of Total Number of Fungi (THF), expressed in CFU / m3 air, were statistically analyzed by calculating the arithmetic mean and standard deviation. The arithmetic means were calculated for each of five sampling points at each visit. Also arithmetic averages were calculated for the values obtained in the course of a month and for the semester. To test the statistical significance of differences between the averages of studied indicators was used analysis of variance test with ANOVA Single Factor, included with Microsoft Excel. Along with ANOVA test also Whitney Mann test was used (Wilcoxon) from Minitab 14 program.

258

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Results and disscusions

The results regarding the total number of fungi (CFU / m3) obtained by aspiration method in the air of a poultry house, raised for breeding, on permanent litter, during the first year of operation are presented in table 1.

Table 1 Total number of fungi (CFU / m3) obtained by aspiration method in the air of a poultry house, raised for breeding, on permanent litter, during the first year of operation Current Month ± Sx / month ± Sx / semester no. 1 DECEMBER 1.43 x 104 ± 0.17 x 104 2 JANUARY 2.62 x 104 ± 0.36 x 104 2.23 x 104 ± 0.68 x 104 3 FEBRUARY 2.63 x 104 ± 0.29 x 104 4 MARCH 3.42 x 104 ± 0.31 x 104 5 APRIL 3.87 x 104 ± 0.23 x 104 3.91 x 104 ± 0.49x 104 6 MAY 4.41 x 104 ± 0.26 x 104 7 JUN 4.65 x 104 ± 0.22 x 104 8 JULIE 5.28 x 104 ± 0.40 x 104 5.29 x 104 ± 0.65 x 104 9 AUGUST 5.95 x 104 ± 0.38 x 104 10 SEPTEMBER 7.12 x 104 ± 0.55 x 104 11 OCTOBRE 7.94 x 104 ± 0.44 x 104 8.35 x 104 ± 1.48 x 104 12 NOVEMBER 9.99 x 104 ± 0.63 x 104 Legend: x - the arithmetic mean, Sx - standard deviation

In the first month of study, the mean value of total number of fungi found in the air of hall was 0.17 x 104 ± 1.43 x 104 CFU / m3 air, value that is considered to be within the limits recommended by most authors (5, 13). In the second month (January), the number of fungi had a highly significant increase compared to the previous month (p <0.001), the average being 1.43 x 104 ± 0.17 x 104 CFU / m3. Mean value of TNF found in the air of the hall, in the third month of the first trimester of laying hens breeding on permanent litter was 2.62 x 104 ± 0.36 x 104 CFU / m3, which is two times higher than that determined in the first month, with highly significant differences (p <0.001) between these two months (p <0.001). For the whole trimester the fungi concentration in the hall air had a mean value of 2.23 x 104 ± 0.68 x 104 CFU / m3. In the first month of the second trimester of the period of breeding of laying hens on permanent litter, the concentration of fungi in the air of house had a mean value of 3.42 x 104 ± 0.31 x 104 CFU / m3, and in the second month of this trimester the fungi concentration gradually increased, achieving, overall, an average of 3.87 x 104 ± 0.23 x 104 CFU / m3. This value was moderate significantly higher (p <0.05) 259

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA compared with the previous month. For the whole trimester, the average of airborne fungi had a value of 0.49 x 104 ± 3.91 x 104 CFU / m3, significantly higher (p <0.05) compared with the previous trimester. In the third quarter, in the air of the hall of hens reared on permanent litter, the load fungi had values of 104, and continued to increase slightly, compared with the previous semester. Thus, after the first month of the third trimester (June) total fungi found in a cubic meter of air, had a value of 4.65 x 104± 0.22 x 104. At the end of the second month of the third trimester, average value of this indicator was 0.40 x 104± 5.28 x 104 CFU / m3, significantly higher than the previous month (p < 0,01) and in August ,the concentration of fungi in the house had an average value of 5.95 x 104 ± 0.38 x 104 CFU / m3, significantly higher than in the first month of this trimester (p < 0,001). In the third trimester, the concentration of fungi in hall of hens reared on permanent litter was 0.65 x 104 ± 5.29 x 104 CFU / m3. In the last trimester, the total number of fungi had an average value of 7.12 x 104 ± 0.55 x 104 CFU / m3 in the first month and 0.44 x 104 ± 7.94 x 104 CFU / m3 in the second month, with significant differences from the statistically point (p˂0,05). In the last month of the trimester of the hens operating cycle, there was an important increase in the total number of fungi, when at some determinations were recorded values of the order of 105, the average value of it being 9.99 x 104 ± 0.63 x 104 UFC / m3, significantly higher than in the first month of this trimester. The average value of this indicator throughout the trimester was 1.48 x 104 ± 8.35 x 104 CFU / m3. The evolution of fungal load in air from the hen house grown on permanent litter is shown in figure 1. Note that the hens hall air the total number of fungi had a relatively constant growth in the first months, a high increasing in the middle of the period, and at the end of it to be almost 10 times higher. For airborne fungi concentrations of poultry farms were not established recommended levels or limits (5). In this respect, the values reported by other researchers are extremely diverse, depending on the type of shelter, the maintenance system, species or breed increased (4, 6, 8, 10, 12, 14). But there are reports of the risks of exposure to increased levels of fungi that are recognize to have to certain potentially allergenic. Hight levels of fungi inside living spaces and also in animal shelters. has been reported by other researchers. GOMEZ et al., 2006 (17) noted the presence of high concentrations in homes of four genera of fungi with increased allergic potential, in autumn (73%) and summer (64.3%). Of the four genera Cladosporium was present in the highest proportion, followed by Penicillium (78%), Aspergillus (71%) and Alternaria (46%). There are no data showing that Aspergillus fumigatus hight concentrations are capable of generating occurrence of allergic symptoms. However, other airborne concentration limits for fungi are estimated at 100 spores / m3 of air for Alternaria, and 3000 spores / m3 of air for Cladosporum (9).

260

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

Total airborne fungi (CFU/m3) 100000

80000

60000

40000

20000

April May June July March January August February October December September November

Fig. 1. The evolution of total number of fungi in the air of a poultry house, raised for breeding, on permanent litter, during the first year of operation

Conclusions

Under this study, the total number of fungi in the air, recorded increase levels during the growth and exploitation cycle of hens on permanent litter. The mean value of TNF in the air of hens house exceeded about 10 default the first value recorded, from 1.43 x 104 CFU / m3 in the first month of operation to 9.99 x 104 CFU / m3 in the last month. This growth was achieved slowly in the first months, but towards the end there was a marked increase Fungal load in the air is influenced primarily by the type system used in hens breeding, in this case the permanent litter, birds age, the quality of feed, manure lasting stagnation and environmental conditions.

References

1. Ainsworth, G. C., Austwick, P. K., Fungal diseases of animals, Commonwealth Agricultural Bureaux, Farnham Royal, Bucks, England, Second Edition, 1973. 2. Attwood, P. R., Brouwer, P., Ruigewaard, P., Versloot, R., De Wit, D., Heederik, J.S., Boleij, M., A study of the relationship between airborne contaminants and environmental factors in Dutch swine confinement buildings, Amer Ind Hyg Assn J, 1987, 48, 745-751.

261

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

3. Bush, R. K., Portony, J., The role and abatement of fungal allergens in allergic didease, 2001, 107 (3), 430–440. 4. Clark, S., Rylander, R., Larsson, L. Airborne bacteria, endotoxin and fungi in dust in poultry and swine confinement buildings, Am. Ind. Hyg. Assoc. J., 1983, 44 (7), p. 537 – 541 5. Decun, M., Igiena veterinară şi protecţia mediului, Editura Helicon, Timişoara, 1997, 74–85, 237–260. 6. Godish, D., Godish, T., Total airborne mold particle sampling: evaluation of sample collection, preparation and counting procedures, and collection devices, J. Occup environ Hyg., 2008, 5(2), 100-6, 7. Gómez de Ana, S., Rodríguez-Torres, J. M., Alvarado, R.,. Mojal, E., García, S., Belmonte-Soler, J., Seasonal distribution of alternaria, Aspergillius, Cladosporium and Penicillium species isolated in patients, J . Investing Allergol Clin Immunol., 2006, 16(6), 357-363. 8. Horner, W. E., Helbing, A., Salvaggio, J. E., Lehrer, S. B., Fungal Allergens, Clinical Microbiology Reviews. 1995, 8, 161-179. 9. Homer, W. E., Worthan, A. G., Morey, P. R., Air and dust borne mycoflora in houses free of water damage and fungal growth, Air Quality Sciences, Inc., Marietta, Georgia 30067, U.S.A. App.l Environ. Microbiol., 2004, 70(11): 6394-6400. 10. Nielsen, B. H., Breum, N. O., Exposure to air contaminants in chicken catching, Am. Ind. Hyg. Assoc. J., 1995, 56 (8), 804 – 808. 11. Radon, K., Danuser, B., Iversen, M., Monso, E., Weber, C., Hartung, J., Donham, K. J., Palmgren, U., Nowak, D., Air contaminants in different European farming environments, Ann. Agric. Environ. Med., 2002, 9, 41- 48. 12. Radon, K., Weber, C., Iversen, M., Danuser, B., Pedersen, S., Nowak, D., Exposure assessment and lung function in pig and poultry farmers, Occup. Environ, Med., 2001, 58, 405 – 410. 13. Saleh, M., Seedorf, J., Hartung, J., Total count of bacteria in the air of three different laying hen housing systems, Dtsch. Tierärztl. Wochenschr., 2003, 110, 394–397. 14. Sauter, E. A., Petersen, C. F., Steele, E. E., Parkinson, J. F., Dixon, J. E., Stroh, R. C., The airborne microflora of poultry houses, Poultry Science, 1981, 60 (3), 569 – 574. 15. Vijay, H. M., Hughes, D. W., Young, N. M., The allergens of Alternaria species, J. Palynol. 1990, 91, 387-397.

262

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

AUTHORS INDEX

A G Ahmadi Mirela – 5, 14 Ghimpețeanu Oana-Mărgărita – 98, 102 B Ghișe Alina – 190 Baltă C. – 5 Giupană R.M. – 49, 57, 108, 114, 172, Barabási Ildikó – 190 178 Boldura Oana-Maria – 5, 14 Gros R.V. – 81, 168, 205, 213, 223, Botuş Daniela – 23 231, 250, 257 Brudașcă Gh. F. – 49, 57, 149, 160 Guguianu Eleonora – 74 Bucur Iulia – 36, 44 Guranda S. – 49, 108, 121 Bucur Jenica – 23 H C Herman V. – 40, 108, 114 Caplan E. – 23 Hotea Ionela – 205 Carp-Cărare C. – 74 Huțu I. – 5, 14 Carp-Cărare M. – 74 I Cătana N. – 36, 40, 44 Cerbu C. GH. – 49, 57, 108, 114, 172, Ilie M.S. – 133, 250, 257 178 Imre K. – 133, 142, 183

Ciocan Oana-Alexandra – 74 K Clep Ramona – 40 Kaba J. – 160 Cocora Zoriţa Maria – 63, 68 Kobolkuti L. – 178 Colibar Olimpia – 142 Colibar Olimpia – 81, 223 L Cotter J. – 23 Liker Monica – 81, 223 Cozma Andreea-Paula – 74 Cucerzan Alexandra – 250, 257 M Culcesscu M. – 23 Măgdaş Alina Dana – 88 Cumpănășoiu C. – 81, 205, 213, 223, Marcu Adela – 250, 257 231 Mares M. – 74 Marian Elena – 121 D Mateș C.I. – 172, 178 Dan S. D. – 88, 239 Mihaiu M. – 88, 239 Dégi J. – 133 Militaru Manuela – 239 Mircu C. – 5, 14 F Mirel Simona – 88 Fărtan S.S. – 57 Mitrănescu Elena – 239 Fiţ N. – 190 Morar Adriana – 133, 142, 168, 183 Fluerașu L. – 40 Morvay A. A. – 142, 183 Fodor Ionica – 40 Mot Daniela – 168, 205, 223 263

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

N Ș Nagy D. A. – 149, 160 Șandru Carmen Dana – 49, 57, 108, Nichita Ileana – 81, 142, 168, 183, 205, 114, 172, 178 213, 223, 231, 250, 257 Șereș Monica – 81, 168, 205, 213, 223, Niculae Mihaela – 49, 57, 108, 114, 231, 250, 257 172, 178 Ștefănuţ Cristina – 190 Nogy Leigh – 23 T O Tăbăran Alexandra – 239 Ognean L. – 190, 197 Tăbăran Alexandra – 88 Ognean S. – 197 Tîrziu E. – 81, 168, 205, 213, 223, 231, 250, 257 P Tudor Aneta – Laura – 239 Pall Emoke – 108, 114, 172, 178 Tudor L. – 239 Paștiu Anamaria-Ioana – 49, 57, 108, Tulcan Camelia – 5, 14 114, 160, 172, 178 Popa Adriana – 168 Ț Popa Diana – 197 Ţibru I. – 63, 68 Popa Gabriela – 14 Popa Virgilia – 23, 36, 44 V Popescu Sorina – 5, 14 Valasutean G. – 239 Vasiu A. – 114 R Reget Oana – 88, 239 W Rîmbu Cristina – 74 Witkowsky L. – 160

S Z Sala Claudia – 133, 142, 168, 183, 223, Zambori Csilla – 205, 223 231 Săplăcan G. – 88 Savu C. – 102 Someșan Rodica – 190, 197 Spînu Marina – 49, 57, 108, 114, 121, 149, 160, 172, 178 Stratulat G. – 23

264

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CONTENT

BOLDURA OANA-MARIA, Traceability of transgenic soybean from 5 C. BALTĂ, MIRELA AHMADI, forage trough animal tissue till the food CAMELIA TULCAN, I. HUȚU, product C. MIRCU, SORINA POPESCU

BOLDURA OANA-MARIA, Molecular fingerprinting based on DNA 14 GABRIELA POPA, C. MIRCU, markers as a method of brown bear MIRELA AHMADI, (Ursus arctos) exemplars identification - CAMELIATULCAN, I. HUȚU, A case study SORINA POPESCU

BOTUŞ DANIELA, Aspects regarding to respiratory 23 VIRGILIA POPA, LEIGH diseases in poultry farms from Romania NOGY, J. COTTER, during 2013 - 2014 determined by ELISA M. CULCESSCU, and PCR assays E. CAPLAN, JENICA BUCUR, G. STRATULAT

BUCUR IULIA, Research regarding the resistance 36 VIRGILIA POPA, phenotypes in Staphylococci isolated N. CĂTANA from bovine mastitis

CĂTANA N., RAMONA Research on mobile serovars frequency 40 CLEP, L. FLUERAȘU, of Salmonella spp. at Gallus gallus IONICA FODOR, V. HERMAN species in Romania

CĂTANA N., Research on the frequency of 44 IULIA BUCUR, staphylococcal species isolated from VIRGILIA POPA subclinical mastitis primiparous bovines

CERBU C. GH., A theoretical approach of the immune 49 GH. F. BRUDAȘCĂ, R. M. system of Danube huchen (Hucho GIUPANĂ, S. GURANDA, hucho) MIHAELA NICULAE, ANAMARIA-IOANA PAȘTIU, CARMEN DANA ȘANDRU, MARINA SPÎNU

265

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

CERBU C. GH., Vaccination failure in chickens: poor 57 GH. F. BRUDAȘCĂ, R. M. vaccine quality, human error, or variable GIUPANĂ, S.S FĂRTAN, individual immune response? MIHAELA NICULAE, ANAMARIA-IOANA PAȘTIU, CARMEN DANA ȘANDRU, MARINA SPÎNU

COCORA ZORIŢA MARIA, Impact of sows in the carrier state of 63 I. ŢIBRU Salmonella spp. in piglets

COCORA ZORIŢA MARIA, Role of sows (pregnant and lactating) in 68 I. ŢIBRU the transmission of Salmonella spp.

COZMA ANDREEA-PAULA, The prevalence of positive ESBL E. coli 74 M. CARP-CĂRARE, OANA- and Klebsiella pneumoniae strains in the ALEXANDRA CIOCAN, dogs in the Iași paddock C. CARP-CĂRARE, ELEONORA GUGUIANU, CRISTINA RÎMBU, M. MARES

CUMPĂNĂȘOIU C., Research regarding immunosuppression 81 MONICA LIKER, ILEANA induced by ochratoxin NICHITA, OLIMPIA COLIBAR, R.V. GROS, MONICA ȘEREȘ, E. TÎRZIU

DAN S. D., M. MIHAIU, Physico-chemical and microbiological 88 ALINA DANA MĂGDAŞ, changes during ripening of telemea G. SĂPLĂCAN, SIMONA cheese MIREL, OANA REGET, ALEXANDRA TĂBĂRAN

GHIMPEȚEANU OANA- General principles regarding risk 98 MĂRGĂRITA analysis of the low acidity canned food manufacturing

GHIMPEȚEANU OANA- Official controls on traditional products 102 MĂRGĂRITA, C. SAVU of animal origin subjected to intracomunitary exchange

266

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

GIUPANĂ R.M., ANAMARIA Identification of plant extracts as 108 IOANA PAŞTIU, MIHAELA potential alternative therapeutic means NICULAE, EMOKE PALL, for dairy cows diagnosed with CARMEN DANA ŞANDRU, subclinical mastitis C.GH. CERBU, S. GURANDA, V. HERMAN, MARINA SPÎNU

GIUPANĂ R.M., ANAMARIA Quantification of nonspecific immune 114 IOANA PAŞTIU, MIHAELA system mediators in a population of NICULAE, EMOKE PALL, dairy cows previously diagnosed with CARMEN DANA ŞANDRU, A. subclinical mastitis VASIU, C.GH. CERBU, V. HERMAN, MARINA SPÎNU

GURANDA S., ELENA Antibiotic resistance - an overview of 121 MARIAN, MARINA SPÎNU horizontal gene transfer mechanisms

IMRE K., An overview of the molecular 133 ADRIANA MORAR, epidemiology of the meat – borne J. DÉGI, M.S. ILIE, pathogen Toxoplasma gondii in pork and CLAUDIA SALA wild boar– A mini review

MORAR ADRIANA, K. IMRE, Biocide effect on biofilm-integrated 142 A. A. MORVAY, ILEANA bacteria isolated from meat carcasses NICHITA, OLIMPIA COLIBAR, CLAUDIA SALA

NAGY D. A., Identification of antibodies against 149 MARINA SPINU, Rhodococcus equi in horses by use of GH. F. BRUDASCA the enzyme-linked immunosorbent assay (ELISA) - A review

NAGY D. A., Identification of antibodies against 160 L. WITKOWSKY, Rhodococcus equi in horses from ANAMARIA IOANA PAŞTIU, different regions of Romania using an in MARINA SPÎNU, J. KABA, house ELISA. First report GH. F. BRUDAŞCĂ

NICHITA ILEANA, E. TÎRZIU, Research regarding the antibacterial 168 R. V. GROS, MONICA activity of acid-soluble chitosan ȘEREŞ, ADRIANA MORAR, DANIELA MOT, ADRIANA POPA, CLADIA SALA

267

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

NICULAE MIHAELA, EMOKE Classical characterization of E. coli 172 PALL, CARMEN DANA isolated from laying hens ȘANDRU, ANAMARIA IOANA PAȘTIU, C.I. MATEȘ, C. CERBU, R. GIUPANĂ, MARINA SPÎNU

NICULAE MIHAELA, E. coli serotypes and their in vitro 178 EMOKE PALL, CARMEN sensitivity to complement in farmed DANA ȘANDRU, ANAMARIA animals IOANA PAȘTIU, C.I. MATEȘ, C. CERBU, R. GIUPANĂ, L. KOBOLKUTI, MARINA SPÎNU

SALA CLAUDIA, K. IMRE, The study of the microbial biofilm 183 A.A. MORVAY, ILEANA structure in various bacterial species NICHITA, ADRIANA MORAR

SOMEȘAN RODICA, Influence of climatic factors on the 190 CRISTINA ȘTEFĂNUŢ, hygenic qualities of milk obtained in the ILDIKÓ BARABÁSI, N. FIŢ, Subcarpathian Mountain region ALINA GHIȘE, L. OGNEAN

SOMEȘAN RODICA, The effects of climatic factors on fat and 197 DIANA POPA, S. OGNEAN, non-fat dry matter content of raw milk L. OGNEAN obtained from cattle raised in conditions of a Subcarpathian Mountain range

ȘEREȘ MONICA, ILEANA Attempt to induce immunological 205 NICHITA, C. CUMPĂNĂȘOIU, tolerance in chicken embryos using DANIELA MOȚ, R.V. GROS, inoculation of allogeneic cells into IONELA HOTEA, CSILLA chorioallantoic vessels ZAMBORI, E. TÎRZIU

ȘEREȘ MONICA, ILEANA Cells involved in allograft rejection 213 NICHITA, C. CUMPĂNĂȘOIU, R.V. GROS, E. TÎRZIU

268

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(2), 2015, TIMIŞOARA

TÎRZIU E., MONICA LIKER, Research regarding immunosuppression 223 ILEANA NICHITA, CLAUDIA induced by T-2 toxin SALA, OLIMPIA COLIBAR, C. CUMPĂNĂȘOIU, DANIELA MOȚ, R.V. GROS, CSILLA ZAMBORI, MONICA ȘEREȘ

TÎRZIU E., ILEANA NICHITA, Changes in cellular compartment of the 231 CLAUDIA SALA, immune system associated with enzootic C. CUMPĂNĂȘOIU, bovine leukosis R.V. GROS, MONICA ȘEREȘ

TUDOR L., The prevalence of Yersinia species in 239 ELENA MITRĂNESCU, slaughtered pigs MANUELA MILITARU, ANETA - LAURA TUDOR

VALASUTEAN G., Evaluation of aflatoxin M1 incidence in 245 ALEXANDRA TĂBĂRAN, raw milk and ripened cheese retailed in a OANA REGET, S.D. DAN, traditional market M. MIHAIU

GROS R.V., ILEANA Study of total aerobic mesophilic 250 NICHITA, MONICA ȘEREȘ, bacteria dynamics in a laying hens M.S. ILIE, ADELA MARCU, house, reared on deep litter ALEXANDRA CUCERZAN, E. TÎRZIU

GROS R.V., ILEANA Study of the fungi dynamics in a poultry 257 NICHITA, MONICA ȘEREȘ, house with permanent litter M.S. ILIE, ADELA MARCU, ALEXANDRA CUCERZAN, E. TÎRZIU

AUTHORS INDEX 263

269