Classification and Genetic Features of Neonatal Haemochromatosis: a Study of 27 Avected Pedigrees and Molecular Analysis of Gene

J Med Genet 2001;38:599–610 599

Classiﬁcation and genetic features of neonatal J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from haemochromatosis: a study of 27 aVected pedigrees and molecular analysis of genes implicated in iron metabolism

Alison L Kelly, Peter W Lunt, Fernanda Rodrigues, P J Berry, Diana M Flynn, Patrick J McKiernan, Deirdre A Kelly, Giorgina Mieli-Vergani, Timothy M Cox

Abstract Neonatal haemochromatosis (NH, Online Neonatal haemochromatosis (NH) is a Mendelian Inheritance in Man, OMIM severe and newly recognised syndrome of 231100) is a newly recognised and rare uncertain aetiology, characterised by con- syndrome in which congenital cirrhosis or ful- genital cirrhosis or fulminant hepatitis minant hepatitis in early infancy is associated and widespread tissue iron deposition. NH with marked iron deposition in the liver and occurs in the context of maternal disease extrahepatic tissues.1–3 Although the presenta- including viral infection, as a complica- tion of neonatal haemochromatosis with he- tion of metabolic disease in the fetus, and patic failure usually preceded by oligohydram- sporadically or recurrently, without overt nios, placental oedema, and intrauterine Department of cause, in sibs. Although an underlying growth retardation or stillbirth is stereotypical, Medicine, University genetic basis for NH has been suspected, the cause of the condition is ill understood.4–8 of Cambridge, Level 5, no test is available for predictive analysis The liver is generally shrunken and bile stained Box 157, Addenbrooke’s in at risk pregnancies. with extensive fibrosis and nodular regenera- Hospital, Cambridge As a first step towards an understanding tion; there is massive loss of hepatocytes but CB2 2QQ, UK of the putative genetic basis for neonatal surviving cells show giant cell or pseudoglan- A L Kelly haemochromatosis, we have conducted a dular transformation with focal nodular regen- TMCox systematic study of the mode of transmis- eration and varying degrees of cholestasis. Lit- sion of this disorder in a total of 40 infants Clinical Genetics tle inflammation is usually present and most of Service, Institute of born to 27 families. We have moreover the iron deposition is found in the hepatocytes. Child Health, Bristol carried out a molecular analysis of candi- Extrahepatic iron is seen in the acinar cells of Royal Hospital for Sick date genes (â2-microglobulin, HFE, and the pancreas and minor salivary glands as well Children, St Michael’s haem oxygenases 1 and 2) implicated in as the proximal renal tubule, adrenal cortex, Hill, Bristol BS2 8BJ, iron metabolism. No pathogenic muta- 9–11 http://jmg.bmj.com/ UK thyroid, and myocardium. P W Lunt tions in these genes were identified that Although the concentration of iron in the segregate consistently with the disease liver is greatly increased in neonatal haemo- University of Bristol, phenotype in multiplex pedigrees. How- chromatosis, in rare patients who spontane- Department of ever, excluding four pedigrees with clear ously recover and in those patients treated by Paediatric Pathology, evidence of maternal infection associated orthotopic liver transplantation, the excess iron St Michael’s Hospital, with NH, a pedigree showing transmission 12–15 Southwell Street, is apparently redistributed. Since increased Bristol BS2 8EG, UK of maternal antinuclear factor and ribo- liver iron and extrahepatic haemosiderosis may on September 30, 2021 by guest. Protected copyright. P J Berry nucleoprotein antibodies to the aVected rarely result from other causes of liver disease infants, and two families with possible during fetal life,13468 it has been suggested Paediatric Liver matrilineal inheritance of disease in ma- that the iron deposited in neonatal haemochro- Service, King’s College ternal half sibs, a large subgroup of the Hospital, Denmark matosis may not be directly responsible for the aVected pedigrees point to the inheritance 9 Hill, London SE5 9RS, tissue injury. However, in one noteworthy UK of an autosomal recessive trait. This case, severe systemic iron overload with fatal F Rodrigues included 14 pedigrees with aVected and cardiomyopathy and recurrent iron deposition G Mieli-Vergani unaVected infants and a single pedigree in the implanted liver occurred rapidly after where all four aVected infants were the hepatic transplantation.16 It has been further The Liver Unit, The sole oVspring of consanguineous but oth- Birmingham suggested that the extrahepatic parenchymal Children’s Hospital erwise healthy parents. siderosis resembles shunt siderosis in adults NHS Trust, Steelhouse We thus report three distinct patterns of where reduced transferrin concentrations with Lane, Birmingham disease transmission in neonatal haemo- increased iron transferrin saturation leads to B4 6NH, UK chromatosis. In the diVerentiation of a D M Flynn systemic redistribution of iron; in the infant large subgroup showing transmission of with cirrhosis a natural portocaval shunt may P J McKiernan disease in a manner suggesting autosomal D A Kelly develop as a result of the patent ductus recessive inheritance, we also provide the venosus.317 Correspondence to: basis for further genome wide studies to At present the diagnosis of neonatal haemo- Professor T M Cox, define chromosomal determinants of iron chromatosis is dependent on the identification [email protected] storage disease in the newborn. of severe liver disease of intrauterine onset (J Med Genet 2001;38:599–610) Revised version received associated with both hepatic and extrahepatic 15 June 2001 Accepted for publication Keywords: iron storage; haemochromatosis; neonatal; iron deposition that spares cells of the mono- 18 June 2001 liver nuclear phagocyte system.818 The diagnosis

www.jmedgenet.com 600 Kelly, Lunt, Rodrigues, et al J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from should also exclude primary structural abnor- A (Family 1) malities of the liver, internal exposure to toxins, blood group antigen incompatibility, other I 1 2 metabolic disorders including bile acid synthe- 128 132 126 130 sis defects and tyrosinaemia, infection associ- 128 128 128 130 ated liver disease including cytomegalovirus – – – – (CMV), echovirus, and other agents, as well as – + – – Down’s syndrome.19–23 Neonatal haemochromatosis has also been associated with birth II defects24 and with distinct syndromes involving the renal tubule, hair growth, and intestinal 34 56 function as well as an acidotic syndrome 126 132 126 128 ND ND recently reported from Finland.25–27 Neonatal 128 128 128 128 ND ND haemochromatosis has been noted in two – – – – – – – + – – – – families where it aVected maternal half sibs, thus raising the possibility of causation by a 28 maternal factor. Evidence for one such factor B (Family 2) has been the description in one family of neonatal haemochromatosis as part of the neonatal I 12 lupus erythematosus syndrome associated with ND ND ND ND maternal anti-Ro/SS-A and anti-La/SS-B au- 120 126 122 116 29 toantibodies. – – – – About 100 cases of neonatal haemochroma- – + – – tosis have been reported and these show a panethnic distribution with an equal sex II incidence.38 Although the syndrome may on occasion represent the common outcome of 34 several diseases that aVect the fetal liver in ND ND ND ND utero, the disorder also occurs both sporadi- 122 126 ND ND – – – – cally and recurrently in sibs in a manner that is – + – + consistent with transmission as an autosomal recessive trait.2512 However, at present no Figure 1 (A) Pedigree of index family aVected by neonatal haemochromatosis. Haplotypes are displayed in genetic test is available to identify at risk preg- the boxes, representing from top to bottom, alleles of nancies or provide appropriate counselling for chromosome 6p loci in strong linkage with the HFE gene aZicted families. An understanding of the (HLA-F and D6S105) and HFE genotypes (C282Y and H63D) that are associated with adult haemochromatosis. putative genetic basis for neonatal haemochro- ND indicates not done. (B) Pedigree of family with matosis in some families would not only neonatal haemochromatosis showing segregation of improve the outlook for predictive diagnosis chromosome 6p marker alleles as shown in (A).

but would provide key information as to its http://jmg.bmj.com/ cause, especially in relation to the molecular oedema and anuria developed. There was little physiology of iron in the fetus. respiratory eVort or spontaneous movement, We have analysed a total of 40 infants hypotension occurred, and death followed at 3 diagnosed with neonatal haemochromatosis days. At necropsy there was moderate jaundice and who were members of 27 families. We have and oedema with an otherwise normal external accordingly conducted a systematic analysis of appearance. The liver had a wrinkled surface the mode of transmission of this condition and with multiple brown-purple nodules up to 1

have categorised possible patterns of inherit- cm in diameter and the spleen was enlarged. on September 30, 2021 by guest. Protected copyright. ance; we have moreover conducted a molecular There was mesenteric haemorrhage but nor- analysis of candidate genes implicated in disor- mal bone marrow appearances. In the lungs ders of iron metabolism. there was focal intra-alveolar haemorrhage and the placenta showed villus oedema. A provi- Patients sional diagnosis of neonatal hepatitis with con- Two index pedigrees form the nucleus of this genital cirrhosis was made. Examination of the study (fig 1). hepatic histology showed fibrosis with cirrhosis, giant cell transformation, and hepatocellu- FAMILY 1 lar necrosis with cholestasis and marked iron The proband was the first child of a healthy 29 deposition in hepatocytes. year old woman who developed hypochromic The second case in this family was the result anaemia because of iron deficiency in preg- of the third pregnancy of the mother, at that nancy and received oral iron therapy. An emer- time 34 years of age. During this pregnancy gency caesarian section was carried out at the and unlike those in which she gave birth to onset of spontaneous labour at 36 weeks’ asso- healthy infants, she again required oral iron ciated with oligohydramnios. The infant had an supplements throughout pregnancy for iron Apgar score of 1 at one minute and 2 at 10 deficiency anaemia (haemoglobin <10.5 g/dl). minutes. The infant weighed 1450 g (3rd cen- The female infant was delivered by emergency tile indicating intrauterine growth retardation) caesarian section for fetal distress at 32 weeks’ and scalp bleeding and bruising was noted, as gestation. The Apgar score was one at 1 well as marked hepatomegaly. Haemoglobin minute, 7 at five minutes, and 8 at 10 minutes, was 7.5 g/dl, platelet count 79 × 109/l, and she but the infant required ventilatory support. had abnormal blood coagulation. Peripheral There was facial bruising and a widespread

www.jmedgenet.com Classiﬁcation and genetic features of neonatal haemochromatosis 601 J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from

Figure 2 Pathological features in recurrent fatal neonatal haemochromatosis. (A) Macroscopic appearances of abdominal contents at necropsy showing enlarged liver with multiple dark surface nodules; generalised oedema and ascites were also present. This infant died on the sixth day of life. (B, C) Microscopic features of disrupted liver architecture showing nodule formation and pigmented and hypertrophic hepatocytes with cirrhosis (B, silver reticulin stain, × 100; C, haematoxylin and eosin stain, × 400). (D) Liver section stained to show massive deposition of iron in hepatocytes (Perls’s stain, × 400). (E) Deposition of iron in pancreatic tissue; note heavy staining of glandular acini of exocrine pancreas and also isolated punctate staining with islet cells (lower left of section) (Perls’s stain, × 100). petechial eruption. Serological tests for hepati- parents and surviving family members showed tis A and B, acute Epstein-Barr virus infection, normal transferrin iron saturation and serum cytomegalovirus, and herpes simplex virus ferritin determinations. infection were negative. The infant had a prolonged bleeding time, thrombocytopenia, a prolonged prothrombin FAMILY 2 time, and anaemia. Hypoglycaemia was also The proband was the first born male infant of noted and she was treated with intravenous a 17 year old woman of Italian origin and a glucose and received transfusions of platelets, Turkish father (fig 1B). Intrauterine growth blood, and fresh frozen plasma. Renal failure retardation was noted and oligohydramnios with progressive hepatic failure occurred. was detected by ultrasound at 36 weeks of ges- Serum iron was 11.8 µmol/l, TIBC 12.3, and tation. No atypical antibodies or rubella http://jmg.bmj.com/ saturation 96%. A normal karyotype was immunity was detected. The membranes obtained. ruptured four hours before delivery with In the light of the findings in the previous meconium stained liquor. The infant weighed child, a gingival biopsy was conducted. This 2260 g (3rd centile), the crown-rump length showed extensive iron deposition in the epithe- was 49 cm (15th centile), and head circumfer- lium of minor salivary glands and a diagnosis of ence 34 cm (50th centile). Cord blood pH was 7.25 at birth and oedema was noted.

neonatal haemochromatosis was made. Active on September 30, 2021 by guest. Protected copyright. support was subsequently withdrawn after dis- Shortly after delivery, hypoglycaemia was cussion with the parents. The infant died at 6 recorded and the infant was treated with intra- days of age. At necropsy the infant weighed venous glucose and four hourly enteral feeding 1944 g (50th centile), there was jaundice, as well as parenteral antimicrobials. By the sec- petechial eruption, generalised oedema, and ond day of life, tachypnoea and jaundice were skin bruising, but otherwise normal external evident as was a metabolic acidosis. Serum appearances. bilirubin was 140 µmol/l and plasma sodium The liver was shrunken and, as in the previ- was 122 mmol/l. The acidosis was treated with ous infant, there were multiple nodules up to intravenous bicarbonate but oliguria associated 0.8 cm in diameter evident on the surface (fig with worsening jaundice and a rising serum 2A). The cut surface was reddish brown. The creatinine occurred by day 3 and there was a appearance of the bone marrow was normal. prolonged prothrombin time. Total bilirubin Microscopy showed oedematous placental villi rose to 168 µmol/l (20 µmol/l conjugated) and and hepatic cirrhosis with marked iron excess the serum albumin decreased to 20 g/l. A pre- in hepatocytes (fig 2B-D). Iron was also abun- sumptive diagnosis of herpes simplex encepha- dant in the exocrine pancreas (fig 2E), thyroid, litis was made and acyclovir was administered. the zona glomerulosa of the adrenal cortex, A diagnosis of hepatorenal failure in relation to bronchial mucous glands, renal tubules, and a possible metabolic disorder was also consid- pulmonary macrophages. ered. As depicted in fig 1A, the parents have had The patient was noted to have an enlarged four children. Their second daughter and the liver and spleen but on the fourth day of life fourth child (a son) were healthy at birth; developed a massive haematemesis and serum tests subsequently carried out in the melaena requiring exchange blood transfusions

www.jmedgenet.com 602

Table 1 Clinical details of patients with neonatal haemochromatosis

Patients AV Family (sex) sibs UnaV sibs (sex) Misc Presentation Diagnosis Infection Maternal Ab Treatment (age) Outcome (age) 1 3 (F) 1 2 (F/M) 0 Hepatomegaly PM: hepatic and extrahepatic siderosis None ND NR Died (3.5 d) Abnormal coagulation 5 (F) 1 2 (F/M) 0 Hypoglycaemia Ferritin 500 µg/µl None ND Glucose and Died (6 d) Transferrin satn 96% antimicrobials Gingival biopsy +ve Transfused blood, PM: hepatic and extrahepatic siderosis plasma, platelets 2 3 (NR) 1 0 0 NR NR NR ND NR Died 4 (M) 1 0 0 Jaundice Transferrin satn 85% None ND Liver transplant (16 d) Died (19 d) Hypoglycaemia PM: hepatic and extrahepatic siderosis 3 4 (F) 1 1 (F) 0 Acute liver failure at birth NR None Anti-Ro Liver transplant (13 d) Survived (6.5 y) Anti-La +ve 5 (M) 1 1 (F) 0 Day 1 NR None Anti-Ro Antioxidants straight Survived (4.5 y) Anti-La after birth +ve 4 5 (F) 0 1 half sib (F) 0 Abnormal thyroid hormone Ferritin 2000 µg/l None ND Chelation (day 18) Died (42 d) Neurology (day 16) Gingival biopsy +ve Liver transplant (day PM: liver—necrosis, no normal parenchyma, 37) iron deposits 5 4 (M) 0 1 (F) 0 Day 3 Liver biopsy: iron excess Coxsackie ANA1:40 Antioxidants (day 5) Survived (2.5 y) MRI: diagnostic B virus www.jmedgenet.com 6 6 (M) 1 1 (NR) 1 Oedematous, hepatosplenomegaly Iron 31.5, ferritin 36 000 None ND NR Died (3 d) and hypoglycaemia at birth Liver biopsy: necrosis Increased iron, few viable hepatocytes 4 (F) 1 1 (NR) 1 NR NR NR NR NR Died (16 d) 7 4 (M) 0 1 half sib (NR) 0 Day 4 PM: liver increased iron E coli sepsis and −ve Antioxidants (day 23) Died candidiasis 8 3 (M) NR NR NR NR MRI: oedema None ND Liver transplant (day NR 45) 9 7 (M) 0 4 half sibs 0 Jaundice (day 10) Liver biopsy: hepatic necrosis, hepatic failure Staph aureus sepsis ND NR Died (2M/2F twins) PM: myocoarditis, liver abscesses 10 6 (F) 0 3 (NR) 0 NR NR NR NR NR Died 11 6 (F) 0 2 half sibs (F) 0 NR Gingival biopsy −ve HSV and candidiasis ND Antioxidants Survived (2 y) Liver biopsy: siderosis Transplant 12 4 (F) 0 2 (M/F) 0 Hypoglycaemia (day 1) High ferritin NR ND Liver transplant (day Died (56 d) Liver biopsy 35) 13 4 (F) 0 2 (M/F) 0 Jaundice (day 2) High ferritin None ND Support therapy only Died (28 d) PM: hepatic and extrahepatic siderosis 14 5 (M) 0 2 (M/F) and 2 0 Lethargy (day 5) High ferritin None ND Antioxidants and liver Died (56 d) twins (M/F)* PM: hepatic and extrahepatic siderosis transplant (day 39) 15 5 (F) 1 1 (M) 0 Jaundice (day 3) High serum ferritin None ND Spontaneous recovery Survived Liver biopsy MRI: iron in pancreas 4 (M) 1 1 (M) 0 NR NR NR NR NR Died 16 5 (M) 1 1 (F) 1 Hypoglycaemia High serum ferritin None ND Antioxidants Died (35 d)

PM: hepatic and extrahepatic siderosis al et Rodrigues, Lunt, Kelly, 6 (F) 1 1 (F) 1 Hypoglycaemia High serum ferritin None ND Antioxidants Survived Liver biopsy Transplant (day 19) 17 4 (F) 0 1 (F) 0 Hypoglycaemia Liver biopsy None ND Liver transplant (day Survived 16) 18 4 (F) 0 1 (F) 0 Jaundice (day 2) High serum ferritin None ND Liver transplant (day Survived Liver biopsy 42) 19 4 (F) 1 0 0 Hypoglycaemia High serum ferritin None Anti-Ro, La, Sm, Jo, Supportive therapy only Died (42 d) PM: hepatic and extrahepatic siderosis RNP −ve 5 (F) 1 0 0 Hypoglycaemia High serum ferritin None Anti-Ro, La, Sm, Jo, Antioxidants Died (92 d)

PM: hepatic and extrahepatic siderosis RNP −ve

J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from from Downloaded 2001. September 1 on 10.1136/jmg.38.9.599 as published first Genet: Med J http://jmg.bmj.com/ on September 30, 2021 by guest. Protected by copyright. by Protected guest. by 2021 30, September on Classiﬁcation and genetic features of neonatal haemochromatosis 603

and albumin infusions together with intra- J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from venous glucose. Ultrasound examination showed a shrunken liver with normal bile ducts and extensive ascites, with a patent portal vein. Serological investigation showed negative HIV Died (28 d) 1 and hepatitis serology, a negative direct Coomb’s test, normal G6PD activity, and a normal bone marrow (showing reactive changes only). Urine succinyl acetone was not detected, thus excluding hereditary tyrosinaemia. The activity of enzymes for galactosaemia

was normal and á1-antitrypsin phenotyping was normal. Serological tests for toxoplasma, 18) Transplant (day 5) herpes simplex, and CMV titres were negative. Hyperammonaemia was shown together with progressive renal failure and prolonged blood coagulation parameters. The infant was trans- ferred to Addenbrooke’s Hospital for hepatic transplantation. Further tests showed no re- ducing substances in the urine but generalised raised plasma amino acids compatible with hepatic failure. Orthotopic transplantation of theliverwascarriedoutfroma3yearold donor but the patient suVered the conse- quences of hepatic arterial thrombosis in relation to diYcult anastomotic procedures and died on the 19th day of life. ND NDAt necropsy, the NR child was oedematous Died (90 d) with extensive bruising; the explanted liver weighed 43 g and showed widespread nodules and bile staining with evidence of regeneration. Micros- copy showed vacuolated hepatocytes, giant cell transformation, metaplastic bile ductules with bile plugs, and widespread haemosiderin in hepatocytes and ductular cells with a small amount of ﬁbrosis. Extensive iron deposits were also identiﬁed in the myocardium, acinar cells of the pancreas,

gastric crypts, tracheal and bronchial glands, http://jmg.bmj.com/ proximal renal tubules, adrenal cortex, thymus, PM: hepatic and extrahepatic siderosis PM: hepatic and extrahepatic siderosis MRI: iron in pancreas Liver biopsy PM: hepatic and extrahepatic siderosisPM: hepatic and extrahepatic siderosis abundant stainable iron MRI: iron in pancreas thyroid, and salivary Transplant (day 18) glands, as well as pulmonary alveolar macrophages. No excess iron was identiﬁed in the spleen, testes, or bone marrow. On the basis of these ﬁndings, a diagnosis of neonatal haemochromatosis was made. Subse- quently the mother had another pregnancy

which terminated in a spontaneous abortion at on September 30, 2021 by guest. Protected copyright. 30 weeks of gestation with an infant with growth retardation, jaundice, and other signs of neonatal hepatitis. A further 20 families (3-22) were recruited from paediatric liver units in the United King- dom in a nationwide collaborative study (table 1). Also included in this study were established ﬁbroblast cell lines representing ﬁve families (23-27) from Corriell Cell Repositories, Cam- den, New Jersey. Twenty-two families are from referral centres within the United Kingdom. sibs (sex) Misc Presentation Diagnosis Infection Maternal Ab Treatment (age) Outcome (age) ected sibs. Misc, miscarriage. PM, postmortem examination. NR, not recorded. ND, not done. F, female. M, male. V Examining information supplied about all 27 V aVected pedigrees with a total of 68 children, 40 have been diagnosed as having neonatal

sibs, una haemochromatosis. The male to female ratio of V A V sibs Una these neonatal haemochromatosis patients (16:24) does not strictly follow the 1:1 ratio previously reported but is not signiﬁcantly dif- ferent from that expected to arise by chance Patients (sex) ()0NN NRNRNRDied 5(F)101NRNR 7 (M)8 2 (F) 1 (F) 2 1 (F) 2 Hypoglycaemia 2 Hypoglycaemia High serum ferritin High serum ferritin None None ND ND Antioxidants Antioxidants Died (28 d) Survived 4 (M)3 (M) 1 1 0 1 (M)(÷ 0 12=2.67, Hepatic failure NR 1 df, p>0.05). NR In the 28 NR unaVected ND NR ND NR NR NR Died (42 d) Died (6 d) V ected sibs. Una children, there is a slight but statistically insig-

sibs, a nificant bias towards females rather than males 21 6 (M) 2 1 (F) 2 Hypoglycaemia High serum ferritin None ND Supportive Died (21 d) 2223 4 (M) 3 (F) 126 1 027 3 (F) 0 3 (F) 0 0 0 0 0 Jaundice (day 1) 0 NR 1 0 Liver failure High serum ferritin NR NR Liver biopsy: post-necrotic cirrhosis, None Liver biopsy: fibrosis and increased iron ND ND ND Antioxidants ND ND Died (31 d) NR NR Died (49 d) Died (75 d) 2425 4 (F) 4 (M) 1 0 1 (M) 1 (M) 1 0 Hepatic failure Hepatic fibrosis/liver failure 10x raised serum ferritin PM: hepatic and extrahepatic siderosis ND ND ND ND NR NR Died (2 d) NR Family 20 4 (M) 1 0 1 Hypoglycaemia High serum ferritin None ND Liver transplant (day Table 1 continued A V (8:14), but at the time of writing the gender of

www.jmedgenet.com 604 Kelly, Lunt, Rodrigues, et al J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from A (3) Neonatal haemochromatosis transmitted in a manner compatible with or indicating an Family 5 Family 7 Family 11 autosomal recessive trait (fig 3C). I 12123123Methods gDNA STUDIES Genomic DNA was isolated from 3-5 ml of II peripheral blood from families 1-22, two 34 45 465 healthy controls, and from established fibroblasts cell lines of families 23-27.30 Family 9 cDNA STUDIES I Peripheral blood mononuclear cells were iso- 12 34 lated from venous blood using Ficoll-paque (Amersham, Pharmacia Biotech) density gradient centrifugation from all members of II family 1 except subject 3 where fibroblasts 5678910 were used and one control sample. Total RNA isolation from these leucocytes was carried out using Trizol reagent (Life Technologies). First strand cDNA was then synthesised using the B Pro StarTM RT-PCR kit (Stratagene). Family 3 Family 19 Family 20 DNA SEQUENCING: HFE GENE I To analyse the complete HFE gene in families 12132 1231 and 2 and in two healthy controls, oligonucle- otide primers were designed from the human HFE genomic sequence (Gene Bank accession II no Z92910) and used to amplify genomic 34 5 45 45 DNA sequences. Purification of amplified PCR products and direct automated sequencing was Figure 3 Patterns of disease transmission in pedigrees aVected by neonatal 30 haemochromatosis. (A) Neonatal haemochromatosis associated with maternal infections. (B) carried out as described previously. Neonatal haemochromatosis acquired as a result of (non-infectious) maternal factor(s). CLASS I MHC AND RELATED GENOTYPING six children is not available. Thirty of the 40 MHC class I genotypes for the HLA-F locus neonatal haemochromatosis patients have died, and additional genotyping at the D6S105 locus four of whom had undergone hepatic trans- telomeric to the class I region on chromosome 6p but showing strong linkage association with

plantation. A further six patients survived after http://jmg.bmj.com/ orthotopic liver transplantation and are cur- adult haemochromatosis was carried out as 31 rently making good progress without evidence previously described. of continuing tissue injury or organ failure. Four neonatal haemochromatosis patients did â2-MICROGLOBULIN GENE not receive hepatic transplantation but made a The â2-microglobulin gene was fully sequenced spontaneous recovery and remain well. in families 1 and 2, as well as two healthy con- These patients were diagnosed principally on trols, using primers and PCR conditions previ-

ously described and using genomic DNA as a on September 30, 2021 by guest. Protected copyright. the basis of liver biopsy and for that reason could 32 not meet the strict criteria required for showing template. extrahepatic iron deposits; they are however included in this study for completeness. HAEM OXYGENASE GENES It was evident early in the course of this Haem oxygenase 1 (HMOX1) study that neonatal haemochromatosis indeed This gene was amplified from genomic DNA isolated from members of families 1 and 2, aVects multiple subjects within given sibships. aVected subjects only from families 23 to 25, However, further scrutiny of the aVected pedi- and two normal subjects, as two long range PCR grees showed three clear patterns of disease products using the ExpandTM Long Template transmission. These are shown in the addi- PCR system (Boehringer Mannheim). Two tional pedigrees (fig 3). pairs of primers were designed from the human (1) Neonatal haemochromatosis transmitted H01 sequence (Gene Bank accession No as a result of maternal disease (infection) XO6985) to amplify the two long range PCR acquired during pregnancy (fig 3A). In family products and are as follows: HMOX1-1, agcgtc 5, infection was Coxsackie viral infection; in ctcagcgcagccgc; HMOX1-4, ctgactcgggagt family 7 the infection was E coli bacteraemia catctcca; HMOX1-2, catggccctgggagccagcat; and candidiasis; in family 9 it was Staphylococ- and HMOX1-3, agaagagctgcaccgcaaggc. Ampli- cus aureus; and in family 11 it was Herpes sim- fication was carried out according to the manu- plex virus and candidiasis. In the aVected facturers’ instructions which included two infants of these families, excess iron was found rounds of amplification and elongation in the only in the liver. second cycle increased by 20 seconds per cycle. (2) Neonatal haemochromatosis acquired as The long range PCR products were purified a result of a maternal factor (fig 3B). using an equal volume of 6% polyethylene glycol

www.jmedgenet.com Classiﬁcation and genetic features of neonatal haemochromatosis 605 J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from C catgccccaggatttgtcag; and HMOX1-11 gtcac Family 6 Family 14 Family 10 ccaggtagcgggtgt.

I Haem oxygenase 2 (HMOX2) 1212 12A pair of primers, HMOX2-A, tgactggaggct ggcggaca and HMOX2-B, ttagtcagggctgga II gaaag, were designed from the human HO2 34 5 6 34 34 5 6 mRNA sequence (Gene Bank Accession No 567 S34389) to amplify the full length HMOX-2 cDNA. Complementary cDNA was isolated Family 13 Family 16 Family 15 from peripheral blood monocytes from mem- I bers of family 1 and a healthy control. RT-PCR 121212was carried out using 5 µl of template cDNA from all members of family 1. An annealing temperature of 58°C was used with a total of 35 II cycles. One µl of the ampliﬁed RT-PCR 34 5 34 5 6 345product was then used as a template in a nested PCR reaction using two sets of primers, Family 12 Family 17 Family 18 HMOX2-A and HMOX2-C, cacattctcaaacatg and HMOX2-B and HMOX2-D, tctacctgtttga I gaatgtg, resulting in two products encompass- 1212 12ing the full length HMOX2 cDNA sequence. The nested PCR products were puriﬁed and II sequenced directly as described for the HFE 30 34 5 3434gene.

Family 21 Family 22 Family 4 CONFIRMATION OF BASE CHANGES I The base changes from the wild type (Wt) sequence identified in the gene were con- 1212123 HFE firmed by restriction enzyme digestion for sites that either created or removed a recognition II sequence for a restriction endonuclease (table 345678 3445 2). The base diVerences identified in the HMOX1 gene were confirmed by sequencing Figure 3 (C) Neonatal haemochromatosis transmitted as a putative autosomal recessive trait. the opposite strand using the primers G425Ar (tggcatcttggcatgtcgcct), A198Gf (tacagctca-

8000 solution at room temperature for 20 min- gacctaattgc), and A226Gr (ttgccagtgagctga- http://jmg.bmj.com/ utes followed by bench centrifugation at 13 000 gatcg). × g for 30 minutes. After the supernatant had been removed, the pellet was washed twice with cold 70% ethanol and washed by centrifugation for 20 minutes. The pellet was then allowed to Results dry in air before being resuspended in sterile From the information obtained from 27 distilled water and used as a DNA template for families aZicted by neonatal haemochromato- automated sequencing. The above primers sis (table 1, figs 1A, B and 3A, B, C), 12 had on September 30, 2021 by guest. Protected copyright. (HMO1X-1 and HMOX1-4) and an additional more than one aVected infant. In five of these seven primers (HMOX1-5-11) were used to 12 families (Nos 2, 19, 20, 22, and 23) all the ensure that the sequences included all five infants born were aVected by neonatal haemo- exons, spliced sites, and lariat spliced junction chromatosis; in the remaining seven families regions of the HMOX1 gene. The sequences of (Nos 1, 3, 6, 15, 16, 21, and 24) children not HMOX1 primers 5-11 are as follows: aVected by the disease were also born. HMOX1-5 ggcagagaatgctgagttcatg; HMOX1-6 In relation to birth order, in three of these aagccgtctcgggtcacctg; HMOX1-7 ttgaggagtt seven families (Nos 1, 6, and 24), unaVected gcaggagctg; HMOX1-8 tccttggtgcatgggtcag; oVspring born to the same parents either alter- HMOX1-9 acacccgctacctgggtgac; HMOX1-10 nated with or followed infants aVected by neo- Table 2 Restriction endonuclease digestion confirming base substitutions in the HFE gene natal haemochromatosis. In the remaining four families (Nos 3, 15, 16, and 21), it was the first Restriction enzyme Restriction site Restriction site born child of the parents who was unaVected; Polymorphism Restriction enzyme site Wild type Base change in these families the healthy child was followed G→A C282Y RsaI GT▼AC Absent Present by the birth of two or more aVected sibs. CA▲TG In 15 out of the total of 27 families, only one C→G H63D BclI T▼GATCA Present Absent ACTAG▲T child was aVected by neonatal haemochroma- A→T S65C HinfI G▼ANTC Present Absent tosis; in three (Nos 8, 26, and 27) no more CTNA▲G T→C4T→C RsaI GT▼AC Absent Present children were born, leaving a residue of 12 CA▲TG families (Nos 4, 5, 7, 9-14, 17, 18, and 25) who T→C 116T→C Sau96I G▼GNCC Absent Present had also had oVspring unaVected by the CCNG▲G disease.

www.jmedgenet.com 606 Kelly, Lunt, Rodrigues, et al J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from MODE OF DISEASE TRANSMISSION association of full blown neonatal haemochro- Infection acquired in pregnancy matosis with the appearance of maternal In four families there was clear evidence of antinuclear factor and ribonuclear antibodies perinatal infection associated with haemochro- has been reported,29 but the presence of matosis (families 5, 7, 9, and 11) in which antibody in plasma from the aVected infants Coxsackie B virus, bacterial sepsis with E coli appears not to be obligatory. The occurrence of and S aureus, and Herpes simplex virus (HSV) neonatal haemochromatosis in the context of type 1 infections, respectively, were associated maternal antibodies may indicate a favourable with the disease. All had a single aVected infant outcome, since in the two infants reported here and one or more unaVected sibs or half sibs. In in family 3 both have survived 41⁄2 and 6 years family 5, a male infant (second born) presented after diagnosis and remain in good health. In with liver failure at 3 days of age. The diagno- this particular family, one infant received an sis was confirmed on liver biopsy and increased hepatic allograft but the other responded to iron deposition was identified by magnetic treatment with antioxidants.33 resonance imaging (MRI) of the abdomen. In the remaining subgroup, neonatal haemo- Acute Coxsackie B virus infection was shown chromatosis has appeared in oVspring of either serologically in the mother and the infant was sex who are maternal half sibs (that is, families treated with an antioxidant cocktail leading to a 19 and 20). The occurrence of disease in half resolution of the symptoms with survival of this sibs has been previously noted,28 although in male child for at least 21⁄2 years at the time of these instances the presence of maternal writing. It is not possible to determine whether antinuclear or ribonuclear protein antibodies in family 5 extrahepatic iron deposits were was not formally excluded. Clearly in these present; in family 7 and family 8 necropsy instances, the occurrence of disease could also showed extensive hepatic iron deposits only. In result from either maternal transmission of family 11, a gingival biopsy was conducted and mitochondria harbouring pathogenic muta- no increased iron was detected; liver biopsy tions in the organellar genome, or from gonadal showed hepatic iron deposits in this infant who mosaicism for a new dominant gene mutation recovered. AVected patients in all four pedi- in the mother. Evidence for the possibility of grees presented within the first 10 days of birth. gonadal mosaicism might be suggested in one In family 7, a female infant who subse- family (family 9) in which twin half sibs who quently had an unaVected paternal half sib died of unknown causes may have been presented with liver failure at the age of 4 days. aVected by neonatal haemochromatosis; these E coli sepsis was found together with candidia- sibs were paternal rather than maternal half sis on blood cultures. Antibody tests showed no sibs. evidence of maternal ribonuclear protein anti- Clearly, if maternal transmission of neonatal bodies or antinuclear factor and the infant was haemochromatosis either as an acquired trait treated with an antioxidant cocktail but died. or as a result of mitochondrial mutations is a Necropsy showed the typical features of possibility, this has profound implications for

neonatal haemochromatosis with greatly in- genetic counselling. In at least two instances in http://jmg.bmj.com/ creased iron deposition in the liver. Staphylo- the series reported here, mothers who had coccal sepsis occurred in the mother of family borne children aVected by the disease had had 9 and the infant died within two weeks of birth further aVected pregnancies as a result of with fulminant hepatitis and septicaemia com- insemination from sperm donors, which had plicated by myocarditis and liver abscess been arranged after genetic counselling on the formation. mistaken assumption of the operation of recessive inheritance in all cases of neonatal haemo- In family 11, where there are two unaVected older maternal half sibs, the index case chromatosis. on September 30, 2021 by guest. Protected copyright. presented with fulminant hepatic failure. There was serological evidence of an acute Herpes Transmission suggesting autosomal recessive simplex virus infection in the mother. Siderosis inheritance and neonatal hepatitis were diagnosed on liver As noted above, in 15 of the 27 families only biopsy and the patient was treated initially with one child was aVected by neonatal haemochro- an antioxidant cocktail.33 She failed to improve matosis; in three of 15 (families 8, 26, and 27) and later an orthotopic liver transplant was no further children were born. Thus in 12 carried out from which she has made a good families (Nos 4,5, 7, 9-14, 17, 18, and 25) recovery and is now alive two years later. A unaVected children were also born. Owing to diagnosis of neonatal haemochromatosis was uncertainties of ascertainment, it is of limited confirmed by examination of the explanted value to estimate recurrence figures for the sib- liver. ships as a whole or afterborn sibs alone. How- ever, based on the 13 families with full sibships of two or more, in which there was no evidence Maternal transmission of disease of infection, maternal antibody, maternal We have observed two distinct patterns of dis- transmission, or mosaicism (families 1, 2, 6, 10, ease transmission in neonatal haemochromato- 12-18, 21-25), there were 18 full sibs born after sis that suggest the influence of a maternal fac- the proband; this includes two unaVected sibs tor. In family 3, with the second and third born in the multiple births that occurred in family aVected, in a sibship of three there was clear 14. Of these, 10 of the 18 were aVected by neo- evidence of maternal antibodies to ribonuclear natal haemochromatosis, which, even allowing proteins; anti-Ro and anti-La antibodies were for exaggerated ascertainment bias, exceeds the also detected in the aVected infants. The expected (approximately four) aVected sibs

www.jmedgenet.com Classiﬁcation and genetic features of neonatal haemochromatosis 607

Table 3 HFE genotypes for families 1 and 2 and aVected patients from families 23, 24, conditions of extreme stress, for example, dur- J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from 25, and 27 ing the neonatal period when haemolysis is most active. The occurrence of disease in only Exon 4 Exon 2 Exon 2 Intron 2 Intron 4 Family Subject C282Y H63D S65C 4T→C 116T→C one of three non-identical newborn triplets provides little support for mitochondrial inher- 1 1 (father) −/− +/− −/− +/− −/− 1 2 (mother) −/− −/− +/− +/− +/− itance or for the operation of other maternal 1 4 (unaVected) −/− +/− +/− +/+ +/− factors including infection in this family, but 15(aVected) −/− −/− +/− +/− +/− clearly cannot formally exclude de novo muta- 1 6 (unaVected) −/− −/− −/− −/− −/− tion. 2 1 (father) −/− +/− −/− +/− −/− Overall it is clear that acquisition of neonatal 2 2 (mother) −/− −/− −/− −/− −/− 23(aVected) −/− +/− −/− +/− −/− haemochromatosis as a result of maternal 24(aVected) −/− +/− −/− +/− −/− transmission, mitochondrial inheritance, de novo dominant mutation but with a significant 23 3 (aVected) −/− +/+ −/− −/− −/− 23 4 (aVected) −/− +/+ −/− −/− −/− chance of gonadal mosaicism all need consid- eration in any given pedigree, especially where 24 4 (aVected) −/− +/+ −/− −/− −/− genetic counselling is being sought. However, it 25 4 (aVected) −/− +/− −/− +/− −/− can be seen that in an important subgroup of families aVected by neonatal haemochromato- 27 3 (aVected) −/− +/+ −/− −/− −/− sis, inheritance of an autosomal recessive trait cannot be excluded. predicted for the 1 in 4 recurrence risk associated with inheritance of an autosomal recessive trait. However, since it may be assumed that DIRECT SEQUENCE ANALYSIS OF CANDIDATE the likelihood of ascertainment of any given GENES sibship is proportional to the number of HFE gene The principal mutation, C282Y, in the aVected sibs,34 then by excluding the proband HFE gene responsible for adult haemochromatosis the ratio of aVected to unaVected sibs can be was not present in any of the six families exam- calculated as the segregation ratio. In this ined by direct sequencing and/or restriction instance, for pedigrees 1, 2, 6, 10, 12-18, endonuclease digestion (table 3). However, the 21-25, and excluding stillbirths, there were 11 H63D mutation segregated in families 1, 2, aVected sibs and 20 unaVected sibs observed and 25 but not in association with neonatal which is not significantly diVerent from the haemochromatosis, since only the father and expected 7.75 aVected sibs out of the total of first unaVected child in family 1 carried a sin- 31. The trend of this proportion is thus to be gle copy of H63D. The frequency of the H63D found biased in the expected direction of allele of in the European population is ascertainment with respect to the present study HFE about 0.2534 with a predicted frequency of of multiply aVected sibships, in which ascer- homozygotes of about 0.02. The 193A→T tainment would be expected to be enhanced substitution in the second exon of the HFE

over the likelihood of identifying haemochro- http://jmg.bmj.com/ gene, which leads to the S65C substitution35 matosis in sibs where this was proportional that has been shown to be associated with a simply to the number of sibs aVected. mild form of adult haemochromatosis, only Consanguinity was observed in only one segregated in family 1 and was not present in family (family 6) which was of Asian descent 108 HFE alleles from 54 control samples. but produced all four oVspring aVected (one Complete sequencing of the gene in stillbirth, three neonatal deaths). Investigations HFE families 1 and 2 identified two intronic base showed no evidence of infection and a normal changes, intron 2 4T→C and intron 4 bile acid profile. However, among 27 families, on September 30, 2021 by guest. Protected copyright. 116T→C,36 37 the allele frequencies being 48% one consanguineous family of Asian descent and 19%, respectively. Thus, no additional would not be exceptional and cannot alone be causative mutations were identified in any of regarded as decisive evidence of inheritance of the eight subjects aVected by neonatal haemo- an autosomal recessive trait. Similarly, al- chromatosis that we examined. though recessive inheritance could provide an alternative explanation for the aVected paternal

half sibs in family 9, this would require both â2-microglobulin gene

mothers to be heterozygous carriers which Complete sequencing of the â2-microglobulin would be exceptional, unless they were in fact gene in families 1 and 2 identified diVerences related by blood. from the published sequence (gene bank In another family (family 14), one male M17986) in exon 1 (absence of G837 and infant of five children born to the parents was CCT in place of GGC at nucleotides 940- aVected by neonatal haemochromatosis. This 942), exon 2 (substitution of A foraCat infant was one of non-identical triplets and nucleotides 107, gene bank M17987, and the died at 57 days after having undergone two absence of a previously reported base change at orthotopic liver transplant procedures; in this nucleotide 20031) and intron 1 (an additional c instance, transplantation surgery was under- after nucleotide 989 and an additional 21 base taken after the administration of the parenteral pairs). This latter additional base change antioxidants had proved to be unsuccessful. In 989+C in intron 1 and codon substitution family 15, one infant died and one recovered Q70P (210C→A) in exon 2 were not observed without the benefit of transplantation. We do in families 1 and 2.32 In the two families inves-

not consider that this excludes a genetic trait tigated, the remaining â2-microglobulin coding which could predispose to disease under sequence and splice sites corresponded to the

www.jmedgenet.com 608 Kelly, Lunt, Rodrigues, et al

Table 4 HMOX1 genotypes for families 1 and 2 and aVected subjects from families 23–25 with the maternal autoantibodies that were J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from identified in the patients depicted in fig 3B. Intron 3 Intron 1 Intron 4 Intron 4 frameshift, T Increased deposition of hepatic iron (hepatic Family Subject 425G→A 198A→G 226A→G base 194 “siderosis”) has also been associated with 1 1 (father) +/− −/− +/− Present genetic defects of bile acid synthesis, hereditary 1 2 (mother) −/− −/− −/− Wt tyrosinaemia, Zellweger syndrome, and lepre- 1 4 (unaVected) +/− +/− +/− Present chaunism.8 Hepatic pathology is accompanied 15(aVected) −/− −/− −/− Wt 1 6 (unaVected) +/− +/− −/− Present by a bleeding diathesis, hypoglycaemia, metabolic acidosis, and incipient renal failure and it 2 1 (father) −/− −/− −/− Wt seems likely that the giant cell hepatitis that 2 2 (mother) ND +/− −/− Present 23(aVected) ND +/− +/− Present characterises the condition in the presence or 24(aVected) −/− −/− −/− Wt absence of defined viral infection in the mother is the end result of multiple insults. 23 3 (aVected) −/− +/+ −/− Present 23 4 (aVected) −/− +/+ −/− Present We review here pedigree studies of a large series of patients and the molecular analysis of 24 4 (aVected) −/− +/+ −/− Present candidate genes implicated in iron metabolism. 25 4 (aVected) −/− +/− −/− Present This includes genes expressed in the human placenta which were studied because the wild type sequence and we believe that the dif- mother represents the only source of additional ferences in intronic and exonic sequences iron before birth. However, although MRI reported here are likely to be innocuous and imaging and chemical analysis of tissue iron thus of little relevance to the pathology of neo- concentrations indicate that neonatal haemo- natal haemochromatosis. chromatosis is indeed associated with excess iron in liver tissue438 and its redistribution to extrahepatic tissues,389it is by no means clear Haem oxygenase 1 gene (HMOX1) that all patients with neonatal haemochromato- The HMOX1 gene was sequenced in its sis harbour an increase in total body iron. In entirety for all members of families 1 and 2 and those patients who recovered from the condi- the aVected neonatal haemochromatosis pa- tion either as a result of, or despite administra- tients from families 23 to 25. No base substitution of antioxidant therapy or successful ortho- tions were identified in the five exonic se- topic hepatic transplantation, the majority quences of HMOX1; however, three nucleotide show no evidence of disordered iron metabo- changes were found in the intronic sequences: lism. Moreover, no other iron storage diseases intron 1 G→A at nucleotide 42 and A→Gat are found in the parents or surviving sibs of nucleotides 198 and 226 in intron 4. Addition- aVected subjects.13–15 39 40 ally, a frameshift was found in intron 3, an extra The degree of iron overload in patients with t at nucleotide 198 from the intron/exon haemochromatosis may be su cient to induce boundary of exon 4, followed by a repeated Y (as with the adult disease) malignant tumours sequence (ccttcctt) which ensured no altera-

and there are three published reports in which http://jmg.bmj.com/ tion in the exon 4 sequence (table 4). primary hepatocellular carcinomas have occurred in neonatal haemochromatosis.3 It is of Haem oxygenase 2 gene (HMOX2) great interest that in one of these patients, fur- Complete sequencing of the HMOX2 cDNA in ther iron accumulated in the donor liver and in family 1 showed no base substitutions in the an amount comparable to that present in the coding sequence. Complementary cDNA explanted organ: the recipient eventually died analysis provided no information on the flank- as a result of a cardiac arrythmia associated ing intron/exon sequences. However, on the with marked cardiac siderosis and cardiomyo- on September 30, 2021 by guest. Protected copyright. nature of the intron/exon boundaries no splice pathy.16 In this patient at least, an iron loading variants were identified. disorder was present in utero and after birth that presumably aVected transplacental and Discussion possibly also intestinal transport of iron. Criteria for the diagnosis of neonatal haemo- Of particular note in the present series of chromatosis have emerged only recently. The patients is the evidence for a substantial condition is defined as a rapidly progressive subgroup in which the transmission of neonatal disorder with death in utero or in the early haemochromatosis is compatible with inherit- neonatal period, with increased tissue iron ance of an autosomal recessive trait. In at least deposits seen in the liver, pancreas, heart, and one family, family 1, that an inherited factor endocrine glands, but with relative sparing of determines net transfer of iron from the mother extrahepatic mononuclear phagocytes. The to the fetus was shown by the occurrence of diagnosis can only be considered in the absence neonatal haemochromatosis in two of four sibs of haemolytic disease or other syndromes asso- with the disease alternating with healthy ciated with haemosiderosis or exogenous iron children. This was suggested also by the occur- overload from transfusions.3489 rence of maternal iron deficiency anaemia, Neonatal haemochromatosis occurs as a part requiring iron supplementation, that developed of neonatal lupus erythematosus syndrome only during the aVected pregnancies. Studies of associated with maternal anti-Ro/SS-A and the segregation haplotypes in this pedigree anti-Ro/SS-B autoantibodies.29 In this previous showed that if there were to be recessive inher- single case report, full blown neonatal haemo- itance of determinants of neonatal haemochro- chromatosis in which the criteria for extrahe- matosis on the short arm of chromosome 6, patic iron deposition were met was associated there is no common background haplotype on

www.jmedgenet.com Classiﬁcation and genetic features of neonatal haemochromatosis 609

which the mutation resides, since the aVected more common polymorphic variant, not neces- J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from haplotypes are diVerent between the two copies sarily in the same gene. An example of this of 6p within the aVected subjects and are phenomenon is given by erythropoietic pro- diVerent between family 1 and family 2. It is toporphyria which shows both recessive and however noteworthy that no mutation in the digenic inheritance patterns.57 58 In our current HFE gene was identiﬁed on direct sequencing, series, two families with neonatal haemochro- as described below. matosis recapitulate published reports of recur- To investigate the role of candidate genes rent disease in maternal half-sibs, in some cases implicated in iron metabolism in the develop- occurring after donor insemination that pro- ment of neonatal haemochromatosis, we con- ceeded after genetic counselling.28 Clearly the ducted a molecular analysis of the human HFE possibility of recurrent disease in half sibs must 41 gene and the related gene for â2- always be considered and an assumption of microglobulin,42 since their cognate proteins autosomal recessive inheritance of neonatal are expressed in the placenta and disordered haemochromatosis in any given pedigree could expression of HFE at cell surfaces mediated by well prove to be erroneous and lead to

interactions with â2-microglobulin is associated inappropriate reproductive decisions. Here we with systemic iron overload.42–45 Since neonatal provide additional evidence for a maternal haemochromatosis occurs at a time of rapid autoantibody factor in two pedigrees and a catabolism of haem derived from fetal haemo- mode of transmission suggesting matrilineal globin,46 we have also conducted a molecular inheritance compatible with mitochondrial analysis of the genes encoding the principal defects as recently reported in two pedigrees.59 haem oxygenase isozymes that are responsible We also report here one family in which for the breakdown of haem to iron, biliverdin neonatal haemochromatosis occurred in pater- and carbon monoxide.47–49 Haem oxygenase 1 nal half sibs. (HMOX1) maps to human chromosome The present study provides strong evidence 22q13.1 and is the main inducible form of the to exclude neonatal iron storage disease result- enzyme; the homologous isozyme haem oxyge- ing from mutations in genes encoding human

nase 2 (HMOX2) is located on chromosome HFE, â2-microglobulin, and haem oxygenases 16p13.3 and encodes the constitutive iso- 1 and 2. To identify further putative disease loci form.50 51 Knockout mice lacking HMOX1 responsible for the inheritance of haemochro- show growth retardation, diminished resistance matosis in those cases with transmission to oxidative injury, and develop anaemia with suggesting inheritance as an autosomal reces- tissue iron deposition.52 Mice lacking HMOX2 sive trait, a genome wide scan conducted by show pulmonary haemosiderosis and are sensi- molecular analysis of DNA samples obtained tive to hyperoxia induced tissue injury.53 The from first degree relatives and aVected subjects first case of human haem oxygenase 1 defi- described here is under way. Given the ciency has recently been described: the 26 burgeoning knowledge about genes indicated month old infant had hepatomegaly, asplenia, in mammalian iron transport and storage as

abnormal coagulation factors, and endothelial well as emerging information from the human http://jmg.bmj.com/ injury in the kidney.54 Iron deposition was genome project and comparative genomic noted in renal and liver tissue, thus further studies,45 we are conﬁdent that major loci that implicating mutations in HMOX1 and predispose to the development of neonatal HMOX2 as potential causes of neonatal haemochromatosis will ultimately be identi- haemochromatosis. ﬁed. Since completion of this study, nonsense mutations, representing null alleles of the We are indebted to The Children’s Liver Disease Foundation,

newly identiﬁed transferrin receptor 2 ( ) the Grocer’s Trust, the Peel Medical Research Trust, and the on September 30, 2021 by guest. Protected copyright. TfR 2 European Union for research support. Dr David A Rhodes gene that maps to chromosome 7q22, have kindly carried out the class I MHC and chromosome 6p geno- been discovered in adult patients with haemo- typing. Mrs Joan Grantham provided expert secretarial assistance. chromatosis otherwise clinically indistinguish- able from that resulting from mutations in 1 Online Mendelian Inheritance in Man (OMIM). National HFE.55 56 The indolent nature of the iron stor- Center for Biotechnology information. Available at: http://www3.ncbi.nim.nih.gov/Omim. age and degree of tissue injury resulting from 2 Kler W, Olesen M. Hepatitis foetalis med perinatal exitus this disorder does not resemble neonatal letalis hos 4 soskende. Ugeskr Laeger 1956;118:868-72. 3 Knisely AS. Neonatal hemochromatosis. Adv Pediatr 1992; haemochromatosis, and thus TfR 2 is an 39:383-403. unlikely candidate gene for the infantile 4 Silver MM, Beverley DW, Valberg LS, Cutz E, Phillips J, Shaheed WA. Perinatal hemochromatosis. Clinical, mor- disease. We also describe a consanguineous phologic and quantitative iron studies. Am J Pathol family with four aVected members and the 1987;128:538-54. 5 Laurendean T, Hill JE, Manning GB. Idiopathic neonatal occurrence of disease in one of three non- hemochromatosis in siblings: an inborn error of metabo- identical triplets as well as in maternal half sibs. lism. Arch Pathol 1961;72:410-23. 6 Witzleben CL, Uri A. Perinatal hemochromatosis: entity or Caution is required, however, in advising an end result? Hum Pathol 1989;20:335-40. individual family about the pattern of inherit- 7 Hardy L, Hansen JL, Kushner JP, Knisely AS. Neonatal haemochromatosis. Genetic analysis of transferrin- ance and the likelihood of disease recurrence. receptor, H-apoferritin, and L-apoferritin loci and of the Although in our series there was no report of human leucocyte antigen class I region. Am J Pathol 1990; 137:149-53. neonatal haemochromatosis in generations 8 Knisely AS, Magid MS, Dische MR, Cutz E. Neonatal previous to those of the parents, the formal haemochromatosis. Birth Defects 1987;23:75-102. 9 Silver MM, Valberg LS, Cutz E, Lines LD, Philips MJ. possibility remains that some cases of the Hepatic morphology and iron quantitation in perinatal disease could be the result of digenic inherit- hemochromatosis. Am J Pathol 1993;143:1312-25. 10 Goldﬁscher S, Grotsky HW, Chang CH, Berman EL, Rich- ance in which a rare mutant allele only causes ert RR, Karmarkar SD, Roskamp JO, Morecki R. the condition in combination with a much Idiopathic neonatal iron storage involving liver, pancreas,

www.jmedgenet.com 610 Kelly, Lunt, Rodrigues, et al

heart, and endocrine and exocrine glands. Hepatology 37 de Villiers J, Nico P, Hillermann R, Loubser L, Kotze MJ. J Med Genet: first published as 10.1136/jmg.38.9.599 on 1 September 2001. Downloaded from 1981;1:58-64. Spectrum of mutations in the HFE gene implicated in 11 Knisely AS, O’Shea PA, Stocks JF, Dimmick JE. Oropha- haemochromatosis and porphyria. Hum Mol Genet 1999;8: ryngeal and upper respiratory mucosal gland siderosis in 1517-22. neonatal hemochromatosis: an approach to biopsy diagno- 38 Hayes AM, Jaramillo D, Levy HL, Knisely AS. Neonatal sis. J Pediatr 1988;113:871-4. hemochromatosis: diagnosis with MR imaging. AJR 1992; 12 Coletti RB, Clemmons JJW. Familial neonatal hemochro- 159:623-5. matosis with survival. J Pediatr Gastroenterol Nutr 1988;7: 39 Müller-Berghaus J, Knisely AS, Zaum R, Vierzig A, Kirn E, 39-45. Michelk DV, Roth B. Neonatal haemochromatosis: report 13 Rand EB, McClenathan DT, Whitington PF. Neonatal of a patient with favourable outcome. Eur J Pediatr haemochromatosis: report of successful orthotopic liver 1997;156:296-8. transplantation. J Pediatr Gastroenterol Nutr 1992;15:325-9. 40 Dalhoj J, Kiaer H, Wiggers P, Grady RW, Jones RL, Knisely 14 Lund DP, Lillehei CW, Kevy S, Perez-Atayde A, Maller E, AS. Iron storage disease in parents and sibs of infants with Treacy S, Vacanti JP. Liver transplantation in newborn liver neonatal hemochromatosis: 30 year follow-up. Am J Med failure: treatment for neonatal haemochromatosis. Trans- Genet 1990;37:342-5. plant Proc 1993;1:1068-71. 41 Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, 15 Muisesan P, Rela M, Kane P, Dawan A, Baker A, Ball C, Basava A, Dormishian F, Domingo R, Ellis MC, Fullan A, Mowat AP, Williams R, Heaton ND. Liver transplantation Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, for neonatal haemochromatosis. Arch Dis Child 1995;73: Lee VK, Loeb AB, Mapa FA, McClelland EE, Meyer NC, F178-80. Mintier GA, Moeller NN, Moore T, Morikang E, Prass 16 Egawa H, Berquist W, Garcia-Klennedy R, Cox K, Knisely CE, Quintana L, Starnes SM, Schatzman RC, Brunke KJ, AS, Esquivel CO. Rapid development of hepatocellular Drayna BT, Risch NJ, Bacon BR, WolV RK. A novel MHC siderosis after liver transplantation for neonatal hemosi- class I-like gene is mutated in patients with hereditary derosis. 1996; :1511-13. Transplantation 62 haemochromatosis. Nat Genet 1996;13:399-408. 17 Conn HO. Portacaval anastomosis and hepatic hemosiderin 42 De Sousa M, Reimao R, Lacerda R, Hugo P, Kaufmann deposition: a prospective, controlled investigation: Gastro- Porto G. Iron overload in beta 2-microglobulin-deficient 1972;62:61-72. enterology mice. 1994;39:105-11. 18 Schneider BL. Neonatal liver failure. Curr Opin Pediatr Immunology Lett 1996;8:495-501. 43 Feder JN, Tsuchihashi Z, Irrinki A, Lee VK, Mapa FA, 19 Schneider BL, Setchell KDR, Whitington PF, Neilson KA, Morikang E, Prass CE, Starnes SM, WolV RK, Parkilla S, Suchy F. Ä4-3-oxosteroid 5â-reductase deficiency causing Sly WS, Schatzman RC. The hemochromatosis founder neonatal liver failure and hemochromatosis. J Pediatr 1994; mutation in HLA-H disrupts beta 2-microglobulin interac- 124:234-8. tion and cell surface expression. J Biol Chem 1997;272: 20 Kershisnik MM, Knisely AS, Sun CCJ, Andrews JM, 14025-8. Wittwer CT. Cytomegalovirus infection, fetal liver disease, 44 Waheed A, Parkkila S, Zhou XY, Tomatsu S, Tsuchihashi Z, and neonatal hemochromatosis. Hum Pathol 1992;23:1075- Feder JN, Schatzman RC, Britton RS, Bacon BR, Sly WS. 80. Hereditary haemochromatosis: eVects of C282Y and 21 Bove KE, Wong R, Kagen H, Balistreri W, Tabor MW. H63D mutations on association with â2-microglobulin, Exogenous iron overload in perinatal hemochromatosis: a intracellular processing and cell surface expression of the case report. Pediatr Pathol 1991;11:389-97. HFE protein in COS-7 cells. Proc Natl Acad Sci USA 1997; 22 MetMetzman R, Anand A, DeGuilio PA, Knisely AS. 94:12384-8. Hepatic insuYciency and fibrosis associated with intrauter- 45 GriYths W, Cox TM. Haemochromatosis: novel gene ine parvovirus B19 infection in a newborn premature discovery and the molecular pathophysiology of iron infant. J Pediar Gastroenterol Nutr 1989;9:112-14. metabolism. Hum Mol Genet 2000;9:2377-82. 23 Ruchelli ED, Uri A, Dimmick JE, Bove KE, HuV DS, Dun- 46 Bratteby LE. Studies on erythro-kinetics in infancy. X1. The can LM, Jennings JB, Witzelben CL. Severe perinatal liver change in circulating red cell volume during the first five disease and Down syndrome: an apparent relationship. months of life. Act Paediatr Scand 1968;57:215-26. Hum Pathol 1991;22:1274-80. 47 Tenhunen R, Marver HS, Schmid R. Microsomal heme 24 Taucher SC, Bentjerodt R, Hübner ME, Nazer J. Multiple oxygenase: characterization of the enzyme. J Biol Chem malformations in neonatal haemochromatosis. Am J Med 1969;244:6388-93. Genet 1994;50:213-14. 48 London IM, West R, Shemin D, Rittenberg D. On the origin 25 Bale PM, Kan AE, Dorney SFA. Renal proximal tubular of bile pigment in normal man. J Biol Chem 1950;184:351- dysgenesis associated with severe neonatal hemosiderotic 8. liver disease. Pediatr Pathol 1994;14:479-89. 49 London IM. The conversion of hematin to bile pigment. J 26 Verloes A, Lombet J, Lambert Y, Hubert A-F, Deprez M, Biol Chem 1950;184:373-6. Fridman V, Gosseye S, Rigo J, Sokal E. Tricho-hepato- 50 Seroussi E, Kedra D, Kost-Alimova M, Sandberg- enteric syndrome: further delineation of a distinct syn- Nordquist A-C, Fransson I, Jacobs JFM, Fu Y, Pan HQ, drome with neonatal hemochromatosis phenotype, intrac-

Roe BA, Imreh S, Dumanski JP. TOM1 genes map to http://jmg.bmj.com/ table diarrhea, and hair abnormalities. Am J Med Genet chromosome 22q 13.1 and mouse chromosome 8C1 and 1997;68:391-5. encode proteins similar to the endosomal proteins HGS 27 Fellman V, Rapola J. Pikho H, Varilo T, Raivio KO. and STAM. Genomics 1999;57:380-8. Iron-overload disease in infants involving fetal growth 51 Kutty RK, Kutty G, Rodriguez IR, Chader GJ, Wiggert B. retardation, lactic acidosis, liver haemosiderosis, and Chromosomal localization of the human oxygenase genes: aminoaciduria. Lancet 1998;351:490-3. heme oxygenase-1 (HMOX1) maps to chromosome 22q12 28 Verloes A, Temple IK, Hubert AF, Hope P, Gould S, and heme oxygenase 2 (HMOX2) maps to chromosome Debauche C, Verellen G, Deville JL, Koulischer L, Sokal 16p 13.3. Genomics 1994;20:513-16. EM. Recurrence of neonatal haemochromatosis in half-sibs 52 Poss KD, Tonegawa S. Reduced stress defence in heme oxy- born of unaVected mothers. J Med Genet 1996;33:444-9. genase 1-deficient cells. Proc Natl Acad Sci USA 1997;94: 29 Schoenlebe J, Buyon JP, Zitelli BJ, Friedman D, Greco MA, 10925-30. Knisely AS. Neonatal hemochromatosis associated with 53 Dennery PA, Spitz DR. Yang G, Tatarov A, Lee CS, Shegog on September 30, 2021 by guest. Protected copyright. maternal autoantibodies against Ro/SS-A and La/SS-B ML, Poss KD. Oxygen toxicity and iron accumulation in ribonucleoproteins. 1993;147:1072-5. Am J Dis Child the lungs of mice lacking heme oxygenase-2. J Clin Invest 30 Kelly A, Rhodes DA, Roland JM, Schofield P, Cox TM. 1998; :1001-11. Hereditary juvenile haemochromatosis: a genetically het- 101 erogeneous life-threatening iron-storage disease. 54 Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, QJMed Ohta K, Kashahara Y, Koizumi S. Oxidative stress caused 1998;91:607-18. 31 Rhodes DA, Raha-Chowdhury R, Cox TM, Trowsdale J. enhanced endothelial cell injury in human heme Homozygosity for the predominant Cys 282 Tyr mutation oxygenase-1 deficiency. J Clin Invest 1999;103:129-35. and absence of disease expression in hereditary haemo- 55 Kawabata H, Yang R, Hirama T, Vuong P T, Kawano S, chromatosis. J Med Genet 1997;34:761-4. Gombart AF, KoeZer HP. Molecular cloning of transferrin 32 Walker AP, Wallace DF, Partridge J, Bomford AB, Dooley receptor 2. A new member of the transferrin receptor-like JS. Atypical haemochromatosis: phenotypic spectrum and family. J Biol Chem 1999;274:20826-32. beta 2-microglobulin candidate gene analysis. J Med Genet 56 Camaschella C, Roetto A, Calli A, De Gobbi M, Garozzo G, 1999;36:537-41. Carella M, Majorano N, Totaro A, Gasparini P. The gene 33 Shamieh I, Kibort PK, Suchy FJ, Freese DK. Antioxidant TfR 2 is mutated in a new type of haemochromatosis map- therapy for neonatal iron storage disease. Pediatric Res ping to 7q22. Nat Genet 2000;25:14-15. 1993;33:109A. 57 Sarkany RP, Alexander GJ, Cox TM. Recessive inheritance 34 Chase GA, Folstein MF, Breitner JC, Beaty TH, Self SG. of erythropoietic protoporphyria with liver failure. Lancet The use of life tables and survived analysis in testing 1994;344:958-9. genetic hypotheses, with an application to Alzheimer’s dis- 58 Gouya L, Puy H, Lamoril J, Da Silva V, Grandchamp B, ease. Am J Epidemiol 1983;117:590-7. Nordmann Y, Deybach JC. Inheritance in erythropoietic 35 Mura C, Raguenes O, Ferec C. HFE mutations analysis in protoporphyria: a common wild-type ferrochelatase allelic 711 hemochromatosis probands: evidence for S65C impli- variant with low expression accounts for clinical manifesta- cation in mild form of hemochromatosis. Blood 1999;93: tion. Blood 1999;93:2105-10. 2502-5. 59 Brown MD, Chitayat D, Allen J, Hosseini J, Litten R, 36 Douabin V, Deugnier Y, Jouanolle A, Moirand R, Mac- Babul-Hirhi R, Wallace DC. Mitochondrial DNA muta- queron G, Gireau A, Le Gall JY, David V. Polymorphisms tions associated with neonatal hemochromatosis. Am J in the HFE gene. Hum Hered 1999;49:21-6. Hum Genet 1999;65:A45.