Intraspecific Phylogeography of the Japanese Threadfin Bream
Total Page：16
File Type：pdf, Size：1020Kb
Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus japonicus (Perciformes: Nemipteridae), from the Persian Gulf and Indo-West Pacific: a preliminary study based on mitochondrial DNA sequence Item Type article Authors Farivar, S.; Jalil-Piran, Z.; Zarei, F.; Hosseinzadeh Sahafi, H. Download date 30/09/2021 23:21:24 Link to Item http://hdl.handle.net/1834/37832 Iranian Journal of Fisheries Sciences 16(2) 587-604 2017 Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus japonicus (Perciformes: Nemipteridae), from the Persian Gulf and Indo-West Pacific: a preliminary study based on mitochondrial DNA sequence Farivar S.1*; Jalil-Piran Z.1; Zarei F.2; Hosseinzadeh Sahafi H.3 Received: September 2015 Accepted: June 2016 Abstract The Japanese threadfin bream, Nemipterus japonicus, the most abundant and crucially economic Nemipterus species is widespread throughout the Indo-West Pacific. The species has been studied widely for various aspects but genetic studies are scanty. This preliminary study contributes to the species phylogeography through the study of the genetic diversity and historical demography of N. japonicus populations from the Persian Gulf and Indo-West Pacific based on cytochrome c oxidase subunit I (COI) gene sequence. Grouping of the data into phylogenetic trees indicated that the Japanese threadfin bream consists of two reciprocally monophyletic phylogroups with 2.3% net sequence divergence which may qualify as cryptic species: clade I, consists of two sub- clades (Ia and Ib) occurs in the Persian Gulf and Western India, and clade II, which is restricted to the South China Sea. Historical and demographic hypotheses were raised to explain the observed phylogeographic pattern and population structure. Among the possible key mechanisms, sea level fluctuations driven by glacial episodes of the second half of the Pleistocene Epoch appear to have played an active role in initiating major phylogeographic separation. Apart from presumptive Pleistocene vicariance, a trend of increasing genetic differences with increasing geographic distance (i.e., isolation-by-distance) and regional differences in breeding season were also proposed as possible alternative scenarios. Since the baseline knowledge on the intraspecific genetic diversity and management and evolutionary significant units is the first step before any action to be taken, the basic findings provided by this research are particularly relevant to conservation efforts, fishery management and stock assessment. Keywords: Nemipterus Japonicus, mtDNA, Phylogeography, Persian Gulf, Indo-West Pacific 1-Department of Genetics, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University (GC), Tehran 1983963113, Iran. 2-Department of Animal Sciences, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University (GC), Tehran 1983963113, Iran. 3-Iranian Fisheries Science Research Institute (IFSRI), Agricultural Research Education and Extension Organization (AREEO), P.O. Box14155-6116, Tehran, Iran. *Corresponding author’s Email: [email protected] 588 Farivar et al., Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus … Introduction 1996; Zacharia, 1998; Raje, 2003; The Japanese threadfin bream, Manojkumar, 2004; Joshi, 2010; Nemipterus japonicus (Bloch, 1795), Naqash and Nazeer, 2010), and the most abundant and crucially population dynamics (Vivekanandan economic Nemipterus species is and James, 1986; Iqbal, 1991; Zacharia, widespread throughout the Indo-West 1998; Rajkumar et al., 2003; Fazeli, Pacific ranging from East Africa, 2014; Rezayi et al., 2014), but including the Persian Gulf and Red Sea morphological and genetic studies are to the Indo-Malay Archipelago (Fig. scanty. Analysis of morphometric 1A). It is a benthic, non-migratory characters have indicated that separate species, very abundant in coastal stocks of this species may exist along waters, found on mud and sand bottoms the east and west coasts of India in the 5-80 m depth ranges, usually in (Sreekanth et al., 2015). Evaluation of schools (Russell, 1990). As a result of mitochondrial cytochrome b (Cyt b) faster growth rates in males, females gene sequence among N. japonicus predominate at small sizes and males at populations along the coast of large sizes (Lee, 1973). As a demersal Peninsular Malaysia by Jamsari et al. carnivore, the diet of this species (2008) and Lim et al. (2016) provided mainly consists of crustaceans, fishes, evidence for possible occurrence of molluscs, polychaetes and echinoderms cryptic species in that region. Analysis (Salarpouri et al., 2010; Afshari et al., of mitochondrial cytochrome c oxidase 2013; Manojkumar et al., 2015). This subunit I (COI) gene sequence among species is trawled in commercial nine Nemipterus species by quantities in the Persian Gulf and Oman Ravitchandirane et al. (2012) revealed Sea (Valinassab et al., 2006), the that the highest intraspecific K2P Andaman Sea (Senta and Tan, 1975), as distance belongs to N. Japonicus well as in the Bay of Bengal (0.069; based on 5 specimens). DNA (Krishnamoorthi, 1971), and the South barcode results based on COI gene for China Sea (Eggleston, 1972; Lee, 1973; three N. Japonicus specimens supported Weber and Jothy, 1977). It has been the possible existence of two studied widely for various aspects like geographically separated lineages, the maturity, reproduction and related Indian Ocean and West Pacific lineages aspects (Krishnamoorthi, 1971; (Ning et al., 2015). On the other hand, Eggleston, 1972; Murty, 1984; Russell, the population genetic structure and 1990; Bakhsh, 1996; Rajkumar et al., phylogeographic pattern within the 2003; Kerdgari et al., 2009; Fazeli, western range of species (consists of the 2013), biology and biochemistry Indian Ocean, Arabian Sea and two (Krishnamoorthi, 1971; Murty, 1984; evaporative basins, the Red Sea and Murty, 1987; Russell, 1990; Samuel, Persian Gulf) is even more poorly 1990; Bakhsh, 1996; Chawla et al., known. However, the early findings Iranian Journal of Fisheries Sciences 16(2) 2017 589 clearly suggest that the diversity of the collected from 8 stations along the Japanese threadfin bream in the Indo- northern coast of the Persian Gulf West Pacific remains largely which based on geographical proximity unexplored. were grouped into two populations (Fig. Mitochondrial DNA (mtDNA), due 1B and Table 1): the Bushehr to its maternal and non-recombining population (consists of 10 specimens mode of inheritance and rapid sequence from five sampling stations including evolution, provides multiple haplotypes the Bushehr waterfront, Bandar Deyr, that can be ordered phylogenetically Bandargah, the Nayband Gulf and the within a species (Avise, 2000). Among Suru Village coast) and the Hormozgan the mitochondrial genes, a 650 bp population (consists of 7 specimens fragment from the 5´ region of the from three sampling stations including mitochondrial COI gene, with a strong Bandar-e Kong, Bandar Abbas and the track record in revealing cryptic Salkh Village coast). All specimens species, has been adopted as a global were identified as N. japonicus based bio-identification system for members on taxonomic keys and descriptions as of the animal kingdom (Hebert et al., referenced in the FAO species 2004; Ward et al., 2005). Recent catalogue vol. 12 (Russell, 1990). In studies have successfully proved the addition, 14 previously published COI efficiency of this gene in diagnosis of sequences from the South China Sea, threadfin breams (Ravitchandirane et Western India (coast of Maharashtra; al., 2012) and other marine fishes from Lakra et al., 2011) and coast of Bushehr the Persian Gulf (Asgharian et al., Province (from Nayband National Park; 2011) and Indian Ocean (Lakra et al., Asgharian et al., 2011) were also 2011). This study contributes to the retrieved from the National Center for species phylogeography through the Biotechnology Information (NCBI). study of the genetic diversity and historical demography of N. japonicus DNA extraction and mtDNA sequencing populations from the Persian Gulf and DNA was isolated from fin tissue Indo-West Pacific based on original and samples by standard Phenol- published COI sequences. Results Chloroform method (Sambrook et al., should provide a primary understanding 1989), and diluted in TE buffer to a of the species history, and may have final concentration of 50 ng/μL. The relevance for conservation, stock COI gene (approximately 655 bp in assessment and fishery management. length) was amplified using a set of primers FishF1: 5´- Materials and methods TCAACCAACCACAAAGACATTGG Origin of samples and populations CAC-3´ and FishR1: 5´- From June to November 2012 a total TAGACTTCTGGGTGGCCAAAGAA number of seventeen specimens were TCA-3´ (Ward et al., 2005). The 25 μl 590 Farivar et al., Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus … Figure 1: (A) Map of the Indo-West Pacific showing the current range of Nemipterus Japonicus (black area; after Russell, 1990). (B) The sample collection sites in the Persian Gulf. Numbers are the same as in Table 1. Table 1: Sampling localities, geographical coordinates and number of specimens. Population No.* Lat. N Lon. E n GenBank Acc. No. Bushehr 1 28˚17´ 51˚64´ 12 KU739523; KU739524; KU739525; KU739526; KU739527; KU739528; KU739529; KU739530; KU739531; KU739532; HQ149889; HQ149888 Hormozgan 2 26˚83´ 55˚45´ 7 KU739533; KU739534; KU739535; KU739536; KU739537; KU739538; KU739539 Western India 3 19˚01´ 72˚78´ 5 EF609553; EF609554;