Downloaded from Ol.1700870 Why the JI? Submit Online

Home , Fetal membranes

Viral Infection Sensitizes Human Fetal Membranes to Bacterial Lipopolysaccharide by MERTK Inhibition and Inflammasome Activation This information is current as of September 24, 2021. Sarah N. Cross, Julie A. Potter, Paulomi Aldo, Ja Young Kwon, Mary Pitruzzello, Mancy Tong, Seth Guller, Carla V. Rothlin, Gil Mor and Vikki M. Abrahams J Immunol published online 15 September 2017 http://www.jimmunol.org/content/early/2017/09/15/jimmun Downloaded from ol.1700870 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 24, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published September 15, 2017, doi:10.4049/jimmunol.1700870 The Journal of Immunology

Viral Infection Sensitizes Human Fetal Membranes to Bacterial Lipopolysaccharide by MERTK Inhibition and Inﬂammasome Activation

Sarah N. Cross,*,1 Julie A. Potter,*,1 Paulomi Aldo,* Ja Young Kwon,*,2 Mary Pitruzzello,* Mancy Tong,* Seth Guller,* Carla V. Rothlin,† Gil Mor,* and Vikki M. Abrahams*

Chorioamnionitis, premature rupture of fetal membranes (FMs), and subsequent preterm birth are associated with local infection and inflammation, particularly IL-1b production. Although bacterial infections are commonly identified, other microorganisms may play a role in the pathogenesis. Because viral pandemics, such as influenza, Ebola, and Zika, are becoming more common, and pregnant women are at increased risk for associated complications, this study evaluated the impact that viral infection had on

human FM innate immune responses. This study shows that a herpes viral infection of FMs sensitizes the tissue to low levels of Downloaded from bacterial LPS, giving rise to an exaggerated IL-1b response. Using an ex vivo human FM explant system and an in vivo mouse model of pregnancy, we report that the mechanism by which this aggravated inflammation arises is through the inhibition of the TAM receptor, MERTK, and activation of the inflammasome. The TAM receptor ligand, growth arrest specific 6, re-establishes the normal FM response to LPS by restoring and augmenting TAM receptor and ligand expression, as well as by preventing the exacerbated IL-1b processing and secretion. These findings indicate a novel mechanism by which viruses alter normal FM immune

responses to bacteria, potentially giving rise to adverse pregnancy outcomes. The Journal of Immunology, 2017, 199: 000–000. http://www.jimmunol.org/

horioamnionitis, preterm premature rupture of mem- attributed to preterm birth (17), and identifiable bacteria associ- branes (PPROM) and preterm birth resulting from in- ated with chorioamnionitis, PPROM, and preterm birth are often C fection are thought to be initiated by bacteria ascending common to the genital tract and the placenta (18). Moreover, al- from the lower genital tract, gaining access to the fetal membranes though the FMs are likely the first tissue colonized by the normal (FMs), and activating innate immune responses (1). The proin- flora of the lower genital tract or by an ascending pathogen (19), flammatory cytokine IL-1b is an important mediator of PPROM most FMs from normal deliveries also have bacteria present (20). and preterm birth (2–5). Normal human FMs express a range of

Thus, bacterial stimulation of the FMs may, in and of itself, be by guest on September 24, 2021 innate immune pattern recognition receptors, such as TLRs, Nod- insufficient to trigger chorioamnionitis and preterm birth. like receptors, and inflammasome family members, and can generate A number of diseases are caused by polymicrobial infections, inflammatory responses following their activation by infectious including disorders of the urogenital tract, like vaginosis (21). components (6–8). Although clinical and experimental studies have Thus, one potential risk factor that could contribute to bacterial- correlated bacterial infection and inflammation at the maternal–fetal associated preterm birth may be another type of infection, such as interface with prematurity (9–16), no single bacterium has been a virus. Although not all women with a viral infection during pregnancy will have complications, some viruses that are detected

*Department of Obstetrics, Gynecology and Reproductive Sciences, Yale University in the amniotic fluid or gestational tissues have been linked to an School of Medicine, New Haven, CT 06510; and †Department of Immunobiology increased risk for chorioamnionitis and preterm birth. These in- and Pharmacology, Yale University School of Medicine, New Haven, CT 06510 clude adenovirus and herpes viruses, such as CMV, EBV, and HSV 1S.N.C. and J.A.P. contributed equally to this work. (22–31). If a virus, which can infect the placenta and FMs increases 2Current address: Department of Obstetrics and Gynecology, Yonsei University Col- a woman’s risk for preterm birth by altering local responses to lege of Medicine, Seoul, Korea. bacterial components, then the mechanisms likely involve modu- ORCIDs: 0000-0002-5019-7038 (S.N.C.); 0000-0003-3009-6325 (J.Y.K.); 0000- lation of innate immune receptors and their regulators. TLR-driven 0002-5693-5572 (C.V.R.); 0000-0002-5499-3912 (G.M.). immune responses are tightly controlled by inhibitors, including the Received for publication June 15, 2017. Accepted for publication August 21, 2017. TAM tyrosine kinase receptors (32, 33). Three TAM receptors, This work was supported in part by Grants R01AI121183 (to V.M.A.) and R56AI124356 (to G.M.) from the National Institute of Allergy and Infectious Dis- TYRO3, AXL, and MERTK, are activated by two endogenous eases, National Institutes of Health and by the McKern Scholar Award for Perinatal ligands: growth arrest specific 6 (GAS6) and protein S1 (PROS1) Research (to V.M.A.). (33). GAS6 activates all three TAM receptors, whereas PROS1 Address correspondence and reprint requests to Dr. Vikki M. Abrahams, Department activates TYRO3 and MERTK (33). Upon ligand binding, TAM of Obstetrics, Gynecology and Reproductive Sciences, Yale University School of Medicine, 333 Cedar Street, LSOG 305C, New Haven, CT 06510. E-mail address: receptors trigger STAT1 phosphorylation, inducing SOCS1 and [email protected] SOCS3, which broadly inhibit TLR signaling (33, 34). In this Abbreviations used in this article: E, embryonic day; FM, fetal membrane; GAS6, study, we investigated how a polymicrobial infection could impact growth arrest specific 6; GRO-a, growth regulated oncogene-a; IP-10, IFN-g– induced protein 10; MHV-68, murine g herpes virus 68; MNS, 3,4-methylenedioxy- human FM innate immune responses and, thus, pregnancy out- b-nitrostyrene; NT, not treated; Poly(I:C), polyinosinic-polycytidylic acid; PPROM, come. Using an ex vivo human FM explant system and an in vivo preterm premature rupture of membranes; PROS1, protein S1; r, recombinant; s, mouse model of pregnancy, we examined the effect that a herpes soluble; VEGF, vascular endothelial growth factor. virus infection had on FM responses to low levels of bacterial Copyright Ó 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$35.00 LPS, as well as the role of the regulatory TAM receptors.

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1700870 2 VIRUS SENSITIZES FETAL MEMBRANES TO BACTERIAL LPS

Materials and Methods from R&D Systems). IL-1b levels were evaluated using the anti-human Human FM collection and preparation primary Abs against pro–IL-1b (product number 12703) and the active form (product number 2022; both from Cell Signaling Technology). Human FMs were collected from planned uncomplicated term (37–41-wk) b-Actin was used as a loading control (Sigma-Aldrich). Images were cesarean deliveries without labor or known infection/inflammation, as pre- recorded, and semiquantitative densitometry was performed using the viously described (7, 8). Tissue collection was approved by Yale University’s Gel Logic 100 system and Carestream software (Carestream Molecular Human Research Protection Program. After washing the FMs with sterile Imaging, Woodbridge, CT). ELISA was used to measure the tissue PBS supplemented with penicillin (100 U/ml) and streptomycin (100 mg/ml) levels of GAS6 (R&D Systems) and total PROS1 (Innovative Research, (Life Technologies, Grand Island, NY), adherent blood clots were removed, Novi, MI). and explants in which the chorion and amnion were intact were obtained using a 6-mm biopsy punch. The FM explants were placed in 0.4-mmpore Statistical analysis cell culture inserts (BD Falcon, Franklin Lakes, NJ) with 500 mlofDMEM Each in vitro FM treatment experiment was performed in triplicate and (Life Technologies) supplemented with 10% FBS (HyClone, Logan, UT), repeated at least three times. For in vivo studies, all FMs from each pregnant and these were placed in a 24-well plate containing 500 mlofthesame animal were pooled. All data are reported as mean 6 SEM of pooled DMEM medium for 24 h, as previously described (7, 8, 35). The next day, experiments. The number of independent experiments or individual mice the medium was removed and replaced with serum-free Opti-MEM (Life from which data were pooled are indicated in the figures or figure legends Technologies). After 3 h, treatments were initiated in serum-free Opti-MEM. as n. Statistical significance (p , 0.05) was determined by one-way ANOVA or a nonparametric test for multiple comparisons or a t test or a Human FM treatments Wilcoxon matched-pairs signed-rank test for the comparison of two FM explants were treated or not for 24 h with murine g herpes virus 68 groups, using Prism software (GraphPad, La Jolla, CA). (MHV-68; 1.5 3 104 PFU/ml) (36), HSV-2 (6.4 3 102 PFU/ml), or the

viral dsRNA mimic polyinosinic-polycytidylic acid [Poly(I:C)] (high m.w., Downloaded from 20 mg/ml; InvivoGen, San Diego, CA). FMs were then treated or not with Results LPS isolated from Escherichia coli 0111:B4 (Sigma-Aldrich, St. Louis, MO) Viral infection synergistically augments human and mouse FM at 1 or 100 ng/ml. For some experiments during the LPS treatment, FMs IL-1b production were also treated or not with the caspase-1 inhibitor Z-WEHD-FMK (1 mM; R&D Systems, Minneapolis, MN) (7, 8), the NLRP3 inflammasome inhib- As previously reported (8), low levels of bacterial LPS signifi- itor 3,4-methylenedioxy-b-nitrostyrene (MNS; 10 mM; Cayman Chemical, cantly upregulated normal human FM explant secretion of IL-1b Ann Arbor, MI) (37), or recombinant (r) human GAS6 (50 ng/ml; R&D Systems). Twenty-four hours later, culture supernatants and FM tissues were compared with the not treated (NT) control (Fig. 1A–C). Infection http://www.jimmunol.org/ collected, snap-frozen, and stored at 280˚C until further analysis. In separate with the herpes virus MHV-68 had no significant effect on FM IL-1b experiments, FMs were pretreated for 30 min with blocking Abs (0.5 mg/ml) secretion compared with the NT control (Fig. 1A). However, to human TYRO3 (mouse mAb; catalog number MAB859), human AXL similarly to human placental trophoblast cells (36, 39), MHV-68 (goat polyclonal; catalog number AF154), and human MERTK (goat poly- efficiently infected human FM tissues. At 24 h postinfection, the clonal; catalog number AF891; all from R&D Systems). FMs were also 3 5 pretreated with isotype-control Abs mouse IgG1 (catalog number MAB002) FM viral load was 7.76 10 /500 ng of DNA, as measured by and goat IgG (catalog number AB-108-C) at the same concentrations (both quantitative PCR for the MHV-68 early-late lytic gene ORF-53 from R&D Systems). FMs were then treated or not with LPS (1 ng/ml), and (36, 41) (data not shown). In combination with LPS, pretreatment culture supernatants and FM tissues were collected 24 h later and stored. with MHV-68 significantly and synergistically augmented IL-1b

6 by guest on September 24, 2021 Mouse studies secretion, as detected by ELISA, by 3.4 1.4–fold compared with LPS alone and by 6.0 6 1.1–fold compared with MHV-68 alone All mouse studies were approved by Yale University’s Institutional Animal 2 2 (Fig. 1A). Western blot analysis of the culture supernatants con- Care and Use Committee. Pregnant wild-type C57BL/6 or pregnant AXL / MERTK2/2 mice (38) were injected i.p. with PBS or low-dose LPS (20 mg/kg) firmed that only the mature active form of IL-1b was released from on embryonic day (E)15.5 (36, 39). Pregnant wild-type C57BL/6 mice were also the FM tissue; no precursor was detected in the culture media (data injected i.p. with PBS or MHV-68 (1 3 106 PFU)onE8.5,followedbyPBSor not shown). When FMs were treated with LPS, followed by MHV- LPS (20 mg/kg) injected i.p. on E15.5. After 6 h, mice were sacrificed. FMs 68 infection, a similar synergistic 5.2 6 2.9–fold augmentation of were collected, pooled, snap-frozen, and stored at 280˚C until further analysis. IL-1b secretion was seen (data not shown). However, because we Cytokine analysis sought to build on previous studies that treated with MHV-68 prior to LPS exposure (36, 39), we continued our studies using this Supernatants were measured for IL-1b by ELISA (R&D Systems), and the following cytokines/chemokines were measured by multiplex analysis (Bio- model. Rad, Hercules, CA): IL-6, IL-8, IL-10, IL-12, IL-17, G-CSF, GM-CSF, IFN-g, To validate the findings for a human viral infection, human FMs MCP-1/CCL2, MIP-1a/CCL3, MIP-1b/CCL4, RANTES/CCL5, TNF-a, were infected with HSV-2 prior to LPS exposure. HSV-2 alone had vascular endothelial growth factor (VEGF), growth regulated oncogene-a no effect on FM IL-1b secretion compared with NT control. (GRO-a), and IFN-g–induced protein 10 (IP-10/CXCL10) (7, 8). Soluble (s)MERTK was measured by ELISA (R&D Systems). Synergistic re- However, HSV-2 infection significantly and synergistically aug- sponses induced by combined treatments were defined as greater than the mented IL-1b secretion by 1.9 6 0.4–fold compared with LPS additive value of the two treatments alone. alone (Fig. 1B). Similarly, the viral dsRNA mimic Poly(I:C) alone did not induce an FM IL-1b response, as previously reported (7). Quantitative real-time PCR However, in combination with LPS, pretreatment with Poly(I:C) also Human and mouse FMs were homogenized, and total RNA was extracted significantly and synergistically augmented IL-1b secretion by 1.8 6 as previously described (6, 40). Quantitative real-time RT-PCR was per- 0.2–fold compared with LPS alone and by 28.8 6 4.5–fold com- formed using the KAPA SYBR FAST qPCR Kit (Kapa Biosystems, Woburn, MA), and PCR amplification was performed on the Bio-Rad CFX pared with Poly(I:C) alone (Fig. 1C). Of note, although Poly(I:C) Connect Real-time System. Data were normalized to the housekeeping and HSV-2 had similar efficacies, MHV-68 was more efficient gene GAPDH, analyzed using the DD threshold cycle method, and pre- (1.7-fold) at augmenting LPS-induced IL-1b secretion by FMs. sented as relative abundance. The primers used are shown in Table I. To validate our in vitro findings in vivo, pregnant wild-type mice Western blot were injected with PBS or MHV-68 at E8.5, followed by PBS or low-dose LPS at E15.5, as previously described (36, 39). Exposure Human FM explants were homogenized, and proteins were extracted and to LPS alone or MHV-68 alone had no significant effect on IL-1B quantified as previously described (8, 35). TYRO3, AXL, and MERTK mRNA levels in mouse FMs compared with the PBS control. levels were evaluated by Western blot, as previously described (8), using the anti-human primary Abs against TYRO3 (catalog number MAB859), However, the combination of MHV-68 and LPS induced a sig- AXL (catalog number AF154), and MERTK (catalog number AF891; all nificantly synergistic increase in FM IL-1B mRNA expression that The Journal of Immunology 3

Table I. Primers used for quantitative RT-PCR

Gene Forward (59 to 39) Reverse (59 to 39) Human TYRO3 CGGTAGAAGGTGTGCCATTTT CGATCTTCGTAGTTCCTCTCCAC AXL CCGTGGACCTACTCTGGCT CCTTGGCGTTATGGGCTTC MERTK CTCTGGCGTAGAGCTATCACT AGGCTGGGTTGGTGAAAACA GAS6 GGCAGACAATCTCTGTTGAGG GACAGCATCCCTGTTGACCTT PROS1 TGCTGGCGTGTCTCCTCCTA CAGTTCTTCGATGCATTCTCTTTCA GAPDH CAGCCTCCCGCTTCGCTCTC CCAGGCGCCCAATACGACCA Mouse TYRO3 CACACGCCCCAGGAGAAT CAGGTAAAAGGTGGCACAGGA AXL ATGCCAGTCAAGTGGATTGCT CACACATCGCTCTTGCTGGT MERTK GTAGATTTACGCACCCTCGTCAAC GCCGAGGATGATGAACATAGAGT GAS6 ACCGTGGGCGGCATT TCCAGGCGAGGGTTAATCG PROS1 GCACAGTGCCCTTTGCCT CAAATACCACAATATCCTGAGACGTT IL-1B CCCAACTGGTACATCAGCAC TCTGCTCATTCACGAAAAGG GAPDH ACCACAGTCCATGCCATCAC CACCACCCTGTTGCTGTAGCC

6 6 was 3.1 0.7–fold higher compared with LPS alone and 4.0 diator of IL-1b processing, caspase-1 (42), significantly reduced FM Downloaded from 0.9–fold higher compared with MHV-68 alone (Fig. 1D). secretion of IL-1b in response to combined MHV-68 and LPS by 6 Viral infection augments human FM IL-1b processing and 53.3 8.7% (Fig. 2B). Inhibition of NLRP3 inflammasome activity secretion in response to bacterial LPS through activation of the using the inhibitor MNS (37) significantly reduced FM secretion of NLRP3 inflammasome IL-1b in response to combined MHV-68 and LPS by 43.3 6 11.3% (Fig. 2C). Having established in a number of systems that a viral infection or http://www.jimmunol.org/ viral dsRNA sensitizes FMs to bacterial LPS by synergistically Viral infection and viral dsRNA differentially modulate the augmenting IL-1b production, we investigated the mechanism by human FM cytokine/chemokine profile in response to which this response was mediated. Using the model of human bacterial LPS FMs infected with MHV-68, the pro- and active forms of IL-1b A broader range of cytokines and chemokines secreted by human were measured. Under NT conditions, FM tissues did not express FMs in response to MHV-68, HSV-2, and Poly(I:C), either alone or detectable levels of either form of IL-1b (Fig. 2A). Treatment with in combination with LPS, was examined. Data from these studies LPS alone significantly induced expression of pro–IL-1b and pro- have been summarized in Table II. Treatment of FMs with LPS alone cessing into its active form. Although treatment with MHV-68 alone significantly increased the secretion of IL-6, IL-8, IL-10, IL-12, by guest on September 24, 2021 induced some active and pro–IL-1b expression by FMs, the levels IL-17, G-CSF, GM-CSF, IFN-g, MCP-1, MIP-1b, RANTES, TNF-a, were not significantly different from the NT control (Fig. 2A). VEGF, GRO-a, and IP-10 compared with the NT control, whereas MHV-68 and LPS in combination significantly induced pro–IL-1b it had no significant effect on MIP-1a production (Figs. 3–5). expression to levels similar to LPS alone. Furthermore, MHV-68 As shown in Fig. 3, infection of FMs with MHV-68 alone sig- and LPS in combination significantly and synergistically induced nificantly increased the secretion of IL-6, IL-8, IL-10, IL-12, IL-17, the processing of 7.9 6 2.3–fold more IL-1b into its active form G-CSF, IFN-g, and GRO-a compared with the NT control. MHV-68 compared with LPS alone (Fig. 2A). Inhibition of the common me- infection alone significantly reduced basal FM secretion of MCP-1

FIGURE 1. Viral infection augments LPS-induced FM IL-1b. Human FM explants were NT or were treated with LPS (100 ng/ml), MHV-68 (1.5 3 104 PFU/ml), or MHV-68 and LPS (n =7)(A), LPS (100 ng/ml), HSV-2 (6.4 3 102 PFU/ml), or HSV-2 and LPS (n =3)(B), or LPS (1 ng/ml), Poly(I:C) (20 mg/ml), or Poly(I:C) and LPS (n =6)(C), and supernatants were measured for IL-1b by ELISA. (D) Pregnant wild-type mice were injected on E8.5 with PBS or MHV-68 (1 3 106 PFU) and on E15.5 with PBS or LPS (20 mg/kg). After 6 h, mice were sacriﬁced. FMs were harvested and homogenized for RNA, and IL-1B mRNA levels were measured by quantitative RT-PCR. Data are expressed as mean + SEM. *p , 0.05 versus NT or PBS control, unless otherwise indicated. 4 VIRUS SENSITIZES FETAL MEMBRANES TO BACTERIAL LPS Downloaded from

FIGURE 2. Viral infection augments LPS-induced FM IL-1b processing and secretion through activation of the NLRP3 inﬂammasome. (A) Human FM explants were NT or were treated with LPS (100 ng/ml), MHV-68 (1.5 3 104 PFU/ml), or MHV-68 and LPS (n = 7). Lysates were evaluated by Western blot for expression of pro–IL-1b (31 kDa) and the 17-kDa active form. Blots are from one representative experiment. Bar graphs show active and pro–IL-1b expression, as determined by densitometry and normalized to b-actin (n = 4 or 5). Human FM explants were NT or were treated with LPS, MHV-68, or

MHV-68 and LPS in the presence of media, a caspase-1 inhibitor (1 mM; n =6)(B), or the NLRP3 inhibitor MNS (10 mM; n =5)(C). Supernatants were http://www.jimmunol.org/ measured for IL-1b by ELISA. Data are expressed as mean + SEM. *p , 0.05 versus NT control, unless otherwise indicated. and had no significant effect on FM GM-CSF, MIP-1a, MIP-1b, Table II. Summary of the effect of viral infection or Poly(I:C) on RANTES, TNF-a, VEGF, or IP-10 secretion (Fig. 3). When FMs human FM responses to LPS were treated with MHV-68 and then exposed to LPS, secretion of IL-6, IL-8, G-CSF, and GRO-a was further significantly increased Effect on Synergistic Additive compared with LPS alone and, with the exception of IL-8, compared LPS Response Increase Increase Suppression None with MHV-68 alone, all in an additive manner. In contrast, MHV-68 IL-1b MHV-68 infection of FMs, followed by exposure to LPS, significantly in- HSV-2 by guest on September 24, 2021 a Poly(I:C) hibited the LPS-induced secretion of MCP-1, TNF- , and IP-10 by IL-6 MHV-68 HSV-2 84.7 6 5.2, 68.3 6 8.8, and 52.9 6 10.0%, respectively. The se- Poly(I:C) cretion of IL-10, IL-12, IL-17, GM-CSF, IFN-g, MIP-1a, MIP-1b, IL-8 MHV-68 HSV-2 RANTES, and VEGF was not significantly altered by the combi- Poly(I:C) nation of MHV-68 and LPS compared with LPS alone or, with the IL-10 MHV-68 HSV-2 exception of RANTES, compared with MHV-68 alone (Fig. 3, Poly(I:C) Table II). IL-12 MHV-68 As shown in Fig. 4, infection of FMs with HSV-2 alone had no HSV-2 significant effect on the FM secretion of any of the factors tested. Poly(I:C) IL-17 MHV-68 When FMs were treated with HSV-2 and then exposed to LPS, FM HSV-2 secretion of G-CSF, MIP-1a, and GRO-a was significantly and Poly(I:C) synergistically augmented by 1.3 6 0.1–fold, 1.2 6 0.1–fold, and G-CSF HSV-2 MHV-68 1.2 6 0.1–fold, respectively, compared with LPS alone. Similarly Poly(I:C) GM-CSF Poly(I:C) MHV-68 to infection with MHV-68, HSV-2 significantly reduced FM se- HSV-2 cretion of MCP-1 in response to LPS by 16.0 6 7.3%. The secretion IFN-g MHV-68 of IL-6, IL-8, IL-10, IL-12, IL-17, GM-CSF, IFN-g, MIP-1b, HSV-2 RANTES, TNF-a, VEGF, or IP-10 was not significantly altered Poly(I:C) by the combination of HSV-2 and LPS compared with LPS alone MCP-1 MHV-68 Poly(I:C) HSV-2 (Fig. 4, Table II). MIP-1a HSV-2 MHV-68 As shown in Fig. 5, treatment of FMs with Poly(I:C) alone sig- Poly(I:C) nificantly increased the secretion of IL-6, IL-17, G-CSF, GM-CSF, MIP-1b MHV-68 IFN-g,MCP-1,MIP-1b, RANTES, TNF-a, VEGF, GRO-a,and HSV-2 Poly(I:C) IP-10 compared with the NT control. Similar to infection with RANTES Poly(I:C) MHV-68 MHV-68, pretreatment of FMs with Poly(I:C) significantly aug- HSV-2 mented the LPS-induced secretion of IL-6, G-CSF, and GRO-a com- TNF-a MHV-68 HSV-2 pared with LPS or Poly(I:C) alone, in an additive manner. However, Poly(I:C) VEGF Poly(I:C) MHV-68 additional factors were also augmented in a similar manner. Poly(I:C) HSV-2 significantly augmented LPS-induced FM secretion of GM-CSF, GRO-a HSV-2 MHV-68 VEGF, and IP-10 in an additive manner compared with LPS alone Poly(I:C) or, with the exception of IP-10, compared with Poly(I:C) alone. Also, IP-10 Poly(I:C) MHV-68 HSV-2 The Journal of Immunology 5 Downloaded from http://www.jimmunol.org/

FIGURE 3. MHV-68 infection differentially modulates FM cytokine/chemokine responses to LPS. Human FM explants were NT or were treated with LPS (100 ng/ml), MHV-68 (1.5 3 104 PFU/ml), or MHV-68 and LPS (n = 4). Supernatants were measured by multiplex analysis. Data are expressed as mean + SEM. *p , 0.05 versus NT control, unless otherwise indicated. ns, not signiﬁcant.

similarly to MHV-68, pretreatment with Poly(I:C) significantly in- MHV-68 plus LPS was reduced significantly (by 42.2 6 5.3%) by guest on September 24, 2021 hibited the LPS-induced FM secretion of TNF-a by 36.6 6 1.3%. compared with the NT control and compared with LPS alone (by Similar to infection with HSV-2, the combination of Poly(I:C) and 34.3 6 9.7%) (Fig. 6C). Similarly to FMs exposed to MHV-68 LPS significantly and synergistically augmented FM secretion of plus LPS, Poly(I:C) plus LPS significantly reduced FM MERTK MIP-1a by 206.6 6 55.5–fold compared with LPS alone and by protein expression by 38.7 6 9.2% compared with the NT 2563.9 6 179.1–fold compared with Poly(I:C) alone. The combi- control (Fig. 6D). However, Poly(I:C) plus LPS significantly nation of Poly(I:C) and LPS also significantly and synergistically increased FM AXL protein expression by 2.1 6 0.3–fold com- augmented FM secretion of RANTES by 1.6 6 0.1–fold compared pared with the NT control (Fig. 6D). To assess whether the re- with LPS alone and by 4.7 6 0.2–fold compared with Poly(I:C) duction in MERTK expression correlated with decoy receptor alone. The secretion of IL-8, IL-10, IL-12, IL-17, IFN-g,MCP-1, release (43), sMERTK levels were measured. Treatment of FM and MIP-1b was not significantly altered by the combination of explants with LPS alone or MHV-68 alone significantly reduced Poly(I:C) and LPS compared with LPS alone or, with the exception FM sMERTK levels by 36.4 6 19.4 and 44.8 6 19.2%, re- of IL-10 and MIP-1b, compared with Poly(I:C) alone (Fig. 5, spectively, compared with the NT control (Fig. 6E). MHV-68 in Table II). combination with LPS significantly augmented sMERTK by 1.7 6 0.6–fold compared with MHV-68 alone, to near baseline (NT) Combined viral infection and LPS inhibit FM MERTK expression, which is reversed by GAS6 levels (Fig. 6E). The presence of the common TAM receptor agonist rGAS6 To better understand the mechanism by which viral infection significantly increased AXL expression in FMs exposed to MHV- of human FMs synergistically augmented the LPS-induced pro- 68 plus LPS by 1.6 6 0.2–fold (Fig. 6B), and it significantly duction of IL-1b, expression of the TAM receptor family was increased MERTK expression in FMs exposed to MHV-68 alone examined in these tissues. Under control conditions, human by 1.3 6 0.1–fold (Fig. 6C). Although significance was not FM explants expressed the TAM receptors TYRO3, AXL,and reached, rGAS6 increased MERTK expression in FMs exposed MERTK, as well as their ligands GAS6 and PROS1,atthemRNA to MHV-68 in combination with LPS by 2.4 6 0.7–fold (Fig. 6C). level, although TYRO3 expression was very low (Fig. 6A). This FM expression of GAS6 and total PROS1 protein was also was reflected at the protein level, because, under NT conditions, evaluated. As shown in Fig. 6F, treatment of FMs with MHV-68, FMs expressed AXL (Fig. 6B, 6D) and MERTK (Fig. 6C, 6D), either alone or in combination with LPS, significantly increased whereas expression of TYRO3 was undetectable (data not GAS6 levels compared with the NT control. In contrast, PROS1 shown). levels did not change significantly with any of the treatments Treatment of human FMs with MHV-68 or LPS, alone or in (Fig. 6G); however, under NT, LPS, and MHV-68 plus LPS combination, had no significant effect on AXL protein expression conditions, the presence of rGAS6 significantly elevated PROS1 levels (Fig. 6B). MERTK protein expression by FMs treated with levels (Fig. 6G). 6 VIRUS SENSITIZES FETAL MEMBRANES TO BACTERIAL LPS Downloaded from http://www.jimmunol.org/

FIGURE 4. HSV-2 infection differentially modulates FM cytokine/chemokine responses to LPS. Human FM explants were NT or were treated with LPS (100 ng/ml), HSV-2 (6.4 3 102 PFU/ml), or HSV-2 and LPS (n = 3). Supernatants were measured by multiplex analysis. Data are expressed as mean + SEM. *p , 0.05 versus NT control, unless otherwise indicated. ns, not significant. by guest on September 24, 2021 Augmented human FM IL-1b production in response to virus FMs predominantly expressed AXL and MERTK, we used double- and LPS is reversed by GAS6 knockout mice as a surrogate for a viral infection (38). Thus, wild- 2/2 2/2 Having established that MHV-68 plus LPS inhibited FM MERTK type or AXL MERTK mice were exposed to PBS or LPS at a expression and promoted sMERTK levels, and that this was re- dose that does not induce inflammation or preterm birth in wild- versed by rGAS6, we next sought to determine whether this type mice (36, 39). FMs collected from pregnant wild-type mice modulation of the TAM receptor pathway played a direct role in the exposed to low levels of LPS expressed levels of IL-1B that were similar to those in pregnant wild-type mice exposed to PBS. IL-1b response. Human FM IL-1b secretion in response to MHV- 2/2 2/2 68 plus LPS was significantly inhibited by 41.2 6 10.4% in the However AXL MERTK mice exposed to low levels of LPS presence of rGAS6 (Fig. 7Ai). To further explore the mechanism expressed significantly higher levels of IL-1B compared with 2/2 2/2 6 by which GAS6 regulated FM IL-1b secretion in response to PBS-treated AXL MERTK mice (5.0 2.4–fold increase) 6 MHV-68 plus LPS, Western blot of tissue lysates for active and and LPS-treated wild-type mice (3.6 1.7–fold increase) pro–IL-1b was performed. rGAS6 had no effect on the levels of (Fig. 7D). pro–IL-1b under all conditions tested (Fig. 7Aii). However, rGAS6 significantly inhibited FM expression of active IL-1b by 52.3 6 Discussion 5.8% when treated with MHV-68 plus LPS (Fig. 7Aiii). Although chorioamnionitis, PPROM, and subsequent preterm birth are associated with infection and inflammation, the underlying b Blocking TAM receptor function augments FM IL-1 mechanisms involved are not fully understood. Furthermore, al- production in response to bacterial LPS though local bacterial infections may be easily identified, other To further confirm a role for the TAM receptors in modulating more difficult-to-detect infections may still play a role in the human FM responses to LPS, their function was inhibited using pathogenesis of preterm birth. Indeed, viral infections are be- blocking anti-TAM Abs instead of virus. Combination anti-TAM coming increasingly linked to pregnancy complications and, thus, Abs significantly augmented LPS-induced human FM IL-1b se- represent an important clinical problem. It is established that cretion by 1.6 6 0.05–fold compared with the levels secreted in viruses able to cross the placenta and infect the fetus, such as Zika response to LPS in the presence of isotype-Ab controls (Fig. 7B). virus, CMV, and rubella, often cause congenital defects and adverse To validate the role of the TAM receptors in regulating human FM pregnancy outcomes (44–46). Much less is known about viruses responses to LPS, an in vivo mouse model was used. Similar to that may not readily transmit vertically during pregnancy, like human FMs, FMs collected from pregnant wild-type mice ex- HSV-2 and influenza H1N1. However, such viruses may still pressed the TAM receptors TYRO3, AXL, and MERTK, as well as impact maternal and fetal morbidity and mortality by infecting their ligands GAS6 and PROS1, at the mRNA level, although, gestational tissues and modulating local innate immune responses again, TYRO3 expression was very low (Fig. 7C). Because mouse (47–52). The results presented in this article indicate that a herpes The Journal of Immunology 7 Downloaded from http://www.jimmunol.org/

FIGURE 5. Poly(I:C) differentially modulates FM cytokine/chemokine responses to LPS. Human FM explants were NT or were treated with LPS (1 ng/ml), Poly(I:C) (20 mg/ml), or Poly(I:C) and LPS (n = 4). Supernatants were measured by multiplex analysis. Data are expressed as mean + SEM. *p , 0.05 relative to NT control, unless otherwise indicated. ns, not signiﬁcant.

viral infection that infects, but does not cross, the placenta (36, 39) this was mediated by activation of the inflammasome, most likely by guest on September 24, 2021 sensitizes human FM tissue to low levels of bacterial LPS, giving rise NLRP3, which is expressed by human FMs (8). That we only to an exaggerated inflammatory IL-1b response. Using an ex vivo detected mature IL-1b in the culture supernatants indicates that human FM explant system and an in vivo mouse model of pregnancy, combined MHV-68 and LPS treatment of FMs promoted classical we have found that the mechanism by which this aggravated FM pyroptosis-associated inflammasome activation. The reduction in inflammation arises is through disabling of the TAM receptor path- FM IL-1b secretion by MNS, which blocks the assembly of way and subsequent activation of the NLRP3 inflammasome. NLRP3 inflammasome (37), and by the caspase-1 inhibitor, a major In chorioamnionitis, PPROM, and preterm birth, the most com- inflammasome component, indicates that inflammasome activation, monly isolated microbes are bacteria that normally colonize the most likely NLRP3, mediated this response. However, there is the lower genital tract, including E. coli, Streptococcus,andUreaplasma possibility that other non-NLRP3 inflammasomes might be in- (53–58). Mixed bacterial infections within the amniotic cavity have volved, because MNS can also inhibit Syk kinase signaling (37). been demonstrated in preterm birth (53, 56) and chorioamnionitis Our finding is in keeping with recent clinical observations showing (59), suggesting that the normal (or pathologic) bacteria of the that FMs from patients with preterm birth or acute histologic cho- genital tract might be an underlying cause. A recent study tested this rioamnionitis have elevated IL-1b, and involvement of the inflam- by exposing human FM explants to a mixed bacterial culture of masome is indicated (64–66). Our in vivo observations of augmented E. coli and Streptococcus agalactiae; however, there was no differ- FM IL-1b production with the combination of MHV-68 and LPS ence in the inflammatory responses generated after mixed or single also complement previous reports that MHV-68 infection during infection (60). Thus, this normal (or abnormal) bacterial flora alone pregnancy, in combination with bacterial LPS, triggered elevated may not be sufficient to trigger an inflammatory response at the uterine and placental inflammation and induced preterm birth (36, maternal–fetal interface that can initiate preterm birth, suggesting a 39). Similarly, intrauterine delivery of viral dsRNA, which is role for polymicrobial infections of different types. Increasingly, produced by many viruses, including herpes virus (67), in com- infectious and inflammatory diseases are being attributed to combination with bacterial peptidoglycan, amplifies inflammation and binations of different infectious kingdoms (21), including pregnancy preterm delivery (68). That we observed a similar synergistic complications like preterm birth (61). Furthermore, the impact that augmentation of IL-1b secretion whether FMs were infected prior viruses may have on pregnancy outcomes is beginning to be ap- to or after LPS demonstrates that this response is due to the polymi- preciated (31, 62, 63). The current study set out to test the impact crobial exposure rather than the timing of virus and LPS. that a polymicrobial infection could have on human FM innate Although treatment of FMs with LPS induced strong pro–IL-1b immune responses and the mechanisms involved. expression, low-dose LPS alone was not sufficient to trigger strong In this article, we report that infection of human FM with herpes IL-1b processing and secretion of active IL-1b. Furthermore, virus MHV-68 synergistically augmented the processing and se- unlike the secretion of IL-1b in response to combination MHV-68 cretion of mature IL-1b in response to low levels of bacterial LPS; and LPS that was inhibited by MNS, IL-1b secretion by LPS alone 8 VIRUS SENSITIZES FETAL MEMBRANES TO BACTERIAL LPS Downloaded from http://www.jimmunol.org/ FIGURE 6. Effect of combined viral infection and LPS on FM TAM receptor and ligand expression. (A) Untreated FM explants (n = 3) were homogenized and analyzed for expression of TYRO3, AXL, MERTK, GAS6, and PROS1 mRNA by quantitative RT-PCR. (B and C) Human FM explants were NT or were treated with LPS (100 ng/ml), MHV-68 (1.5 3 104 PFU/ml), or MHV-68 and LPS in the presence of media or rGAS6 (50 ng/ml) (n = 5). Tissues were homogenized for protein, and Western blot was performed for AXL (∼140 kDa) (B) and MERTK (∼180 kDa) (C). Blots are from one representative experiment. Bar graphs show AXL and MERTK expression, as determined by densitometry and normalized to b-actin. (D) FM explants were NT or were treated with LPS (1 ng/ml), Poly(I:C) (20 mg/ml), or Poly(I:C) and LPS (n = 4). Tissues were homogenized for protein, and Western blot was performed for AXL and MERTK. Blots are from one representative experiment. Bar graphs show AXL and MERTK expression, as determined by densitometry and normalized to b-actin. (E–G) Human FM explants were NT or were treated with LPS, MHV-68, or MHV-68 and LPS in the presence of media or rGAS6. Tissues were homogenized for protein, and ELISA was performed for sMERTK (n =7)(E), GAS6 (n =5)(F), and PROS1 (n =8)(G). Data are expressed as by guest on September 24, 2021 mean + SEM. *p , 0.05 versus NT control, unless otherwise indicated. appeared to be NLRP3 independent, unlike higher concentrations pressed LPS-induced FM MCP-1, whereas MHV-68 and Poly(I:C) (69). Similarly, although MHV-68 alone induced some FM pro–IL- reduced LPS-induced TNF-a secretion. MHV-68 also reduced LPS- 1b expression, there was not significant IL-1b processing. Instead, induced IP-10, whereas HSV-2 synergistically augmented LPS- it was the combination of LPS and MHV-68 that significantly induced GRO-a. The inhibition of TNF-a by MHV-68 has been augmented FM IL-1b processing and subsequent secretion and reported in CD8+ T cells stimulated by the viral protein encoded by secretion of mature IL-1b. This suggests that LPS, by activating ORF-61 (75). Thus, similar mechanisms may be involved in MHV- TLR4, serves as a classical signal 1 and that MHV-68 may provide 68–infected FMs for the suppression of LPS-induced TNF-a,MCP-1, signal 2 by putatively activating NLRP3. NLRP3 can be activated and IP-10. Alternatively, or in combination, the MHV-68– and by viruses (70, 71), including the herpes virus, HSV-1, although LPS-induced production of IL-10 may be involved in the suppres- how is unclear (72). How MHV-68 may be contributing to NLRP3 sion of TNF-a and IP-10 (76). HSV immediate-early protein ICP0 inflammasome activation is an area for future study. has been shown to inhibit TLR4-mediated inflammatory responses HSV-2 infection and viral dsRNA [Poly(I:C)] had a similar impact to HSV and, thus, may account for HSV-2 suppression of the FM on human FM IL-1b secretion in response to LPS, and they may MCP-1 responses (77). Where the FM cytokine/chemokine profiles also activate the NLRP3 inflammasome (73). diverge in response to MHV-68, HSV-2, or Poly(I:C) combined with Thus, the observed augmented IL-1b by virally infected human LPS likely reflects the ability of different live viruses to simulta- FMs in response to low levels of bacterial LPS might be common neously regulate a number of host innate immune pathways, as well to viruses able to produce dsRNA (67) and activate the TLR3 as produce their own immunomodulatory factors. pathway (74). However, we did note a difference in the magnitude Because IL-1b is an important mediator of PPROM and preterm of the response. Although Poly(I:C) and HSV-2 had similar effi- birth (2–5), and its production by human FMs was synergistically cacies, MHV-68 was more efficient at augmenting LPS-induced increased in our model of a polymicrobial infection for MHV-68, IL-1b secretion by FMs. This may be due to additional mecha- HSV-2, and Poly(I:C), as well as in mouse FMs, subsequent mech- nism(s) used by MHV-68. Indeed, this possibility is highlighted by anistic studies focused on this inflammatory cytokine. Activation of the additional cytokine/chemokine data in which we observed over- the TAM receptors (TYRO3, AXL, MERTK) by their ligands lapping and differential responses for MHV-68, HSV-2, and Poly(I: (GAS6, PROS1) restrains TLR signaling, keeping the constitutive C). HSV-2 and Poly(I:C) synergistically augmented LPS-induced chemokine/cytokine expression regulated (33). Because FMs con- MIP-1a, whereas MHV-68 and Poly(I:C) additively augmented stitutively express high levels of AXL, MERTK, GAS6, and PROS1, LPS-induced IL-6, G-CSF, and GRO-a secretion by FMs, again we hypothesized that MHV-68 infection removed this brake, al- indicating a potential role for TLR3. MHV-68 and HSV-2 sup- lowing heightened TLR4-mediated IL-1b production in response to The Journal of Immunology 9 Downloaded from FIGURE 7. Viral infection augments LPS-induced FM IL-1b through inhibition of the TAM receptor pathway. (A) Human FM explants were NT or were treated with LPS (100 ng/ml), MHV-68 (1.5 3 104 PFU/ml), or MHV-68 and LPS in the presence of media or rGAS6 (50 ng/ml). (i) IL-1b secretion in supernatants was measured by ELISA (n = 6). Lysates were evaluated by Western blot for expression of pro-IL-1b (ii) and active IL-1b (iii). Bar graphs show active and pro–IL-1b expression, as determined by densitometry and normalized to b-actin (n = 4 or 5). *p , 0.05 versus NT control, unless otherwise indicated. (B) Human FM explants were treated or not with LPS (1 ng/ml) in the presence of blocking anti-TAM Abs or isotype-control Abs. IL-1b secretion was measured, and levels were expressed as LPS-induced fold change (FC) relative to NT control (n = 4). *p , 0.05 versus isotype control. (C and D) Pregnant wild-type or AXL2/2MERTK2/2 mice were injected on E15.5 with PBS or LPS (20 mg/kg). After 6 h mice were sacrificed. FMs were http://www.jimmunol.org/ harvested and homogenized for RNA. (C) TYRO3, AXL, MERTK, GAS6, and PROS1 mRNA expression levels in FMs from PBS-treated wild-type mice (n = 3) were measured by quantitative RT-PCR. (D) IL-1B mRNA expression levels in FMs from PBS- and LPS-treated wild-type or AXL2/2MERTK2/2 mice were measured by quantitative RT-PCR. *p , 0.05 versus control groups, unless otherwise indicated. Data are expressed as mean + SEM.

LPS. Indeed, MHV-68 and Poly(I:C), in combination with LPS, re- One strength of this study was the use of intact FM explants; we duced FM MERTK expression. Compared with treatment alone, LPS chose to work with an FM system in which the compartments were and MHV-68 also augmented sMERTK levels, which act as a decoy maintained as in vivo, because contact between the chorion and receptor for GAS6 (43), indicating reduced FM TAM receptor func- amnion likely influences each other’s response (8, 83). However, this by guest on September 24, 2021 tion. The increased GAS6 production under combined LPS and MHV- also limits our knowledge about which cell types within the tissue 68 conditions may indicate a compensatory mechanism that was in- (amniotic epithelial, chorionic decidual, or trophoblast; resident sufficient to restore receptor expression and function. Moreover, in the leukocytes) are the major targets for MHV-68, HSV-2, or Poly(I:C) absence of viral stimulation, blocking human FM TAM receptor or are the major producer of IL-1b and other cytokines/chemokines. function also sensitized the tissue to LPS, augmenting IL-1b pro- Thus, in future studies, we intend to dissect out the relative con- duction. This is in contrast to studies using other enveloped viruses tribution of the chorion and amnion and the specific cell types in- that can bind GAS6 and activate TAM receptors through their surface volved in the polymicrobial response. expression of phosphatidylserine (78). To further validate this finding, In summary, FM inflammatory IL-1b responses to LPS become we turned back to an in vivo model of pregnancy using wild-type unrestrained postinfection with herpes virus by reduced TAM re- mice, which are hyporesponsive to low-dose LPS in terms of placental ceptor MERTK expression and enhanced inflammasome activation. inflammation and pregnancy outcome (36, 39, 79, 80), and AXL2/2 GAS6 re-establishes the normal FM response to bacterial LPS by MERTK2/2 mice, which generate hyperresponsive immune reactions restoring and augmenting TAM receptor and ligand expression and to low-dose LPS (33, 81). In concert with our ex vivo human FM function, preventing the exacerbated IL-1b response. These findings studies, in which TAM receptor function was inhibited instead of suggest a novel mechanism by which viruses alter FM responses to treating with virus, FMs from AXL2/2MERTK2/2 mice generated an intrauterine bacteria, giving rise to chorioamnionitis and preterm birth. augmented IL-1b response 6 h following exposure to low-dose LPS compared with FMs from wild-type mice. When mice are not sacri- Acknowledgments 22 ficed for tissues, the same dose of LPS induced preterm birth in AXL / We thank the staff of Yale–New Haven Hospital’s Labor and Birth and MERTK2/2 mice but not in wild-type animals (G. Mor, manuscript in the Yale University Reproductive Sciences Biobank for help with tissue preparation). Conversely, the addition of exogenous GAS6 to human collection. FMs treated with MHV-68 and LPS not only inhibited the augmented IL-1b response, it increased FM expression of AXL, MERTK, and Disclosures PROS1. Thus, GAS6 may activate, as well as self-regulate, expression The authors have no financial conflicts of interest. of its own signaling pathway to further enhance TAM receptor inhibition of TLR-induced inflammation. Furthermore, although rGAS6 References was able to inhibit the processing and secretion of active IL-1b in 1. Romero, R., J. Espinoza, L. F. Gonçalves, J. P. Kusanovic, L. Friel, and response to MHV-68 plus LPS, it was unable to alter pro–IL-1b S. Hassan. 2007. The role of inflammation and infection in preterm birth. Semin. levels, indicating that GAS6 might be suppressing virus-induced Reprod. Med. 25: 21–39. 2. Christiaens, I., D. B. Zaragoza, L. Guilbert, S. A. Robertson, B. F. Mitchell, and inflammasome activation. Indeed GAS6–AXL signaling may pre- D. M. Olson. 2008. Inflammatory processes in preterm and term parturition. vent NLRP3 inflammasome activation in murine macrophages (82). J. Reprod. Immunol. 79: 50–57. 10 VIRUS SENSITIZES FETAL MEMBRANES TO BACTERIAL LPS

3. Kemp, M. W., M. Saito, J. P. Newnham, I. Nitsos, K. Okamura, and S. G. Kallapur. parvovirus B19 and herpes viruses in early pregnancy and risk of second trimester 2010. Preterm birth, infection, and inflammation advances from the study of animal miscarriage or very preterm birth. Reprod. Toxicol. 26: 298–302. models. Reprod. Sci. 17: 619–628. 31. Kalu, E. I., C. K. Ojide, A. Chuku, I. I. Chukwuonye, F. E. Agwu, V. U. Nwadike, 4. Adams Waldorf, K. M., C. E. Rubens, and M. G. Gravett. 2011. Use of non- F. C. Korie, and G. O. Okafor. 2015. Obstetric outcomes of human herpes virus- human primate models to investigate mechanisms of infection-associated pre- 2 infection among pregnant women in Benin, Nigeria. Niger. J. Clin. Pract. term birth. BJOG 118: 136–144. 18: 453–461. 5. Menon, R., R. N. Taylor, and S. J. Fortunato. 2010. Chorioamnionitis–a complex 32. Rothlin, C. V., S. Ghosh, E. I. Zuniga, M. B. Oldstone, and G. Lemke. 2007. TAM pathophysiologic syndrome. Placenta 31: 113–120. receptors are pleiotropic inhibitors of the innate immune response. Cell 131: 1124– 6. Abrahams, V. M., J. A. Potter, G. Bhat, M. R. Peltier, G. Saade, and R. Menon. 1136. 2013. Bacterial modulation of human fetal membrane Toll-like receptor ex- 33. Lemke, G., and C. V. Rothlin. 2008. Immunobiology of the TAM receptors. Nat. pression. Am. J. Reprod. Immunol. 69: 33–40. Rev. Immunol. 8: 327–336. 7. Bakaysa, S. L., J. A. Potter, M. Hoang, C. S. Han, S. Guller, E. R. Norwitz, and 34. O’Neill, L. A. 2008. When signaling pathways collide: positive and negative V. M. Abrahams. 2014. Single- and double-stranded viral RNA generate distinct regulation of toll-like receptor signal transduction. Immunity 29: 12–20. cytokine and antiviral responses in human fetal membranes. Mol. Hum. Reprod. 35. Luo, G., V. M. Abrahams, S. Tadesse, E. F. Funai, E. J. Hodgson, J. Gao, and 20: 701–708. E. R. Norwitz. 2010. Progesterone inhibits basal and TNF-alpha-induced apo- 8. Hoang, M., J. A. Potter, S. M. Gysler, C. S. Han, S. Guller, E. R. Norwitz, and ptosis in fetal membranes: a novel mechanism to explain progesterone-mediated V. M. Abrahams. 2014. Human fetal membranes generate distinct cytokine prevention of preterm birth. Reprod. Sci. 17: 532–539. profiles in response to bacterial Toll-like receptor and nod-like receptor agonists. 36. Cardenas, I., G. Mor, P. Aldo, S. M. Lang, P. Stabach, A. Sharp, R. Romero, Biol. Reprod. 90: 39. S. Mazaki-Tovi, M. Gervasi, and R. E. Means. 2011. Placental viral infection 9. Elovitz, M. A., and C. Mrinalini. 2004. Animal models of preterm birth. Trends sensitizes to endotoxin-induced pre-term labor: a double hit hypothesis. Am. J. Endocrinol. Metab. 15: 479–487. Reprod. Immunol. 65: 110–117. 10. Pettker, C. M., I. A. Buhimschi, L. K. Magloire, A. K. Sfakianaki, B. D. Hamar, 37. He, Y., S. Varadarajan, R. Munõz-Planillo, A. Burberry, Y. Nakamura, and G. Nuń˜ez. and C. S. Buhimschi. 2007. Value of placental microbial evaluation in diag- 2014. 3,4-methylenedioxy-b-nitrostyrene inhibits NLRP3 inflammasome activation nosing intra-amniotic infection. Obstet. Gynecol. 109: 739–749. by blocking assembly of the inflammasome. J. Biol. Chem. 289: 1142–1150. 11. Romero, R., J. Espinoza, J. P. Kusanovic, F. Gotsch, S. Hassan, O. Erez, 38. Bosurgi, L., J. H. Bernink, V. Delgado Cuevas, N. Gagliani, L. Joannas, T. Chaiworapongsa, and M. Mazor. 2006. The preterm parturition syndrome. E. T. Schmid, C. J. Booth, S. Ghosh, and C. V. Rothlin. 2013. Paradoxical role of Downloaded from BJOG 113(Suppl. 3): 17–42. the proto-oncogene Axl and Mer receptor tyrosine kinases in colon cancer. Proc. 12. Elovitz, M. A., C. Mrinalini, and M. D. Sammel. 2006. Elucidating the early Natl. Acad. Sci. USA 110: 13091–13096. signal transduction pathways leading to fetal brain injury in preterm birth. 39. Cardenas, I., R. E. Means, P. Aldo, K. Koga, S. M. Lang, C. J. Booth, A. Manzur, Pediatr. Res. 59: 50–55. E. Oyarzun, R. Romero, and G. Mor. 2010. Viral infection of the placenta leads 13. Burd, I., A. I. Bentz, J. Chai, J. Gonzalez, H. Monnerie, P. D. Le Roux, A. S. Cohen, to fetal inflammation and sensitization to bacterial products predisposing to M. Yudkoff, and M. A. Elovitz. 2010. Inflammation-induced preterm birth alters preterm labor. [Published erratum appears in 2011 J. Immunol. 187: 2835.] J. neuronal morphology in the mouse fetal brain. J. Neurosci. Res. 88: 1872–1881. Immunol. 185: 1248–1257.

14. Pirianov, G., S. N. Waddington, T. M. Lindstro¨m, V. Terzidou, H. Mehmet, and 40. Potter, J. A., M. Garg, S. Girard, and V. M. Abrahams. 2015. Viral single http://www.jimmunol.org/ P. R. Bennett. 2009. The cyclopentenone 15-deoxy-delta 12,14-prostaglandin J stranded RNA induces a trophoblast pro-inflammatory and antiviral response in a (2) delays lipopolysaccharide-induced preterm delivery and reduces mortality in TLR8-dependent and -independent manner. Biol. Reprod. 92: 17. the newborn mouse. Endocrinology 150: 699–706. 41. Racicot, K., I. Cardenas, V. Wunsche,€ P. Aldo, S. Guller, R. E. Means, 15. Koga, K., I. Cardenas, P. Aldo, V. M. Abrahams, B. Peng, S. Fill, R. Romero, and R. Romero, and G. Mor. 2013. Viral infection of the pregnant cervix predisposes G. Mor. 2009. Activation of TLR3 in the trophoblast is associated with preterm to ascending bacterial infection. J. Immunol. 191: 934–941. delivery. Am. J. Reprod. Immunol. 61: 196–212. 42. Martinon, F., and J. Tschopp. 2007. Inflammatory caspases and inflammasomes: 16.Cardenas,I.,M.J.Mulla,K.Myrtolli,A.K.Sfakianaki,E.R.Norwitz, master switches of inflammation. Cell Death Differ. 14: 10–22. S. Tadesse, S. Guller, and V. M. Abrahams. 2011. Nod1 activation by bacterial 43. Sather, S., K. D. Kenyon, J. B. Lefkowitz, X. Liang, B. C. Varnum, P. M. Henson, iE-DAP induces maternal-fetal inflammation and preterm labor. J. Immunol. and D. K. Graham. 2007. A soluble form of the Mer receptor tyrosine kinase in- 187: 980–986. hibits macrophage clearance of apoptotic cells and platelet aggregation. Blood 17. Ganu, R. S., J. Ma, and K. M. Aagaard. 2013. The role of microbial communities 109: 1026–1033. in parturition: is there evidence of association with preterm birth and perinatal 44. de Carvalho, N. S., B. F. de Carvalho, B. Do´ris, E. Silverio Biscaia, C. Arias by guest on September 24, 2021 morbidity and mortality? Am. J. Perinatol.30: 613–624. Fugaça, and L. de Noronha. 2017. Zika virus and pregnancy: an overview. Am. J. 18. Aagaard, K., J. Ma, K. M. Antony, R. Ganu, J. Petrosino, and J. Versalovic. 2014. Reprod. Immunol. DOI: 10.1111/aji.12616. The placenta harbors a unique microbiome. Sci. Transl. Med. 6: 237ra265. 45. Alvarado, M. G., and D. A. Schwartz. 2017. Zika virus infection in pregnancy, 19. Herve´, R., T. Schmitz, D. Evain-Brion, D. Cabrol, M. J. Leroy, and C. Me´hats. microcephaly, and maternal and fetal health: what we think, what we know, and 2008. The PDE4 inhibitor rolipram prevents NF-kappaB binding activity and what we think we know. Arch. Pathol. Lab. Med. 141: 26–32. proinflammatory cytokine release in human chorionic cells. J. Immunol. 181: 46. Silasi, M., I. Cardenas, J. Y. Kwon, K. Racicot, P. Aldo, and G. Mor. 2015. Viral 2196–2202. infections during pregnancy. Am. J. Reprod. Immunol. 73: 199–213. 20. Steel, J. H., S. Malatos, N. Kennea, A. D. Edwards, L. Miles, P. Duggan, 47. Brown, Z. A., A. Wald, R. A. Morrow, S. Selke, J. Zeh, and L. Corey. 2003. P. R. Reynolds, R. G. Feldman, and M. H. Sullivan. 2005. Bacteria and in- Effect of serologic status and cesarean delivery on transmission rates of herpes flammatory cells in fetal membranes do not always cause preterm labor. Pediatr. simplex virus from mother to infant. JAMA 289: 203–209. Res. 57: 404–411. 48. Aldo, P., Y. You, K. Szigeti, T. L. Horvath, B. Lindenbach, and G. Mor. 2016. 21. Bakaletz, L. O. 2004. Developing animal models for polymicrobial diseases. HSV-2 enhances ZIKV infection of the placenta and induces apoptosis in first- Nat. Rev. Microbiol. 2: 552–568. trimester trophoblast cells. Am. J. Reprod. Immunol. 76: 348–357. 22. Srinivas, S. K., Y. Ma, M. D. Sammel, D. Chou, C. McGrath, S. Parry, and 49. Finger-Jardim, F., E. C. Avila, V. P. da Hora, C. V. Gonçalves, A. M. B. de M. A. Elovitz. 2006. Placental inflammation and viral infection are implicated in Martinez, and M. A. Soares. 2017. Prevalence of herpes simplex virus types 1 second trimester pregnancy loss. Am. J. Obstet. Gynecol. 195: 797–802. and 2 at maternal and fetal sides of the placenta in asymptomatic pregnant 23. Tsekoura, E. A., A. Konstantinidou, S. Papadopoulou, S. Athanasiou, women. Am. J. Reprod. Immunol. 78: e12689. N. Spanakis, D. Kafetzis, A. Antsaklis, and A. Tsakris. 2010. Adenovirus ge- 50. Wiley, C. A., D. M. Carter, T. M. Ross, and S. J. Bissel. 2012. Absence of fetal nome in the placenta: association with histological chorioamnionitis and preterm transmission of H1N1 despite severe maternal infection. Influenza Other Respi. birth. J. Med. Virol. 82: 1379–1383. Viruses 6: e1. 24. Gibson, C. S., P. N. Goldwater, A. H. MacLennan, E. A. Haan, K. Priest, and 51. Fatemi, S. H., T. D. Folsom, R. J. Rooney, S. Mori, T. E. Kornfield, G. A. Dekker, South Australian Cerebral Palsy Research Group. 2008. Fetal T. J. Reutiman, R. E. Kneeland, S. B. Liesch, K. Hua, J. Hsu, and D. H. Patel. exposure to herpesviruses may be associated with pregnancy-induced hypertensive 2012. The viral theory of schizophrenia revisited: abnormal placental gene ex- disorders and preterm birth in a caucasian population. BJOG 115: 492–500. pression and structural changes with lack of evidence for H1N1 viral presence in 25. Gibson, C. S., A. H. Maclennan, E. A. Haan, K. Priest, and G. A. Dekker. 2011. placentae of infected mice or brains of exposed offspring. Neuropharmacology Fetal MBL2 haplotypes combined with viral exposure are associated with ad- 62: 1290–1298. verse pregnancy outcomes. J. Matern. Fetal Neonatal Med. 24: 847–854. 52. Beigi, R. H. 2014. Prevention and management of influenza in pregnancy. 26. Strong, B. S., and S. A. Young. 1995. Intrauterine coxsackie virus, group B type Obstet. Gynecol. Clin. North Am. 41: 535–546. 1, infection: viral cultivation from amniotic fluid in the third trimester. Am. J. 53. Gonçalves, L. F., T. Chaiworapongsa, and R. Romero. 2002. Intrauterine in- Perinatol. 12: 78–79. fection and prematurity. Ment. Retard. Dev. Disabil. Res. Rev. 8: 3–13. 27. Chen, Y. H., H. C. Lin, and H. C. Lin. 2010. Increased risk of adverse pregnancy 54. Goldenberg, R. L., W. W. Andrews, and J. C. Hauth. 2002. Choriodecidual in- outcomes among women affected by herpangina. Am. J. Obstet. Gynecol. 203: fection and preterm birth. Nutr. Rev. 60: S19–S25. 49.e41–47. 55. Hecht, J. L., A. Onderdonk, M. Delaney, E. N. Allred, H. J. Kliman, 28. Elefsiniotis, I., K. Tsoumakas, E. Vezali, I. Glynou, N. Drakoulis, and E. Zambrano, S. M. Pflueger, C. A. Livasy, I. Bhan, and A. Leviton, ELGAN G. Saroglou. 2010. Spontaneous preterm birth in women with chronic hepatitis B Study Investigators. 2008. Characterization of chorioamnionitis in 2nd-trimester virus infection. Int. J. Gynaecol. Obstet. 110: 241–244. C-section placentas and correlation with microorganism recovery from sub- 29. Huang, Q. T., Q. Huang, M. Zhong, S. S. Wei, W. Luo, F. Li, and Y. H. Yu. 2015. amniotic tissues. Pediatr. Dev. Pathol. 11: 15–22. Chronic hepatitis C virus infection is associated with increased risk of preterm 56. DiGiulio, D. B. 2012. Diversity of microbes in amniotic fluid. Semin. Fetal birth: a meta-analysis of observational studies. J. Viral Hepat. 22: 1033–1042. Neonatal Med. 17: 2–11. 30.Johansson,S.,S.Buchmayer,S.Harlid,A.Iliadou,M.Sjo¨holm, L. Grillner, 57. DiGiulio, D. B., R. Romero, H. P. Amogan, J. P. Kusanovic, E. M. Bik, M. Norman, P. Spareń, J. Dillner, and S. Cnattingius. 2008. Infection with F. Gotsch, C. J. Kim, O. Erez, S. Edwin, and D. A. Relman. 2008. Microbial The Journal of Immunology 11

prevalence, diversity and abundance in amniotic fluid during preterm labor: a 71. Netea, M. G., A. Simon, F. van de Veerdonk, B. J. Kullberg, J. W. Van der Meer, molecular and culture-based investigation. PLoS One 3: e3056. and L. A. Joosten. 2010. IL-1beta processing in host defense: beyond the 58. Lamont, R. F. 2003. Recent evidence associated with the condition of preterm inflammasomes. PLoS Pathog. 6: e1000661. prelabour rupture of the membranes. Curr. Opin. Obstet. Gynecol. 15: 91–99. 72. Johnson, K. E., L. Chikoti, and B. Chandran. 2013. Herpes simplex virus 1 in- 59. Czikk, M. J., F. P. McCarthy, and K. E. Murphy. 2011. Chorioamnionitis: from fection induces activation and subsequent inhibition of the IFI16 and NLRP3 pathogenesis to treatment. Clin. Microbiol. Infect. 17: 1304–1311. inflammasomes. J. Virol. 87: 5005–5018. 60. Flores-Herrera, H., G. Garcıá-Lo´pez, N. F. Dıáz, A. Molina-Hernańdez, 73. Kanneganti, T. D., N. Ozo¨ren, M. Body-Malapel, A. Amer, J. H. Park, M. Osorio-Caballero, D. Soriano-Becerril, and V. Zaga-Clavellina. 2012. An L. Franchi, J. Whitfield, W. Barchet, M. Colonna, P. Vandenabeele, et al. 2006. experimental mixed bacterial infection induced differential secretion of proin- Bacterial RNA and small antiviral compounds activate caspase-1 through cryopyrin/ flammatory cytokines (IL-1b, TNFa) and proMMP-9 in human fetal mem- Nalp3. Nature 440: 233–236. branes. Placenta 33: 271–277. 74. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition 61. Payne, M. S., and S. Bayatibojakhi. 2014. Exploring preterm birth as a poly- of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. microbial disease: an overview of the uterine microbiome. Front. Immunol. 5: 595. Nature 413: 732–738. 62. Kwon, J. Y., R. Romero, and G. Mor. 2014. New insights into the relationship 75. Jennings, R. N., J. M. Grayson, and E. S. Barton. 2014. Type I interferon sig- between viral infection and pregnancy complications. Am. J. Reprod. Immunol. naling enhances CD8+ T cell effector function and differentiation during murine 71: 387–390. gammaherpesvirus 68 infection. J. Virol. 88: 14040–14049. 63. Meijer, W. J., A. G. van Noortwijk, H. W. Bruinse, and A. M. Wensing. 2015. 76. Marques, C. P., S. Hu, W. Sheng, M. C. Cheeran, D. Cox, and J. R. Lokensgard. Influenza virus infection in pregnancy: a review. Acta Obstet. Gynecol. Scand. 2004. Interleukin-10 attenuates production of HSV-induced inflammatory me- 94: 797–819. diators by human microglia. Glia 47: 358–366. 64. Gotsch, F., R. Romero, T. Chaiworapongsa, O. Erez, E. Vaisbuch, J. Espinoza, 77. Daubeuf, S., D. Singh, Y. Tan, H. Liu, H. J. Federoff, W. J. Bowers, and J. P. Kusanovic, P. Mittal, S. Mazaki-Tovi, C. J. Kim, et al. 2008. Evidence of the K. Tolba. 2009. HSV ICP0 recruits USP7 to modulate TLR-mediated innate involvement of caspase-1 under physiologic and pathologic cellular stress during response. Blood 113: 3264–3275. human pregnancy: a link between the inflammasome and parturition. J. Matern. 78. Bhattacharyya, S., A. Zago´rska, E. D. Lew, B. Shrestha, C. V. Rothlin, Fetal Neonatal Med. 21: 605–616. J. Naughton, M. S. Diamond, G. Lemke, and J. A. Young. 2013. Enveloped 65. Gomez-Lopez, N., R. Romero, Y. Xu, O. Plazyo, R. Unkel, N. G. Than, viruses disable innate immune responses in dendritic cells by direct activation of P. Chaemsaithong, T. Chaiworapongsa, Z. Dong, A. L. Tarca, et al. 2016. A role TAM receptors. Cell Host Microbe 14: 136–147. Downloaded from for the inflammasome in spontaneous labor at term with acute histologic cho- 79. Murphy, S. P., L. D. Fast, N. N. Hanna, and S. Sharma. 2005. Uterine NK cells rioamnionitis. Reprod. Sci. 24: 934–953. mediate inflammation-induced fetal demise in IL-10-null mice. J. Immunol. 175: 66. Gomez-Lopez, N., R. Romero, Y. Xu, O. Plazyo, R. Unkel, Y. Leng, N. G. Than, 4084–4090. T. Chaiworapongsa, B. Panaitescu, Z. Dong, et al. 2017. A role for the inflam- 80. Robertson, S. A., R. J. Skinner, and A. S. Care. 2006. Essential role for IL-10 in masome in spontaneous preterm labor with acute histologic chorioamnionitis. resistance to lipopolysaccharide-induced preterm labor in mice. J. Immunol. 177: Reprod. Sci. DOI: 10.1177/1933719116687656. 4888–4896. 67. Weber, F., V. Wagner, S. B. Rasmussen, R. Hartmann, and S. R. Paludan. 2006. 81. Camenisch, T. D., B. H. Koller, H. S. Earp, and G. K. Matsushima. 1999. A

Double-stranded RNA is produced by positive-strand RNA viruses and DNA novel receptor tyrosine kinase, Mer, inhibits TNF-alpha production and http://www.jimmunol.org/ viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. lipopolysaccharide-induced endotoxic shock. J. Immunol. 162: 3498–3503. 80: 5059–5064. 82. Han, J., J. Bae, C. Y. Choi, S. P. Choi, H. S. Kang, E. K. Jo, J. Park, Y. S. Lee, 68. Ilievski, V., and E. Hirsch. 2010. Synergy between viral and bacterial toll-like H. S. Moon, C. G. Park, et al. 2016. Autophagy induced by AXL receptor ty- receptors leads to amplification of inflammatory responses and preterm labor in rosine kinase alleviates acute liver injury via inhibition of NLRP3 inflammasome the mouse. Biol. Reprod. 83: 767–773. activation in mice. Autophagy 12: 2326–2343. 69. Lappas, M. 2014. Caspase-1 activation is increased with human labour in foetal 83. Zaga, V., G. Estrada-Gutierrez, J. Beltran-Montoya, R. Maida-Claros, R. Lopez- membranes and myometrium and mediates infection-induced interleukin-1b Vancell, and F. Vadillo-Ortega. 2004. Secretions of interleukin-1beta and tumor secretion. Am. J. Reprod. Immunol. 71: 189–201. necrosis factor alpha by whole fetal membranes depend on initial interactions of 70. Jin, C., and R. A. Flavell. 2010. Molecular mechanism of NLRP3 inflammasome amnion or choriodecidua with lipopolysaccharides or group B streptococci. Biol. activation. J. Clin. Immunol. 30: 628–631. Reprod. 71: 1296–1302. by guest on September 24, 2021