Genetic Diversity and Phylogenetic Relationships of Threadfin Breams (Nemipterus Spp.) from the Red Sea and Eastern Mediterranean Sea
Total Page：16
File Type：pdf, Size：1020Kb
Genome Genetic Diversity and Phylogenetic Relationships of Threadfin Breams (Nemipterus spp.) from the Red Sea and eastern Mediterranean Sea Journal: Genome Manuscript ID gen-2019-0163.R3 Manuscript Type: Article Date Submitted by the 16-Jun-2020 Author: Complete List of Authors: Ogwang, Joel; The American University in Cairo, Biology Bariche, Michel; American University of Beirut Bos, Arthur; The American University in Cairo, Biology; Naturalis BiodiversityDraft Center COI, DNA barcoding, founder effect, haplotype diversity, Lessepsian Keyword: migration Is the invited manuscript for consideration in a Special Trends in DNA Barcoding and Metabarcoding 2019 Issue? : https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 35 Genome 1 Genetic Diversity and Phylogenetic Relationships of Threadfin 2 Breams (Nemipterus spp.) from the Red Sea and eastern 3 Mediterranean Sea 4 5 Joel Ogwang, Michel Bariche, and Arthur R. Bos 6 7 8 J. Ogwang and A.R. Bos. The American University in Cairo, P.O. Box 74, AUC Avenue 9 11835, Cairo, Egypt. Draft 10 M. Bariche. The American University in Beirut, P.O. Box 11-0236, Riad El-Solh / Beirut 1107 11 2020, Lebanon. 12 A.R. Bos. Naturalis Biodiversity Center, P.O. Box 9517, 2300 RA Leiden, The Netherlands. 13 Corresponding author: Joel Ogwang (email: [email protected]). 14 1 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 2 of 35 15 Abstract: The present work utilized partial sequences of cytochrome c oxidase subunit I (COI) to 16 study Red Sea populations of threadfin breams (Nemipteridae), and compare their genetic diversity 17 to that of Mediterranean Sea (Nemipterus randalli only) and Indo-Pacific populations. A 18 Maximum Likelihood tree separated four fish species – N. randalli, N. japonicus, N. bipunctatus 19 and N. zysron – into four clades. Haplotype analyses revealed a strong case of the founder effect 20 for the Lessepsian migrant N. randalli: Three haplotypes represented all sampled geographical 21 ranges in the Mediterranean Sea and only one haplotype was shared with a Red Sea individual, 22 presenting evidence that the colonizing population was founded by a small number of migrants. 23 The Red Sea population of N. japonicus shared haplotypes with Persian Gulf and Indian Ocean 24 populations, but South China Sea populations remained fully isolated. The haplotype networks of 25 N. randalli and N. bipunctatus also revealedDraft haplotype sharing between Red Sea and Indian Ocean 26 populations. For N. zysron, one haplotype was shared between Indonesia and the Persian Gulf. We 27 discuss the impact of continued usage of public database sequences of initially misidentified 28 organisms and provide recommendations for avoiding distribution of sequences with incorrect 29 scientific names. 30 31 Key words: COI, DNA barcoding, founder effect, haplotype diversity, Lessepsian migration 32 33 34 2 https://mc06.manuscriptcentral.com/genome-pubs Page 3 of 35 Genome 35 Introduction 36 Threadfin Breams (Nemipteridae) are conspicuously colored demersal fishes that appear in 37 various combinations of pink and yellow (Froese and Pauly 2019). Nemipterids are endemic to the 38 Indo-Pacific region, including the Red Sea, and have been categorized into at least 67 species 39 belonging to five genera (Russel 1990; Froese and Pauly 2019). Ten species of the genus 40 Nemipterus are known from the western Indian Ocean, but only five have been reported from the 41 northern parts of the Red Sea (Russel 1990; Froese and Pauly 2019). Identification of Nemipterus 42 spp. may be challenging due to their similar coloration and appearance, and as a consequence new, 43 previously overlooked, species have been described in recent years (e.g. Russell and Ho 2017; 44 Bineesh et al. 2018; Nakamura et al. 2018).Draft 45 Hebert et al. (2003) proposed the use of DNA barcoding to aid fish identification, an 46 approach that inspired the establishment of Fish Barcode of Life (FISH-BOL) aiming to barcode 47 all taxonomically described fish species (Ward et al. 2009). Hung et al. (2017) conducted the most 48 comprehensive barcoding study of the Nemipteridae to date, mainly targeting populations from 49 the Indian Ocean. Only Isari et al. (2017) barcoded some Nemipterus specimens from the central 50 Red Sea while studying the composition of coral reef larval fish communities. As Red Sea 51 populations have never been targeted for genetic studies, their phylogenetic relationships to the 52 wider Indo-Pacific populations are still poorly understood. 53 An individual of Nemipterus randalli (Russell, 1986) was reported to have entered the 54 Mediterranean Sea through the Suez Canal (Golani and Sonin 2006; Lelli et al. 2008), resulting 55 from a well-studied phenomenon referred to as Lessepsian migration (Por 1978; Gambi et al. 2009; 56 Spanier and Galil 1991; Zakaria 2015; Tzomos et al. 2010; Mavruk and Avsar 2008; Bos and 57 Ogwang 2018). However, the above specimen of N. randalli had been wrongly identified as 3 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 4 of 35 58 Nemipterus japonicus (Bloch, 1791) by Golani and Sonin (2006). A revision by Lelli et al. (2008) 59 correctly reidentified the specimen as N. randalli, making it the so-far only successful 60 Mediterranean colonizer from this genus. Successive occurrences were reported from Turkey 61 (Bilecenoglu and Russell 2008; Aydin and Akyol 2017) and Lebanon (Lelli et al. 2008; Bariche et 62 al. 2015). Although the biology of N. randalli populations in the Mediterranean Sea has been 63 relatively well studied (ElHaweet 2013; Stern et al. 2014; Rizkalla et al. 2016; Kalhoro et al. 2017; 64 Aydin and Akyol 2017), genetic studies of Mediterranean populations are limited (e.g. Hung et al. 65 2017), while none have been conducted in the Red Sea. How the Mediterranean populations of N. 66 randalli relate genetically to the source population in the Red Sea, or possibly Indian Ocean, is 67 presently unknown. 68 The current work aimed at studyingDraft the phylogenetic relationships of the common 69 Nemipterus species in the northern Red Sea and elucidating how their genetic diversity relates to 70 source populations in the Indo-Pacific region. Furthermore, we studied the genetic diversity of the 71 Lessepsian populations of N. randalli and compared them to the potential source population from 72 the Red Sea. 73 74 Material and methods 75 Sample collection and handling 76 Between January and March 2018, Nemipterus randalli Russell, 1986 tissue samples were 77 collected from 22 individuals bought at local fish markets in Beirut, Lebanon (N = 4), in Hurghada, 78 Red Sea, Egypt (N = 11) and near the Mediterranean port of Abu Qir, Alexandria, Egypt (N = 7). 79 Furthermore, tissue samples were taken from individuals of Nemipterus bipunctatus 4 https://mc06.manuscriptcentral.com/genome-pubs Page 5 of 35 Genome 80 (Valenciennes, 1830) (N = 12), N. japonicus (Bloch, 1791) (N = 6) and N. zysron (Bleeker, 1856) 81 (N = 2) caught off Hurghada, Egypt (Fig. 1) in March 2018. All tissue samples were preserved in 82 98% ethanol, transported to the lab at the American University in Cairo and stored at -20°C until 83 analysis. Russell (1990) was used for species identification, and for N. japonicus, additional 84 characteristics were used (Lelli et al. 2008). Specimens and tissue vouchers from Egypt were 85 stored in the Aquatic Biology lab at the American University in Cairo, whereas specimens obtained 86 from Lebanon were stored in the Department of Biology at the American University in Beirut. 87 88 DNA extraction, Polymerase Chain Reaction (PCR) and Cycle Sequencing 89 DNA was extracted from 18–50Draft mg of ethanol-preserved gill rakers or muscle tissue using 90 QIAmp® DNA Mini Kit (Cat. No.: 51304) from Qiagen following the manufacturer’s instructions. 91 The integrity of the DNA was checked on 1% agarose gel, and the DNA was stored at -20 °C. 92 MyTaq™ DNA Polymerase (Cat No.: BIO-21105) was used to amplify COI sequences using the 93 forward primer FishF1: TCAACCAACCACAAAGACATTGGCAC and the reverse primer FishR1: 94 TAGACTTCTGGGTGGCCAAAGAATCA (Ward et al. 2005). Each Polymerase Chain Reaction 95 (PCR) had a total volume of 25 µl and consisted of 5 µl MyTaq™ Red DNA reaction buffer, 1 µl 96 of 10 µM forward and reverse primer, 0.5 µl of DNA polymerase, varying volumes of template 97 DNA equivalent to 0.25–1 µg DNA. The remaining volume was topped up with nuclease-free 98 water. Cycling conditions were set as follows: 95 °C for initial denaturation (5 minutes), and 35 99 cycles of 95 °C (30 seconds), 45 °C (45 seconds), 72 °C (1 minute), a final extension at 72 °C (7 100 minutes) and a final hold at 4 °C, following Bos (2014). Five microliter volume of each finished 101 reaction was run on 1% agarose gel to visualize COI bands. Samples with clear bands were cleaned 102 using Qiagen’s MinElute™ PCR Purification Kit (Cat. No.: 28004), and the purified PCR products 5 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 6 of 35 103 were sent to Macrogen Inc., Seoul, South Korea, for standard bidirectional Sanger sequencing 104 using the primer pair indicated above. 105 106 Data Analysis 107 To obtain consensus sequences, raw forward and reverse DNA sequences were merged 108 using Fragment Merger (Bell and Kramvis 2013) using default settings, whereas primer trimming 109 was performed in MEGA X version 10.0.5 (Kumar et al. 2018) alignment viewer. The result was 110 forty-two (42) new sequences, each 570 bp long (supplementary data, File S1). To verify species 111 identifications, all new sequences were queried, using BLASTn search algorithm, against subjects 112 in NCBI’s GenBank database. Furthermore,Draft the nucleotide alignment was translated in MEGA X 113 alignment viewer (Kumar et al. 2018) to check for any premature stop codons (supplementary 114 data, File S2).