UMT Research Outlook
January – December 2020
Learning Resource Center (LRC)
University of Management & Technology, Lahore [email protected]
UMT Research Outlook January – December 2020
Table of Contents School of Science (SSC)...... 01 Department of Mathematics...... 01 Research Articles ...... 01 Book/Book Chapters ……………………...... 46 Conference Proceedings ...... 47 Conference Paper ………...... 47 Department of Life Sciences ...... 48 Research Articles ...... 48 Book/Book Chapters ……………………...... 67 Conference Proceedings ...... 68 Department of Chemistry ...... 69 Research Articles ...... 69 Conference Paper ………...... 83 Department of Physics...... 84 Research Articles ...... 84 School of System and Technology (SST) ...... 90 Department of Computer Science ……...... 90 Research Articles ...... 90 Conference Proceedings ...... 118 Department of Software Engineering ...... 120 Research Articles ...... 120 Conference Proceedings...... 121 Department of Informatics and System ...... 123 Research Articles ...... 123 Conference Proceedings...... 128 School of Engineering (SEN)...... 130 Department of Mechanical Engineering...... 130 Research Articles ...... 130 Department of Electrical Engineering ...... 131 Research Articles ...... 131 Conference Proceedings ...... 134 Conference Paper ………...... 136
Department of Industrial Engineering...... 137 Research Articles ...... 137 Department of Civil Engineering ...... 139 Research Articles...... 139 Conference Proceedings ...... 144 School of Business & Economics (SBE) ...... 145 Department of Management...... 145 Research Articles ...... 145 Conference Proceedings ...... 152 Conference Paper ………...... 153 Department of Operations & Supply Chain...... 153 Research Articles ...... 153 Department of Information System ...... 155 Research Articles ...... 155 Department of Marketing ...... 157 Research Articles ...... 157 Conference Proceedings...... 160 Department of Economics ...... 161 Research Articles ...... 161 Book/Book Chapters ……………………...... 175 Conference Paper ………...... 176 Department of Quantitative Methods...... 178 Research Articles ...... 178 Department of Finance ...... 179 Research Articles ...... 179 Book/Book Chapters ……………………...... 183 Department of Banking and Finance ...... 184 Research Articles ...... 184 School of Social Science & Humanities (SSSH) ...... 186 Department of Political Sciences & International Relations ...... 186 Research Articles ...... 186 Conference Paper ………...... 191
Department of Sociology...... 192 Research Articles ...... 192 Department of Special Needs Education...... 194 Research Articles ...... 194 Department of Education...... 195 Research Articles ...... 195 Department of Gender Studies...... 211 Research Articles ...... 211 Conference Paper ………...... 213 Department of Islamic Thought & Civilization...... 213 Research Articles ...... 213 School Of Health Science (SHS)...... 216 Department of Health Science...... 216 Research Articles ...... 216 Book/Book Chapters ……………………...... 219 School of Food and Agricultural Science (SFAS)...... 219 Department of Food and Agricultural Science ...... 219 Research Articles ...... 219 Book/Book Chapters ……………………...... 233 School of Textile Design (STD)...... 233 Department of Textile Design ...... 233 Research Articles ...... 233 Institute of Liberal Arts (ILA) ……………………...... 236 Department of Linguistics and Communications ………...... 236 Research Articles …...... 236 Conference Paper ….……………………...... 244 Department of English and Literary Studies ...... 247 Research Articles ...... 247 School of Professional Psychology (SPP)...... 249 Department of Clinical Psychology...... 249 Research Articles ...... 249 Conference Paper...... 256 Department of Applied Psychology...... 257
Research Articles ...... 257 Conference Paper ………...... 259 School of Professional Advancement (SPA) ...... 260 Department of Professional Advancement...... 260 Research Articles ...... 260 Conference Proceedings...... 264 Conference Paper...... 265 Book/Book Chapters ……………………...... 266 School of Commerce and Accountancy (SCA) ...... 266 School of Commerce and Accountancy ……...... 266 Research Articles ...... 266 Conference Paper...... 268 School of Law and Policy (SLP) ……………………...... 269 School of Law and Policy ……………………...... 269 Research Articles ...... 269 School of Media and Communication Studies (SMCS)...... 269 School of Media and Communication Studies...... 269 Research Articles ...... 269 School of Governance and Society (SGS)...... 279 School of Governance and Society ………………...... 279 Research Articles ...... 279 School of Architecture and Planning (SAP) ………………...... 279 Department of Architecture…………………………...... 279 Research Articles ...... 279 Department of City and Regional Planning ………...... 283 Research Articles ...... 283 Institute of Aviation Studies ...... 284 Department of Aviation Studies ...... 284 Research Articles ...... 284 Conference Proceedings...... 285 Center for Teaching and Learning (CTL) …..………………...... 285 Research Articles ...... 285 Office of Research Innovation and Commercialization (ORIC) …..………………...... 287
Research Articles ...... 287 Conference Proceedings...... 291 Conference Paper…………...... 291 Institute of Islamic Perspective and Guidance (IIPG) …………….…..………………...... 292 Research Articles ...... 292 Research Grand …………...... 292 Table I ………………………………………………………………………………………….…………………………..….……...………. 293
School of Science (SSC) Department of Mathematics Research Articles 1. Javaid, M., Imran, M., Imran, M. A., Khan, I., & Nisar, K. S. (2020). Natural convection flow of a second grade fluid in an infinite vertical cylinder. Scientific Reports, 10(1), 8327. doi: 10.1038/s41598‐020‐64533‐z. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In current study natural convection flow of second grade fluid in an oscillating infinite vertical cylinder is investigated. The dimensionless governing equations for temperature and velocity are obtained by introducing the non‐dimensional variables. Exact solutions for temperature and velocity field are computed by means of integral transformation. Solutions for cosine and sine oscillations of velocity field are introduced in the form of transient and post‐transient arrangements. A special case for Newtonian fluid is obtained from general results and transients solutions are computed in terms of tables. In the end, the impact of dimensionless numbers (Grashof and Prandtl numbers) at different values of time is presented in graphical form and found that velocity for Newtonian fluid has greater values than the second grade fluid. Furthermore, there are some comparisons of calculated solutions with existing solutions in literature. Keywords: not available.
2. Kashuri, A., Iqbal, S., Liko, R., Gao, W., & Samraiz, M. (2020). Integral inequalities for s‐convex functions via generalized conformable fractional integral operators. Advances in Difference Equations, 2020(1), 217. doi: 10.1186/s13662‐020‐02671‐4. (Sajid Iqbal (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: We introduce new operators, the so‐called left and right generalized conformable fractional integral operators. By using these operators we establish new Hermite–Hadamard inequalities for s‐convex functions and products of two s‐convex functions in the second sense. Also, we obtain two interesting identities for a differentiable function involving a generalized conformable fractional integral operator. By applying these identities we give Hermite–Hadamard and midpoint‐type integral inequalities for s‐convex functions. Different special cases have been identified and some known results are recovered from our general results. These results may motivate further research in different areas of pure and applied sciences. Keywords: hermite–hadamard inequality, hölder inequality, power mean inequality, convexity, conformable fractional integral, general fractional integral operators.
3. Ahmed, N., Rafiq, M., Baleanu, D., Alshomrani, A. S., & Aziz‐ur‐Rehman, M. (2020). Positive explicit and implicit computational techniques for reaction–diffusion epidemic model of dengue disease dynamics. Advances in Difference Equations, 2020(1), 202. doi: 10.1186/s13662‐020‐02622‐z.(Nauman Ahmed, Muhammad Aziz‐ur‐Rehman (Mathematics/SSC) Abstract: The aim of this work is to develop a novel explicit unconditionally positivity preserving finite difference (FD) scheme and an implicit positive FD scheme for the numerical solution of dengue epidemic reaction–diffusion model with incubation period of virus. The proposed schemes are unconditionally stable and preserve all the essential properties of the solution of the dengue reaction diffusion model. This proposed FD schemes are unconditionally dynamically consistent with positivity property and converge to the true equilibrium points of dengue epidemic reaction diffusion system. Comparison of the proposed scheme with the well‐known existing techniques is also presented. The time efficiency of both the proposed schemes is also compared, with the two widely used techniques. Keywords: structure preserving methods, finite difference schemes, dengue model, diffusion epidemic system,
Research Outlook 2020 | 1
numerical simulations.
4. Ahmed, N., Korkmaz, A., Rafiq, M., Baleanu, D., Alshomrani, A. S., Rehman, M. A., & Iqbal, M. S. (2020). A novel time efficient structure‐preserving splitting method for the solution of two‐dimensional reaction‐ diffusion systems. Advances in Difference Equations, 2020(1), 197. doi: 10.1186/s13662‐020‐02659‐0. (Nauman Ahmed, M. A. Rehman (Mathematics/SSC) Abstract: In this article, the first part is concerned with the important questions related to the existence and uniqueness of solutions for nonlinear reaction‐diffusion systems. Secondly, an efficient positivity‐preserving operator splitting nonstandard finite difference scheme (NSFD) is designed for such a class of systems. The presented formulation is unconditionally stable as well as implicit in nature and even time efficient. The proposed NSFD operator splitting technique also preserves all the important properties possessed by continuous systems like positivity, convergence to the fixed points of the system, and boundedness. The proposed algorithm is implicit in nature but more efficient in time than the extensively used Euler method. Keywords: operator splitting finite difference scheme, reaction‐diffusion models, positivity, numerical simulations.
5. Malik, A., Ahmed, S., & Mahmood, S. (2020). Some bianchi type cosmological models in f(R, ϕ) gravity. New Astronomy, 81, 101418. doi: https://doi.org/10.1016/j.newast.2020.101418. (Adnan Malik, Shahzad Ahmed, Saqib Mahmood (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: In this paper, we study three different Bianchi type line elements, like Bianchi type‐I (BT‐I), Bianchi type‐III (BT‐III) and Kantowski Sachs space‐time in the framework of f(R, ϕ) theory of gravity, where R and ϕ represent the Ricci scalar and the scalar potential function respectively. We find the exact solution of vacuum field equations of f(R, ϕ) theory by taking valuable assumption that the expansion scalar θ is proportional to the shear scalar σ that is P=Qn. We also see some physical parameters like Hubble parameter H, volume scale factor V, average scale factor a, the expansion scalar θ and shear scalar σ for each metric. Finally, we analyze that the exact solution satisfied the present cosmic condition of universe and singularity (Big‐Bang) is also justified through our evaluated solutions. Keywords: gravitation, anisotropic universe, dark energy.
6. Malik, A., Ahmad, S., & Ahmad, S. (2020). Energy bounds in f(R, ϕ) gravity with anisotropic backgrounds. New Astronomy, 79, 101392. doi: https://doi.org/10.1016/j.newast.2020.101392. (Adnan Malik, Shahzad Ahmad, Sagheer Ahmad (Mathematics/Knowledge Unit of Science ) (SKT Campus) Abstract: This research work discusses the energy bounds in f(R, ϕ) with anisotropic background. For this purpose, a BT‐I cosmological model in f(R, ϕ) is considered. After calculating field equations, we find the exact solutions by considering field equations of the f(R, ϕ) gravity model. To investigate the cosmic expansion, we explore the model f(R, ϕ) for f(R,ϕ)=R(1+α2R2ϕ2) and f(R,ϕ)=ϕ(R+αR2). We formulate the inequalities in energy constraints and use the Hubble, deceleration, jerk and snap parameters to evaluate the feasibility of the models given above. Graphical analysis shows that the NEC, WEC and DEC are satisfied with the appropriate anisotropy values and model parameters for the given above two f(R, ϕ) gravity models. In fact, for both of considered models, SEC is violated and models are found favorable for cosmic expansion. Keywords: gravitation, anisotropic systems, energy conditions.
7. Ahmed, N., Ali, M., Rafiq, M., Khan, I., Nisar, K. S., Rehman, M. A., & Ahmad, M. O. (2020). A numerical efficient splitting method for the solution of two dimensional susceptible infected recovered epidemic model of whooping cough dynamics: Applications in bio‐medical engineering. Computer Methods and Programs in Biomedicine, 190, 105350. doi: https://doi.org/10.1016/j.cmpb.2020.105350. (Nauman Research Outlook 2020 | 2
Ahmed, M. A. Rehman (Mathematics/SSC) Abstract: Background and Objective The positivity property of the non‐linear dynamical systems is one of the essential features in different fields of bio‐medical engineering, science and many more. The state variables, involving in the models, describing the natural phenomenon such as concentration, density and population size etc. must be positive. Therefore, the computing techniques used to solve the system of non‐linear differential equations must be consisted with the continuous nature of the models. But, unfortunately there are some existing techniques in the literature that do not preserve the positivity property, especially for the multi‐space dimensional models. So there is a gap in the literature that should be filled up, by constructing the positivity preserving numerical algorithms. In this study, we consider a susceptible‐infected‐recovered (SIR) reaction diffusion epidemic model in two space dimensions from biomedical engineering and solved numerically to observe the behavior of the model. Since the state variables involved in this system are population densities therefore we design a novel computational method which is time efficient because of its splitting structure and holds the positivity as well as other important structure of epidemic system. Methods Three different computational techniques are designed to examine the numerical solution of SIR model of infectious disease. Two approaches are well‐known existing computing methods named as forward Euler finite difference (FD) method and backward Euler operator splitting finite difference (OS‐FD) method. The third approach is operator splitting nonstandard finite difference (OS‐NSFD) method which is devised by using the NSFD rules. Results The proposed OS‐NSFD technique retains efficiently the stability of equilibria as well as the positivity. Graphical behavior depicts that the existing computing methods can not get success to preserve the structure of the epidemic system of whooping cough dynamics. At the same time OS‐NSFD computing method is proven to be reliable and suitable for the system of bio‐medical engineering mathematically and graphically. Conclusion A reliable and novel computing technique is developed for the solution of two dimensional reaction diffusion problem. This technique preserves all the imperative characteristics of the model under study. Also the time efficiency of this method makes it easy to find the solution of physical system in two space dimension. The comparison with other techniques shows the efficacy and reliability of the designed technique. Keywords: operator splitting finite difference scheme, reaction diffusion models, positivity, numerical simulations.
8. Prasad, R., Ali, M., Xiang, Y., & Khan, H. (2020). A double decomposition‐based modelling approach to forecast weekly solar radiation. Renewable Energy, 152, 9‐22. doi: https://doi.org/10.1016/j.renene.2020.01.005. (Huma Khan (Mathematics/SSC) Abstract: To meet the future energy demand and avert any looming crises, efforts are being carried out to utilize sustainable and renewable energy resources. In this paper, the naturally occurring non‐linearity and non‐ stationarity deficiencies within the climatological predictors to forecast solar radiation (Rdn) are resolved via a multivariate empirical mode decomposition method (MEMD). First, a set of antecedent weekly lags at timescale (t‐1) of input datasets were collated and then were divided into training and testing subsets. The MEMD method is restricted to dissolve the training and testing climatic data independently into intrinsic modes functions (IMFs). As the numbers of total IMFs were very large, the singular value decomposition (SVD) algorithm is accustomed for dimensionality reduction simultaneously capturing the most relevant oscillatory features embedded within the IMFs. Finally, the random forest (RF) model is applied to forecast Rdn at selected solar‐rich regions in Australia. The resulting hybrid MEMD‐SVD‐RF model was established as a consequence of the aforementioned modelling strategy. The results are benchmarked with other comparative models. The hybrid MEMD‐SVD‐RF model generates better and reliable forecasts having significant implications for renewable and sustainable energy applications and resources management. Keywords: solar radiation, multivariate ensemble mode decomposition, MEMDSVD, random forest, energy. 9. Abbas, M., Lael, F., & Saleem, N. (2020). Fuzzy b‐Metric Spaces: Fixed Point Results for ψ‐Contraction Correspondences and Their Application. Axioms, 9(2), 36. (Naeem Saleem (Mathematics/SSC) Research Outlook 2020 | 3
Abstract: In this paper we introduce the concepts of ψ ‐contraction and monotone ψ ‐contraction correspondence in “fuzzy b ‐metric spaces” and obtain fixed point results for these contractive mappings. The obtained results generalize some existing ones in fuzzy metric spaces and “fuzzy b ‐metric spaces”. Further we address an open problem in b ‐metric and “fuzzy b ‐metric spaces”. To elaborate the results obtained herein we provide an example that shows the usability of the obtained results. Keywords: fixed point, correspondence, fuzzy b‐metric space, b‐metric space.
10. Na, W., Shah, N. A., Tlili, I., & Siddique, I. (2020). Maxwell fluid flow between vertical plates with damped shear and thermal flux: Free convection. Chinese Journal of Physics, 65, 367‐376. doi: https://doi.org/10.1016/j.cjph.2020.03.005. (Imran Siddique (Mathematics/SSC) Abstract: In this article, we studied free convection flow of Maxwell fluid between two parallel plates a distance d apart from each other. The Caputo time‐fractional derivative is used in model and the model is fractionalized through mechanical laws (generalized shear stress constitutive equation and generalized Fourier's law). Closed form solutions are found by means of Laplace and sine‐Fourier transforms which are suitable for our boundary conditions. The solutions are expressed in the form of Mittag–Leffler function and generalized G–function of Lorenzo and Hartley. The viscous fractional and ordinary Maxwell and fractional model are presented as special cases. The effects of fractional and physical parameters are graphically illustrated. Keywords: free convection, maxwell fluid, damped shear and thermal flux, caputo time‐fractional derivative.
11. Ullah, N., Rehman, H. U., Imran, M. A., & Abdeljawad, T. (2020). Highly dispersive optical solitons with cubic law and cubic‐quintic‐septic law nonlinearities. Results in Physics, 17, 103021. doi: https://doi.org/10.1016/j.rinp.2020.103021. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this paper, the Kudryashov’s method and generalized tanh method (GTM) are employed to retrieve the new distinct optical solitons for highly dispersive NLSE. These two schemes effectively acquire the exact solution of the model in the form of dark, singular, singular periodic and bright‐singular combo optical solitons. These solutions assist the mathematicians and physicians to realize the physical phenomena of present model. The solutions in presents work indicate that these schemes offer us an influential mathematical tools for solving NLSEs in various areas of applied sciences. In addition, the graphical illustrations of some solutions are also illustrated. Keywords: Kudryashov’s method, generalized tanh method, cubic‐quintic‐septic law, cubic law, highly dispersive solitons.
12. Ahmed, N., Rafiq, M., Baleanu, D., Aziz‐ur‐Rehman, M., I., Ali, M., & Nisar, K. S. (2020). Structure preserving algorithms for mathematical model of auto‐catalytic glycolysis chemical reaction and numerical simulations. The European Physical Journal Plus, 135(6), 522. doi: 10.1140/epjp/s13360‐020‐00539‐w. (Nauman Ahmed, Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: This paper aims to develop positivity preserving splitting techniques for glycolysis reaction–diffusion chemical model. The positivity of state variables in the glycolysis model is an essential property that must be preserved for all choices of parameters. We propose two splitting methods that remain dynamically consistent with the continuous glycolysis reaction– diffusion model. The proposed methods converge to a true steady‐state or fixed point under the given condition. On contrary to the classical operator splitting finite difference methods, we use nonstandard finite difference theory to propose a new class of operator splitting techniques. Keywords: not available.
13. Imran, M. A. (2020). Application of fractal fractional derivative of power law kernel (FFP0Dxα,β) to MHD viscous fluid flow between two plates. Chaos, Solitons & Fractals, 134, 109691. doi: Research Outlook 2020 | 4
https://doi.org/10.1016/j.chaos.2020.109691. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this problem, I have studied the application of newly introduced fractal fractional operators with power law kernel in fluid dynamics. We Considered the MHD viscous fluid flow between two plates such that the upper plate is in motion with constant velocity while the lower plate is at rest. The governing equation developed from the problem can be formulated withe fractal fractional derivative operator with power law kernel. The proposed fractal fractional model can be solved by means of Laplace transform technique and obtained exact solutions. To see the impact of magnetic field M, fractional α as well as fractal parameter β on the fluid velocity field, we plotted some graphs through MathCad software and presented in the graphical section. As a result, we found that for larger values of α and β, a decay in velocity of the fluid was observed. Further, fractal fractional model more slow down the velocity of the model in comparison of fractional only. Therefore, a combined approach of fractal fractional explains the memory of the function better than fractional only. Keywords: fractal fractional derivative, viscous fluid, power law kernel, couette flow.
14. Tabassum, M. F., Saeed, M., Akgül, A., Farman, M., & Chaudhry, N. A. (2020). Treatment of HIV/AIDS epidemic model with vertical transmission by using evolutionary Padé‐approximation. Chaos, Solitons & Fractals, 134, 109686. doi: https://doi.org/10.1016/j.chaos.2020.109686.(Muhammad Farhan Tabassum, Muhammad Saeed (Mathematics/SSC) Abstract: Human Immunodeficiency Virus (HIV) infection has become a significant infectious disease for both developed and developing countries that can contribute to the acquired immunodeficiency syndrome (AIDS). In this study a nonlinear mathematical model for the transmission of HIV/AIDS has been proposed and discussed in a populace of changing size with transfer of infection. The theorems and propositions have been constructed for well‐posed‐ness and bounded‐ness of the model respectively. Evolutionary Padé‐approximation (EPA) technique has been used for the treatment of this nonlinear mathematical model. Initial conditions are converted into constraints and constraints’ problem is transformed into unconstrained by using penalty function. In the suggested EPA method, no step lengths have to be chosen, also converges to a steady state point is proved. The model for the transmission of HIV/AIDS also solved by using non‐standard finite difference (NSFD) scheme and results were compared, simulations justify our outcomes more efficient and compact. Finally, a convergence and error analysis evidence that the convergence speed of EPA is superior that of the NSFD. Keywords: HIV/AIDS transmission model, padé‐approximation, differential evolution, non‐standard finite difference, stability analysissensitivity analysis.
15. Iqbal, Z., Ahmed, N., Baleanu, D., Rafiq, M., Iqbal, M. S., & Aziz‐ur‐Rehman, M.,(2020). Structure preserving computational technique for fractional order Schnakenberg model. Computational and Applied Mathematics, 39(2), 61. doi: 10.1007/s40314‐020‐1068‐1.(Zafar Iqbal, Nauman Ahmed, Muhammad Aziz‐ ur Rehman (Mathematics/SSC) Abstract: The current article deals with the analysis and numerical solution of fractional order Schnakenberg (S‐ B) model. This model is a system of autocatalytic reactions by nature, which arises in many biological systems. This study is aiming at investigating the behavior of natural phenomena with a more realistic and practical approach. The solutions are obtained by applying the Grunwald–Letnikov (G–L) finite difference (FD) and the proposed G–L nonstandard finite difference (NSFD) computational schemes. The proposed formulation is explicit in nature, strongly structure preserving as well as it is independent of the time step size. One very important feature of our proposed scheme is that it preserves the positivity of the solution of continuous fractional order S‐B model because the unknown variables involved in this system describe the chemical concentrations of different substances. The comparison of the proposed scheme with G–L FD method reflects the significance of the said method. Research Outlook 2020 | 5
Keywords: fractional order differential equations, schnakenberg model, grunwald–letnikov approach, structure preserving method.
16. Iqbal, Z., Ahmed, N., Baleanu, D., Adel, W., Rafiq, M., Aziz‐ur Rehman, M., & Alshomrani, A. S. (2020). Positivity and boundedness preserving numerical algorithm for the solution of fractional nonlinear epidemic model of HIV/AIDS transmission. Chaos, Solitons & Fractals, 134, 109706. doi: https://doi.org/10.1016/j.chaos.2020.109706.(Zafar Iqbal, Nauman Ahmed, Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: In this article, an integer order nonlinear HIV/AIDS infection model is extended to the non‐integer nonlinear model. The Grunwald Letnikov nonstandard finite difference scheme is designed to obtain the numerical solutions. Structure preservence is one of the main advantages of this scheme. Reproductive
number R0 is worked out and its key role in disease dynamics and stability of the system is investigated with the
following facts, if R0 < 1 the disease will be diminished and it will persist in the community for R0 > 1. On the other
hand, it is sought out that system is stable when R0 < 1 and R0 > 1 implicates that system is locally asymptotically stable. Positivity and boundedness of the scheme is also proved for the generalized system. Two steady states of the system are computed and verified by computer simulations with the help of some suitable test problem. Keywords: HIV/AIDS disease transmission, Structure preserving algorithm, Fractional order epidemic model, Simulations.
17. Manzoor, R., Adeel, M., & Saeed, M. (2020). Dynamics of collapsing stellar filament and exotic matter. International Journal of Modern Physics D, 29(5), 2050036. doi: 10.1142/s0218271820500364.(Rubab Manzoor, M. Adeel, Muhammad Saeed (Mathematics/SSC) Abstract: This paper studies the collapse of stellar filaments in the presence of dark matter (DM). We use f(R) gravity to involve DM in the collapse. We apply Darmois junction conditions (DJCs) on the surface of collapsing boundary Σ and obtain the collapse equation. The radial pressure associated with the seen matter is found to be nonzero at Σ. We then use Starobinsky model, f(R) = R + αR2, as a candidate of DM to obtain stability criteria (SC) of the collapsing body. It is found that the stability of filamentary structure relates radial pressure of baryonic directly with the gravitational effects of DM. Stability of polytropic family of filaments are studied by applying polytropic equation of state to baryonic contribution. For all polytropic stable filaments, it turns out that the visible matter density is exponentially linked to effects of DM. Finally, we discuss connection between exotic terms and gravitational waves (GW). It is theoretically indicated that the presence of DM can affect the GW propagation. Keywords: f(R) theory, dark matter, galactic filament, gravitational collapse, gravitational waves.
18. Idrees, B., Zafar, S., Rashid, T., & Gao, W. (2020). Image encryption algorithm using S‐box and dynamic Hénon bit level permutation. Multimedia Tools and Applications, 79(9), 6135‐6162. doi: 10.1007/s11042‐ 019‐08282‐w.(Bazgha Idrees, Sohail Zafar, Tabasam Rashid (Mathematics/SSC) Abstract: For the secure transmission of data through the medium of internet, images have significant importance. Image encryption provides secure transmission of images by converting recognizable form of image into an unrecognizable form. Chaos is considered as a natural required ingredient for cryptography applications, by providing unpredictability, sensitivity of initial state and erogodicity. Therefore from the last decade, a number of chaos‐based cryptosystems have been developed for the protection of transmitted images’ content. In this paper, a chaos based algorithm is developed and experimented on six different standard empirical images. The proposed cryptosystem is based on substitution‐permutation network (SPN) with cipher block chaining (CBC) mode of operation. A novel algorithm is proposed for the construction of substitution box by using chaotic sine map, which is applied on a block‐input of bytes, followed by a permutation based on discretized Hénon map, Research Outlook 2020 | 6
which is applied on a block‐input of bits instead of bytes. The hyper chaotic Lü system, which is nonlinear and produces discrete values with long orbits, is used as pseudorandom generator to set new values to control parameters of discretized Hénon map for bit‐permutation for each block. Moreover, proposed bit‐permutation is applied by a matrix formulation which accelerates the bit permutation process for a block‐input. Security analysis and results obtained from simulations show that cryptosystem is good resistant to various well‐known attacks and have good key space therefore is reliable for secure transmission of images. Keywords: image encryption . s‐box . bit‐permutation . hénon map.
19. Riaz, M. B., & Iftikhar, N. (2020). A comparative study of heat transfer analysis of MHD Maxwell fluid in view of local and nonlocal differential operators. Chaos, Solitons & Fractals, 132, 109556. doi: https://doi.org/10.1016/j.chaos.2019.109556. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this paper, a comparative analysis is carried out to study the unsteady flow of a MHD Maxwell fluid in the presence of Newtonian heating near a vertical plate. Maxwell fluid is modeled for integer order derivative, Caputo (C), Caputo‐Fabrizio (CF) and Atangana‐Baleanu (ABC) fractional‐time derivatives. The Laplace transform, inversion algorithm and the convolution theorem are used in this paper to derive solutions to predict the behavior of temperature and velocity. To see the effectiveness of the differential operator, especially the effect of each fractional order, graphical study is carried out in order to show effect of magnetic effect (M) and Maxwell fluid parameter (λ) on temperature and velocity profiles for C, CF and ABC. A comparison is made for C, CF and ABC models for temperature and velocity in tabular form. Keywords: fractional‐time derivatives, inversion algorithm, laplace transform, local and nonlocal kernels, maxwell fluid, magnetic effect, newtonian heating.
20. Bashir, Z., Malik, M. G. A., Afridi, F., & Rashid, T. (2020). The algebraic and lattice structures of type‐2 intuitionistic fuzzy sets. Computational and Applied Mathematics, 39(1), 26. doi: 10.1007/s40314‐019‐ 1008‐0. (Tabasam Rashid (Mathematics/SSC) Abstract: Type‐2 intuitionistic fuzzy sets are proposed as functions from non empty set U to TTTT where T={(μ,ν):μ+ν≤1,μ≥0,ν≥0}T={(μ,ν):μ+ν≤1,μ≥0,ν≥0} and TTTT is the set of all mappings from TT to TT. The members of TTTT are called intuitionistic fuzzy values (IFV). In this paper, we develop a mathematical framework for IFVs by defining a set of generalized operations on TTTT and proved it to be an algebra. The other important properties like convexity, normality of IFVs and many important subalgebras are also explored and studied. Furthermore, two partial orders based on generalized operations are defined, which enable us to study the lattices in TTTT. Keywords: type‐2 fuzzy sets, type‐2 intuitionistic fuzzy sets, intuitionistic fuzzy values, algebra.
21. Ahmed, N., Ali, M., Baleanu, D., Rafiq, M., & Aziz‐ur Rehman, M., (2020). Numerical analysis of diffusive susceptible‐infected‐recovered epidemic model in three space dimension. Chaos, Solitons & Fractals, 132, 109535. doi: https://doi.org/10.1016/j.chaos.2019.109535. (Nauman Ahmed, Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: In this article, numerical solution of three dimensional susceptible‐infected‐recovered (SIR) reaction‐ diffusion epidemic system is furnished with a time efficient operator splitting nonstandard finite difference (OS‐ NSFD) method. We perform the comparison of proposed OS‐NSFD method with popular forward Euler explicit finite difference (FD) method and time efficient backward Euler operator splitting finite difference (OS‐FD) implicit method. The proposed OS‐NSFD method is implicit in nature but computationally efficient as compared to forward Euler explicit (FD) scheme. The numerical stability and bifurcation value of transmission coefficient for SIR reaction‐diffusion epidemic system is also investigated with the aid of Routh–Hurwitz method. At the end, we give two numerical experiments and simulation. In first experiment, all the numerical schemes are compared
Research Outlook 2020 | 7
with the help of simulations. In second experiment we show the simulations of proposed NSFD technique at different values of parameters. Also we discuss the importance of transmission rate to control the spread of disease with the help of simulations. Keywords: operator splitting methods, nonstandard finite difference schemes, positivity, sir epidemic model, numerical stability, bifurcation value.
22. Karapınar, E., Abbas, M., & Farooq, S. (2020). A Discussion on the Existence of Best Proximity Points That Belong to the Zero Set. Axioms, 9(1), 19. doi: https://doi.org/10.3390/axioms9010019. (Sadia Farooq (Mathematics/SSC) Abstract: In this paper, we investigate the existence of best proximity points that belong to the zero set for the αp ‐admissible weak (F,φ) ‐proximal contraction in the setting of M‐metric spaces. For this purpose, we establish φ ‐best proximity point results for such mappings in the setting of a complete M‐metric space. Some examples are also presented to support the concepts and results proved herein. Our results extend, improve and generalize several comparable results on the topic in the related literature. Keywords: m‐metric space, proximal αp‐admissible, αp‐admissible weak (F,φ)‐proximal contraction, G‐proximal graphic contraction, φ‐best proximity point.
23. Mardan, S. A., Rehman, M., Noureen, I., & Jamil, R. N. (2020). Impact of generalized polytropic equation of state on charged anisotropic polytropes. The European Physical Journal C, 80(2), 119. doi: 10.1140/epjc/s10052‐020‐7647‐x. (Syed Ali Mardan, Mudasar Rehman, Ifra Noureen, Raja Noshad Jamil (Mathematics/SSC) Abstract: In this paper, generalized polytropic equation of state is used to get new classes of polytropic models from the solution of Einstein‐Maxwell field equations for charged anisotropic fluid configuration. The models are developed for different values of polytropic index n=1, 12, 2n=1, 12, 2. Masses and radii of eight different stars have been regained with the help of developed models. The speed of sound technique and graphical analysis of model parameters is used for the viability of developed models. The analysis of models indicates they are well behaved and physically viable. Keywords: not available.
24. Ali, A., Milovanović, E., Matejić, M., & Milovanović, I. (2020). On the Upper Bounds for the Degree Deviation of Graphs. Journal of Applied Mathematics and Computing, 62(1), 179‐187. doi: 10.1007/s12190‐019‐01279‐6. (Akbar Ali (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: Let G be a simple connected non‐trivial graph of order n, size m, and vertex degree sequence (d1,d2,…,dnd1,d2,…,dn). The first Zagreb index M1M1, forgotten index F and inverse degree ID are the graph invariants defined as M1(G)=∑ni=1d2iM1(G)=∑i=1ndi2, F(G)=∑ni=1d3iF(G)=∑i=1ndi3 and ID(G)=∑ni=11diID(G)=∑i=1n1di, respectively. A graph is said to be regular if all of its vertices have the same degree and otherwise, it is called a nonregular graph. For the quantitative topological characterization of the nonregularity of graphs, the graph invariants s(G)=∑ni=1∣∣di−2mn∣∣s(G)=∑i=1n|di−2mn| and Var(G)=1n∑ni=1(di−2mn)2Var(G)=1n∑i=1n(di−2mn)2 may be used. In this paper, some upper bounds for s(G) that reveal connections between s(G) and M1(G)M1(G), F(G), ID(G), Var(G) are obtained. Keywords: irregularity of graph, degree deviation, first zagreb index, forgotten topological index, inverse degree.
25. Ahmed, N., Fatima, M., Baleanu, D., Nisar, K. S., Khan, I., Aziz‐ur Rehman, M., . . . Ahmad, M. O. (2020). Numerical Analysis of the Susceptible Exposed Infected Quarantined and Vaccinated (SEIQV) Reaction‐ Diffusion Epidemic Model. Frontiers in Physics, 7(220). doi: 10.3389/fphy.2019.00220.(Nauman Ahmed,
Research Outlook 2020 | 8
Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: In this paper, two structure‐preserving nonstandard finite difference (NSFD) operator splitting schemes are designed for the solution of reaction diffusion epidemic models. The proposed schemes preserve all the essential properties possessed by the continuous systems. These schemes are applied on a diffusive SEIQV epidemic model with a saturated incidence rate to validate the results. Furthermore, the stability of the continuous system is proved, and the bifurcation value is evaluated. A comparison is also made with the existing operator splitting numerical scheme. Simulations are also performed for numerical experiments. Keywords: splitting methods, NSFD schemes, positivity, epidemic model, stability, bifurcation value.
26. Jawaz, M., Ahmed, N., Baleanu, D., Rafiq, M., & Aziz‐ur Rehman, M., (2020). Positivity Preserving Technique for the Solution of HIV/AIDS Reaction Diffusion Model With Time Delay. Frontiers in Physics, 7(229). doi: 10.3389/fphy.2019.00229. (Muhammad Jawaz, Nauman Ahmed, Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: This study is concerned with finding a numerical solution to the delay epidemic model with diffusion. This is not a simple task as variables involved in the model exhibit some important physical features. We have therefore designed an efficient numerical scheme that preserves the properties acquired by the given system. We also further develop Euler's technique for a delayed epidemic reaction–diffusion model. The proposed numerical technique is also compared with the forward Euler technique, and we observe that the forward Euler technique demonstrates the false behavior at certain step sizes. On the other hand, the proposed technique preserves the true behavior of the continuous system at all step sizes. Furthermore, the effect of the delay factor is discussed graphically by using the proposed technique. Keywords: epidemic model with diffusion, time delay, HIV/AIDS (acquired immunodeficiency syndrome), positivity, finite difference method, simulations.
27. Ali, U., Javaid, M., & Kashif, A. (2020). Modified Zagreb connection indices of the T‐sum graphs. Main Group Metal Chemistry, 43(1), 43‐55. doi: DOI: https://doi.org/10.1515/mgmc‐2020‐0005. (Usman Ali, Muhammad Javaid, Agha Kashif (Mathematics/SSC) Abstract: The quantitative structures activity relationships (QSAR) and quantitative structures property relationships (QSPR) between the chemical compounds are studied with the help of topological indices (TI’s) which are the fixed real numbers directly linked with the molecular graphs. defined the first degree based TI to measure the total π‐electrone energy of a molecular graph. Recently, restudied the connection based TI’s such as first Zagreb connection index, second Zagreb connection index and modified first Zagreb connection index to find entropy and accentric factor of the octane isomers. In this paper, we study the modified second Zagreb connection index and modified third Zagreb connection index on the T‐sum (molecular) graphs obtained by the operations of subdivision and product on two graphs. At the end, as the applications of the obtained results for the modified Zagreb connection indices of the T‐sum graphs of the particular classes of alkanes are also included. Mainly, a comparision among the Zagreb indices, Zagreb connection indices and modified Zagreb connection indices of the T‐sum graphs of the particular classes of alkanes is performed with the help of numerical tables, 3D plots and line graphs using the statistical tools. Keywords: modified Zagreb indices, connection number, T‐sum graphs. 28. Siddique, I., & Bukhari, S. M. (2020). Analysis of the effect of generalized fractional Fourier’s and Fick’s laws on convective flows of non‐Newtonian fluid subject to Newtonian heating. The European Physical Journal Plus, 135(1), 45. doi: 10.1140/epjp/s13360‐019‐00013‐2. (Imran Siddique, Syeda Mahwish Bukhari (Mathematics/SSC) Abstract: The aim of this report is to study an unsteady mixed convection flow of an incompressible differential type fluid occurrence of chemical reaction that is first order, heat source and radiative heat source with fractional Research Outlook 2020 | 9
mass diffusion and thermal transports over an infinite vertical plate. The fractional derivative Caputo–Fabrizio which is defined recently with non‐singular kernel is used in constitutive laws for the mass and thermal flux, respectively. Semi analytical solutions of the dimensionless concentration, temperature, and velocity fields in addition the rates of heat and mass transfer from the plate to the fluid are established by virtue of the Laplace inversion numerical algorithms Stehfest’s and Tzou’s. Some solutions for ordinary case and obvious results from articles are retrieved as limiting cases. Finally, an impact of flow and fractionalize parameters α and β on concentration, temperature and velocity profiles is tabularly and graphically underlined and discussed . We present a valuation between second grade (fractional and ordinary) and viscous (fractional and ordinary) fluids is also interpreted. It is identified that the ordinary fluid has high velocity as comparable to fractional fluids. Keywords: not available.
29. Mardan, S. A., Siddiqui, A. A., Noureen, I., & Jamil, R. N. (2020). New models of charged anisotropic polytropes with radiation density. The European Physical Journal Plus, 135(1), 3. doi: 10.1140/epjp/s13360‐ 019‐00077‐0. (Syed Ali Mardan, Ahsan Ali Siddiqui, Ifra Noureen, Raja Noshad Jamil (Mathematics/SSC) Abstract: In this manuscript, new classes of polytropic models have been developed by using polytropic equation of state (PEoS) for spherically symmetric gravitating sources in isotropic coordinates. The inner fluid configuration is charged anisotropic and models are developed for different values of polytropic index n=1, 12, 2, 23n=1, 12, 2, 23. Mass and radii of eight stars 4U 1820‐30, Cen X‐3, EXO 1785‐248, SMC X‐4, LMC X‐4, SAX J1808.4‐3658, 4U 1538‐52 and Her X‐1 have been regained with the help of developed models. The stability of models is discussed by using speed of sound technique and graphical analysis of model parameters. It is concluded that all models are well behaved and physically acceptable. Keywords: not available.
30. Awais, H. M., Jamal, M., & Javaid, M. (2020). Topological properties of metal‐organic frameworks. Main Group Metal Chemistry, 43(1), 67‐76. doi: https://doi.org/10.1515/mgmc‐2020‐0007. (Hafiz Muhammad Awais, Muhammad Javaid (Mathematics/SSC) Abstract: Metal‐organic frameworks (MOFs) are porous materials formed by strong bonds between metal ions and organic ligands to represent very high surface area, large pore volume, excellent chemical stability and unique morphology. Work on synthesis, structures and characteristics of many MOFs shows the importance of these frameworks with versatile applications, such as energy storage devices of excellent electrode materials, gas storage, heterogeneous catalysis, environmental hazard, assessment of chemicals and sensing of different gases. A topological property or index is a numerical invariant that predicts the physicochemical properties of the chemical compounds of the underlying molecular graph or framework. Wiener (1947) created the practice of the topological indices (TI’s) in organic molecules with the reference of boiling point of paraffin. In this paper, we study the two different metalorganic frameworks with respect to the number of increasing layers with metal and organic ligands as well. We also compute the generalized Zagreb index and generalized Zagreb connection index of these frameworks. Moreover, the various indices and connection indices are obtained by using the aforesaid generalized versions. At the end, a comparison is also included between the indices and connection indices with the help of numerical values and their 3D plots. Keywords: metal‐organic frameworks, zagreb index, zagreb connection index.
31. Ashraf, K., Siddique, I., & Hussain, A. (2020). Impact of thermophoresis and brownian motion on non‐ Newtonian nanofluid flow with viscous dissipation near stagnation point. Physica Scripta, 95(5), 055217. doi: 10.1088/1402‐4896/ab72c1. (Kaleem Ashraf, Imran Siddique (Mathematics/SSC) Abstract: In present manuscript, we have explored three dimensional non‐Newtonian nanofluid flow with radiation impact considering dissipation in a vertical cylinder. The flow analysis is made in the existence of Research Outlook 2020 | 10
stagnation point. Radiative heat flux is estimated by Rosseland model. Thermophoresis and Brownian motion are the glamorous features for the delineation of nanofluids. Appropriate similarity transformations are applied to reduce the governing system of (PDE'S) together with boundary conditions into dimensionless form by taking boundary layer approximation. Arising coupled system of nonlinear (ODE'S) accompanied by boundary conditions are set about by powerful bvp4c method in Matlab software. Graphs and tables are drawn to present the influence of physical parameters. Skin friction and Nusselt number are contemplated for several parameters. Mounting the Eyring‐Powel fluid parameter quickens the fluid velocity and enhance the temperature. Keywords: dissipation effect, Rosseland model, vertical cylinder, eyring‐powel fluid, bvp4c, stagnation point.
32. Sana, A., Muhammad, J., & Muhammad, J. (2020). Bounds on F‐index of tricyclic graphs with fixed pendant vertices. Open Mathematics, 18(1), 150‐161. doi: https://doi.org/10.1515/math‐2020‐0006. (Sana Akram, Muhammad Javaid (Mathematics/SSC) Abstract: The F‐index F(G) of a graph G is obtained by the sum of cubes of the degrees of all the vertices in G. It is defined in the same paper of 1972 where the first and second Zagreb indices are introduced to study the structure‐dependency of total π‐electron energy. Recently, Furtula and Gutman [J. Math. Chem. 53 (2015), no. 4, 1184–1190] reinvestigated F‐index and proved its various properties. A connected graph with order n and size m, such that m = n + 2, is called a tricyclic graph. In this paper, we characterize the extremal graphs and prove the ordering among the different subfamilies of graphs with respect to F‐index in Ωαn, where Ωαn is a complete class of tricyclic graphs with three, four, six and seven cycles, such that each graph has α ≥ 1 pendant vertices and n ≥ 16 + α order. Mainly, we prove the bounds (lower and upper) of F(G), i.e 8n+12α+76≤F(G)≤8(n−1)−7α+(α+6)3 for each G∈Ωαn. Keywords: extremal graphs, tricyclic graphs, F‐index, 05C12, 05C50, 05C35.
33. Faizi, S., Rashid, T., & Zafar, S. (2020). TODIM approach based on score function under hesitant 2‐tuple linguistic environment. Journal of Intelligent & Fuzzy Systems, 38, 663‐673. doi: 10.3233/JIFS‐179439. (Tabasam Rashid, Sohail Zafar (Mathematics/SSC) Abstract: The hesitant 2‐tuple linguistic set (H2TLS) as an important extension of the 2‐tuple linguistic model, can effectively express the judgments of the decision makers (DMs) not only in qualitative aspects but also reflect the vagueness and hesitancy by assigning more than one translation parameters to every linguistic variable of the linguistic term set (LTS). The aim of this study is to extend the TODIM (an acronym in Portuguese of interactive and multi‐criteria decision making) method, to solve multi‐criteria group decision making (MCGDM) problems in the context of H2TLSs with completely unknown criteria weights. The TODIM method is developed on the basis of prospect theory which can effectively capture the psychological behavior of DMs during the decision analysis. In order to enhance the suitability and applicability of H2TLSs, this paper investigates first the generalized distance measure between hesitant 2‐tuple linguistic elements (H2TLEs). Furthermore, a score function for H2TLEs is proposed and the dominance relations are defined by using this function. A TODIM method is established that can greatly help in solving MCGDM problems in which alternatives are assessed in the form of H2TLEs in the presence of certain criteria. A procedure for determining the criteria weights is also established as a follow up. Finally, a numerical example is offered and a comparison analysis of proposed extended TODIM method is made with other methods to check the validity and practicality of the proposed study. Keywords: hesitant 2‐tuple linguistic set, score function, generalized distance measure, multi‐criteria group decision making, todim method.
34. Ali, A., Matejic, M., Milovanovic, E., & Milovanovic, I. (2020). Some new upper bounds for the inverse sum indeg index of graphs. Electronic Journal of Graph Theory and Applications, 8(1), 59–70. (Akbar Ali (Mathematics/Knowledge Unit of Science ) (SKT Campus) Research Outlook 2020 | 11
Abstract: Let G = (V,E) be a simple connected graph with the vertex set V = {1,2,...,n} and sequence of vertex
degrees (d1,d2,...,dn) where di denotes the degree of a vertex i ∈ V. With i ∼ j, we denote the adjacency of the
vertices i and j in the graph G. The inverse sum indeg (ISI) index of the graph G is defined as ISI(G)=∑i∼j(didj)/(di+dj). Some new upper bounds for the ISI index are obtained in this paper. Keywords: Vertex‐degree‐based topological indices, inverse sum indeg index, Zagreb indices, multiplicative Zagreb indices.
35. Noureen, S., Bhatti, A. A., & Ali, A. (2020). Extremum Modified First Zagreb Connection Index of ‐Vertex Trees with Fixed Number of Pendent Vertices. Discrete Dynamics in Nature and Society, 2020, 3295342. doi: 10.1155/2020/3295342. (Akbar Ali (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: The modified first Zagreb connection index is a graph invariant that appeared about fifty years ago within a study of molecular modeling, and after a long time, it has been revisited in two papers ((Ali and Trinajstić, 2018) and (Naji et al., 2017)) independently. For a graph , this graph invariant is defined as , where is the degree of the vertex and is the connection number of (that is, the number of vertices having distance 2 from ). In this paper, the graphs with maximum/minimum value are characterized from the class of all ‐vertex trees with fixed number of pendent vertices (that are the vertices of degree 1). Keywords: not available.
36. Liu, J., Aslam, M. K., & Javaid, M. (2020). Local Fractional Metric Dimensions of Rotationally Symmetric and Planar Networks. IEEE Access, 8, 82404‐82420. doi: 10.1109/ACCESS.2020.2991685. (Muhammad Kamran Aslam, Muhammad Javaid (Mathematics/SSC) Abstract: Mathematical modeling, coding or labeling with the help of numeric numbers based on the parameter of distance plays a vital role in the studies of the structural properties of the networks such as accessibility, centrality, clustering, complexity, connectivity, modularity, robustness and vulnerability. In particular, various distance based dimensions of the networks are used to rectify the problems in different strata of computer science and chemistry such as navigation, image processing, pattern recognition, integer programming problem, drug discovery and formation of different chemical compounds. In this note, we consider a family of rotationally symmetric and planar networks called by circular ladders consisting of different faced triangles, quadrangles and pentagons. We compute local fractional metric dimensions of the aforesaid networks and study their boundedness. Moreover, our findings at the closure of this note have been summarized in the form of tables and 3‐D plots. Keywords: fractional metric dimension, symmetric networks, resolving neighbourhoods.
37. Saleem, N., Habib, I., & Sen, M. D. l. (2020). Some New Results on Coincidence Points for Multivalued Suzuki‐Type Mappings in Fairly Complete Spaces. Computation, 8(1), 17. doi: https://doi.org/10.3390/computation8010017. (Naeem Saleem, Iqra Habib (Mathematics/SSC) Abstract: In this paper, we introduce Suzuki‐type (α,β,γg)− generalized and modified proximal contractive mappings. We establish some coincidence and best proximity point results in fairly complete spaces. Also, we provide coincidence and best proximity point results in partially ordered complete metric spaces for Suzuki‐ type (α,β,γg)− generalized and modified proximal contractive mappings. Furthermore, some examples are presented in each section to elaborate and explain the usability of the obtained results. As an application, we obtain fixed‐point results in metric spaces and in partially ordered metric spaces. The results obtained in this article further extend, modify and generalize the various results in the literature. Keywords: coincidence best proximity point, suzuki‐type (α,β,γɡ)‐generalized proximal contraction, suzuki‐type (α,β,γɡ)‐modified proximal contraction, fairly complete space, fixed point, partially ordered metric space.
Research Outlook 2020 | 12
38. Hong, G., Gu, Z., Javaid, M., Awais, H. M., & Siddiqui, M. K. (2020). Degree‐Based Topological Invariants of Metal‐ Organic Networks. IEEE Access, 8, 68288‐68300. doi: 10.1109/ACCESS.2020.2985729. (Muhammad Javaid, Hafiz Muhammad Awais (Mathematics/SSC) Abstract: Metal‐organic networks (MONs) is a family of chemical compounds consisting of clusters or metal ions and organic ligands. These are studied as one, two or three dimensional structures of porous materials and subclasses of coordination polymers. MONs are mostly used in catalysis for the separation & purification of gases and as conducting solids or super‐capacitors. In some situations, these networks are found to be stable in the process of removal or solvent of the guest molecules and could be restored with some other chemical compounds. The physical stability and mechanical properties of these networks have become a topic of great interest due to the aforesaid characteristics. Topological indices (TIs) are numeric quantities that are used to forecast the natural relationships among the physico‐chemical characteristics of the chemical compounds in their fundamental network. During the studies of the MONs, TIs show an essential role in the theoretical & environmental chemistry and pharmacology. In this paper, we compute various latest developed degree‐based TIs for two different metal‐organic networks with increasing number of layers consisting on both metal and organic ligands vertices as well. A comparison among the computed different versions of the TIs with the help of the numerical values and their graphs is also included. Keywords: Topological indices, chemical compounds, metals‐organic networks.
39. Javaid, M., Ali, A., Milovanović, I., & Milovanović, E. (2020). On the extremal cactus graphs for variable sum exdeg index with a fixed number of cycles. AKCE International Journal of Graphs and Combinatorics, 17(3), 920–923. doi: 10.1016/j.akcej.2019.08.007. (Mubeen Javaid, Akbar Ali (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: The variable sum exdeg index, introduced by Vukičević [Croat. Chem. Acta 84 (2011) 87–91] for predicting the octanol‐water partition coefficient of certain chemical compounds, of a graph G is defined as where a is any positive real number different from 1, V(G) is the vertex set of G and dv denotes the degree of a vertex v. A connected graph G is a cactus if and only if every edge of G lies on at most one cycle. For n > 3 and let be the class of all n‐vertex cacti with k cycles. The present paper is devoted to find the graphs with minimal and maximal values among all the members of the graph class for a > 1. Keywords: Topological index, variable sum exdeg index, extremal problem, cactus graph.
40. Cao, J., Ali, U., Javaid, M., & Huang, C. (2020). Zagreb Connection Indices of Molecular Graphs Based on Operations. Complexity, 2020, 7385682. doi: 10.1155/2020/7385682. (Usman Ali, Muhammad Javaid (Mathematics/SSC) Abstract: Topological index (numeric number) is a mathematical coding of the molecular graphs that predicts the physicochemical, biological, toxicological, and structural properties of the chemical compounds that are directly associated with the molecular graphs. The Zagreb connection indices are one of the TIs of the molecular graphs depending upon the connection number (degree of vertices at distance two) appeared in 1972 to compute the total electron energy of the alternant hydrocarbons. But after that, for a long period, these are not studied by researchers. Recently, restudied the Zagreb connection indices and reported that the Zagreb connection indices comparatively to the classical Zagreb indices provide the better absolute value of the correlation coefficient for the thirteen physicochemical properties of the octane isomers (all these tested values have been taken from the website http://www.moleculardescriptors.eu). In this paper, we compute the general results in the form of exact formulae & upper bounds of the second Zagreb connection index and modified first Zagreb connection index for the resultant graphs which are obtained by applying operations of corona, Cartesian, and lexicographic product. At the end, some applications of the obtained results for particular chemical structures such as alkanes,
Research Outlook 2020 | 13
cycloalkanes, linear polynomial chain, carbon nanotubes, fence, and closed fence are presented. In addition, a comparison between exact and computed values of the aforesaid Zagreb indices is also included. Keywords: not available.
41. Asıf, F., Zahı̇ d, Z., Zafar, S.̇ , Farahanı, M., Gao, W. (2020). On topological properties of some convex ̇ polytopes by using line operator on their subdivisions . Hacettepe Journal of Mathematics and Statistics, 49 (1) , 136‐146 . DOI: 10.15672/HJMS.2019.671. (Fatima Asif, Zohaib Zahid, Sohail Zafar (Mathematics/SSC) Abstract: In this paper, we give theoretical results for some topological indices such as Zagreb indices M1(G), M2(G), M3(G), R(G), M1(G), M2(G), Zagreb coindices M1(G), M2(G), M2(G) hyper‐Zagreb index HM(G), atom‐ bond connectivity index ABC(G), sum connectivity index χ(G) and geometric‐arithmetic connectivity index GA(G), by considering G as line graph of subdivision of some convex polytopes and G denotes its complement. Keywords: topological indices, line graph, subdivision, convex polytopes.
42. Bashir, Z., Rashid, T., Sałabun, W., & Zafar, S. (2020). Certain convergences for intuitionistic fuzzy sets. Journal of Intelligent & Fuzzy Systems, 38, 553‐564. doi: 10.3233/JIFS‐179429. (Tabasam Rashid, Sohail Zafar (Mathematics/SSC) Abstract: In this paper, the characterization of Γ‐convergence for the first countable topological spaces, characterization of convergence in supremum metric in general setting and some mutual relation between these convergences are discussed. The Γ‐convergence is defined as the Kuratowaski‐Painlevé convergence of the endographs of the intuitionistic fuzzy sets. The supremum metric is the supremum of Hausdroff distance among the η‐cuts of the intuitionistic fuzzy sets. To study these convergences is an important part of the theoretical fundamentals for intuitionistic fuzzy set theory. Some results are given as an application to variational analysis. Keywords: intuitionistic fuzzy sets, pointwise convergence, γ‐convergence, hausdroff metric, supremum metric.
43. Bashir, Z., Abbas Malik, M. G., Asif, S., & Rashid, T. (2020). The topological properties of intuitionistic fuzzy rough sets. Journal of Intelligent & Fuzzy Systems, 38, 795‐807. doi: 10.3233/JIFS‐179449. (Tabasam Rashid (Mathematics/SSC) Abstract: In this paper, an in depth study is done on topological properties of intuitionistic fuzzy rough sets in light of different conditions like serial, strongly serial, left continuity, transitivity on intuitionistic fuzzy relations, t‐norms, implicators by adopting a axiomatic approach with the ingredients of intuitionistic fuzzy logic. Numerous intuitionistic fuzzy topologies based on many different kinds of intuitionistic fuzzy relations are explored. Also, a special class of intuitionistic fuzzy relations known as T‐similarity class has been studied algebraically and found interesting lattices to model real life problems for better applications of intuitionistic fuzzy rough sets. Keywords: Intuitionistic fuzzy rough sets, intuitionistic fuzzy topologies, intuition fuzzy logic, lattices.
44. Aleem, M., Asjad, M. I., Shaheen, A., & Khan, I. (2020). MHD Influence on different water based nanofluids (TiO2, Al2O3, CuO) in porous medium with chemical reaction and newtonian heating. Chaos, Solitons & Fractals, 130, 109437. doi: https://doi.org/10.1016/j.chaos.2019.109437. (Maryam Aleem, Muhammad Imran Asjad (Mathematics/SSC) Abstract: The present study is aimed to provide the unsteady MHD nanofluid’s flow passing through an accelerating infinite vertical plate situated in porous medium. The flow is effected by thermal radiation, Newtonian heating and chemical reaction. Water is considered as conventional base fluid comprising of five
different types of nano particles such as Titanium oxide (TiO2), Aluminium Oxide (Al2O3), Copper Oxide (CuO), Silver (Ag) and Copper (Cu). By using dimensional analysis, the governing equations for temperature, velocity and concentration are reduced to dimensionless and after that these classical equations of present model are Research Outlook 2020 | 14
generalized to Caputo and Caputo‐Fabrizio fractional derivatives. Semi‐exact solutions for these equations are obtained via Laplace transform method. Inversion algorithms (Tzou’s and Stehfest’s) are applied to find the inverse Laplace transform. At last the comparison of water based nanofluids suspended with five different types of nano particles is drawn and effect of nanoparticles as well as fractional parameters (α, β, γ) on temperature and velocity can be seen by software Mathcad. We concluded that Ag‐water nanofluid has greater temperature
due to its greater value of thermal conductivity as compare to others. Whereas Al2O3‐water has greater velocity
because these particles are less denser than TiO2, Cu, Ag, CuO. Further we can see that by increasing the value of fractional parameters velocity as well as temperature decreases. Fluid flow can be enhanced with Caputo fractional model while Caputo‐Fabrizio decays faster than Caputo and hence well suited in exhibiting the memory of the flow problem at certain time. Keywords: MHD, nanofluids, Newtonian heating, free convection, accelerated platecaputo & caputo–fabrizio fractional derivative operators, porous medium, chemical reaction.
45. Akram, T., Abbas, M., Riaz, M. B., Ismail, A. I., & Ali, N. M. (2020). An efficient numerical technique for solving time fractional Burgers equation. Alexandria Engineering Journal. 59 (4). 2201‐2220. doi: https://doi.org/10.1016/j.aej.2020.01.048. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: A finite difference scheme which depends on a new approximation based on an extended cubic B‐ spline for the second order derivative is used to calculate the numerical outcomes of time fractional Burgers equation. The presented scheme uses Caputo’s formulation for the time derivative. Finite difference method will be used to discretize the Caputo’s fractional derivative. The proposed scheme will be shown to be unconditionally stable by Von‐Neumann method. The convergence analysis of the numerical scheme will be presented of order O(h2+τ2‐α). The presented scheme is tested on four numerical examples. The numerical results are compared favorably with other computational schemes. Keywords: nonlinear time fractional burgers equation, extended cubic b‐spline basis functions, caputo’s derivative, stability, convergence.
46. Ghalib, M. M., Zafar, A. A., Hammouch, Z., Riaz, M. B., & Shabbir, K. (2020). Analytical results on the unsteady rotational flow of fractional‐order non‐Newtonian fluids with shear stress on the boundary. Discrete & Continuous Dynamical Systems‐S, 13(3), p683‐693. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: The objective of this paper is to study the unsteady rotational flow of some non Newtonian fluids with Caputo fractional derivative through an infinite circular cylinder by means of the finite Hankel and Laplace transform. The novelty of the work is that motion is produced by applying tangential force not a specific but general function of time on the boundary. Initially the cylinder is at rest and after time to=0+to=0+ it begins to rotate about its axis with an angular velocity τog(t)τog(t). The obtained solutions of velocity field and shear stress have been presented under series form in terms of generalized GG‐function, satisfying all imposed initial and boundary conditions. The corresponding solutions can be easily particularized to give similar solutions from existing literature for Oldroyd‐B fluids, Maxwell fluids, Second grade fluids and Newtonian fluids with/without fractional derivatives performing similar motions. Keywords: caputo fractional derivative, unsteady flow, analytical solution, hankel transform.
47. Aleem, M., Asjad, M. I., Ahmadian, A., Salimi, M., & Ferrara, M. (2020). Heat transfer analysis of channel flow of MHD Jeffrey fluid subject to generalized boundary conditions. The European Physical Journal Plus, 135(1), 26. doi: 10.1140/epjp/s13360‐019‐00071‐6. (Maryam Aleem, Muhammad Imran Asjad (Mathematics/SSC) Abstract: Free convective, unsteady flow of Jeffrey liquid under the influence of magnetic field between two hot upright parallel plates fixed in porous medium is investigated in this paper. First plate is moving with time‐ dependent velocity Uo f (t) in its own plane while other is fixed. Mathematical model is developed using law of Research Outlook 2020 | 15
conservation of momentum, Fourier’s law of heat transfer. Equations for temperature and velocity fields are reduced to dimensionless form by applying suitable dimensionless variables. The Laplace transform method is used to find exact solutions of temperature and velocity. Finally, we have presented the effects of material and flow parameters and illustrated graphically. As a result, through this study, we found that coefficient of heat transfer shows dual behavior for small and large time. Also, the obtained results are reduced to the recently published work. Keywords: not available.
48. Zafar, A. A., Kudra, G., Awrejcewicz, J., Abdeljawad, T., & Riaz, M. B. (2020). A comparative study of the fractional oscillators. Alexandria Engineering Journal. 59 (4). 2649‐2676. doi: https://doi.org/10.1016/j.aej.2020.04.029. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this work, we have investigated the fractional differential equation to describe the motion of a linear oscillator using fractional derivative operators with or without singular kernels. In order to be consistent with the physical systems the value of the fractional parameter that characterizes the existence of fractional structures in the system, lies within unit interval. The solutions of the non‐integer order differential equation are obtained and expressed in terms of generalized G function depending upon the fractional parameter. The classical cases could be recovered by making the limit of fractional parameter approaches to unity. Moreover, we will analyse and compare the behaviour of the oscillator with different definitions of the fractional operators via graphical illustrations, phase portraits and Poincare maps. Keywords: linear oscillator, fractional derivative, power law kernel, non‐singular kernel, phase portraits.
49. Saeed, S. T., Riaz, M. B., Baleanu, D., & Abro, K. A. (2020). A mathematical study of natural convection flow through a channel with non‐singular kernels: An application to transport phenomena. 59 (4). 2269‐2281. Alexandria Engineering Journal. doi: https://doi.org/10.1016/j.aej.2020.02.012. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this manuscript, we have obtained closed form solution using Laplace transform, inversion algorithm and convolution theorem. The study of mass transfer flow of an incompressible fluid is carried out near vertical channel. Recently, new classes of differential operators have been introduced and recognized to be efficient in capturing processes following the decay law and the crossover behaviors. For the study of heat and mass transfer, we applied the newly differential operators say Atangana‐Baleanu (ABC) and Caputo‐Fabrizio (CF) to model such flow. This model for temperature, concentration and velocity gradient is presented in dimensionless form. The obtained solutions have been plotted for various values physical parameters like α,Df,Gm,Gr,Sc and Pr on temperature and velocity profile. Our results suggest that for the variation of time the velocity behavior for CF and ABC are reversible. Finally, an incremental value of prandtl number is observed for decrease in the velocity field which reflects the control of thickness of momentum and enlargement of thermal conductivity. Further, dynamical analysis of fluid with memory effect are efficient for ABC as compared to CF. Keywords: modern fractional operator, inversion algorithm, dufour effectmass transfer, convolution, convection flow.
50. Ghalib, M. M., Zafar, A. A., Riaz, M. B., Hammouch, Z., & Shabbir, K. (2020). Analytical approach for the steady MHD conjugate viscous fluid flow in a porous medium with nonsingular fractional derivative. Physica A: Statistical Mechanics and its Applications, 554, 123941. doi: https://doi.org/10.1016/j.physa.2019.123941. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: This study investigates the unsteady magnetohydrodynamics (MHD) flow of a viscous fluid. The fluid is passing over a vertical plate through porous medium. Additionally conjugate effects of heat and mass transfer with ramped temperatures, slip effect and influence of thermal radiation in the energy equation are taken into account. The dimensionless fractional‐order governing equations, in the Caputo–Fabrizio sense, are solved with Research Outlook 2020 | 16
the help of Laplace transformation. Moreover, semi analytical technique is used to investigate the velocity field. Some results which present in literature are recovered as limiting cases. Influences of different parameters on the velocity profiles for the case of f(t)=t and f(t)=sinωt are highlighted. The novelty of the manuscript is the use of the most recent definition of the non integer order derivative operator i.e. Caputo–Fabrizio derivative operator, the use of generalized boundary conditions in terms of general function f(t), from our general results, several particular cases for instance when f(t) is a linear or sinusoidal function could be recovered. Keywords: nonsingular‐kernel derivative, unsteady mhd flow, porous medium, ramped wall temperature, closed‐ form solution.
51. Shahid, N., Ahmed, N., Baleanu, D., Alshomrani, A. S., Iqbal, M. S., Aziz‐ur Rehman, M., . . . Rafiq, M. (2020). Novel numerical analysis for nonlinear advection–reaction–diffusion systems. Open Physics, 18(1), 112‐125. (Naveed Shahid, Nauman Ahmed, Muhammad Aziz‐ur Rehman (Mathematics/SSC) Abstract: In this article, a numerical model for a Brusselator advection–reaction–diffusion (BARD) system by using an elegant numerical scheme is developed. The consistency and stability of the proposed scheme is demonstrated. Positivity preserving property of the proposed scheme is also verified. The designed scheme is compared with the two well‐known existing classical schemes to validate the certain physical properties of the continuous system. A test problem is also furnished for simulations to support our claim. Prior to computations, the existence and uniqueness of solutions for more generic problems is investigated. In the underlying system, the nonlinearities depend not only on the desired solution but also on the advection term that reflects the pivotal importance of the study. Keywords: advection, diffusion, reaction, consistency, stability, structure preserving, equi‐continuity.
52. Ahmed, S., Ahmad, I., & Nawaz, K. (2020). Stability of Anisotropic Spheres. Canadian Journal of Physics. 98 (11). doi: 10.1139/cjp‐2019‐0620. (Shahzad Ahmad, K. Nawaz (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: This work is devoted to understand the dynamical instability of spherically symmetric spacetime in the background of Einstein‐Λ gravity. For this purpose, we have considered a spherical geometric distribution and assumed that it is filled with an anisotropic fluid content. In order to proceed our analysis, we have calculated the corresponding field as well as mass function. We found non‐linear behavior of physical variables. In order to dealt with that situation, we have subjected our system into the radial perturbations. We assume that after a particular era, our structural quantities are having the same time dependence parameter. After linearizing the basic expressions, we have studied the impact of cosmological constant in the modeling of relativistic stars. It is concluded that $\Lambda$ tends to slow down the rate of spherical anisotropic collapse. Keywords: gravitation, anisotropic fluids, relativistic fluids.
53. Saleem, M., Al‐Mdallal, Q. M., Chaudhry, Q. A., Noreen, S., & Haider, A. (2020). Partial slip effects on the peristaltic motion of an upper‐convected Maxwell fluid through an irregular channel. SN Applied Sciences, 2(5), 976. doi: 10.1007/s42452‐020‐2457‐1. (Musharafa Saleem (Mathematics/Knowledge Unit of Science) Aun Haider (Electrical Engineering) (SKT Campus) Abstract: A theoretical investigation was carried out in this paper by taking the partial slip result in an irregular wavy channel for the incompressible upper‐convected Maxwell fuid. Due to peristaltic motion, asymmetric waves with diferent amplitudes are produced. This fow is driven in an irregular channel due to the pressure gradient, where the perturbation technique applied to tackle the stream function and the pressure gradient. A numerical integration technique was used to fnd out the diferent expressions of the frictional rise per wavelength and pressure rise per wavelength and presented their graphs. The graphical results for the partial slip parameter, small wave number, phase diference, Reynolds number, Weissenberg number, wave amplitudes a and b, and Research Outlook 2020 | 17
channel width d are included. The pressure gradient is an increasing function of the wave number, but the slip parameter is vice versa. The velocity profle u is increased by a small increase in the wave number while it is decreased by a rise in the slip parameter. The frictional forces have the same behavior for the lower and upper wall. According to the slip efects, the bolus has improved behavior. Moreover, the relaxation parameter enhanced the strength of the bolus. Keywords: irregular channel, non‐newtonian fuid model, weissenberg number, slip parameter.
54. Saleem, N., Abbas, M., Bin‐Mohsin, B., & Radenovic, S. (2020). Pata type best proximity point results in metric spaces. Miskolc Mathematical Notes, 21(1), 365‐384. (Naeem Saleem (Mathematics/SSC) Abstract: The aim of this paper is to initiate the study of best proximity point and optimal coincidence point results of some α−Pata‐proximal admissible contraction of type‐I and type‐II in the framework of complete metric space. Some examples are presented to support the results obtained herein. Our results unify, extend and generalize various existing results in literature. Keywords: Metric space and α−Pata‐proximal admissible contraction of type‐I and type‐II and Generalized α−Pata‐proximal contraction and Optimal coincidence best proximity point.
55. Khan, I., Saeed, S. T., Riaz, M. B., Abro, K. A., Husnine, S. M., & Nisar, K. S. (2020). Influence in a Darcy's medium with heat production and radiation on MHD convection flow via modern fractional approach. Journal of Materials Research and Technology, 9(5). (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: This theoretical study explores MHD convection flow confined to an unbounded vertical plate embedded in a permeable surface under the effect of heat generation and ramp temperature. Solutions of concentration, temperature, and velocity profiles are derived symmetrically by applying non‐dimensional parameters along with Laplace transformation (LT) and numerical inversion algorithm. The graphical results for different physical constraints are produced for the velocity profiles. Our results suggest that an incremental value of the M is observed for a decrease in the velocity field, which reflects to control resistive force. Additionally, Atangana‐Baleanu (ABC) model is good to explain the dynamics of fluid with better memory effect as compared to other fractional operators. Keywords: MHD convection flow, fractional differential operator, chemical reaction, thermal effect, heat production,non‐singular kernels.
56. Riaz, M. B., Atangana, A., & Abdeljawad, T. (2020). Local and nonlocal differential operators: A comparative study of heat and mass transfer in MHD Oldroyd‐B fluid with ramped wall temperature. Fractals, 28(8). doi: DOI: 10.1142/S0218348X20400332. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: Study of heat and mass transfers is carried out for MHD Oldroyd‐B fluid (OBF) over an infinite vertical plate having time‐dependent velocity and with ramped wall temperature and constant concentration. It is proven in many already published articles that the heat and mass transfers do not really or always follow the classical mechanics process that is known as memoryless process. Therefore, the model using classical differentiation based on the rate of change cannot really replicate such dynamical process very accurately, thus, a different concept of differentiation is needed to capture such process. Very recently, a new class of differential operators were introduced and have been recognized to be efficient in capturing processes following the power‐law, the decay law and the crossover behaviors. For the study of heat and mass transfers, we applied the newly introduced differential operators to model such flow and compare the results with integer‐order derivative. Laplace transform and inversion algorithms are used for all the cases to find analytical solutions and to predict the influences of different parameters. The obtained analytical solutions were plotted for different values of fractional orders αα and ββ, λλ, λrλr, MM, GrGr and PrPr on the velocity field. In comparison, Atangana–Baleanu (ABC) fractional derivatives are found to be the best to explain the memory effects than the classical, Caputo (C) Research Outlook 2020 | 18
and Caputo–Fabrizio (CF) fractional derivatives. Some calculated values for Nusselt number and Sherwood number are presented in tables. Moreover, from the present solutions, the already published results were found as limiting cases. Keywords: Oldroyd‐B Fluid, Power‐Law, Decay Law, Crossover Behaviors, Local and Nonlocal Kernels, Ramped Wall Temperature, Concentration, Laplace Transformation, Inversion Algorithm.
57. Akram, T., Abbas, M., Riaz, M. B., Ismail, A. I., & Ali, N. M. (2020). Development and analysis of new approximation of extended cubic B‐spline to the non‐linear time fractional Klein‐Gordon equation. Fractals, 28(08), 2040039‐1 ‐ 2040039‐20. doi: 10.1142/s0218348x20400393. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: A new extended cubic B‐spline approximation is formulated, analysed and applied to obtain the numerical solution of the time fractional Klein‐Gordon equation. The temporal fractional derivative is estimated using Caputo’s discretization and the space derivative is discretized by extended cubic B‐spline basis functions. A combination of the Caputo’s fractional derivative and the new approximation of extended cubic B‐spline together with θ−weighted scheme is u lized to obtain the solu on. The method is shown to be uncondi onally stable and convergent. Numerical examples indicate that the obtained results compare well with other numerical results available in the literature. Keywords: Non‐linear time fractional Klein‐Gordon equation, Extended cubic B‐spline, Caputo’s fractional derivative, Stability, Convergence.
58. Arshad, M. S., Baleanu, D., Riaz, M. B., & Abbas, D. M. (2020). Novel 2‐Stage Fractional Runge Kutta Method for Time‐Fractional Logistic Growth Model. Discrete Dynamics in Nature and Society, 2020. doi: 10.1155/2020/1020472. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this paper, the fractional Euler method has been studied, and the derivation of the novel 2‐stage fractional Runge–Kutta (FRK) method has been presented. (e proposed fractional numerical method has been implemented to find the solution of fractional differential equations. (e proposed novel method will be helpful to derive the higher‐order family of fractional Runge–Kutta methods. (e nonlinear fractional Logistic Growth Model is solved and analyzed. (e numerical results and graphs of the examples demonstrate the effectiveness of the method. Keywords: not available. 59. Arshad, M. S., Mardan, S. A., Riaz, M. B., & Altaf, S. (2020). Analysis of Time‐Fractional Semi‐Analytical Solutions of Strong Interacting Internal Waves in Rotating Ocean. Punjab University Journal of Mathematics, 52(3), 99‐111. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this paper, time‐fractional Gardner’s Ostrovsky equation is considered which represents the shallow water wave phenomena of strong interacting internal Waves with rotational effects. Using the novel perturbation technique, we found the semi‐analytical solutions of such obscure phenomena for the rotational parameters introduced in fractional time domain. The Homotopy Perturbation Method is implemented in conjunction with Laplace transformation. Caputo’s time fractional derivative has been used to obtain the upcoming solutions on the basis of all previous backgrounds. Keywords: fractional ostrovsky equation, fractional gardner’s equation, laplace transforms, nonlinear fractional differential equations, homotopy perturbation transform method.
60. Riaz, M. B., Saeed, S. T., BALEANU, D., & Ghalib, M. M. (2020). Computational results with non‐singular & non‐ local kernel flow of viscous fluid in vertical permeable medium with variant temperature. Frontiers in Physics, 8, 275. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: This present article explores the transversal magnetized flow of a viscous fluid. The flow is confined to a vertical wall saturated in permeable medium along with ramped wall temperature. In this study, the conjugate Research Outlook 2020 | 19
impact of heat and mass transfer with slip and non‐slip conditions are considered in the velocity field and energy equation. The dimensionless Atangana‐Baleanu fractional governing equations are derived with Laplace transformation. Computational results are expressed graphically with the effect of various physical parameters. Comparative graphical analysis of Atangana‐Baleanu derivative for temperature, concentration and velocity field with slip and non‐slip impact shows that the memory effects of Atangana‐Baleanu derivative are better than the results existing in literature. Keywords: not available.
61. Imran, M. A., Shaheen, A., Sherif, E.‐S. M., Rahimi‐Gorji, M., & Seikh, A. H. (2020). Analysis of peristaltic flow of Jeffrey six constant nano fluid in a vertical non‐uniform tube. Chinese Journal of Physics, 66, 60‐73. doi: https://doi.org/10.1016/j.cjph.2019.11.029. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: Peristaltic flow of non‐Newtonian nano fluid through a non‐uniform surface has been investigated in this paper. The fluid motion along the wall of the surface is caused by the sinusoidal wave traveling with constant speed. The governing equations are converted into cylindrical coordinate system and assuming low Reynolds number and long wave length partial differential equations are simplified. Analytically solutions of the problem are obtained by utilizing the homotopy perturbation method (HPM). In order to insight the impact of embedded parameters on temperature, concentration and velocity some graphs are plotted for different peristaltic waves. At the end, some observations were made from the graphical presentation that velocity, pressure rise and nano
particle concentration are increasing function of thermophoresis parameter Nt while temperature and frictional forces show opposite trend. Keywords: peristaltic flow, nanoparticles, jeffrey six constant fluid, homotopy perturbation method.
62. Asjad, M. I., Aleem, M., Ahmadian, A., Salahshour, S., & Ferrara, M. (2020). New trends of fractional modeling and heat and mass transfer investigation of (SWCNTs and MWCNTs)‐CMC based nanofluids flow over inclined plate with generalized boundary conditions. Chinese Journal of Physics, 66, 497‐516. doi: https://doi.org/10.1016/j.cjph.2020.05.026. (Muhammad Imran Asjad, Maryam Aleem (Mathematics/SSC) Abstract: In this paper, we have considered unsteady MHD viscous fluid flow of Carboxyl methyl cellulose (CMC) as based fluid and Carbon nanotubes CNTs (SWCNTs, MWCNTs) nanoparticles passing through an inclined plate of infinite length. Furthermore, the effects of heat source, chemical reaction, porosity and MHD are considered. Fractional model is developed by Caputo time fractional derivatives though recent trends of fractional modeling. The semi exact solutions are obtained for the governing equations in dimensionless form by Laplace transform method. Influence of fractional and other flow parameters on temperature, concentration and velocity fields are graphically illustrated. The Nusselt number, Sherwood number and skin friction are computed for fixed values of flow parameters and presented in tabular form. As a result, for larger values of fractional parameters temperature, concentration and velocity fields can be enhanced. A comparison has been drawn between SWCTs‐ CMC and MWCTs‐CMC based nanofluids and found that MWCTs based nanofluids are more efficient in heat transfer than SWCTs‐CMC based nanofluids. Further, in the absence of nanoparticles the obtained results are reduced to recently published results and this fact have been proved graphically and they are in good agreement. Keywords: MHD flow, CMC based CNTs (SWCNTSMWCNTs) nanofluids, fractional flow, generalised boundary conditions, free convection, inclined plate, porous medium.
63. Rubbab, Q., Mahsud, Y., Irshad, S., Asjad, M. I., Ahmadian, A., Salahshour, S., & Ferrara, M. (2020). Numerical simulations of unsteady flows in a rotating channel using a novel eigenfunction expansion method. AIP Advances, 10(6), 065035. doi: 10.1063/5.0012874. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: Starting flows of a viscous incompressible fluid, modeled by the time‐fractional derivatives, within a rotating channel due to an impulsive pressure gradient are studied. Using the eigenfunction expansion, the Research Outlook 2020 | 20
analytic solutions in series form are obtained. The flow of the ordinary fluid is studied as a special case of the time‐fractional problem. The convergence of series solutions is proved. In addition, using the classical analytical method, coupled with the Laplace transform and Stehfest’s algorithm, an approximate solution is found. The flow rates in x‐ and y‐directions are determined. In the case of the ordinary fluid, the steady‐state and transient components of velocities are obtained. The numerical calculations are carried out by using the Mathcad software. It is found that, for fractional fluids, the reversal flow is much attenuated if the values of the fractional parameter are less than 1. Keywords: not available.
64. Rafique, K., Anwar, M. I., Misiran, M., & Asjad, M. I. (2020). Energy and mass transport of micropolar nanofluid flow over an inclined surface with Keller‐Box simulation. Heat Transfer, 49. 4592–4611. doi: 10.1002/htj.21843. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this article, micropolar nanofluid boundary layer flow over a slanted stretching surface with Soret and Dufour effect is studied. The inclined stretching surface in this study is considered permeable and linear. In this problem, the Buongiorno model is considered for thermal efficiencies of fluid flow in the existence of Brownian movement and thermophoresis properties. The nonlinear problem for Micropolar Nanofluid flow over the slanted channel is developed to think about the heat and mass exchange phenomenon by incorporating portent flow factors to strengthened boundary layers. In this study, nonlinear partial differential equations are converted to nonlinear ordinary differential equations by utilizing appropriate similarity transformations then elucidated the numerical outcomes by the Keller‐Box technique. An examination of the set‐up results is performed with accessible outcomes and perceived in a good settlement without involved impacts. Numerical and graphical outcomes are additionally displayed in tables and charts. Keywords: dufour, inclined surface, mhd, micropolar nanofluid, permeable, soret.
65. Saqlain, M., Moin, S., Jafar, M. N., Saeed, M., & Smarandache, F. (2020). Aggregate Operators of Neutrosophic Hypersoft Set. Neutrosophic Sets and Systems, 32(1), 18. (Muhammad Naveed Jafar, Muhammad Saeed (Mathematics/SSC) Abstract: Multi‐criteria decision making (MCDM) is concerned about organizing and taking care of choice and planning issues including multi‐criteria. When attributes are more than one, and further bifurcated, neutrosophic softset environment cannot be used to tackle such type of issues. Therefore, there was a dire need to define a new approach to solve such type of problems, So, for this purpose a new environment namely, Neutrosophic Hypersoft set (NHSS) is defined. This paper includes basics operator’s like union, intersection, complement, subset, null set, equal set etc., of Neutrosophic Hypersoft set (NHSS). The validity and the implementation are presented along with suitable examples. For more precision and accuracy, in future, proposed operations will play a vital role is decision‐makings like personal selection, management problems and many others. Keywords: MCDM, uncertainty, soft set, neutrosophic soft set, hyper soft set.
66. Saqlain, M., Jafar, N., Moin, S., Saeed, M., & Broumi, S. (2020). Single and Multi‐valued Neutrosophic Hypersoft set and Tangent Similarity Measure of Single valued Neutrosophic Hypersoft Sets. Neutrosophic Sets and Systems, 32(1), 20. (Muhammad Saeed (Mathematics/SSC) Abstract: In this paper, we present a single‐valued Neutrosophic Hypersoft set, multi‐valued Neutrosophic Hypersoft set and tangent similarity measure for single‐valued neutrosophic hypersoft sets and its properties. Then we use this technique in an application namely selection of cricket players for different types of matches (ODI, T20, and test) based on Neutrosophic Hypersoft set in decision making of single‐valued neutrosophic hypersoft sets. This technique will help us to decide the best option for the players.
Research Outlook 2020 | 21
Keywords: Neutrosophic hypersoft set (NHSS), single‐valued neutrosophic hypersoft set (SVNHSS), multi‐valued Neutrosophic Hypersoft set (MVNHSS), tangent similarity measure (TSM), multiple attribute decision making, cricket player set.
67. Muhammad, R., Saeed, M., Ali, B., Ahmad, N., Ali, L., & Abdal, S. (2020). Application of Interval Valued Fuzzy Soft Max‐Min Decision Making Method in Medical Diagnosis. International Journal of Mathematical Research, 9(1), 11‐19. (Muhammad Saeed (Mathematics/SSC) Abstract: In this paper, we study some basic concepts of fuzzy sets, soft sets, fuzzy soft sets, and interval‐valued fuzzy soft sets. Secondly, we study the interval‐valued fuzzy soft maxmin decision‐making function and developed the graphical model for the Intervalvalued fuzzy soft max‐min decision making (IVFSMmDM) method by using Intervalvalued fuzzy soft max‐min decision‐making function. Finally, we used IVFSMmDM for faculty selection in the education department and observed that is the best teacher for teaching by using hypothetical data. Keywords: Fuzzy set, Soft set, Interval‐valued fuzzy soft set, IvfsMmDM function.
68. Zulqarnain, R. M., Saeed, M., Ahmad, N., Dayan, F., & Ahmad, B. (2020). Application of TOPSIS Method for Decision Making. International Journal of Scientific Research in Mathematical and Statistical Sciences, 7(2), 76‐ 81. (Muhammad Saeed, Fazal Dayan (Mathematics/SSC) Abstract: —In this paper, we discuss the order preference by similarity ideal solution (TOPSIS) method with basic concepts and determine the TOPSIS algorithm. Secondly, we construct a graphical model for the TOPSIS method by using the TOPSIS algorithm. Finally, we use the developed method for decision making in our daily life. In this work, we use the TOPSIS method for the selection of a car by using hypothetical data and examined that the civic is the best automotive car according to given parameters. Keywords: Multiple Criteria Decision Making (MCDM), TOPSIS, Positive Ideal Solution (PIS), Negative Ideal Solution (NIS).
69. Saeed, M., Saqlain, M., Mehmood, A., Naseer, K., & Yaqoob, S. (2020). Multi‐Polar Neutrosophic Soft Sets with Application in Medical Diagnosis and Decision‐Making. Neutrosophic Sets and Systems, 33(1), 13. (Muhammad Saeed, Asad Mehmood, Khushbakht Naseer, Sonia Yaqoob (Mathematics/SSC) Abstract: A Similarity measure for Neutrosophic function performs a fundamental role in tackling the problems that include blurred and hazed information but is not able to handle the fuzziness and vagueness of the problems which have numerous information. The objective of this research paper is to generalize neutrosophic soft set to the multi‐polar neutrosophic soft set (mNS set), aggregation operators and their properties on mNS sets. It also discusses the distance‐based similarity measures that rely on between two mNS sets. It explains with the help of examples that the intended similarity measures of mNS sets are applicable in the field of medical diagnosis and decision‐making problem for selection of lecturer in universities. Eventually, this proposed method is concluded as an algorithm in the application. Keywords: mNS Set; Operators on mNS; Properties; Distance and Similarity Measure; Medical Diagnosis; Decision‐Making.
70. Rana, S., Saeed, M., Qayyum, M., & Smarandache, F. (2020). Plithogenic Subjective Hyper‐Super‐Soft Matrices with New Definitions & Local, Global, Universal Subjective Ranking Model. International Journal of Neutrosophic Science (IJNS), 6(2), 56‐79. (Shazia Rana, Muhammad Saeed (Mathematics/SSC) Abstract: In this paper, we initially introduce a novel type of matrix representation of Plithogenic Crisp/Fuzzy/Intuitionistic/Neutrosophic Hypersoft Set named as Plithogenic Crisp/Fuzzy/Intuitionistic/Neutrosophic Hypersoft Matrix, which is generated by multiple parallel sheets of matrices. Furthermore, these parallel sheets are representing parallel universes or parallel realities (a Research Outlook 2020 | 22
combination of attributes and sub‐attributes w.r.t. subjects). We represent cross‐sectional cuts of these hyper‐ soft matrices as parallel sheets (images of the expanded universe). Later, we utilize these Hypersoft matrices to formulate Plithogenic Subjective Crisp/Fuzzy/Intuitionistic/Neutrosophic Hyper‐Super‐Soft Matrix. These matrices are framed by the generalization of Whole Hyper‐Soft Set to Subjective Whole Hyper‐Soft Set and then their representation in such hyper‐super‐soft‐matrix (parallel sheets of matrices) whose elements are matrices. The Hypersoft matrices and hyper‐super‐soft matrices are tensors of rank three and four, respectively, having three and four indices of variations. Later we provide an application of these Plithogenic Hyper super soft matrices in the form of Local, Global, Universal Subjective Ranking Model. The specialty of this model is that it offers precise classification of the universe from micro‐universe to macro‐universe levels by observing them through several angles of visions in many environments having several ambiguities and hesitation levels. This model provides optimal and neutral values of universes and can compact the expanded universe to a single point in such a way that the compacted universe reflects the cumulative effect of the whole universe. It further offers a transparent ranking by giving a percentage authenticity measure of the ranking. Finally, we provide an application of the model as a numerical example. Keywords: plithogenic hyper‐super‐soft matrices, sheets of matrices, expanded universe, compacted universe, subjective, local, global, universal ranking.
71. Zulqarnain, R. M., Xin, X. L., Saeed, M., Ahmad, N., Dayan, F., & Ahmad, B. (2020). Recruitment of Medical Staff in Health Department by Using TOPSIS Method. International Journal of Pharmaceutical Sciences Review and Research, 62(1), 1‐7. (Muhammad Saeed, Nadeem Ahmad, Fazal Dayan (Mathematics/SSC) Abstract: In this paper, we debate the order preference by similarity ideal solution (TOPSIS) method and develop a model for the TOPSIS method. The selection of medical staff is a very significant portion of our life to promote the quality of health in our society. We select the more appropriate medical staff for the health department by using the TOPSIS method in the following research. Keywords: Multiple Criteria Decision Making (MCDM), TOPSIS, Positive Ideal Solution (PIS), Negative Ideal Solution (NIS).
72. Imtiaz, M., Saqlain, M., & Saeed, M. (2020). TOPSIS for Multi Criteria Decision Making in Octagonal Intuitionistic Fuzzy Environment by Using Accuracy Function. Journal of New Theory, 31, 32‐40. (Madiha Imtiaz, Muhammad Saeed (Mathematics/SSC) Abstract: Multi Criteria Decision Making (MCDM) enables a strong valid platform in domains where choosing the best of the best among various attributes is quite complicated. This paper provides a suitable methodology for solving MCDM problems in Intuitionistic Fuzzy region. In this paper we shall be dealing with the environment of octagonal intuitionistic fuzzy numbers. These numbers are more suitable to deal with uncertainties than other generalized form of fuzzy numbers. There are ways to solve MCDM in IF environment. Many have used ‐cuts of numbers which are complicated calculations usually ending up with deviation from the results. Despite of solving the problem using ‐ cuts, we propose a new ranking technique in the procedure. This ranking technique is called an accuracy function for octagonal intuitionistic fuzzy numbers. Octagonal Intuitionistic fuzzy numbers are introduced along with its membership and non‐membership values. For application, a numerical example is solved at the end of this paper. Keywords: Fuzzy Numbers (FN’s), Intuitionistic Fuzzy Numbers (IFN’s), Octagonal Intuitionistic Fuzzy Number (OIFN’s), Accuracy Function (AF), TOPSIS.
73. Saeed, M., Ahmad, M. R., Saqlain, M., & Riaz, M. (2020). Rudiments of N‐framed soft sets. Punjab University Journal of Mathematics, 52(5), 15‐30. (Muhammad Saeed, Muhammad Rayees Ahmad (Mathematics/SSC)
Research Outlook 2020 | 23
Abstract: Uncertainty is a human instinct that prevails on the mind of a person while making an important decision. Decision making is the most integral part of human life which has a potential to change an entire life of a man. Soft set theory is an important tool which deals with uncertainty and helps to make the appropriate decision. This paper covers the generalization of soft sets including double framed and triple framed soft sets and discusses its extension to N‐framed soft sets. By defining significant aggregative operations including union, intersection, not set, complement, relative complement, difference of double framed, triple framed and in general N‐framed soft sets and some other laws, this paper provides an imperative insight for studying N‐framed soft sets. Keywords: Uncertainties, Decision making,soft sets, Double framed soft sets (DFSS),Triple framed soft sets (TFSS), N‐framed soft sets (NFSS).
74. Ali, U., & Javaid, M. (2020). Zagreb connection indices of disjunction and symmetric difference operations on graphs. Journal of Prime Research in Mathematics, 16(2), 1‐15. (Usman Ali, Muhammad Javaid (Mathematics/SSC) Abstract: In this paper, we compute the general results in the form of the upper bounds of the Zagreb indices based on connection number called as first Zagreb connection index, second Zagreb connection index and modified first Zagreb connection index for the resultant graphs which are obtained by applying the product‐ related operations such as disjunction (co‐normal product) and symmetric difference. At the end, some applications of the obtained results with a comparison between exact and computed values of the aforesaid Zagreb connection indices for the particular classes of alkanes are also included. Keywords: Zegreb indices, connection number, disjunction, symmetric difference.
75. Awais, H. M., Javaid, M., & Raheem, A. (2020). Hyper‐Zagreb index of graphs based on generalized subdivision related operations. Punjab University Journal of Mathematics, 52(5), 89‐103. (Hafiz Muhammad Awais, Muhammad Javaid (Mathematics/SSC) Abstract: Mathematical modeling of the molecular graphs plays a fundamental part in the analysis of the quantitative structures activity relationship (QSAR) and quantitative structures property relationship models (QSPR models). In 2013, Shirdel et. al. [IJMC; 4(2013); 213‐220] defined the new topological index of a graph (Γ) named as hyper‐Zagreb index [HM(Γ)] is HM(Γ) = P yz²E(Γ) [dΓ(y) + dΓ(z)]2 Liu et al. [IEEE Access; 7(2019); 105479‐ 105488] defined the concept of the generalized subdivision operations on graphs and obtained the generalized F‐sum graphs. In this paper, the hyper‐Zagreb index is calculated for the generalized F‐sum graphs in terms of their factor graphs. In fact, the obtained results are the general extension of the results Anandkumar et al. [IJPAM; 112(2017); 239‐252] Keywords: molecular graph, cartesian product, generalized f‐sum graph.
76. Ali, U., & Javaid, M. (2020). Upper bounds of Zagreb connection indices of tensor and strong product on graphs. Punjab University Journal of Mathematics, 52(2), 89‐100. (Usman Ali, Muhammad Javaid (Mathematics/SSC) Abstract: A topological index (TI) is a function from P to the set of real numbers, where P is the set of finite simple graphs. In fact, it is a final outcome of a logical, systematical and mathematical process that transforms feature encoded in a molecular graph to a fixed real number. Gutman and Trinajstic (1972) first time defined degree based TI named as first Zagreb index to compute the total π‐electron energy of a molecular graph. They also exposed another TI that is renamed as modified first Zagreb connection index in [Ali and T rinajstic, Mol. Inform. 37(2018), 1 − 7]. In this paper, we compute the upper bounds for the Zagreb connec on indices i.e. first Zagreb connection index, second Zagreb connection index and modified first Zagreb connection index of the resultant graphs which are obtained by applying the tensor and strong product of two graphs. Keywords: zagreb indices, connection number, tensor product and strong product. Research Outlook 2020 | 24
77. Raheem, A., Javaid, M., Hasni, R., & Shah, N. (2020). On SEMT Labeling of Disjoint Union of Subdivided Stars and Stars. Southeast Asian Bulletin of Mathematics, 44(4), 587–596. (Muhammad Javaid (Mathematics/SSC) Abstract: An edge magic total (EMT) labeling on a graph Γ = (V (Γ),E(Γ)) with |V (Γ)| = p and |E(Γ)| = q is a bijective function ψ : V (Γ) ∪ E(Γ) → {1,2,..., p + q} with the property that for each edge uv ∈ E(Γ), ψ(u) + ψ(uv) + ψ(v) = c, where c is a constant. An edge magic total (EMT) labeling is called super edge magic total (SEMT) labeling if the smallest numbers are given to the vertices. In this paper, we study the existence of SEMT labeling of disjoint union of stars and subdivided stars. Keywords: subdivided star, star, SEMT labeling.
78. Raheem, A., & Javaid, M. (2020). ON (a; d)‐EAT LABELING OF SUBDIVISION OF TREES. TWMS Journal of Applied and Engineering Mathematics, 10(3), 574. (Muhammad Javaid (Mathematics/SSC) Abstract: An (a, d)‐edge antimagic total (EAT) labeling on a graph Γ with p vertices and q edges is a one‐to‐one function ψ from V (Γ)∪E(Γ) onto the set of integers 1, 2, ...p+q with the property that for each edge uv, the set {ψ(u) +ψ(uv) +ψ(v) : uv ∈ E(Γ)} form an arithmetic progression (A. P.) starting with a and having common difference d, where a > 0 and d ≥ 0 fixed integers. A (a, d)‐EAT labeling is called super (a, d)‐EAT labeling if the smallest numbers are labels to the vertices. In this paper, we have to show that the graph of the subdivided star and subdivided caterpillar are super (a, d)‐EAT labeling. Keywords: subdivided stars, subdivided caterpillars, super (a, d)‐EAT labeling. 79. Raheem, A., Hasni, R., Javaid, M., & Umar, M. A. (2020). On cordial related labeling of isomorphic copies of paths and subdivision of star. Journal of Discrete Mathematical Sciences and Cryptography, 23 (7). 1381–1390. doi: 10.1080/09720529.2019.1698802. (Muhammad Javaid (Mathematics/SSC)
Abstract: In this paper, we investigate the cordiality of the isomorphic copies of paths mPn . We also give sufficient
condition for mPn to admit the prime cordial labeling, product cordial labeling and total product cordial labeling. Furthermore, we also determine the prime cordial labeling, product cordial labeling and total product cordial labeling for subdivision of star under certain conditions. Keywords: cordial labeling, paths, subdivision of star.
80. Ali, U., Javaid, M., & Alanazi, A. M. (2020). Computing Analysis of Connection‐Based Indices and Coindices for Product of Molecular Networks. Symmetry, 12(8), 1320. (Usman Ali, Muhammad Javaid (Mathematics/SSC) Abstract: Gutman and Trinajstić (1972) defined the connection‐number based Zagreb indices, where connection number is degree of a vertex at distance two, in order to find the electron energy of alternant hydrocarbons. These indices remain symmetric for the isomorphic (molecular) networks. For the prediction of physicochemical and symmetrical properties of octane isomers, these indices are restudied in 2018. In this paper, first and second Zagreb connection coindices are defined and obtained in the form of upper bounds for the resultant networks in the terms of different indices of their factor networks, where resultant networks are obtained from two networks by the product‐related operations, such as cartesian, corona, and lexicographic. For the molecular networks linear polynomial chain, carbon nanotube, alkane, cycloalkane, fence, and closed fence, first and second Zagreb connection coindices are computed in the consequence of the obtained results. An analysis of Zagreb connection indices and coindices on the aforesaid molecular networks is also included with the help of their numerical values and graphical presentations that shows the symmetric behaviour of these indices and coindices with in certain intervals of order and size of the under study (molecular) networks. Keywords: connection number, Zagreb indices, coindices, product of networks.
81. Li, X., Ahmad, M., Javaid, M., Saeed, M., & Liu, J.‐B. (2020). Bounds on General Randić Index for F‐Sum Graphs. Journal of Mathematics, 2020, 9129365. doi: 10.1155/2020/9129365. (Maqsood Ahmad, Muhammad Javaid, Muhammad Saeed (Mathematics/SSC) Research Outlook 2020 | 25
Abstract: analysis of quantitative structure activity/property relationships (QSAR/QSPR). 'e correlation between the entire π‐electron energy and the structure of a molecular graph was explored and understood by the first Zagreb index. Recently, Liu et al. (2019) calculated the first general Zagreb index of the F‐sum graphs. In the same paper, they also proposed the open problem to compute the general Randi´c index Rα(Γ) � uv∈E(Γ)[dΓ(u) × dΓ(v)]α of the F‐sum graphs, where α ∈ R and dΓ(u) denote the valency of the vertex u in the molecular graph Γ. Aim of this paper is to compute the lower and upper bounds of the general Randi´c index for the F‐sum graphs when α ∈ N. We present numerous examples to support and check the reliability as well as validity of our bounds. Furthermore, the results acquired are the generalization of the results offered by Deng et al. (2016), who studied the general Randi´c index for exactly α � 1. Keywords: not available.
82. Saeed, M., Ali, U., Ali, J., & Dayan, F. (2020). Fuzzy Soft Relative Method and its Application in Decision Making Problem. Proceedings of the Pakistan Academy of Sciences: A. Physical and Computational Sciences, 57(1), 21‐30. (Muhammad Saeed, Usman Ali, Javaid Ali, Fazal Dayan (Mathematics/SSC) Abstract: In day to day problems, so many situations are faced which are full of dissatisfaction and uncertainties. Fuzzy soft set theory has evolved as an effective decision making tool to cope with problems with uncertainties. This work develops a new technique, Fuzzy Soft relative (FS‐relative) method for solving such problems. Underlying concept is inspired from fuzzy soft set aggregate approach. We find maximal set and apply it to FS‐ set to get a relative set which contains relative fuzzy approximation functions values. Then FS‐relative operator is generated and the values are applied with maximal set by FS‐relative operator to get a single relative fuzzy set. The proposed FS‐relative method has been effectively applied to find the optimum solution for selecting the best teacher in a High School according to the teacher specific characteristics. Keywords: soft sets, fuzzy sets, fuzzy soft sets, fs‐relative method.
83. Saeed, M., Hussain, M., Mughal, A. A. (2020). A Study of Soft Sets with Soft Members and Soft Elements: A New Approach. Punjab University Journal of Mathematics, 52(8), 1‐15. (Muhammad Saeed, Manzoor Hussain, Abdul Aleem Mughal (Mathematics/SSC) Abstract: Soft set theory has gained significant worth since its emergence. Soft algebraic structures have been discussed in numerous researches with the help of sub algebraic structures. Properties of soft algebraic structures, somehow, are hard to study in parallel to the study of the classical approach of algebraic structures. In this study, we perform an extensive inspection of the concept of soft elements and soft members in soft sets. By using soft members and soft elements, soft sets operations and soft sets relations are discussed which enables us to study the concept of soft algebraic structures with this new approach. To elaborate on the new introduced concept, Cayley’s table for the soft group has been constructed from where some properties of the soft groups are verified. Keywords: soft member, soft element, isolated soft element, sub soft member, soft relations, soft binary operations, soft identity member, soft inverse.
84. Chu, Y.‐M., Javed, S., Javaid, M., & Kamran Siddiqui, M. (2020). On bounds for topological descriptors of φ‐ sum graphs. Journal of Taibah University for Science, 14(1), 1288‐1301. doi: 10.1080/16583655.2020.1819026. (Saira Javed, Muhammad Javaid (Mathematics/SSC) Abstract: The properties of chemical compounds are very important for the studies of the non‐isomorphism phenomenon's related to the molecular graphs. Topological indices (TIs) are one of the mathematical tools which are used to study these properties. Gutman and Trinajsti [Graph theory and molecular orbitals. Total π‐electron energy of alternant hydrocarbons. Chem Phys Lett. 1972;17(4):535–538] defined the Zagreb indices (descriptors) to find correlation value between a molecular graph and its total π‐electron energy. Later on, Bollobás and Erdös Research Outlook 2020 | 26
[Graphs of extremal weights. Ars Comb; 1998;50:225–233] defined the most general form of these indices (descriptors) called by general Randić index (GRI) and first general Zagreb index (FGZI), respectively. In this paper, we computed the bounds for FGZI and GRI of φ‐sum graphs, obtained by the strong product of the graph φ(G)φ(G) with another graph Γ, where φ(G)φ(G) is constructed using four subdivision operations on the graph G. At the end, we also include the results for some particular families of graphs as the applications of the obtained results. Keywords: topological descriptors, φ‐sum graphs, strong product.
85. Javaid, M., Raza, M., Kumam, P., & Liu, J. B. (2020). Sharp Bounds of Local Fractional Metric Dimensions of Connected Networks. IEEE Access, 8, 172329‐172342. doi: 10.1109/ACCESS.2020.3025018. (Muhammad Javaid, Mohsin Raza (Mathematics/SSC) Abstract: Metric dimension is a distance based parameter which is used to determine the locations of machines (or robots) with respect to minimum consumption of time, shortest distance among the destinations and lesser number of the utilized nodes as places of the objects. It is also used to characterize the chemical compounds in the molecular networks in the form of their unique presentations. These are problems worth investigating in different strata of computer science and chemistry such as navigation, combinatorial optimization, pattern recognition, image processing, integer programming, network theory and drugs discovery. In this paper, a general computational criteria is established to compute the local fractional metric dimension (LFMD) of connected networks in the form of sharp lower and upper bounds. A complete characterization of the connected networks whose LFMDs attain the exactly lower bound is obtained and some particular classes of networks (complete networks, generalized windmill and h ‐level windmill) whose LFMDs attain the exactly upper bound are also addressed. In the consequence of the main obtained criteria, LFMDs of wheel‐related networks (anti‐web gear, m ‐level wheel, prism, helm and flower) are computed and their boundedness (or un‐boundedness) is also illustrated with the help of 2D and 3D graphical presentations. Keywords: distance in networks, metric dimension, resolving neighborhood sets, fractional metric dimension, connected networks, wheel‐related networks.
86. Ali, R., Akgül, A., & Asjad, M. I. (2020). Power law memory of natural convection flow of hybrid nanofluids with constant proportional Caputo fractional derivative due to pressure gradient. Pramana, 94(1), 131. doi: 10.1007/s12043‐020‐01997‐8. (Rizwan Ali, Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this work, influence of hybrid nanofluids on heat transfer flow of a viscous fluid due to pressure gradient is discussed with innovative constant proportional Caputo fractional derivative. For this purpose, we consider an infinite vertical wall which is exponentially moving in the x‐direction with variable temperature. Nanosized particles of Cu and Al2O3Al2O3 are suspended in water, the base fluid. The governing equations of the problem are converted into dimensionless form. Further, we develop the constant proportional Caputo fractional model with a new operator with power law kernel which can be used to study the fluid behaviour for different values of fractional parameter at the present time. We applied the Laplace transform method to obtain the solutions and to see the impact of hybrid nanofluids and fractional parameter αα respectively. We compared the present results with the recently published work (Nehad et al, Adv. Mech. Eng. 11(7): 1 (2019)) with Caputo fractional derivative. As a result, we have found that the present solutions are best to describe the memory concept of temperature and velocity. For small values of fractional parameter, temperature and velocity have maximum values and for larger values of fractional parameter, temperature and velocity have minimum values. Further, rate of heat transfer and skin friction are also computed in tabular forms and it is found that Nusselt number with CPC is much less than that is computed with Caputo fractional derivative for greater values of fractional parameter αα. Keywords: hybrid nanofluids, Newtonian fluid, pressure gradient, channel flow, power law kernel. Research Outlook 2020 | 27
87. Saleem, N., Iqbal, I., Iqbal, B., & Radenovíc, S. (2020). Coincidence and fixed points of multivalued F‐ contractions in generalized metric space with application. Journal of Fixed Point Theory and Applications, 22(4), 81. doi: 10.1007/s11784‐020‐00815‐3. (Bilal Iqbal (Mathematics/SSC) Abstract: The aim of the paper was to prove some new fixed point theorems, coincidence point theorems and common fixed point theorems for multivalued F‐contractions involving a binary relation that is not necessarily a partial order, in the context of generalized metric spaces (in the sense of Jleli and Samet). We also prove existence of common solutions to integral inclusions. Keywords: fixed point, common fixed point, coincidence point, periodic point, f‐contraction, js‐generalized metric space.
88. Jhangeer, A., Munawar, M., Riaz, M. B., & Baleanu, D. (2020). Construction of traveling waves patterns of (1+n)‐dimensional modified Zakharov‐Kuznetsov equation in plasma physics. Results in Physics, 19, 103330. doi: https://doi.org/10.1016/j.rinp.2020.103330. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this research, we examine the modified model of (1+n)‐dimensional Zakharov‐Kuznetsov (ZK) equation, which will be used to analyze the nature of weakly nonlinear traveling waves in the existence of a constant magnetic area in a plasma comprising in cold ions and hot isothermal electrons. The modified Zakharov‐Kuznetsov (mZK) equation will have solutions describing the traveling solitary waves, using the extended (G′G2)‐expansion method and extended direct algebraic method gives way to the mZK equation regulating the transmission of ion dynamics for nonlinear traveling waves in a plasma. The sufficient conditions for the stability and existence of the traveling wave solutions are reported. Semi‐dark, rational, and singular solitary wave solutions are computed. Graphical interpretations of certain practical solutions for specific values of parameters have also been available. The research findings reported throughout this evaluation are fresh and from which this model is employed to analyze waves in numerous plasmas, could be valuable and important. Subsequently, there are concluding remarks mentioned.
Keywords: modified zakharov‐kuznetsov equation, soliton solutions, cubic duffing equation, the extended ‐ expansion method, new extended algebraic method.
89. Iqbal, S., Adil Khan, M., Abdeljawad, T., Samraiz, M., Rahman, G., & Nisar, K. S. (2020). New general Grüss‐ type inequalities over σ‐finite measure space with applications. Advances in Difference Equations, 2020(1), 468. doi: 10.1186/s13662‐020‐02933‐1. (Sajid Iqbal (Mathematics/Knowledge Unit of Science)(SKT Campus) Abstract: In this paper, we establish some new integral inequalities involving general kernels. We obtain the related broad range of fractional integral inequalities. Also, we apply the Young inequality to find new forms of inequalities for generalized kernels. These new and motivated results generalize the results for fractional integrals such that fractional integral of a function with respect to an increasing function, Riemann–Lioville fractional integrals, Erdélyi–Kober fractional integrals, Hadamard fractional integrals, generalized factional integral integrals in addition to the corresponding k‐fractional integrals. Keywords: grüss‐type inequalities, kernel, fractional integrals, young’s inequality.
90. Siddique, I., & Akgül, A. (2020). Analysis of MHD generalized first problem of Stokes’ in view of local and non‐ local fractal fractional differential operators. Chaos, Solitons & Fractals, 140, 110161. doi: https://doi.org/10.1016/j.chaos.2020.110161. (Imran Siddique (Mathematics/SSC) Abstract: In this work, we investigate the unsteady MHD generalized first problem of Stokes’ for an incompressible viscous fluid under isothermal conditions. The developed governing equations for the problem are formulated with the newly introduced fractal fractional operators with power law, exponential decay law and Research Outlook 2020 | 28
the Mittag‐Leffler law kernels. For every operator, we give a point by point examination including, numerical arrangement and stability investigation. Likewise, we present some numerical recreation. Keywords: fractal fractional derivative, mittag‐leffler kernel, stability analysis, discretization.
91. Awrejcewicz, J., Zafar, A. A., Kudra, G., & Riaz, M. B. (2020). Theoretical study of the blood flow in arteries in the presence of magnetic particles and under periodic body acceleration. Chaos, Solitons & Fractals, 140, 110204. doi: https://doi.org/10.1016/j.chaos.2020.110204.(Muhammad Bilal Riaz (Mathematics/SSC) Abstract: In this article, the dynamics of blood with suspended magnetic particles in coronal and femoral arteries are investigated. The flow of blood is examined in the presence of external magnetic field, periodic body acceleration and a pressure gradient of an oscillating type. Expressions for the velocity of blood and velocity of magnetic particles will be yielded by employing integral transforms. The analytical results will be expressed in terms of steady‐state and transient parts. Moreover, to get insight of the control of the material parameters such as amplitude, the lead angle, frequency of body acceleration, magnetic field and particles’ concentration parameter, numerical simulations and graphical illustrations will be used and useful consequences will be summarized. Keywords: bio fluid, body acceleration, magnetic field, integral transforms.
92. Rauf, A., Mahsud, Y., & Siddique, I. (2020). Multi‐layer flows of immiscible fractional Maxwell fluids in a cylindrical domain. Chinese Journal of Physics, 67, 265‐282. doi: https://doi.org/10.1016/j.cjph.2019.09.015.(Imran Siddique (Mathematics/SSC) Abstract: Laminar unsteady multilayer axial flows of fractional immiscible Maxwell fluids in a circular cylinder are investigated. The flow of fluids is generated by a time‐dependent pressure gradient in the axial direction and by the translational motion of a cylinder along his axis. The considered mathematical model is based on the fractional constitutive equation of Maxwell fluids with Caputo time‐fractional derivatives. Analytical solutions for the fractional differential equations of the velocity fields with boundary and interfaces conditions have been determined by using the Laplace transform coupled with the Hankel transform of order zero and the Weber transform of order zero. The influence of the memory effects on the motion of the fluid has been investigated for the particular case of three fractional Maxwell fluids. It is found that for increasing values of the fractional parameter the fluid velocity is decreasing. The memory effects have a stronger influence on the velocity of the second layer. Keywords: Maxwell fluid, Fractional constitutive equation, Multi‐layer flow, Integral transforms, Velocity field.
93. Kang, S., Chu, Y.‐M., Virk, Abaid‐Ur‐Rehman, Nazeer, W., & Jia, J. (2020). Computing Irregularity Indices for Probabilistic Neural Network. Frontiers in Physics, 8(359). doi: 10.3389/fphy.2020.00359.(Abaid‐Ur‐ Rehman Virk (Mathematics/SSC) Abstract: A topological index (TI) is a quantity expressed as a number that help us to catch symmetry of network. With the help of quantitative structure property relationship (QSPR), we can guess physical and chemical properties of several networks. A neural network is a computer system based on the nerve system. There are numerous uses of these systems in different fields of studies but their most critical use to date is in Neurochemistry. In this paper, we will discuss thirteen irregularity indices for probabilistic neural networks (PNN). Keywords: irregularity indices, probabilistic neural network, graph, topological index, zagreb index.
94. Faizi, S., Sałabun, W., Tabasam, R., Zafar, S., & Wątróbski, J. (2020). Intuitionistic Fuzzy Sets in Multi‐Criteria Group Decision Making Problems Using the Characteristic Objects Method. Symmetry, 12(9), 1382. doi: http://dx.doi.org/10.3390/sym12091382. (Tabasam Rashid, Sohail Zafar(Mathematics/SSC) Abstract: Over the past few decades, several researchers and professionals have focused on the development and application of multi‐criteria group decision making (MCGDM) methods under a fuzzy environment in Research Outlook 2020 | 29
different areas and disciplines. This complex research area has become one of the more popular topics, and it seems that this trend will be increasing. In this paper, we propose a new MCGDM approach combining intuitionistic fuzzy sets (IFSs) and the Characteristic Object Method (COMET) for solving the group decision making (GDM) problems. The COMET method is resistant to the rank reversal phenomenon, and at the same time it remains relatively simple and intuitive in practical problems. This method can be used for both symmetric and asymmetric information. The Triangular Intuitionistic Fuzzy Numbers (TIFNs) have been used to handle uncertain data. This concept can ensure the preference information about an alternative under specific criteria more comprehensively and allows for easy modelling of symmetrical or asymmetrical linguistic values. Each expert provides the membership and non‐membership degree values of intuitionistic fuzzy numbers (IFNs). So this approach deals with a different kind of uncertainty than with hesitant fuzzy sets (HFSs). The proposed combination of COMET and IFSs required an adaptation of the matrix of expert judgment (MEJ) and allowed to capture the behaviour aspects of the decision makers (DMs). Therefore, we get more reliable solutions while solving MCGDM problems. Finally, the proposed method is presented in a simple academic example. Keywords: intuitionistic fuzzy sets, multi‐criteria group decision making, the COMET method.
95. Abbas, M., Shatanawi, W., Farooq, S., & Mitrović, Z. D. (2020). On a JH‐operators pair of type (A) with applications to integral equations. Journal of Fixed Point Theory and Applications, 22(3), 72. doi: 10.1007/s11784‐020‐00807‐3. (Sadia Farooq (Mathematics/SSC) Abstract: The aim of this paper is to introduce a new class of noncommuting mappings called JH‐operator pairs of type (A). We obtain the unique point of coincidence point in generalized metric spaces and the common fixed point results of such pairs of mappings in the setting of metric spaces. Some examples are also presented to support the concepts and results proved herein. We prove the existence of solution of nonlinear integral equations as an application of our result. In the end, we give any open question. Keywords: Coincidence point, point of coincidence, common fixed point, weakly compatible mapping, JH‐ operator pair, JH‐operator pair of type (R), JH‐operator pair of type (A), generalized metric space, metric space.
96. Mohammed, M. A., AL‐Mayyahi, S. Y. A., Chu, Y.‐M., Virk, Abaid‐Ur‐Rehman, Rehman, H. M. (2020). Irregularity indices for line graph of Dutch windmill graph. Proyecciones (Antofagasta), 39(4), 903‐918. doi: http://dx.doi.org/10.22199/issn.0717‐6279‐2020‐04‐0056. (Abaid‐Ur‐Rehman Virk (Mathematics/SSC) Abstract: Among topological descriptors topological indices are significant and they have a conspicuous role in chemistry. Dutch Windmill graph D x y can be obtain by taking x copies of cycle C y with a vertex in common. In this paper, we will compute some irregularity índices that are useful in quantitative structure activity relationship for Line Graph of Dutch Windmill graph. Keywords: dutch windmill graph, irregularity indices.
97. Ahmed, N., Elsonbaty, A., Adel, W., Baleanu, D., & Rafiq, M. (2020). Stability analysis and numerical simulations of spatiotemporal HIV CD4+ T cell model with drug therapy. Chaos: An Interdisciplinary Journal of Nonlinear Science, 30(8), 083122. doi: 10.1063/5.0010541.(Nauman Ahmed (Mathematics/SSC) Abstract: In this study, an extended spatiotemporal model of a human immunodeficiency virus (HIV) CD4+ T cell with a drug therapy effect is proposed for the numerical investigation. The stability analysis of equilibrium points is carried out for temporal and spatiotemporal cases where stability regions in the space of parameters for each case are acquired. Three numerical techniques are used for the numerical simulations of the proposed HIV reaction–diffusion system. These techniques are the backward Euler, Crank–Nicolson, and a proposed structure preserving an implicit technique. The proposed numerical method sustains all the important characteristics of the proposed HIV model such as positivity of the solution and stability of equilibria, whereas the other two methods have failed to do so. We also prove that the proposed technique is positive, consistent, and Von Neumann stable. The effect of different values for the parameters is investigated through numerical simulations Research Outlook 2020 | 30
by using the proposed method. The stability of the proposed model of the HIV CD4+ T cell with the drug therapy effect is also analyzed. Keywords: not available.
98. Faizi, S., Sałabun, W., Ullah, S., Rashid, T., Więckowski, J. (2020). A New Method to Support Decision‐ Making in an Uncertain Environment Based on Normalized Interval‐Valued Triangular Fuzzy Numbers and COMET Technique. Symmetry, 12(4), 516. doi: https://doi.org/10.3390/sym12040516. (Tabasam Rashid (Mathematics/SSC) Abstract: Multi‐criteria decision‐making (MCDM) plays a vibrant role in decision‐making, and the characteristic object method (COMET) acts as a powerful tool for decision‐making of complex problems. COMET technique allows using both symmetrical and asymmetrical triangular fuzzy numbers. The COMET technique is immune to the pivotal challenge of rank reversal paradox and is proficient at handling vagueness and hesitancy. Classical COMET is not designed for handling uncertainty data when the expert has a problem with the identification of the membership function. In this paper, symmetrical and asymmetrical normalized interval‐valued triangular fuzzy numbers (NIVTFNs) are used for decision‐making as the solution of the identified challenge. A new MCDM method based on the COMET method is developed by using the concept of NIVTFNs. A simple problem of MCDM in the form of an illustrative example is given to demonstrate the calculation procedure and accuracy of the proposed approach. Furthermore, we compare the solution of the proposed method, as interval preference, with the results obtained in the Technique for Order of Preference by Similarity to Ideal solution (TOPSIS) method (a certain preference number). Keywords: multi‐criteria decision‐making, the COMET method, triangular fuzzy number.
99. Nasir, R., Zahid, Z., & Zafar, S. (2020). Edge version of metric dimension for the families of grid graphs and generalized prism graphs. Discrete Mathematics, Algorithms and Applications, 12(03), 2050037. doi: 10.1142/s1793830920500378. (Ruby Nasir, Zohaib Zahid, Sohail Zafar (Mathematics/SSC) Abstract: The minimum edge version of metric basis is the smallest set SESE of edges in a connected graph GG such that for every pair of edges e1,e2e1,e2∈∈EG,EG, there exists an edge ee∈∈SESE for which dE(e1,e)dE(e1,e)≠≠dE(e2,e)dE(e2,e) holds. In this paper, the families of grid graphs and generalized prism graphs have been studied for edge version of metric dimension. Edge version of metric dimension is found to be constant for both families of graphs. Keywords: line graph, grid graph, generalized prism graph, edge version of resolving sets, edge version of metric dimension.
100. Ahmad, M., Ameen, N., Zahid, Z., & Zafar, S. (2020). Computing edge version of metric and double metric dimensions of Kayak paddle graphs. Discrete Mathematics, Algorithms and Applications, 12(05), 2050070. doi: 10.1142/s1793830920500706. (Muhammad Ahmad, Naeem Ameen, Zohaib Zahid, Sohail Zafar (Mathematics/SSC) Abstract: Locating the source of diffusion in complex networks is an exciting but challenging task. It is critical for preventing and controlling the epidemic risks. Source localization has been studied under many feasible models. In this paper, we discuss the localization problem in Kayak paddle graphs KP(l,m,n)KP(l,m,n) for l,m≥3l,m≥3 and n≥2n≥2 by computing edge version of metric and double metric dimensions. Keywords: Edge version of resolving sets and metric dimension, edge version of doubly resolving sets and double metric dimension, Kayak paddle graphs.
101. Guirao, J. L. G., Sarwar Sindhu, M., Rashid, T., & Kashif, A. (2020). Multiple Criteria Decision‐Making
Research Outlook 2020 | 31
Based on Vector Similarity Measures under the Framework of Dual Hesitant Fuzzy Sets. Discrete Dynamics in Nature and Society, 2020, 1425487. doi: 10.1155/2020/1425487. (M. Sarwar Sindhu, Tabasam Rashid , Agha Kashif (Mathematics/SSC) Abstract: Similarity measures have a great importance in the decision‐making process. In order to identify the similarity between the options, many experts have established several types of similarity measures on the basis of vectors and distances. The Cosine, Dice, and Jaccard are the vector similarity measures. The present work enclosed the modified Jaccard and Dice similarity measures. Founded on the Dice and Jaccard similarity measures, we offered a multiple criteria decision‐making (MCDM) model under the dual hesitant fuzzy sets (DHFSs) situation, in which the appraised values of the alternatives with respect to criteria are articulated by dual hesitant fuzzy elements (DHFEs). Since the weights of the criteria have a much influence in making the decisions, therefore decision makers (DMs) allocate the weights to each criteria according to their knowledge. In the present work, we get rid of the doubt to allocate the weights to the criteria by taking an objective function under some constraints and then extended the linear programming (LP) technique to evaluate the weights of the criteria. The Dice and Jaccard weighted similarity measures are practiced amongst the ideal and each alternative to grade all the alternatives to get the best one. Eventually, two practical examples, about investment companies and selection of smart phone accessories are assumed to elaborate the efficiency of the proposed methodology. Keywords: not available.
102. Gao, W., Idrees, B., Zafar, S., & Rashid, T. (2020). Construction of Nonlinear Component of Block Cipher by Action of Modular Group PSL(2, Z) on Projective Line PL(GF(28)). IEEE Access, 8, 136736‐136749. doi: 10.1109/ACCESS.2020.3010615. (Bazgha Idrees, Sohail Zafar, Tabasam Rashid (Mathematics/SSC) Abstract: Substitution box (S‐Box) has a prominent significance being the fundamental nonlinear component of block cipher which fulfils confusion, one of the properties proposed by Claude Shannon in 1949. In this paper, we proposed an S‐Box by using the action of modular group PSL (2,Z) on projective line PL (F257) over Galois field GF (28) . In the first step we obtained elements of GF (28) by using powers of α , where α is the primitive root of irreducible polynomial p(x) of order 8 over field Z2 , then applied the generators of PSL (2,Z) and followed steps to get rid of infinity from output. In the final step of proposed scheme, one of the permutations of S16 is applied which enhanced the possible number of S‐Boxes obtained by any single specific irreducible polynomial p(x) over field Z2 of order 8. We analyzed performance of the proposed 8×8 S‐Box under cryptographic properties such as strict avalanche criterion, bit independence criterion, nonlinearity, differential approximation probability, linear approximation probability; and compared obtained results with a number of renowned S‐Boxes. Lastly, we performed statistical analysis (which comprises of contrast analysis, homogeneity analysis, energy analysis, correlation analysis, entropy analysis and mean of absolute deviation analysis) on our proposed S‐Box and obtained results have been compared with adequate number of S‐Boxes. Keywords: MS action of modular group, cryptographic properties’ analyses, finite field, majority logic criterion, s‐ bo.
103. Qiang, X., Siddique, I., Sadiq, K., & Shah, N. A. (2020). Double diffusive MHD convective flows of a viscous fluid under influence of the inclined magnetic field, source/sink and chemical reaction. Alexandria Engineering Journal. 59 (6). 4171‐4181. doi: https://doi.org/10.1016/j.aej.2020.07.023. (Imran Siddique, Kashif Sadiq (Mathematics/SSC) Abstract: Unsteady magneto‐hydrodynamic double‐diffusive convection flows between two infinite vertical parallel plates have been investigated in the presence of the inclined magnetic field, heat generation or absorption, and chemical reaction. The dimensionless form of governing equations for momentum, energy and concentration has been solved using the integral transforms (Laplace and finite sine‐Fourier transforms). The exact solutions for the velocity, temperature and concentration are obtained without any constraints. Semi Research Outlook 2020 | 32
analytical solutions of these problems are also established by using the Laplace inversion numerical algorithms Stehfest’s and Tzou’s. Further, we compare our obtained analytical and numerical results in graphical and tabular forms. Finally, the influence of pertinent parameters on the fluid velocity, temperature and concentration have been disused in detailed through graphs. Keywords: free convection, inclined magnetic field, Laplace and finite sine‐fourier transforms, dufour effect, chemical reaction.
104. Huo, C., Bashir, H., Zahid, Z., & Chu, Y. M. (2020). On the 2‐metric resolvability of graphs. AIMS Mathematics, 5(6), 6609–6619. doi: DOI: 10.3934/math.2020425. (Humera Bashir, Zohaib Zahid (Mathematics/SSC) Abstract: Let G=(V(G),E(G)) be a graph. An ordered set of vertices R={v1,v2,…,vl} is a 2−resolving set for G if for any distinct vertices s,w∈V(G), the representation of vertices r(s|R)=(dG(s,v1),…,dG(s,vl)) and r(w|R)=(dG(w,v1),…,dG(w,vl)) differs in at least 2 positions. A 2−resolving set of minimum cardinality is called a 2−metric basis of G and its cardinality is called the 2−metric dimension (fault‐tolerant metric dimension). In this article, the exact value of the 2−metric dimension of the family circulant graph Cn(1,2) is computed and thereby disproving the conjecture given by H. Raza et al., [Mathematics. 2019, 7(1), 78]. The 2−metric dimension of the family generalized prism graph Pm×Cn and the Möbius ladder graph Mn is computed. Furthermore, we improved the result given by M. Ali et al., [Ars Combinatoria 2012, 105, 403‐410]. Keywords: k−metric dimension, circulant graph, the generalized prism graph, möbius ladder.
105. Yousaf, S., Bhatti, A. A., & Ali, A. (2020). Minimum Variable Connectivity Index of Trees of a Fixed Order. Discrete Dynamics in Nature and Society, 2020, 3976274. doi: 10.1155/2020/3976274. (Akbar Ali (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: The connectivity index, introduced by the chemist Milan Randić in 1975, is one of the topological indices with many applications. In the first quarter of 1990s, Randić proposed the variable connectivity index by extending the definition of the connectivity index. The variable connectivity index for graph is defined as , where is a nonnegative real number, is the edge set of , and denotes the degree of an arbitrary vertex in . Soon after the innovation of the variable connectivity index, its various chemical applications have been reported in different papers. However, to the best of the authors’ knowledge, mathematical properties of the variable connectivity index, for, have not yet been discussed explicitly in any paper. The main purpose of the present paper is to fill this gap by studying this topological index in a mathematical point of view. More precisely, in this paper, we prove that the star graph has the minimum variable connectivity index among all trees of a fixed order, where. Keywords: not available.
106. Li, Q.‐Z., Virk, Abaid‐Ur‐Rehman, Nazar, K., Ahmed, I., & Tlili, I. (2020). Valency‐Based Descriptors for Silicon Carbides, Bismuth(III) Iodide, and Dendrimers in Drug Applications. Journal of Chemistry, 2020, 8616309. doi: 10.1155/2020/8616309. (Abaid‐Ur‐Rehman Virk (Mathematics/SSC) Abstract: Silicon carbide (SiC), also called carborundum, is a semiconductor containing silicon and carbon. Dendrimers are repetitively branched molecules that are typically symmetric around the core and often adopt a spherical three‐dimensional morphology. Bismuth(III) iodide is an inorganic compound with the formula . This gray‐black solid is the product of the reaction between bismuth and iodine, which once was of interest in qualitative inorganic analysis. In chemical graph theory, we associate a graph to a compound and compute topological indices that help us in guessing properties of the understudy compound. A topological index is the graph invariant number, calculated from a graph representing a molecule. Most of the proposed topological indices are related either to a vertex adjacency relationship (atom‐atom connectivity) in the graph or to Research Outlook 2020 | 33
topological distances in the graph. In this paper, we aim to compute the first and second Gourava indices and hyper‐Gourava indices for silicon carbides, bismuth(III) iodide, and dendrimers. Keywords: not available.
107. Ahmad, M., Imran, M. A., & Nazar, M. (2020). Mathematical modeling of (Cu−Al2O3) water based Maxwell hybrid nanofluids with Caputo‐Fabrizio fractional derivative. Advances in Mechanical Engineering, 12(9), 1687814020958841. doi: 10.1177/1687814020958841. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this article, a free convection flow of Cu−𝐴𝑙2𝑂3−𝐻2𝑂 hybrid Maxwell nanofluids through a channel formed by two infinite vertical plates have been studied. Together with the the energy balance and heat source, a fractional model of Maxwell fluid is considered. To develop an analytical exact solution for velocity field, only the Caputo‐Fabrizio definition of non‐integral derivative together with application of Laplace transform method has been used. Some graphical presentation and discussion are made to see the effects of hybrid nanofluids and non‐dimensional parameters on velocity boundary layer. As a result, a dual behavior of velocity was exposed due to fractional parameter for large and small times. A comparison between two kind of non‐Newtonian fluids has been made and found that Brinkman fluid is more viscous than Maxwell fluid. Also, by letting Brinkman and Maxwell parameters zero, they coincides and the results obtained for Newtonian fluid showed graphically. The obtained results are realistic from the fractional model as by adjusting the values of fractional parameter can be compared with some experimental data. Keywords: Caputo‐Fabrizio, hybrid nanofluid, channel flow, boundary layer, heat source, Maxwell fluid.
108. Samraiz, M., Nawaz, F., Iqbal, S., Abdeljawad, T., Rahman, G., & Nisar, K. S. (2020). Certain mean‐type fractional integral inequalities via different convexities with applications. Journal of Inequalities and Applications, 2020(1), 208. doi: 10.1186/s13660‐020‐02474‐x. (Sajid Iqbal (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: In this paper, we establish certain generalized fractional integral inequalities of mean and trapezoid type for (s+1)(s+1)‐convex functions involving the (k,s)(k,s)‐Riemann–Liouville integrals. Moreover, we develop such integral inequalities for h‐convex functions involving the k‐conformable fractional integrals. The legitimacy of the derived results is demonstrated by plotting graphs. As applications of the derived inequalities, we obtain the classical Hermite–Hadamard and trapezoid inequalities. Keywords: Mean‐type inequalities, h‐convex; (s+1)‐convex, k‐conformable integral, (k,s)‐Riemann–Liouville fractional integral, Conformable integral, Trapezoid inequalities.
109. Saleem, M. U., Farman, M., Meraj, M., & Tabassum, M. F. (2020). Comparison of Glucose Insulin Model for Artificial Pancreas. Proceedings of the Pakistan Academy of Sciences: A. Physical and Computational Sciences, 56(4), 43–54‐43–54. (Muhammad Farhan Tabassum (Mathematics/SSC) Abstract: The controllability and observability of a glucose‐insulin system are checked for Bergman’s minimal model, Sandhya model, Hovorka model, Sturis Tolic model and their modified form for a type 1 diabetic patient. These models are to simulate the glucose‐insulin system for the treatment of type 1 diabetes mellitus. Models take the only insulin as input and glucose as an output. A control system can only be used in the form of closed‐ loop control to stabilize the system. It would enable diabetic patients to control their disease. Currently, no fully automated artificial pancreas is available. Comparison of controllability and observability are measured for this purpose. These models can be used to simulate a glucose‐insulin system for the treatment of type 1 diabetes. This may play an important role in the development of the fully automatic artificial pancreas and stabilize the control loop system for the Glucose Insulin pump. Keywords: ordinary differential equation models, artificial pancreas, observability, controllability, linear control.
Research Outlook 2020 | 34
110. Bin Wahid, S., Ain, Q. U., Quraishi, A., & Wahid, B. (2020). Clinical correlation of liver function tests with suppression of cytokine signaling (SOCS1) gene expression in HCV infected patients: A real‐world clinical experience. Journal of Medical Virology, 92(2), 257‐259. doi: 10.1002/jmv.25596. (Qurat Ul Ain (Mathematics/SSC) Azra Quraish, Braira Wahid (Life Sciences/SSC) Abstract: Hepatitis C virus (HCV) is the leading cause of chronic liver complications globally and suppressor of cytokine signaling‐1 (SOCS‐1) is a gene triggered by cytokines that activates transcription of the JAK/STAT signal transduction pathway and negatively regulates Janus kinase‐signal transducer. Several studies have shown that the expression of SOCS1 and SOCS3 genes negatively regulate the response of HCV infection to interferon therapy and interferon‐free regimens. It has been reported that liver function enzymes elevate in CHC patients but the association of SOCS1 gene expression with LFTs haven't been studied. This study recruited 114 CHC patients and 112 normal healthy participants and analyzed the correlation of SOCS1 gene expression and liver function enzymes (LFEs). Herein, we observed that the expression of SOCS1 gene had a positive correlation with LFEs. Keywords: ALP, ALT, AST, HCV, LFTs, SOCS1 gene.
111. Saeed, S. T., Khan, I., Riaz, M. B., & Husnine, S. M. (2020). Study of Heat Transfer under the Impact of Thermal Radiation, Ramped Velocity, and Ramped Temperature on the MHD Oldroyd‐B Fluid Subject to Noninteger Differentiable Operators. Journal of Mathematics, 2020, 8890820. doi: 10.1155/2020/8890820. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: This theoretical study explores the impact of heat generation/absorption with ramp wall velocity and ramp wall temperature on the magnetohydrodynamic (MHD) time‐dependent Oldroyd‐B fluid over an unbounded plate embedded in a porous surface. The mathematical analysis of fractional governing partial differential equations has been established using systematic and powerful techniques of Laplace transform with its numerical inversion algorithms. The fractionalized solutions have been traced out separately through all fractional differential operators. Nondimensional parameters along with Laplace transformation are used to find the solution of temperature and velocity profiles. Fractional time derivatives are used to analyze the impact of fractional parameters (memory effect) on the dynamics of the fluid. While making a comparison, it is observed that the fractional‐order model is the best to explain the memory effect as compared to classical models. The obtained solutions are plotted graphically for different values of physical parameters. Our results suggest that the velocity profile decreases by increasing the effective Prandtl number. Furthermore, the existence of an effective Prandtl number may reflect the control of the thickness of momentum and enlargement of thermal conductivity. Keywords: not available.
112. Liu, J.‐B., Afzal, H. U., & Javaid, M. (2020). Computing Edge Weights of Magic Labeling on Rooted Products of Graphs. Mathematical Problems in Engineering, 2020, 2160104. doi: 10.1155/2020/2160104. (Muhammad Javaid (Mathematics/SSC) Abstract: Labeling of graphs with numbers is being explored nowadays due to its diverse range of applications in the fields of civil, software, electrical, and network engineering. For example, in network engineering, any systems interconnected in a network can be converted into a graph and specific numeric labels assigned to the converted graph under certain rules help us in the regulation of data traffic, connectivity, and bandwidth as well as in coding/decoding of signals. Especially, both antimagic and magic graphs serve as models for surveillance or security systems in urban planning. In 1998, Enomoto et al. introduced the notion of super edge‐antimagic labeling of graphs. In this article, we shall compute super edge‐antimagic labeling of the rooted product of and the complete bipartite graph combined with the union of path, copies of paths, and the star. We shall also compute a super edge‐antimagic labeling of rooted product of with a special type of pancyclic graphs. The labeling provided here will also serve as super edge‐antimagic labeling of the aforesaid graphs. All the structures Research Outlook 2020 | 35
discussed in this article are planar. Moreover, our findings have also been illustrated with examples and summarized in the form of a table and 3 plots. Keywords: not available.
113. Liu, J.‐B., Raza, Z., & Javaid, M. (2020). Zagreb Connection Numbers for Cellular Neural Networks. Discrete Dynamics in Nature and Society, 2020, 8038304. doi: 10.1155/2020/8038304. (Muhammad Javaid (Mathematics/SSC) Abstract: Neural networks in which communication works only among the neighboring units are called cellular neural networks (CNNs). These are used in analyzing 3D surfaces, image processing, modeling biological vision, and reducing nonvisual problems of geometric maps and sensory‐motor organs. Topological indices (TIs) are mathematical models of the (molecular) networks or structures which are presented in the form of numerical values, constitutional formulas, or numerical functions. These models predict the various chemical or structural properties of the under‐study networks. We now consider analogous graph invariants, based on the second connection number of vertices, called Zagreb connection indices. The main objective of this paper is to compute these connection indices for the cellular neural networks (CNNs). In order to find their efficiency, a comparison among the obtained indices of CNN is also performed in the form of numerical tables and 3D plots. Keywords: not available.
114. Awais, H. M., Javaid, M., & Ali, A. (2020). First General Zagreb Index of Generalized F‐sum Graphs. Discrete Dynamics in Nature and Society, 2020, 2954975. doi: 10.1155/2020/2954975. (Hafiz Muhammad Awais, Muhammad Javaid (Mathematics/SSC) Abstract: )e first general Zagreb (FGZ) index (also known as the general zeroth‐order Randic index) of a graph ´ G can be defined as Mc(G) � �uv∈E(G)[dc− 1 G (u) + dc− 1 G (v)], where c is a real number. As Mc(G) is equal to the order and size of G when c � 0 and c � 1, respectively, c is usually assumed to be different from 0 to 1. In this paper, for every integer c ≥ 2, the FGZ index Mc is computed for the generalized F‐sums graphs which are obtained by applying the different operations of subdivision and Cartesian product. )e obtained results can be considered as the generalizations of the results appeared in (IEEE Access; 7 (2019) 47494–47502) and (IEEE Access 7 (2019) 105479–105488). Keywords: not available.
115. Zulqarnain, R. M., Saeed, M., Ahamad, M. I., Abdal, S., Zafar, Z., & Aslam, M. (2020). Application of Intuitionistic Fuzzy Soft Matrices for Disease Diagnosis. International Journal of Discrete Mathematics. 5(1): 4‐9. doi:10.11648/j.dmath.20200501.12. (Muhammad Saeed (Mathematics/SSC) Abstract: Decision Making is the best procedure to choose a superlative alternative from all feasible alternatives. Almost in all other issues, the overall number of criteria because decision making the general alternatives is pervasive. Nowadays decision making is a critical problem in every field of life. In some cases, we must deliberate membership unbiassed as the non‐ membership values for the suitable representation of an object in uncertain and indeterminate conditions that could not be handled by fuzzy sets nor by interval‐valued fuzzy sets. To overcome these difficulties the notion of Intuitionistic fuzzy sets has been presented. In this paper, we study some basic concepts of fuzzy sets, soft sets, fuzzy soft sets, intuitionistic fuzzy sets, intuitionistic soft sets, intuitionistic fuzzy soft sets (IFSS), and intuitionistic fuzzy soft matrices (IFSM). Finally, in this research, we use the IFSM for disease diagnoses in patients who suffer from different diseases such as stomach ulcer and typhoid by using hypothetical data we conclude that patient p2 suffering stomach ulcer p2 and p3 patients suffering from typhoid. Keywords: Fuzzy Set, Fuzzy Soft Set, Intuitionistic Soft Set, Intuitionistic Fuzzy Soft Set, Intuitionistic Fuzzy Soft Matrices. Research Outlook 2020 | 36
116. Rahman, A. U., Saeed, M., Smarandache, F., & Ahmad, M. R. (2020). Development of Hybrids of Hypersoft Set with Complex Fuzzy Set, Complex Intuitionistic Fuzzy set and Complex Neutrosophic Set. Neutrosophic Sets & Systems (38), 335‐354. (Atiqe Ur Rahman, Muhammad Saeed, Muhammad Rayees Ahmad (Mathematics/SSC) Abstract: The complex fuzzy soft set and its generalized hybrids are such effective structures which not only minimize the impediments of all complex fuzzy‐like structures for dealing uncertainties but also fulll all the parametric requirements of soft sets. This feature makes it a completely new mathematical tool for solving problems dealing with uncertainties. Smarandache conceptualized hypersoft set as a generalization of soft set as it transforms the single attribute function into a multi‐attribute function. This generalization demands an extension of complex fuzzy soft‐like structures to hypersoft structure for more precise results. In this study, hybrids of hypersoft set with complex fuzzy set and its generalized structures i.e. complex intuitionistic fuzzy set and complex neutrosophic set, are developed along with illustrative examples to address the demand of literature. Moreover, some of their fundamentals i.e. subset, equal sets, null set, absolute set etc. and theoretic operations i.e. compliment, union, intersection etc. are discussed. Keywords: Complex fuzzy sets (CF‐Sets), soft set, hypersoft set and complex fuzzy hypersoft set.
117. Rahman, A. U., Saeed, M., & Smarandache, F. (2020). Convex and Concave Hypersoft Sets with Some Properties. Neutrosophic Sets & Systems (38), 497‐508. (Atiqe Ur Rahman, Muhammad Saeed (Mathematics/SSC) Abstract: Convexity plays an imperative role in optimization, pattern classication and recognition, image processing and many other relating topics in dierent elds of mathematical sciences like operation research, numerical analysis etc. The concept of soft sets was rst formulated by Molodtsov as a completely new mathematical tool for solving problems dealing with uncertainties. Smarandache conceptualized hypersoft set as a generalization of soft set (hS;E) as it transforms the function hS into a multi‐attribute function hHS. Deli introduced the concept of convexity cum concavity on soft sets to cover above topics under uncertain scenario. In this study, a theoretic and analytical approach is employed to develop a conceptual framework of convexity cum concavity on hypersoft set which is generalized and more effective concept to deal with optimization relating problems. Moreover, some generalized properties like Delta‐inclusion, intersection and union, are established. The novelty of this work is maintained with the help of illustrative examples and pictorial version rst time in literature. Keywords: convex soft set, concave soft set, hypersoft set, convex hypersoft set, concave hypersoft set.
118. Zulqarnain, R. M., Xiao Long, X., Saeed, M., Smarandache, F., & Ahmad, N. (2020). Generalized Neutrosophic TOPSIS to Solve Multi‐Criteria Decision‐Making Problems. Neutrosophic Sets & Systems (38), 276‐292. (Muhammad Saeed, Nadeem Ahmad (Mathematics/SSC) Abstract: Multi‐criteria decision making (MCDM) is the technique of selecting the best alternative from multiple alternatives and multiple conditions. The technique for order preference by similarity to an ideal solution (TOPSIS) is a crucial practical technique for ranking and selecting different options by using a distance measure. In this article, we protract the fuzzy TOPSIS technique to neutrosophic fuzzy TOPSIS, and prove the accuracy of the method by explaining the MCDM problem with single‐ value neutrosophic information, and use the method for supplier selection in the production industry. We hope that this article will promote future scientific research on numerous existence issues based on multi‐criteria decision making. Keywords: neutrosophic set, single valued neutrosophic set, TOPSIS, MCDM.
119. Saeed, M., Saqlain, M., & Mehmood, A. (2020). Application of Similarity Measure on m‐polar Interval‐ Research Outlook 2020 | 37
valued Neutrosophic Set in Decision Making in Sports. Neutrosophic Sets & Systems (38), 317‐334. (Muhammad Saeed, Asad Mehmood (Mathematics/SSC) Abstract: In real life, most of the problems occurred by wrong decision making, while in sports it is mandatory for every player, coach, and technique director to make a good and an ideal decision. In this paper, the concept of similarity measure is used in the neutrosophic environment for decision making in a football game for the selection of players. The data is collected in interval‐valued, while the new concept m‐polar is illustrated as previous records of m matches played by players. m‐polar structures provide multiple data on the concerned problem, so as a result the best solution can be developed for the selection problem. An m‐polar Intervalvalued Neutrosophic Set (mIVNS) is derived for the targeted task of player selection problem. Then some operations, properties, and distance measures are introduced on m‐polar Interval‐valued Neutrosophic Set (mIVNS). Distance‐base Similarity Measure is illustrated to each player with an ideal set in mIVNS structure. In the end, the Algorithm is given for ideal decision‐making in sports for the selection of players. Keywords: mIVNS Set, Operators on Mivns, Properties, Distance and Similarity Measure, Decision‐Making, Selection of Players.
120. Tabassum, M. F., Saeed, M., Chaudhry, N. A., & Akram, S. (2020). Treatment of Nonlinear Epidemiological Smoking Model using Evolutionary Padé‐approximation. Proceedings of the Pakistan Academy of Sciences: A. Physical and Computational Sciences. 57 (2): 11‐19. (Muhammad Farhan Tabassum, Muhammad Saeed, Sana Akram (Mathematics/SSC) Abstract: Smoking is the world's biggest public health concern. In epidemiology, the mechanisms of smoking addiction play a crucial role in mathematical models. In this paper Evolutionary Padé Approximation (EPA) scheme has been implemented for the treatment of the non‐linear epidemiological smoking model. The evolutionary Padé Approximation scheme transforms the nonlinear epidemiology smoking model into an optimization problem by using Padé‐approximation. Sufficient parameter settings for EPA have been implemented through MATLAB. Simulations represent numerical solutions of the epidemiology smoking model by solving the established optimization problem. First, the convergence solution of EPA scheme on population; potential smokers occasional smokers, heavy smokers, temporary quitters, and smokers who quit permanently have been studied and found to be significant. Evolutionary Padé Approximation has provided a convergence solution regarding the relationship among the different population compartments for diseases free equilibrium, it has been observed that the results EPA scheme are more reliable and significant when a comparison is drawn with Non‐Standard Finite Difference (NSFD) numerical scheme. Finally, the EPA scheme reduces the contaminated levels for disease‐free equilibrium very rapidly and restricts the spread of smoking within the population. Keywords: optimization, non‐linear epidemiological smoking model, padé approximation, differential evolution, penalty function.
121. Ahmad, M. R., Saeed, M., Afzal, U., & Yang, M.‐S. (2020). A Novel MCDM Method Based on Plithogenic Hypersoft Sets under Fuzzy Neutrosophic Environment. Symmetry, 12(11), 1855. doi: 10.3390/sym12111855. (Muhammad Rayees Ahmad, Muhammad Saeed, Usman Afzal (Mathematics/SSC) Abstract: In this paper, we advance the study of plithogenic hypersoft set (PHSS). We present four classifications of PHSS that are based on the number of attributes chosen for application and the nature of alternatives or that of attribute value degree of appurtenance. These four PHSS classifications cover most of the fuzzy and neutrosophic cases that can have neutrosophic applications in symmetry. We also make explanations with an illustrative example for demonstrating these four classifications. We then propose a novel multi‐criteria decision making (MCDM) method that is based on PHSS, as an extension of the technique for order preference by similarity to an ideal solution (TOPSIS). A number of real MCDM problems are complicated with uncertainty that Research Outlook 2020 | 38
require each selection criteria or attribute to be further subdivided into attribute values and all alternatives to be evaluated separately against each attribute value. The proposed PHSS‐based TOPSIS can be used in order to solve these real MCDM problems that are precisely modeled by the concept of PHSS, in which each attribute value has a neutrosophic degree of appurtenance corresponding to each alternative under consideration, in the light of some given criteria. For a real application, a parking spot choice problem is solved by the proposed PHSS‐ based TOPSIS under fuzzy neutrosophic environment and it is validated by considering two different sets of alternatives along with a comparison with fuzzy TOPSIS in each case. The results are highly encouraging and a MATLAB code of the algorithm of PHSS‐based TOPSIS is also complied in order to extend the scope of the work to analyze time series and in developing algorithms for graph theory, machine learning, pattern recognition, and artificial intelligence. Keywords: Soft set, hypersoft set, plithogenic hypersoft set (PHSS), multi‐criteria decision making (MCDM), PHSS‐ based TOPSIS.
122. Naveed, M., Saqlain, M., Saeed, M., & Abbas, Q. (2020). Application of Soft‐Set Relations and Soft Matrices in Medical Diagnosis using Sanchez’s Approach. International Journal of Computer Applications, 177 (32). 975, 8887. (Muhammad Saeed (Mathematics/SSC) Abstract: This article presents the concepts of soft set theory and its relations. It the common observation that more symptoms give more accuracy to calculate the disease, so we enhanced the work (Jafar at el., 2019) from trapezoidal to octagonal symptoms symbolically. So, we have used Sanchez’s Approach in terms of Octagonal fuzzy number. In the end for the better understanding the theory an elaborative example using hypothetical data has also been presented. Keywords: Fuzzy Number (FN), Octagonal Number, Soft Set (SS), Soft Matrix (SM) Sanchez’s Method.
123. Saeed, M., Ahsan, M., Siddique, M. K., & Ahmad, M. R. (2020). A Study of The Fundamentals of Hypersoft Set Theory. International Journal of Scientific & Engineering Research, 11(1), 320‐329. (Muhammad Saeed, Muhammad Ahsan, Muhammad Khubab Siddique, Muhammad Rayees Ahmad (Mathematics/SSC) Abstract: In this study, we discuss the fundamentals of hypersoft set such as hypersoft subset, complement, not hypersoft set and aggregation operators. After that we discuss the hypersoft set relation, sub relation, complement relation, function, matrices and operations on hypersoft matrices. Keywords: Hypersoft set, hypersoft subset, complement, not set, aggregation operators, hypersoft set relation, sub relation, complement relation, function, hypersoft matrices.
124. Saeed, M., Siddique, M. K., Ahsan, M., Rayees, A., & Rasool, G. (2020). A New Approach For Triangular Intuitionistic Fuzzy Number in Multi‐criteria Decision Making Problems. International Journal of Scientific & Engineering Research, 11(1), 818‐830. (Muhammad Saeed, Muhammad Khubab Siddique, Muhammad Ahsan, Muhammad Rayees Ahmad, Ghulam Rasool (Mathematics/SSC) Abstract: In this paper, we use triangular intuitionistic fuzzy numbers to solve MCDM problem. we will consider the situation in which data is available in the form of triangular intuitionistic fuzzy numbers. We convert the data in to triangular fuzzy numbers and then by using topsis for fuzzy numbers the ranking is made. Keywords: not available.
125. Zulqarnain, R. M., Saeed, M., Bagh, A., Abdal, S., Saqlain, M., Ahamad, M. I., & Zafar, Z. Generalized Fuzzy TOPSIS to Solve Multi‐Criteria Decision‐Making Problems. Journal of New Theory (32), 40‐50. (Muhammad Saeed (Mathematics/SSC) Abstract: Multiple Criteria Decision Making (MCDM) is a process in which we choose the best alternative from Research Outlook 2020 | 39
all feasible alternatives. In this paper, we study fuzzy sets with some basic concepts and fuzzy TOPSIS (technique for order preference by similarity to ideal solution) method. We proposed the TOPSIS method under a fuzzy environment and expressed the rating of each alternative and weight of each criterion in the form of a triangular fuzzy number. Finally, we used the proposed method for decision making in the garments industry for the selection of supplier. Keywords: Fuzzy set, triangular fuzzy number (TFN), fuzzy TOPSIS, MCDM.
126. Asjad, M. I., Ikram, M. D., Ali, R., Baleanu, D., & Alshomrani, A. S. (2020). New analytical solutions of heat transfer flow of clay‐water base nanoparticles with the application of novel hybrid fractional derivative. Thermal Science, 24(Suppl. 1), 343‐350. (Muhammad Imran Asjad, Muhammad Danish Ikram (Mathematics/SSC) Abstract: Clay nanoparticles are hanging in three different based fluids (water, kerosene, and engine oil). The exact terminologies of Maxwell‐Garnett and Brinkman for the current thermophysical properties of clay nanofluids are used, while the flow occurrence is directed by a set linear PDE with physical initial and boundary conditions. The classical governing equations are extended to non‐integer order hybrid fractional derivative which is introduced in [33]. Analytical solutions for temperature and velocity fields are attained via Laplace transform technique. Some limiting solutions are also obtained from the existing literature and compared for different values of fractional parameter. To vision the impact of several flow parameters on the temperature and velocity some graphs are drawn using Mathcad software and designed in different figures. As a result, we found that hybrid fractional model is better in describing the decay behavior of temperature and velocity in comparison of classical derivatives. In comparison of nanofluid with different base fluids, it is concluded that water‐based nanofluid has higher velocity than others. Keywords: hybrid fractional derivative, power law kernel, Clay‐nanoparticles, analytical solutions.
127. Ahmad, M., Imran, M. A., Baleanu, D., & Alshomrani, A. S. (2020). Thermal analysis of magnetohydrodynamic viscous fluid with innovative fractional derivative. Thermal Science, 24(Suppl. 1), 351‐359. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this study, an attempt is made to investigate a fractional model of unsteady and an incompressible MHD viscous fluid with heat transfer. The fluid is lying over a vertical and moving plate in its own plane. The problem is modeled by using the constant proportional Caputo fractional derivatives with suitable boundary conditions. The non‐dimensional governing equations of problem have been solved analytically with the help of Laplace transform techniques and explicit expressions for respective field variable are obtained. The transformed solutions for energy and momentum balances are appeared in terms of series form. The analytical results regarding velocity and temperature are plotted graphically by MATHCAD software to see the influence of physical parameters. Some graphic comparisons are also mad among present results with hybrid fractional derivatives and the published results that have been obtained by Caputo. It is found that the velocity and temperature with constant proportional Capu‐to fractional derivative are portrait better decay than velocities and temperatures that obtained with Caputo and Caputo‐Fabrizio derivative. Further, rate of heat transfer and skin friction can be enhanced with smaller values of fractional parameter. Keywords: new analytical solutions, novel fractional derivative, thermal analysis, viscous fluid, MHD.
128. Asjad, M. I., Ikram, M. D., & Akgül, A. (2020). Analysis of MHD viscous fluid flow through porous medium with novel power law fractional differential operator. Physica Scripta, 95(11), 115209. doi: 10.1088/1402‐4896/abbe4f. (Muhammad Imran Asjad, Muhammadish Danish Ikram (Mathematics/SSC) Abstract: The present study deals with the unsteady and incompressible viscous fluid flow with constant proportional Caputo type fractional derivative (hybrid fractional operator). We find analytical solutions of a well‐ Research Outlook 2020 | 40
known problem in fluid dynamics known as Stokes' first problem. MHD and porosity are also considered as an additional effects. Using dimensional analysis, governing equations of motion converted into non‐dimensional form and then extended with novel fractional operator of singular kernel and series solutions are obtained by Laplace transform method. As a result, we compared present result with all the existing fractional operators and found that momentum boundary layer thickness can be control by changing the value of fractional parameter. Moreover, it is also observed that constant proportional Caputo type operator is well suited in exhibiting the decay of velocity of the fluid than all the existing fractional operators with power law (C), exponential law (CF) and Mittage‐Leffler law (ABC). Keywords: Constant proportional Caputo, A comparison, Analytical solution, MHD, Porous medium.
129. Chu, Y.‐M., Ali, R., Asjad, M. I., Ahmadian, A., & Senu, N. (2020). Heat transfer flow of Maxwell hybrid nanofluids due to pressure gradient into rectangular region. Scientific Reports, 10(1), 16643. doi: 10.1038/s41598‐020‐73174‐1. (Rizwan Ali, Muhammad Imran Asjad (Mathematics/SSC) Abstract: In this work, influence of hybrid nanofluids (Cu and Al2O3) on MHD Maxwell fluid due to pressure gradient are discussed. By introducing dimensionless variables the governing equations with all levied initial and boundary conditions are converted into dimensionless form. Fractional model for Maxwell fluid is established by Caputo time fractional differential operator. The dimensionless expression for concentration, temperature and velocity are found using Laplace transform. As a result, it is found that fluid properties show dual behavior for small and large time and by increasing volumetric fraction temperature increases and velocity decreases respectively. Further, we compared the Maxwell, Casson and Newtonian fluids and found that Newtonian fluid has greater velocity due to less viscosity. Draw the graphs of temperature and velocity by Mathcad software and discuss the behavior of flow parameters and the effect of fractional parameters. Keywords: Applied mathematics, Mathematics and computing.
130. Ahmadian, A., Bilal, M., Khan, M. A., & Asjad, M. I. (2020). The non‐Newtonian maxwell nanofluid flow between two parallel rotating disks under the effects of magnetic field. Scientific Reports, 10(1), 17088. doi: 10.1038/s41598‐020‐74096‐8. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: The main feature of the present numerical model is to explore the behavior of Maxwell nanoliquid moving within two horizontal rotating disks. The disks are stretchable and subjected to a magnetic field in axial direction. The time dependent characteristics of thermal conductivity have been considered to scrutinize the heat transfer phenomena. The thermophoresis and Brownian motion features of nanoliquid are studied with Buongiorno model. The lower and upper disk's rotation for both the cases, same direction as well as opposite direction of rotation is investigated. The subsequent arrangement of the three dimensional Navier Stoke’s equations along with energy, mass and Maxwell equations are diminished to a dimensionless system of equations through the Von Karman’s similarity framework. The comparative numerical arrangement of modeled equations is further set up by built‐in numerical scheme “boundary value solver” (Bvp4c) and Runge Kutta fourth order method (RK4). The various physical constraints, such as Prandtl number, thermal conductivity, magnetic field, thermal radiation, time relaxation, Brownian motion and thermophoresis parameters and their impact are presented and discussed briefly for velocity, temperature, concentration and magnetic strength profiles. In the present analysis, some vital characteristics such as Nusselt and Sherwood numbers are considered for physical and numerical investigation. The outcomes concluded that the disk stretching action opposing the flow behavior. With the increases of magnetic field parameter M the fluid velocity decreases, while improving its temperature. We show a good agreement of the present work by comparing with those published in literature. Keywords: applied mathematics, mathematics and computing, computer science, scientific data.
Research Outlook 2020 | 41
131. Ahmadian, A., Bilal, M., Khan, M. A., & Asjad, M. I. (2020). Numerical analysis of thermal conductive hybrid nanofluid flow over the surface of a wavy spinning disk. Scientific Reports, 10(1), 18776. doi: 10.1038/s41598‐020‐75905‐w. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: A three dimensional (3D) numerical solution of unsteady, Ag‐MgO hybrid nanoliquid flow with heat and mass transmission caused by upward/downward moving of wavy spinning disk has been scrutinized. The magnetic field has been also considered. The hybrid nanoliquid has been synthesized in the presence of Ag‐MgO nanoparticles. The purpose of the study is to improve the rate of thermal energy transmission for several industrial purposes. The wavy rotating surface increases the heat transmission rate up to 15%, comparatively to the flat surface. The subsequent arrangement of modeled equations is diminished into dimensionless differential equation. The obtained system of equations is further analytically expounded via Homotopy analysis method HAM and the numerical Parametric continuation method (PCM) method has been used for the comparison of the outcomes. The results are graphically presented and discussed. It has been presumed that the geometry of spinning disk positively affects the velocity and thermal energy transmission. The addition of hybrid nanoparticles (silver and magnesium‐oxide) significantly improved thermal property of carrier fluid. It uses is more efficacious to overcome low energy transmission. Such as, it provides improvement in thermal performance of carrier fluid, which play important role in power generation, hyperthermia, micro fabrication, air conditioning and metallurgical field. Keywords: not available.
132. Kashif, A., & Aslam, M. (2020). On BCK‐Topological Modules. Computational Journal of Combinatorial Mathematics. 1 (1). 1‐9. (Agha Kashif (Mathematics/SSC) Abstract: In this paper, we introduce the notion of a BCK‐topological module in a natural way. It is established that every decreasing sequence of submodules on a BCK‐module M over bounded commutative BCK‐algebra X is indeed a BCK‐topological module. The notion of compatible and strict BCK‐module homomorphisms is introduced, and it is furnished that a strict BCK‐module homomorphism is an open as well as a continuous mapping. Also, we establish the necessary and sufficient condition for a compatible mapping to be strict. Keywords: BCK‐Modules, baig topology, strict, compatible.
133. Asjad, M. I. (2020). Novel Fractional Differential Operator and its Application in Fluid Dynamics. Journal of Prime Research in Mathematics, 16(2), 67‐79. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: Theoretical analysis of unsteady incompressible viscous fluid has been carried with constant proportional Caputo fractional derivative namely constant proportional Caputo type with singular kernel. The modeled considered in this paper is the fundament problem of fluid dynamics. The resulting governing equations are modeled with hybrid fractional operator of singular kernel and its solution obtained by using Laplace transform method and expressed in terms of series. Some graphs are captured for fractional parameter α for large and small time and found that velocity shows dual trend for small and large values of time for different values of fractional parameter α. Further, compared the present results with the results obtained with new fractional operators and found that constant proportional Caputo type operator portrait better velocity decay. Moreover, for increasing time, momentum boundary layer thickness increases while for grater values of fractional parameter it reduces. Keywords: constant proportional caputo, analytical solutions, couette flow.
134. Ahsan, M., Zahid, Z., & Zafar, S. (2020). Edge metric dimension of some classes of circulant graphs. Analele Stiintifice ale Universitatii Ovidius Constanta, Seria Matematica, 28(3), 15‐27. doi: DOI: 10.2478/auom‐ 2020‐0032. (Muhammad Ahsan, Zohaib Zahid, Sohail Zafar (Mathematics/SSC) Abstract: Let G = (V (G), E(G)) be a connected graph and x, y ∈ V (G), d(x, y) = min{ length of x − y path } and Research Outlook 2020 | 42
for e ∈ E(G), d(x, e) = min{d(x, a), d(x, b)}, where e = ab. A vertex x distinguishes two edges e1 and e2, if d(e1, x)
≠ d(e2, x). Let WE = {w1, w2, . . ., wk} be an ordered set in V (G) and let e ∈ E(G). The representation r(e | WE)
of e with respect to WE is the k‐tuple (d(e, w1), d(e, w2), . . ., d(e, wk)). If distinct edges of G have distinct
representation with respect to WE, then WE is called an edge metric generator for G. An edge metric generator of minimum cardinality is an edge metric basis for G, and its cardinality is called edge metric dimension of G,
denoted by edim(G). The circulant graph Cn(1, m) has vertex set {v1, v2, . . ., vn} and edge set {vivi+1 : 1
≤ i ≤ n−1}∪{vnv1}∪{vivi+m : 1 ≤ i ≤ n−m}∪{vn−m+ivi : 1 ≤ i ≤ m}. In this paper, it is shown that the edge metric dimension
of circulant graphs Cn(1, 2) and Cn(1, 3) is constant. Keywords: Edge metric dimension, edge metric generator, basis, resolving set, circulant graphs.
135. Farman, M., Tabassum, M. F., Naik, P. A., & Akram, S. (2020). Numerical treatment of a nonlinear dynamical Hepatitis‐B model: an evolutionary approach. European Physical Journal Plus. 135(12). 941. doi: 10.1140/epjp/s13360‐020‐00902‐x. (Muhammad Farhan Tabassum, Sana Akram (Mathematics/SSC) Abstract: Hepatitis‐B is the world’s number one public health epidemic. Vast population of infects in developing countries is yet at risk. Generally, the mathematical model of HepatitisB is nonlinear and therefore changeable to solve by traditional analytical and finite difference schemes by processing all properties of model like boundedness, positivity, feasibility. In this paper, an unconditionally convergent semi‐analytical approach based on modern evolutionary computational technique and Padé approximation (EPA) has been implemented for the treatment of nonlinear Hepatitis‐B model. The convergence solution of EPA scheme on different compartments of population has been studied and found to be significant with robust and durable solution. Eventually, EPA reduces contaminated levels very rapidly, without the need to supply step size. Keywords: not available.
136. Tufail, M. N., Saleem, M., & Chaudhry, Q. A. (2020). Chemically reacting mixed convective Casson fluid flow in the presence of MHD and porous medium through group theoretical analysis. Heat Transfer. 49(8). 4657‐4677. doi: https://doi.org/10.1002/htj.21846. (Muhammad Nazim Tufail, Musharafa Saleem (Mathematics/Knowledge Unit of Science) (SKT Campus) Abstract: This paper explores the consequences of chemically reacting magnetohydrodynamic mixed convective fluid substances driven by the porous medium, slippery, incompressible, and laminar vertical channel flow. Casson fluid model in a vertical channel is strengthened with mixed convection flow. The effects of the heat source‐sink parameter, the suction‐injection parameter, slips on the slide wall, and thermal radiation are also considered. A Lie group method is taken into consideration and nonlinear partial differential equations are converted into nonlinear ordinary differential equations (ODEs). The NDSolve command solves these ODEs and shows the action of the related parameters in the velocity, temperature, and concentration figures. The Casson fluid parameter increases the velocity profile but reduces the concentration profile. The parameter of suction‐ injection enhances the velocity, temperature, and concentration profiles. The variations in skin‐friction coefficient in the heat and mass transfer rate are addressed in the diagrams. Moreover, streamlines are plotted for suction‐injection parameter. Keywords: channel flow, Lie group approach, mixed convective Casson fluid, slip parameter, viscous dissipation.
137. Zhao, D., Ali, M. A., Murtaza, G., & Zhang, Z. (2020). On the Hermite–Hadamard inequalities for interval‐valued coordinated convex functions. Advances in Difference Equations, 2020(1), 570. doi: 10.1186/s13662‐020‐03028‐7. (Ghulam Murtaza (Mathematics/SSC) Abstract: In this work, we introduce the notion of interval‐valued coordinated convexity and demonstrate Hermite–Hadamard type inequalities for interval‐valued convex functions on the co‐ordinates in a rectangle from the plane. Moreover, we prove Hermite–Hadamard inequalities for the product of interval‐valued convex Research Outlook 2020 | 43
functions on coordinates. Our results generalize several other well‐known inequalities given in the existing literature on this subject. Keywords: Interval‐valued functions, Coordinated convex functions, Hermite–Hadamard inequality.
138. Hussain, Z., Munir, M., Ahmad, A., Chaudhary, M., Alam Khan, J., & Ahmed, I. (2020). Metric basis and metric dimension of 1‐pentagonal carbon nanocone networks. Scientific Reports, 10(1), 19687. doi: 10.1038/s41598‐020‐76516‐1. (ImtiazAhmed (Mathematics/SSC) Abstract: Resolving set and metric basis has become an integral part in combinatorial chemistry and molecular topology. It has a lot of applications in computer, chemistry, pharmacy and mathematical disciplines. A subset S of the vertex set V of a connected graph G resolves G if all vertices of G have different representations with respect to S. A metric basis for G is a resolving set having minimum cardinal number and this cardinal number is called the metric dimension of G. In present work, we find a metric basis and also metric dimension of 1‐ pentagonal carbon nanocones. We conclude that only three vertices are minimal requirement for the unique identification of all vertices in this network. Keywords: not available.
139. Asif, F., Zahid, Z., & Cancan, M. (2020). On some leap indices of Polycyclic Aromatic Hydrocarbons (PAHs). Journal of Discrete Mathematical Sciences and Cryptography, 23(6), 1269‐1277. doi: 10.1080/09720529.2020.1816696. (Fatima Asif , Zohaib Zahid (Mathematics/SSC) Abstract: Graph invariants are numerical values assigned to some molecular graph GM to characterize its topological properties. The second neighbourhood or a 2 –distance degree of any vertex v in a graph GM is the cardinality of its second neighbors. In this research article, we formulated some expressions for the leap Zagreb indices, leap hyper‐indices and F – leap indices, depending on the second degree of a vertex, of a family of a molecular graph called Polycyclic Aromatic Hydrocarbons PAHs. Keywords: Leap Zagreb indices, Leap hyper‐Zagreb indices, F –leap indices, Polycyclic Aromatic Hydrocarbons PAHn, second degree.
140. Réti, T., & Ali, A. (2020). On the variance‐type graph irregularity measures. Communications in Combinatorics and Optimization, 5(2), 169‐178. doi: DOI: 10.22049/CCO.2020.26701.1131. (Akbar Ali (Mathematics/Knowledge Unit of Science ) (SKT Campus) Abstract: Bell’s degree‐variance VarB for a graph G, with the degree sequence (d1, d2, . . . , dn) and size m, is defined as V arB(G) = 1 n Pn i=1 di − 2m n 2 . In this paper, a new version of the irregularity measures of variance‐ type, denoted by V arq, is introduced and discussed. Based on a comparative study, it is demonstrated that the newly proposed irregularity measure V arq possess a better discrimination ability than the classical Bell’s degree‐ variance in several cases. Keywords: non‐regular graphs, irregularity measures, degree variance.
141. Ali, A., Javaid, M., Matejic, M., Milovanovic, I., & Milovanovic, E. (2020). Some new bounds on the general sum‐‐connectivity index. Communications in Combinatorics and Optimization, 5(2), 97‐109. (Akbar Ali (Mathematics/Knowledge Unit of Science ) (SKT Campus) Abstract: Let G = (V, E) be a simple connected graph with n vertices, m edges and sequence of vertex degrees d1 ≥ d2 ≥ ∙ ∙ ∙ ≥ dn > 0, di = d(vi), where vi ∈ V . With i ∼ j we denote adjacency of vertices vi and vj . The general sum–connectivity index of graph is defined as χα(G) = P i∼j (di + dj ) α, where α is an arbitrary real number. In this paper we determine relations between χα+β(G) and χα+β−1(G), where α and β are arbitrary real numbers, and obtain new bounds for χα(G). Also, by the appropriate choice of parameters α and β, we obtain a number of old/new inequalities for different vertex–degree–based topological indices. Research Outlook 2020 | 44
Keywords: Topological indices, vertex degree, sum‐connectivity index.
142. Saleem, N., Abbas, M., & Raza, Z. (2020). Fixed fuzzy point results of generalized Suzuki type F‐ contraction mappings in ordered metric spaces. Georgian Mathematical Journal, 27(2), 307‐320. doi: doi:10.1515/gmj‐2017‐0048. (Naeem Saleem (Mathematics/SSC) Abstract: The aim of this paper is to introduce generalized Suzuki type F‐contraction fuzzy mappings and to prove the existence of fixed fuzzy points for such mappings in the setup of complete ordered metric spaces. An example is provided to show the validity of our results, followed by couple of remarks about the comparison of obtained results with the existing results in the literature. An application of our result to the domain of words is also presented. Keywords: F‐contraction, fixed fuzzy point, fuzzy mapping, fuzzy set, approximate quantity.
143. Ali, A., Elumalai, S., & Mansour, T. (2020). On the symmetric division deg index of molecular graphs. MATCH Communications in Mathematical and in Computer Chemistry, 83, 205‐220. (Akbar Ali (Mathematics/Knowledge Unit of Science ) (SKT Campus) Abstract: The symmetric division deg (SDD) index is one the 148 discrete Adriatic indices, introduced several years ago. The SDD index has already been proved a valuable index in the QSPR/QSAR (quantitative structure‐ property/activity relationships) studies. In the present paper, we firstly correct an upper bound on the SDD index of molecular trees, reported in the recent paper [MATCH Commun. Math. Comput. Chem. 82 (2019) 43–55], by giving the best possible upper bound on the SDD index of any molecular (n, m)‐graph (a molecular graph with order n and size m). We then establish a lower bound on the SDD index of any molecular (n, m)‐graph. Finally, by extending a theorem of the aforementioned paper, we characterize the graphs with fifth to ninth minimum SDD indices from the class of all molecular trees having a fixed, but sufficiently large, order. Keywords: not available.
144. Lael, F., Saleem, N., & Abbas, M. (2020). On the fixed points of multivalued mappings in b−metric spaces and their application to linear systems. UPB Scientific Bulletin, Series A: Applied Mathematics and Physics, 82(4), 121‐130. (Naeem Saleem (Mathematics/SSC) Abstract: In this paper, we replied to an open problem related to a b−metric version of Banach’s fixed point theorem. It was addressed with a partial answer by several authors, choosing a suitable contractive constant but we proved it in general, without adding any assumption in comparison with its classical one. Also, some new fixed point theorems for multivalued mappings in b−metric spaces are obtained. Furthermore, as applica ons, we showed the existence of a solution of an integral inclusion and a linear equation system. We provided two applications and examples to support our main results. Keywords: fixed point, multivalued mapping, b−metric space, par al order.
145. Basit, A., Abbas, M., & de la Sen, M. (2020). Completeness of b∼Metric spaces and the fixed points of generalized multivalued quasicontractions. Discrete Dynamics in Nature and Society, 2020 doi:http://dx.doi.org/10.1155/2020/5183291. (Basit Ali (Mathematics/SSC) Abstract: In this article, we present a completeness characterization of b ∼ metric space via existence of fixed points of generalized multivalued quasicontractions.'e purpose of this paper is twofold: (a) to establish the existence of fixed points of multivalued quasicontractions in the setup of b ∼ metric spaces and (b) to establish completeness of a b ∼ metric space which is a topological property in nature with existence of fixed points of generalized multivalued quasicontractions. Further, a comparison of our results with comparable results shows that the results obtained herein improve and unify the existing results in the literature applicable to the case where existing results fail. Research Outlook 2020 | 45
Keywords: not available.
146. Ahmed, N., Baleanu, D., Korkmaz, A., Rafiq, M., Rehman, M. A.‐U., & Ali, M. (2020). Positivity preserving computational techniques for nonlinear autocatalytic chemical reaction model. National Institute for Laser, Plasma and Radiation Physics, 72(4), 121. (Nauman Ahmed (Mathematics/SSC) Abstract: In many physical problems, positivity is one of the most prevalent and imperative attribute of diverse mathematical models such as concentration of chemical reactions, population dynamics etc. However, the numerical discretization of dynamical systems that illustrate negative values may lead to meaningless solutions and sometimes to their divergence. The main objective of this work is to develop positivity preserving numerical schemes for the two‐dimensional autocatalytic reaction diffusion Brusselator model. Two explicit finite difference (FD) schemes are proposed to solve numerically the two‐dimensional Brusselator system. The proposed methods are the non‐standard finite difference (NSFD) scheme and the unconditionally positivity preserving scheme. These numerical methods retain the positivity of the solution and the stability of the equilibrium point. Both proposed numerical schemes are compared with the forward Euler explicit FD scheme. The stability and consistency of all schemes are proved analytically and then verified by numerical simulations. Keywords: Explicit finite difference scheme, Brusselator reaction‐diffusion model, positivity, consistency, Von Neumann stability analysis, numerical simulations.
147. Saeed, M., Dayan, F., & Ali, U. (2020). A Comparative Study of FCSM, FSAW and TOPSIS Techniques using Triangular Fuzzy Numbers. Scientific Inquiry and Review, 4(2), 17‐30. https://doi.org/10.32350/sir/2020/42/1235. (Muhammad Saeed, Usman Ali, Fazal Dayan (Mathematics/SSC) Abstract: This paper presents a comparative study of different techniques used for fuzzy multi‐criteria expert’s decision‐making (FMCEDM). These include CSM1, CSM2, CSM3, FSAW, and TOPSIS. We developed the methods CSM1 and CSM3 respectively and studied their validity by comparing their illustration results with that of CSM2, FSAW and TOPSIS. Expert’s ratings and weights were assigned in linguistic variables in terms of triangular fuzzy numbers (TFNs) to the FMCEDM problem. Airport performance evaluation and a personnel selection problem were studied as alternatives under different decision criteria and experts. Keywords: Fuzzy Multiple Criteria Expert Decision‐Making(FMCEDM), fuzzy simple additive weighting, fuzzy cosine similarity measures,technique for order performance by similarity to ideal solution. Book/Book Chapters 1. Riaz, M. B., Atangana, A., & Saeed, S. T. (2020). MHD‐free Convection Flow Over a Vertical Plate with Ramped Wall Temperature and Chemical Reaction in View of Nonsingular Kernel. In H. Dutta, A. O. Akdemir & A. Atangana (Eds.), Fractional Order Analysis (pp. 253‐282): John Wiley & Sons, Inc. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: The aim of this chapter is to study the unsteady MHD‐free convection flow of an electrically conducting incompressible generalized Maxwell fluid over an infinite vertical plate with ramped temperature and constant concentration. Fractional‐order Caputo, Caputo‐Fabrizio, and Atangana– Baleanu time derivatives are used to study the effect of fractional parameters (memory effect) on the dynamics of fluid. The motion of plate is rectilinear translation with an arbitrary time‐dependent velocity. On comparison, it is observed that fractional‐order model is best to explain the memory effect and flow behavior of the fluid with reference to ordinary order model. Furthermore, it is noted that ABC is the best to highlight the dynamics of fluid. The influence of transverse magnetic fields studied. Moreover, the effects of system parameters on the field velocity are analyzed through numerical simulation and graphs. Some results present in literature are also recovered.
Research Outlook 2020 | 46
Keywords: Maxwell fluid, magnetic effect, ramped temperature, fractional time derivatives, memory effects, nonsingular kernel. Conference Proceedings 1. Zafar, A. A., Riaz, M. B., & Hammouch, Z. (2020). A Class of Exact Solutions for Unsteady MHD Natural Convection Flow of a Viscous Fluid over a Moving Inclined Plate with Exponential Heating, Constant Concentration and Chemical Reaction. Paper presented at the 4th International Conference on Computational Mathematics and Engineering Sciences (CMES‐2019), Cham. (Muhammad Bilal Riaz (Mathematics/SSC) Abstract: The purpose of this article is to study analytically the hydromagnetic natural convection flow of an electrically conducting, incompressible viscous fluid over a moving infinite inclined plate. Moreover, the dynamic of fluid is studied under the influence of exponential heating and constant concentration. Porous effects are taken into consideration and in order to investigate the influence of the transverse magnetic field, two cases when the transverse magnetic field is held fixed to the fluid or to the plate are considered. The Laplace transform technique is used to obtain exact solutions for such motions. The dimensionless Latin symbols velocity, and also the corresponding skin friction, is presented as sum of mechanical, thermal and concentration components. Finally, for illustration, as well as for a check of results, some special cases with applications in engineering are considered and influence of the system parameters is graphically brought to light. Keywords: magnetohydrodynamic, inclined plate, natural convection, exponential heating, chemical reaction. Conference Paper 1. Asjad, M. I. (2020). Applications of Nanofluids in Industry. Paper presented at the 5th International Conference on Pure and Applied Mathematics, University of Sargodha, Sargodha, Pakistan. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: Some basic definitions, Mathematical formulations, and applications of nanofluids with heat transfer in Industry. Keywords: not available.
2. Asjad, M. I. (2020). Heat Transfer Flow of Clay‐Water Base Nanoparticles with the Application of Novel Constant Proportional Caputo Fractional Derivative. Paper presented at the First Online Conference on Modern Fractional Calculus and its Applications (OCMFCA‐2020) Biruni University, Istanbul, Turkey. (Muhammad Imran Asjad (Mathematics/SSC) Abstract: Clay nanoparticles are hanging in three different based fluids (water, kerosene, and engine oil). The exact terminologies of Maxwell‐Garnett and Brinkman for the cur‐rent thermophysical properties of clay nanofluids are used, while the flow occurrence is directed by a set linear PDE with physical initial and boundary conditions. The classical governing equations are extended to non‐integer order hybrid fractional derivative which is introduced in [33]. Analytical solutions for temperature and velocity fields are attained via Laplace transform technique. Some limiting solutions are also obtained from the existing literature and compared for different values of fractional parameter. To vision the impact of several flow parameters on the temperature and velocity some graphs are drawn using Mathcad software and designed in different figures. As a result, we found that hybrid fractional model is better in describing the decay behavior of temperature and velocity in comparison of classical derivatives. In comparison of nanofluid with different base fluids, it is concluded that water‐based nanofluid has higher velocity than others. Keywords: not available.
Research Outlook 2020 | 47
Department of Life Sciences Research Articles 1. Raza, H., Wahid, B., Rubi, G., & Gulzar, A. (2020). Molecular epidemiology of SARS‐CoV‐2 in Faisalabad, Pakistan: A real‐world clinical experience. Infection, Genetics and Evolution, 84, 104374. doi: https://doi.org/10.1016/j.meegid.2020.104374. (Hassan Raza, Braira Wahid (Life Sciences/SSC) Abstract: Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) or COVID‐2019 is a new global health challenge which causes severe respiratory complications. As of May 17th, 2020, SARS‐CoV‐2 has infected 4.6 million people and caused 310,000 deaths, worldwide. In order to study potential impact of infection, complete epidemiological information should be reported on regular basis however, data from Pakistan has not yet been published. This retrospective study is the first report of epidemiological trends of COVID‐19 in Faisalabad, Pakistan. On April 4th, 2020, 128 nasopharyngeal swabs collected from city Faisalabad were transported to Postgraduate Research Institute, Lahore for further processing. RNA was extracted using QIAsymphony DSP Virus/Pathogen Midi Kit and real‐time PCR was performed to quantify COVID‐19. Our finding showed that overall prevalence of COVID‐19 in Faisalabad on April 4th was 17.18% (22 of 128). Prevalence was higher in males (n = 17; 77.2%) as compared to females (n = 5; 22.8%) but this gender‐wise difference was not statistically significant. Patients belonging to age group 37–47 years were found to be most (45.5%) infected with COVID‐19. Keywords: CODID‐19, SARS‐CoV‐2, Pakistan, epidemiology.
2. Hanif, M. K., Malik, K. A., Hameed, S., Saddique, M. J., Ayesha, Fatima, K., . . . Imran, A. (2020). Growth stimulatory effect of AHL producing Serratia spp. from potato on homologous and non‐homologous host plants. Microbiological Research, 238, 126506. doi: https://doi.org/10.1016/j.micres.2020.126506. (Kaneez Fatima (Life Sciences/SSC) Abstract: Plant growth promoting rhizobacteria are known to improve plant performance by developing healthy and productive interactions with the host plants. These associations may be symbiotic or asymbiotic depending upon the genetic potential of the resident microbe and promiscuity of the host. Present study describes the potential of two Serratia spp. strains for promotion of plant growth in homologous as well as non‐homologous hosts. The strains KPS‐10 and KPS‐14; native to potato rhizosphere belong to genus Serratia based on 16S rRNA gene sequences (accession no. LN831934 and LN831937 respectively) and contain multiple plant growth promoting properties along‐with the production of quorum sensing acyl homoserine lactone (AHL) molecules. Both Serratia spp. strains showed solubilization of inorganic tri‐calcium phosphate while KPS‐14 also exhibited phytase activity (1.98 10−10 kcat). KPS‐10 showed higher P‐solubilization activity (128.5 μg/mL), IAA production (8.84 μg/mL), antifungal activity and also showed the production of two organic acids i.e., gluconic acid and lactic acid. Both strains produced three common AHLs: C6‐HSL, 3oxo‐C10‐HSL, 3oxo‐C12‐HSL while some strain‐specific AHLs (3OH‐C5‐HSL, 3OH‐C6‐HSL, C10‐HSL specific to KPS‐10 and 3OH‐C6‐HSL, C8‐HSL, 3oxo‐C9‐HSL, 3OH‐C9‐HSL specific to KPS‐14). Strains showed roots and rhizosphere colonization of potato and other non‐homologous hosts up to one month. In planta AHLs‐detection confirmed a likely role of AHLs during seedling growth and development where both extracted AHLs or bacteria inoculated roots showed extensive root hair. A significant increase in root/shoot lengths, root/ shoot fresh weights, root/shoot dry weights was observed by inoculation in different hosts. PGP‐characteristics along with the AHLs‐production signify the potential of both strains as candidate for the development of bio‐inoculum for potato crop in specific and other crops in general. This inoculum will not only reduce the input of chemical fertilizer to the environment but also improve soil quality and plant growth. Keywords: Serratia, AHLsHomologous host, IAA production, PGPR, Non‐homologous host.
Research Outlook 2020 | 48
3. Khan, A., Ahmed, H., Khan, H., Simsek, S., Kilinc, S. G., Kesik, H. K., . . . Afzal, M. S., Budke, C. M. (2020). First report of Echinococcus canadensis (G6/G7) by sequence analysis from the Khyber Pakhtunkhwa province of Pakistan. Acta Tropica, 209, 105559. doi: https://doi.org/10.1016/j.actatropica.2020.105559. (Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Cystic echinococcosis (CE) is a zoonotic parasitic disease that can result in human and animal health problems globally. Although the disease is known to be endemic in Asia and the Middle East, there are few epidemiological studies on CE in Pakistan. The purpose of the present study was to identify the Echinococcus granulosus sensu lato species and genotypes contributing to human CE cases in the Khyber Pakhtunkhwa (KPK) province of Pakistan. A total of fifty‐six formalin fixed paraffin embedded (FFPE) CE cyst samples of human origin were collected from the Pathology Department, Rehman Medical Institute (RMI), KPK for the years 2012‐2017. Cyst samples came from the liver (26/56; 46.4%), lungs (3/56; 5.3%), spleen (3/56; 5.3%), pelvis (1/56; 1.8%), breast (1/56; 1.8%), and thigh (1/56; 1.8%). The organ location for 21 of the cysts was not recorded. World Health Organization‐Informal Working Group on Echinococcosis (WHO‐IWGE) ultrasound‐based cyst staging was available for 17 of the 26 (65.4%) hepatic cysts. Five of these cysts (29.4%) were CE3 (transitional), nine (52.9%) were CE4 (inactive), and three (17.6%) were CE5 (inactive). Most of the cysts were obtained from CE patients that were ethnically Afghan Pashtuns (44/56; 78.6%), while 12.5% (7/56) were from patients that were Pakistani Pashtuns. The majority (41/56; 73.2%) of patients reported having close interactions with dogs. Using 12SrRNA primers, 33 cyst samples were identified as being caused by E. granulosus sensu stricto (s.s.). Mitochondrially encoded cytochrome C oxidase 1 (mt‐CO1) was evaluated for the remaining 23 samples. PCR product was obtained from six of these 23 samples. Of these six samples, one was identified as Echinococcus canadensis (G6/7). Haplotype analysis showed high haplotype and low nucleotide diversity for the mt‐CO1 gene. There were 26 polymorphic sites for the mt‐CO1 sequence, of which 65.3% (17/26) were parsimony informative. The E. canadensis mt‐CO1 haplotype network consisted of 11 haplotypes, with a main central haplotype. In conclusion, it appears that E. granulosus s.s. and E. canadensis (G6/7) are circulating in the northwestern region of Pakistan. Further molecular epidemiological studies are needed to explore the local genetic diversity of the parasite. Keywords: Cystic Echinococcosis, FFPE tissue, Human, Genotyping, Echinococcus canadensis (G6/G7).
4. Mahmood, M. S., Irshad, S., Butt, T. A., Batool, H., Batool, S., & Ashraf, N. M. (2020). In‐silico analysis of deleterious missense SNPs of human TYR gene associated with oculocutaneous albinism type 1 (OCA1). Meta Gene, 24, 100674. doi: https://doi.org/10.1016/j.mgene.2020.100674. (Hina Batool (Life Sciences/SSC) Abstract: Single Nucleotide Polymorphisms (SNPs) are among the major genetic anomalies behind genetically rare disorders. The human TYR gene encodes a key regulatory enzyme, tyrosinase for melanin biosynthesis. Missense mutations in the TYR gene may disrupt the normal function of tyrosinase and cause oculocutaneous Albinism type 1 (OCA1). The present study involves the use of multiple computational tools based on different algorithms for the identification of potential deleterious missense SNPs from the TYR gene. In this study, we identified ten deleterious missense mutations which may be contributing factors for OCA1. The 3D modeling analysis of mutant models of tyrosinase also strengthen the hypothesis that these mutations may induce significant structural and conformational changes on the native tyrosinase enzyme. Keywords: Oculocutaneous albinism type 1 (OCA1), Single Nucleotide Polymorphism (SNP), Missense SNPTyrosinase.
5. Singh, G. C., Ahmed, M., Zaid, M., & Hasnain, S. (2020). Biochemical, serological, and genetic aspects related to gene HLA‐DQB1 and its association with type 1 diabetes mellitus (T1DM). Molecular Genetics & Genomic Medicine, 8(5), e1147. doi: 10.1002/mgg3.1147. (Muhammad Zaid (Life Sciences/SSC)
Research Outlook 2020 | 49
Abstract: Background: Type 1 Diabetes Mellitus (T1DM) is the autoimmune disorder of destruction of β cells of pancreas, creating insulin deficiency condition, which leads to hyperglycemia, polyuria, polydipsia, ketoacidosis, and other metabolic disorder especially in children. Different genetic aspects and environmental factors are involved in pathophysiology of the disease. About 20 genes are associated with this disease in which the most common is the different combination of haplotype DRB1‐DQA1‐DQB1 present at HLA gene. At HLA‐DQB1, there are some SNPs which are associated with T1DM. In T1DM, there are number of biochemical, serological parameters which show some abnormalities leading to some complications. Methods: Samples were subjected to all biochemical and serological techniques to get the measurement of concentration of glucose, lipid profile (cholesterol, triglycerides, and HDL and LDL cholesterol), urea, creatinine, albumin, insulin, anti‐insulin antibodies, C‐peptides, and leptin. All these values were compared with controls values and statistical analysis was also done on these values. At molecular level, two primers set which were allele specific at HLA‐DQB1, were used to amplify the SNPs, homozygous and heterozygous conditions were stated. Results: PCR results for the studied population showed that most of samples have heterozygous condition for these SNPs of this allele specific region on HLA‐DQB1. Very few of them have homozygous state for it. Even in the control sample have the same conditions. Conclusion: In Pakistan, there is dire need of studies about SNPs and haplotypes related to HLA‐DQB1 which show association with T1DM. Keywords: DQA1, DQB1, DRB1, HLA gene, hyperglycemia, type 1 diabetes mellitus (T1DM).
6. Khan, A., Ahmed, H., Naz, K., Gul, S., Ishaque, S. M., Zaidi, Afzal, M. S., S. S. A., . . . Budke, C. M. (2020). Surgically confirmed cases of cystic echinococcosis from Baluchistan Province, Pakistan for the years 2011–2018. Acta Tropica, 205, 105354. doi: https://doi.org/10.1016/j.actatropica.2020.105354. (Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Introduction: Cystic echinococcosis (CE) is a parasitic zoonotic disease caused by the larval stage of Echinococcus granulosus tapeworms. It has a worldwide geographic distribution and can threaten the livestock industry and human health in endemic areas, including Pakistan. CE prevalence is high in Pakistan due to lack of local knowledge about disease transmission and a lack of control measures. The Pakistan province of Baluchistan shares a border with Iran and Afghanistan and is largely agricultural. However, little is known about E. granulosus transmission in this region. Methods: Information on surgically confirmed cases of CE in Baluchistan Province was obtained through evaluation of paraffin fixed cyst samples and patient records obtained from three local hospitals for the years 2011–2018. Results: A total of 22 paraffin fixed samples were collected during the study period. The majority of cysts were obtained from the liver (9/22; 40.9%), with anatomical location not available for two of the cysts. Demographic information was available for 18 cases. Females made up 61.1% (11/18) of the cases. The largest numbers of cases were found in the 31–40 years age group (5/18; 22.7%). Discussion: This study shows that Echinococcus spp. parasites are circulating in the study area. In order to control the disease, a comprehensive regional surveillance and control program is needed. Keywords: cystic echinococcosis, surgically managed cases, Baluchistan, Pakistan.
7. Wahid, B. (2020). Clinical Correlation of Blood Cells with Suppression of Cytokine Signaling Gene Expression in Hepatitis C Virus‐Infected Patients. Journal of Interferon & Cytokine Research, 40(4), 169‐171. doi: 10.1089/jir.2019.0116. (Braira Wahid (Life Sciences/SSC) Abstract: Both innate and adaptive immune responses of host are regulated by fine balance between negative and positive signals to ensure their termination and onset on entry of pathogens. Suppressor of cytokine signaling (SOCS) genes inhibit cytokine signaling pathways and regulate innate and adaptive immunity. SOCS genes Research Outlook 2020 | 50
perform their function by positive and negative regulation of macrophages, development and differentiation of T cells, and activation of dendritic cells. Although the role of SOCS1 and SOCS3 genes in hepatitis C virus (HCV) patients has been well studied, the correlation of SOCS1 gene expression with complete blood count in HCVpositive patients has not been established yet. We observed a weak positive correlation of SOCS1 gene expression with hemoglobin (Hb) and platelet count, whereas leukocytes were negatively correlated with the expression. This study also provides a comparative analysis of complete blood count between healthy subjects and HCV‐positive subjects. The findings suggest that Hb and platelet count were significantly lower (P < 0.0001) in HCV patients than in healthy subjects. Keywords: SOCS1 gene, LFTs, HCV, ALP, ALT, AST.
8. Aslam, M. S., Gull, I., Mahmood, M. S., Iqbal, M. M., Abbas, Z., Tipu, I., . . . Athar, M. A. (2020). High yield expression, characterization, and biological activity of IFNα2‐Tα1 fusion protein. Preparative Biochemistry & Biotechnology, 50(3), 281‐291. doi: 10.1080/10826068.2019.1689509. (Imran Tipu (Life Sciences/SSC) Abstract: The use of interferon α‐2 in combination with thymosin α‐1 shows higher anti‐cancer effect in comparison when both are used individually because of their synergistic effects. In this study we produced an important human interferon α‐2‐thymosin α‐1 (IFNα2‐Tα1) fusion protein with probable pharmaceutical properties coupled to its high‐level expression, characterization, and study of its biological activity. The IFNα2‐ Tα1 fusion gene was constructed by over‐lap extension PCR and expressed in Escherichia coli expression system. The expression of IFNα2‐Tα1 fusion protein was optimized to higher level and its maximum expression was obtained in modified terrific broth medium when lactose was used as inducer. The fusion protein was refolded into its native biologically active form with maximum yield of 83.14% followed by purification with ∼98% purity and 69% final yield. A band of purified IFNα2‐Tα1 fusion protein equal to ∼23 kDa was observed on 12 % SDS‐ PAGE gel. The integrity of IFNα2‐Tα1 fusion protein was confirmed by western blot analysis and secondary structure was assessed by CD spectroscopy. When IFNα2‐Tα1 fusion protein was subjected to its biological activity analysis it was observed that it exhibits both IFNα2 & Tα1 activities as well as significantly higher anticancer activity as compared to IFNα‐2 alone. Keywords: biological activity, expression optimization, fusion protein, high yield, overlap extension pcr, purification.
9. Rahman Qureshi, U. U., Saleem, S., Khan, A., Afzal, M. S., Ali, M. S., & Ahmed, H. (2020). Outbreak of novel Corona virus (2019‐nCoV); implications for travelers to Pakistan. Travel medicine and infectious disease, 34, 101571‐ 101571. doi: 10.1016/j.tmaid.2020.101571. (Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
10. Hussain, A., Tanveer, R., Azeem, F., Mustafa, G., Farooq, M., Amin, I., & Mansoor, S. (2020). Erratum to ‘Comparative phylogenetic analysis of aquaporins provides insight into the gene family expansion and evolution in plants and their role in drought tolerant and susceptible chickpea cultivars. Genomics, 112(1). 263‐275. doi: https://doi.org/10.1016/j.ygeno.2020.01.018.(Athar Hussain (Life Sciences/SSC) Abstract: Not available. Keywords: not available.
11. Khan, A., Ahmed, H., Simsek, S., Afzal, M. S., & Cao, J. (2020). Spread of Cystic Echinococcosis in Pakistan Due to Stray Dogs and Livestock Slaughtering Habits: Research Priorities and Public Health Importance. Frontiers in Public Health, 7(412). doi: 10.3389/fpubh.2019.00412. (Muhammad Sohail Afzal (Life Sciences/SSC)
Research Outlook 2020 | 51
Abstract: Background: Cystic echinococcosis (CE) is a global zoonotic parasitic disease caused by the larval stage of Echinococcus granulosus and it has been reported from both livestock and humans in Pakistan. The definitive host of E. granulosus is the dog, and the large number of stray dogs in Pakistan contributes to the spread of CE. However, there is little information between stray dogs and CE relation in the country. Methods: During the study, total 123 butcher's shops and abattoirs were included for collection of data relating to the hydatid cyst prevalence in slaughtered animals (sheep, goat, cattle, and buffaloes). The number of animals slaughtered in each butcher's shop during sampling period was also recorded, and the association of the shop environment with dogs was inspected. Results: Data was collected for CE from 123 butcher's shops in Rawalpindi and Islamabad, Pakistan. The slaughtering rate the in the butcher's shops was 2–10 animals/day including sheep/goat/cattle and buffaloes. The overall prevalence of CE in all examined animals was 2.77%. In buffaloes the higher prevalence was recorded as compared to other hosts. The findings showed that lung and liver were most affected organs and majority (59%) of the cysts were fertile in infected animals. The presence of a large number of stray dogs were an important factor in the spread of CE. They were rarely vaccinated, have easy access to infected offal at slaughtering site and had insufficient or inappropriate anthelmintic treatment. Conclusions: The most pressing need is to raise public awareness of this huge problem by considering CE a major ailment and promoting the collection and mapping of epidemiological data. Efficient CE control is required, especially treating dogs with antiparasitic drugs, for which government support and affiliation with the veterinary sector is essential. Keywords: cystic echinococcosis, Echinococcus granulosus, livestock, dog, public health, Pakistan.
12. Ameen, A. (2020). Comparison of Chemical Analysis of Compost Leachate and Commercial Fertilizer to check the quantity of heavy metals. International Journal of Psychosocial Rehabilitation, 24(8), 3398‐3402. doi: DOI: 10.37200/IJPR/V24I8/PR280356. (Ayesha Ameen (Life Sciences/SSC) Abstract: Leachate can be defined as a possibly polluting liquidproduced during composting of organic waste that may lead to some harmful effects on soil, public safety and health, surrounding aquatic ecosystems, and groundwater resources. Solid waste Compost Leachate is a liquid that percolates through the organic solid waste and brings out dissolved or suspended materials of the process and normally contains a complex variety of organic compounds and materials such as heavy metals, fatty acids, humic substances, and many harmful chemicals. This study was designed to compare the concentration of heavy metals present in compost leachate and commercial fertilizer. Municipal solid waste compost leachate and commercial fertilizer were analysed for the physico‐chemical parameters. Samples of municipal solid waste compost leachate were collected from the leachate collection tank of Lahore Compost Company. Samples were digested and analysed in duplicates for Temperature, pH, BOD, EC, TDS and COD. The metals (Ni, Cr, Zn, and Cu) quantity in the leachate was also determined using the Atomic Absorption technique with a flame photometer system. It was concluded from this study that the quantity of heavy metals (such as Cu, Ni, Zn, and Cr) present in leachate waswithin permissible limits and lower than the commercial fertilizer. It is safe to use compost leachate for plants and other crops. Keywords: compost, leachate, fertilizer, organic waste.
13. Wahid, B. (2020). Worst outbreaks of leishmaniasis and HIV AIDS in Pakistan: An update from 2019. Journal of Medical Virology, 92(8). 932‐934. doi: https://doi.org/10.1002/jmv.25671. (Braira Wahid (Life Sciences/SSC) (Commentary) Abstract: Not available. Keywords: AIDS, blood, blood‐borne, HIV, immunity, KPK, leishmaniasis, outbreak, Pakistan, prevalence, sanitation, transmission.
Research Outlook 2020 | 52
14. Wahid, B. (2020). Successful treatment of HBV, HCV, & HEV, with 12‐week long use of tenofovir, sofosbuvir, daclatasvir, and ribavirin: A case report. Journal of Infection and Public Health, 13(1), 149‐150. doi: https://doi.org/10.1016/j.jiph.2019.06.004. (Braira Wahid (Life Sciences/SSC) Abstract: Hepatitis C virus (HCV) is the leading cause of morbidity and mortality worldwide. It causes both chronicand acute infections and it has been estimated that about 80% of HCV infected patients develop chronicHCV infection of which 15–30% develop liver complications specifically liver cirrhosis and hepatocellualarcarcinoma (HCC). Interferon therapy was previously used standard of care therapy associated with poorefficacy in major proportion of HCV infected population whereas, the recent development of interferon‐free therapy or direct‐acting antiviral (DAA) drugs are able to achieve sustained virological response (SVR)in 95% of patients. These new drugs are still not properly explored and currently there is minimal clinicalexperience regarding an efficacious treatment option suitable for triple infection i.e, Hepatitis B virus(HBV), HCV, and Hepatitis E virus (HEV). Here, we suggest well‐tolerated sofsobuvir‐based treatmentregimen in patient infected with HBV, HCV, and HEV. Twelve weeks long treatment with sofsobuvir,daclatasvir, ribavirin, and tenofovir resulted in sustained virological response (SVR) and cleared HBV,HCV, and HEV in diabetic and asthmatic patient. Keywords: HBV, HCV, HEV, Asthma, Diabetes, Sofosbuvir.
15. Kabir, M., Saqib, M. A. N., Zaid, M., Ahmed, H., & Afzal, M. S. (2020). COVID‐19, economic impact and child mortality: A global concern. Clinical nutrition (Edinburgh, Scotland), 39(7), 2322‐2323. doi: 10.1016/j.clnu.2020.05.027. (Mahvish Kabir, Muhammad Arif Nadeem Saqib, Muhammad Zaid, Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
16. Ali, M., Zaid, M., Saqib, M. A. N., Ahmed, H., & Afzal, M. S. (2020). SARS‐CoV‐2 and the hidden carriers: Sewage, feline, and blood transfusion. Journal of Medical Virology, 92, 2291‐2292. https://doi.org/10.1002/jmv.25956. (Muhammad Ali, Muhammad Zaid, Muhammad Arif Nadeem Saqib, Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
17. Kabir, M., Afzal, M. S., Khan, A., & Ahmed, H. (2020). COVID‐19 pandemic and economic cost; impact on forcibly displaced people. Travel medicine and infectious disease, 35, 101661‐101661. doi: 10.1016/j.tmaid.2020.101661. (Mahvish Kabir, Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
18. Hussain, W., Amir, A., & Rasool, N. (2020). Computer‐aided study of selective flavonoids against chikungunya virus replication using molecular docking and DFT‐based approach. Structural Chemistry, 31, 1363–1374. doi: https://doi.org/10.1007/s11224‐020‐01507‐x. (Anam Amir (Life Sciences/SSC) Abstract: Chikungunya fever has a high morbidity rate in humans and is caused by chikungunya virus (CHIKV). Currently, there is no vaccination or treatment available to show an effective efficacy against this disease. This study targets four non‐structural proteins of CHIKV using 650 flavonoids from various medicinal plants, inhabited in Pakistan and India. The compounds are initially screened on the basis of their effective pharmacological properties and are docked against the four proteins. A threshold of − 8.5 kcal/mol is applied to screen and reduce the number of flavonoids for further analysis. The reactivity of screened flavonoids is analyzed using the density Research Outlook 2020 | 53
functional theory (DFT). Cirsimaritin, apigenin, tamarixetin, and 5,7,3′,4′‐tetrahydroxyflavone from Andrographis paniculata have shown a high binding affinity against nsP1. Rhamnetin, tamarixetin and medioresinol have shown a strong binding affinity against nsP2. Four flavonoids, i.e. 5,7,3′,4′‐tetrahydroxyflavone, 5,7,4′‐trihydroxyflavone, tamarixetin and rhamnetin, showed a high binding affinity for nsP3 while apigenin depicted a strong binding affinity for nsP4. Pharmacological properties of these flavonoids illustrate an effective disposition in humans. The results manifest that the screened eight flavonoids can be analyzed against CHIKV for in vitro and in vivo cell replication, due to their effective pharmacological properties, strong inhibition and high reactivity. Keywords: CHIKV, Flavonoids, In silico analysis, ADMET, Molecular docking, DFT.
19. Rasool, N., Akhtar, A., & Hussain, W. (2020). Insights into the inhibitory potential of selective phytochemicals against Mpro of 2019‐nCoV: a computer‐aided study. Structural Chemistry, 31, 1777–1783. doi: https://doi.org/10.1007/s11224‐020‐01536‐6. (Ammara Akhtar (Life Sciences/SSC) Abstract: At the end of December 2019, a novel strain of coronavirus, given the name of 2019‐nCoV, emerged for exhibiting symptoms of severe acute respiratory syndrome. The virus is spreading rapidly in China and around the globe, affecting thousands of people leading to a pandemic. To control the mortality rate associated with the 2019‐nCoV, prompt steps are needed. Until now there is no effective treatment or drug present to control its life‐threatening effects in the humans. The scientist is struggling to find new inhibitors of this deadly virus. In this study, to identify the effective inhibitor candidates against the main protease (Mpro) of 2019‐nCoV, computational approaches were adopted. Phytochemicals having immense medicinal properties as ligands were docked against the Mpro of 2019‐nCoV to study their binding properties. ADMET and DFT analyses were also further carried out to analyze the potential of these phytochemicals as an effective inhibitor against Mpro of 2019‐nCoV. Keywords: 2019‐nCoV, main protease, phytochemicals, docking, ADMET, DFT.
20. Wahid, B., Shami, K., Joiya, S. A., Özuyar, S. E. G., & Idrees, M. (2020). Comparing the risk of hypothyroidism in HCV patients treated with different DAA drugs combinations (sofosbuvir + interferon + ribavirin and sofosbuvir + daclatasvir + ribavirin). Journal of Medical Virology, 92, 3868–3870. doi: 10.1002/jmv.25931. (Braira Wahid (Life Sciences/SSC) Abstract: The recent development of direct‐acting antiviral (DAA) drugs has revolutionized the area of hepatitis C virus (HCV) therapeutics but the efficacy and clinical outcome of interferon (IFN)‐free therapy have not been extensively studied yet. We observed a dramatic increase in hypothyroidism among patients treated with sofosbuvir, IFN, and ribavirin. This is the first prospective study of the thyroid dysfunction in DAA drugs treated patients. This study compared the risk of hypothyroidism in two different groups of HCV patients treated with different DAA drugs regimens that were sofosbuvir + pegylated‐IFN‐α + ribavirin and sofosbuvir + daclatasvir + ribavirin. Our findings highlight the periodic screening of serum thyroid‐stimulating hormone and T4 levels in HCV infected patients during the treatment and posttreatment. Keywords: daclatasvir, HCV, hypothyroidism, peg‐IFN‐α, ribavirin, sofosbuvir.
21. Ayub, R., Umer, M., Maan, A. A., Rasool, B., Younis, M. K. I. K. T., Afzal, M. S., Shah, Z. H., . . . Afzal, M. I. (2020). Antibiotics, Acid and Heat Tolerance of Honey adapted Escherichia coli, Salmonella Typhi and Klebsiella pneumoniae. Foods, 9(3), 311. (Muhammad Sohail Afzal (Life Sciences/SSC) Zaheer Hussain Shah (Physics/SSC) Abstract: The medicinal importance of honey has been known for many decades due to its antimicrobial properties against life‐threatening bacteria. However, previous studies revealed that microorganisms are able to develop adaptations after continuous exposure to antimicrobial compounds. The present study was conducted to explore the impact of subinhibitory concentrations of branded honey (Marhaba) and unbranded honey (extracted from Ziziphus mauritiana plant) locally available in Pakistan on Escherichia coli ATCC Research Outlook 2020 | 54
10536, Salmonella Typhi and Klebsiella pneumoniae by investigating the development of self‐ or cross‐resistance to antibiotics (gentamicin, kanamycin and imipenem). Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of autoclaved honeys were determined. The bacterial cells of E. coli ATCC 10536, S. Typhi and K. pneumoniae were subjected to honey adaptation by exposing to ¼ × MIC (4 passages) and ½ × MIC (4 passages) of both honeys. Moreover, tolerance to low pH and high temperature was also studied in
adapted and unadapted cells. The decreasing trend in growth pattern (OD600nm) of E. coli ATCC 10536, S. Typhi and K. pneumoniae was observed with increases in the concentration of honeys (6.25–50% v/v) respectively. Our results showed that continuous exposure of both honeys did not lead to the development of any self‐ or cross‐ resistance in tested bacteria. However, percent survival to low pH was found to be significantly higher in adapted cells as compared to unadapted cells. The results indicate that both branded honey (Marhaba) and unbranded honey (extracted from Ziziphus mauritiana plant) were effective in controlling the growth of tested pathogenic bacteria. However, the emergence of tolerance to adverse conditions (pH 2.5, temperature 60 °C) deserves further investigation before proposing honey as a better antibacterial agent in food fabrication/processing, where low pH and high temperatures are usually implemented. Keywords: honey, escherichia coli, salmonella typhi, klebsiella pneumoniae, microbial adaptation, stress resistance.
22. Tariq, A., Mateen, R. M., Afzal, M. S., & Saleem, M. (2020). Paromomycin: a potential dual targeted drug effectively inhibits both Spike (S1) and Main Protease of COVID‐19. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, 98, 166‐175. doi: 10.1016/j.ijid.2020.06.063. (Rana Muhammad Mateen, Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: bjectives: With the increasing number of people suffering from coronavirus disease 2019 (COVID‐19), caused by severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), there is a dire need to look for effective remedies against this pandemic. Drug repurposing seems to be the solution for the current situation. Methods: In a quest to find a potential drug against this virus, 15 antimalarial drugs (including chloroquine) and 2413 US Food and Drug Administration‐approved drugs were investigated for activity against both the protease and spike proteins of SARS‐CoV‐2 using an in silico approach. Molecular docking analysis followed by molecular dynamics simulation was performed to estimate the binding and stability of the complexes. Results: This study identified a single drug – paromomycin – with activity against two targets of SARS‐CoV‐2, i.e., spike protein (S1) and protease domain. Paromomycin was found to have strong binding affinity for both targets of coronavirus. The results also showed that no antimalarial drug exhibited effective binding for either S1 or protease. Conclusions: This study found that paromomycin may be an effective dual targeting drug against coronavirus, as it binds not only to the protease domain of the virion, but also to the spike domain, with high stability. Furthermore, none of the antimalarial drugs showed strong binding affinity for either protease or the receptor binding domain (RBD). Keywords: COVID‐19, Drug repurposing, Chloroquine, Protease, Spike, MD simulation.
23. Saqib, M. A. N., Rafique, I., Ullah, O., Irshad, R., Javed, N., Raza, A., . . . Afzal, M. S. (2020). Protection against Haemophilus influenzae Type B, Diphtheria, and Tetanus in Children from Major Cities of Pakistan: A Community‐ Based Study. Journal of Pediatric Infectious Diseases, 15(04), 163‐168. (Ali Raza, Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Objective Pentavalent vaccine has been introduced in Pakistan against tetanus, diphtheria, Haemophilus influenzae type B (HiB), pertussis, and hepatitis B virus. Methods This study was designed to determine protection against diphtheria, tetanus, and HiB in children of age 18 to 24 months from community which had received all three doses of pentavalent vaccine.
Research Outlook 2020 | 55
Results Overall, 97% were having immunity against HiB, 97% against tetanus, and 88% against diphtheria. Our study showed that children aged 18 to 24 months in Pakistan have high level of protection against HiB and tetanus. However, the protection for diphtheria was low in 40% of children which could be improved by adding a booster dose of diphtheria. Conclusion By increasing the vaccine coverage among children, the burden of these diseases can be reduced in the future. Keywords: pentavalent vaccine ‐ vaccine efficacy ‐ vaccine coverage ‐ Pakistan.
24. Saleem, S., Ahmed, H., Siddiqui, T., Kilinc, S. G., Khan, A., Afzal, M. S., & Simsek, S. (2020). Reduce Disease Burden of Human Schistosomiasis in Asia Through Biological Control. Mini Reviews in Medicinal Chemistry, 20(12), 1118‐ 1132. (Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Schistosomiasis is a chronic parasitic disease caused by a trematode blood fluke of the genus Schistosoma that belongs to the Schistosomatidae family. It is a neglected disease in different regions of Asia. In this review, 218 articles (between 2000 and 2017) related to the topic were collected from PubMed and Google scholar and reviewed. After thoroughly reading collected articles, due to irrelevant topic requirements, 94 articles were excluded. Articles that have data associated with Asian regions are considered. In Asia, the disease is prevalent in China, Philippines, Indonesia, Yemen, Nepal and Laos, etc. While in Pakistan, India and Bangladesh, the disease is not endemic and very few cases were reported. The disease was eliminated from Japan and Iran. The current review highlights the geographical distribution among Asian countries, transmission patterns, diagnosis, control strategies based on the use of anthelmintic plants and management practices implemented in Asia for the control of schistosomiasis. However, new implementations to treat schistosomiasis in humans should be proved to eliminate the disease finally in the future. This review emphasizes the biological control of schistosomiasis for the eradication of the disease from Asia in the near future. Keywords: Asia, schistosomiasis, biological control, distribution, plants.
25. Afzal, M. S. (2020). Childhood Cancer in Pakistan. Iranian Journal of Public Health, 49(8), 1579. https://doi.org/10.18502/ijph.v49i8.3908. (Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
26. Shabbir, R. M. K., Saleem, S., Khan, A., Afzal, M. S., Qureshi, U. M., & Ahmed, H. (2020). Hot spots, Risk Factors and Management of Polio virus in Pakistan. Journal of Medical Virology 92, 2374‐2375. https://doi.org/10.1002/jmv.26058. (Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
27. Iqbal, I., Aftab, M., Afzal, M. S., & Kaleem, A. (2020). Characterization of Geobacillus stearothermophilus protease for detergent industry. Revista Mexicana De Ingeniería Química, 19(Sup. 1), 267‐279. https://doi.org/10.24275/rmiq/Bio1647. (Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Cloning of protease gene from a thermophilic strain of Geobacillus stearothermophilus (B‐1172) was carried out in E. coli BL 21, and its expression was studied. The expressed protease was purified followed by its identification. A 16.9 folds purification with 55.68% recovery of the protease was achieved by ammonium sulfate precipitation and gel filtration chromatography. The protease specific activity was 120 U mg−1. The purified enzyme remained stable at 90°C at a pH range 6‐9. Its interaction with EDTA, different metal ions, inhibitors, surfactants and detergents was also mapped. Its interaction with EDTA showed no significant effect on the activity of the enzyme confirming its metaloprotease nature. Metal ions i.e. Ca2+, Mg2+, Ni2+, Cd2+, Cu2+, Research Outlook 2020 | 56
Zn2+ showed no significant effect on the stability of protease. Its compatibility was checked with different commercial detergent (6 mg/mL) such as Surf Excel Arial, Bonus, wheel and Shine. It retained more than 80% proteolytic activity in all detergents after incubation at 50°C for 1 h. Wash performance analysis of the protease of G. stearothermophilus showed good results of de‐staining of blood sample at various temperatures. Therefore, recombinant protease could prove as good candidate for commercial use in detergents. Keywords: Geobacillus stearothermophilus, protease, thermophile, detergent, purification.
28. Hussain, A., Farooq, M., Naqvi, R. Z., Amin, I., Pervaiz, K., Saeed, M., . . . Mansoor, S. (2020). Genome‐wide identification and classification of resistance genes predicted several decoy domains in Gossypium sp. Plant Gene, 24, 100250. doi: https://doi.org/10.1016/j.plgene.2020.100250. (Athar Hussain (Life Sciences/SSC) Abstract: Resistance (R) genes are directly or indirectly involved in the activation of the plant immune systems. Despite their essential roles in defense against a variety of pathogens, very little is known about their classification as well as associated decoy domains, particularly in crop plants. Using advanced bioinformatics strategies, this study provided a complete classification of all R genes in three cotton species, G. arboreum (Ga), G. raimondii (Gr) and G. hirsutum (Gh)). A total of 3085, 3024 and 5355 R genes were identified in Ga, Gr and Gh, respectively and these were classified into fifteen major classes based on R domains. Moreover, we identified several decoy domains associated with the R domains mainly comprising DUF, Lectin_legB, WRKY and Calmodulin_binding domains. Interestingly, most of the identified decoy domains belong to stress‐responsive protein families. Furthermore, the comparison among the cotton genomes suggested the gain and loss of R gene classes displaying the evolutionary divergence of these three genomes. Finally, promoter analysis also predicted different cis‐acting sites in different NBS‐containing R gene classes. Overall this study provides in‐depth genome‐ wide insights into R genes and their associated decoy domains in cotton, and potentially also appears as a reference study on R genes for other agronomically important crops. Keywords: resistance genes, genome‐wide, cotton, classification, bioinformatics, comparative, genomics, R domains, Phylogenetic tree.
29. Batool, H., Mushtaq, N., Batool, S., Ullah, F. I., Hamid, A., Ali, M., . . . Ashraf, N. M. (2020). Identification of the potential type 2 diabetes susceptibility genetic elements in South Asian populations. Meta Gene, 26, 100771. doi: https://doi.org/10.1016/j.mgene.2020.100771. (Hina Batool (Life Sciences/SSC) Abstract: Currently, type 2 diabetes (T2D) is a significant health risk to humanity. Regardless of many comprehensive genetic studies, the potential role of many candidate genes involved in the pathogenesis of T2D remains unclear. Identification of disease‐associated genes and their variants through conventional experimental techniques is an expensive and time‐consuming job. In this data‐driven study, we tried to predict novel T2D related genetic signatures in South Asian (SAS) populations which may make these population susceptible to the T2D. Gene expression and SNPs association data related to T2D was retrieved from the GWAS catalogue and GEO database for the predictions. After cleaning and fetching the most relevant genes related to diabetes from GWAS and GEO data, functional annotation of the selected genes was performed using DAVID, resulting in the core gene list. SAS‐specific genes from the core gene list were selected based on minor allele frequency (MAF < 0.05). The list was further shortlisted for already reported genes in SAS populations. Finally, we were able to identify a total of seven unreported candidate genes and their associated gene variants. We presume our computational gene collection data using various bioinformatics tools would not only contribute towards a knowledge‐base but also throw in ideas for the development of genotyping arrays for better‐targeted therapeutics and management of the T2D. Keywords: not available.
Research Outlook 2020 | 57
30. Zubair, M., Khan, M. Z., Rauf, I., Raza, A., Shah, A. H., Hassan, I., . . . Mansoor, S. (2020). Artificial micro RNA (amiRNA)‐mediated resistance against whitefly (Bemisia tabaci) targeting three genes. Crop Protection, 137, 105308. doi: https://doi.org/10.1016/j.cropro.2020.105308. (Amir Raza (Biotechnology/Knowledge Unit of Science) (SKT Campus) Abstract: Whitefly (Bemicia tabaci) is an insect pest that causes severe losses in economically important crops by sucking the plant sap and transmitting plant viruses. We used the promising new approach of plant‐mediated artificial miRNA (amiRNA) expression against three essential genes of whitefly. The Arabidopsis thaliana miR159 precursor was modified and engineered to express artificial miRNAs (amiRNAs) targeting three vital genes of whitefly, sex lethal (Sxl) protein, acetylcholinesterase (AChE) and orcokinin (Orc). The amiRNAWF construct was transformed into the Nicotiana tabacum plants. Whiteflies were infested in separate cages on both control and transgenic plants. After four weeks of infestation, the nymphs were counted and real time quantitative PCR (RT‐ qPCR) was performed to assess the relative expression of whitefly genes. The transgenic N. tabacum plants showed resistance against whitefly and the number of whiteflies in the next generation were substantially reduced on transgenic plants compared to control plants. Abnormal egg hatching and poor development was observed and only a small number of whitefly nymphs matured to adults. RT‐qPCR results indicated that the expression of target genes (Sxl, AChE and Orc) in the nymphs was considerably down‐regulated in whiteflies reared on transgenic plants. The amiRNA mediated resistance against whitefly in transgenic plants may pave the way for engineering resistance against whitefly in cotton plants. Keywords: Whitefly, RNA Silencing, amiRNA, Sxl, AChE, Orc.
31. Jahejo, A. R., Raza Bukhari, S. A., Jia, F.‐J., Abbas Raza, S. H., Shah, M. A., Rajput, N., . . . Tian, W.‐X. (2020). Integration of gene expression profile data to screen and verify immune‐related genes of chicken erythrocytes involved in Marek's disease virus. Microbial Pathogenesis, 148, 104454. doi: https://doi.org/10.1016/j.micpath.2020.104454. (Sayyad Ali Raza Bukhari (Biotechnology/Knowledge Unit of Science) (SKT Campus) Abstract: Chicken erythrocytes participated in immunity, but the role of erythrocytes in the immunity of Marek's disease virus (MDV) has not been reported related to the immunity genes. The purpose of this study was to screen and verify the immune‐related genes of chicken erythrocytes which could be proven as a biomarker in MDV. The datasets (GPL8764‐Chicken Gene Expression Microarray) were downloaded from the GEO profile database for control and MDV infected chickens to obtain differentially expressed genes (DEGs) through bioinformatics methods. Kyoto Encyclopedia of Genes and Genomes (KEGG) was performed to find enriched pathways, including Gene Ontology (GO). Based on enriched pathways, the top 19 immune‐related genes were screened‐out and process further to construct the protein‐protein interaction (PPI) networks. The screened genes were validated on RT‐PCR and qPCR. Results suggested that the mRNA transcription of Toll‐like receptors 2, 3, 4, 6 (TLR2, TLR3, TLR4, TLR6), major histocompatibility complex‐II (MHCII), interleukin‐7 (IL‐7), interferon‐βeta (IFN‐β), chicken myelomonocytic growth factor (cMGF) and myeloid differentiation primary response 88 (MyD88) were significantly up‐regulated. The expression of toll‐like receptor 5,7 (TLR5, TLR7) interleukin‐12 (IL‐12p40), interleukin‐13 (IL‐13), and interferon‐αlpha (IFN‐α) were significantly down‐regulated in the erythrocytes of the infected group (P < 0.05). In contrast, the expression of toll‐like receptor‐1, 15, 21 (TLR1, TLR15, TLR21), major histocompatibility complex I (MHCI) and Tumor necrosis factor receptor (TNFR)‐associated factor 6 (TRAF6) were not significant. In conclusion, it has been verified on qRT‐PCR results that 19 immune‐related genes, which included TLRs, cytokines and MHC have immune functions in MDV infected chickens. Keywords: Chicken, Erythrocytes, Immunity, MDV, TLRs.
32. Saqib, M. A. N., Siddiqui, S., Qasim, M., Jamil, M. A., Rafique, I., Awan, U. A., . . . Afzal, M. S. (2020). Effect of COVID‐19 lockdown on patients with chronic diseases. Diabetes & Metabolic Syndrome: Clinical Research & Research Outlook 2020 | 58
Reviews, 14(6), 1621‐1623. doi: https://doi.org/10.1016/j.dsx.2020.08.028. (Muhammad Arif Nadeem Saqib, Usman Ayub Awan, Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Background and aims: We sought to measure the effect of lockdown, implemented to contain COVID‐ 19 infection, on routine living and health of patients with chronic diseases and challenges faced by them. Methods: A semi‐structured online questionnaire was generated using “Google forms” and sent to the patients with chronic diseases using WhatsApp. Data were retrieved and analyzed using SPSS. Results: Out of 181 participants, 98% reported effect of lockdown on their routine living while 45% reported an effect on their health. The key challenges due to lockdown were to do daily exercise, missed routine checkup/lab testing and daily health care. Conclusion: It is important to strategize the plan for patients with chronic diseases during pandemic or lockdown. Keywords: COVID‐19, chronic diseases, lockdown.
33. Kanwal, F., Tahir, A., Qadir Shah, S. A., Tsuzuki, T., Nisbet, D., Chen, J., & Rehman, Y. (2020). Effect of phyto‐ fabricated nanoscale organic‐iron complex on photo‐fermentative hydrogen production by Rhodopseudomonas palustris MP2 and Rhodopseudomonas palustris MP4. Biomass and Bioenergy, 140, 105667. doi: https://doi.org/10.1016/j.biombioe.2020.105667. (Yasir Rehman (Life Sciences/SSC) Abstract: Biosynthesis is a promising green method to produce hydrogen fuel. Different approaches have been used in this regard to enhance hydrogen yield, however, there is still a need to explore further. The current research is an effort to enhance hydrogen yield using nanoscale organic‐iron (NO–Fe) complex. NO–Fe complex was synthesized using Eucalyptus viminalis leaf extract and was characterized by UV–Vis, FTIR, XRD, FESEM, TEM and EDS. The NO–Fe complex was used as an iron source for the newly isolated photo fermentative Rhodopseudomonas palustris MP2 and Rhodopseudomonas palustris MP4 bacterial strains.
FeSO4∙7H2O was also used as a source of iron and compared with the effects of NO–Fe complex. Both the strains responded well to the NO–Fe complex and production of hydrogen was increased with increasing concentrations −1 of NO–Fe complex. Highest yield of hydrogen was achieved by R. palustris MP4 (0.08 ± 0.01 mol‐H2mol of‐ succinate) when the NO–Fe complex was used at 5.0 mg L−1 concentration. The NO–Fe complex was more efficient than iron ions in enhancing bio‐hydrogen production. The study revealed that phyto‐fabricated NO–Fe complex is an efficient nutrient to improve hydrogen production by purple non‐sulfur bacteria. Keywords: bio‐hydrogen production, nanoscale organic‐iron ‘complex, eucalyptus viminalis, photo‐fermentation bacteria, purple non‐sulfur bacteria, rhodopseudomonas palustris.
34. Mateen, R. M., Tariq, A., Ali, M., Afzal, M. S., Samra, Q. Z., & Athar, M. A. (2020). Cloning and Heterologous Expression of Hepatitis B Virus Pre‐Surface Antigen 1. Molecular Genetics, Microbiology and Virology, 35(2), 112‐ 116. doi: 10.3103/S089141682002007X. (Rana Muhammad Mateen, Muhammad Ali, Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Hepatitis B causes major deathly infections in developing countries. The surface antigen preS1, hepatocytes attachment site, plays a crucial role in development and progression of disease. The present study was, therefore, an effort to develop an efficient expression system for PreS1 gene in Esherishia coli. PreS1 gene was amplified and cloned in pTZ57R/T vector. Following confirmation through restriction enzyme digestion and sequencing, it was subcloned in pET22b(+). E. coli BL21 (DE3) CodonPlus cells were transformed with the recombinant plasmid. PreS1 gene was induced using IPTG, the protein was expressed and quantified with Bradford assay and analyzed on SDS‐PAGE. Enzyme Linked Immunosorbent Assay and Western Blot analysis were performed for protein integrity and conformation. Keywords: ELISA, recombinant plasmid, SDS PAGE, western blot.
Research Outlook 2020 | 59
35. Mateen, R. M., Tariq, A., & Hussain, M. (2020). Generating DNA profile from low copy number DNA: Strategies and associated risks. Acta Scientiarum. Biological Sciences, 42(1), e52239. https://doi.org/10.4025/actascibiolsci.v42i1.52239. (Rana Muhammad Mateen, Mureed Hussain(Life Sciences/SSC) Abstract: Many shreds of evidence found on the crime scenes contain a trace amount of DNA which results in insignificant profiling results for subsequent comparison. This can nullify the potential evidence material and hamper investigation process. Over the years, different strategies have been employed by various DNA testing laboratories to create interpretable DNA profiles generated from low template of DNA. This review highlights different strategies used by forensic laboratories worldwide for creating complete DNA profiles from low copy number template for comparison purposes along with its associated risks for forensic purposes. Keywords: TR profiling, forensic genetics, likelihood ratio, random match probability.
36. Arif, N., Subhani, A., Hussain, W., & Rasool, N. (2020). In Silico Inhibition of BACE‐1 by Selective Phytochemicals as Novel Potential Inhibitors: Molecular Docking and DFT Studies. Current drug discovery technologies, 17(3), 397‐411. doi: 10.2174/1570163816666190214161825. (Nadia Arif, Andleeb Subhani (Life Sciences/SSC) Abstract: Background: Alzheimer’s Disease (AD) has become the most common age‐dependent disease of dementia. The trademark pathologies of AD are the presence of amyloid aggregates in neurofibrils. Recently phytochemicals being considered as potential inhibitors against various neurodegenerative, antifungal, antibacterial and antiviral diseases in human beings. Objective: This study targets the inhibition of BACE‐1 by phytochemicals using in silico drug discovery analysis. Methods: A total of 3150 phytochemicals were collected from almost 25 different plants through literature assessment. The ADMET studies, molecular docking and density functional theory (DFT) based analysis were performed to analyze the potential inhibitory properties of these phytochemicals. Results: The ADMET and docking results exposed seven compounds that have high potential as an inhibitory agent against BACE‐1 and show binding affinity >8.0 kcal/mol against BACE‐1. They show binding affinity greater than those of various previously reported inhibitors of BACE‐1. Furthermore, DFT based analysis has shown high reactivity for these seven phytochemicals in the binding pocket of BACE‐ 1, based on ELUMO, EHOMO and Kohn‐ Sham energy gap. All seven phytochemicals were testified (as compared to experimental ones) as novel inhibitors against BACE‐1. Conclusion: Out of seven phytochemicals, four were obtained from plant Glycyrrhiza glabra i.e. Shinflavanone, Glabrolide, Glabrol and PrenyllicoflavoneA, one from Huperzia serrate i.e. Macleanine, one from Uncaria rhynchophylla i.e. 3a‐dihydro‐cadambine and another one was from VolvalerelactoneB from plant Valeriana‐ officinalis. It is concluded that these phytochemicals are suitable candidates for drug/inhibitor against BACE‐1, and can be administered to humans after experimental validation through in vitro and in vivo trials. Keywords: ADMET, BACE‐1, Molecular Docking, DFT, phytochemicals, in silico inhibition.
37. Rasool, N., Majeed, A., Riaz, F., & Hussain, W. (2020). Identification of novel inhibitory candidates against two major Flavivirus pathogens via CADD protocols: in silico analysis of phytochemical binding, reactivity, and pharmacokinetics against NS5 from ZIKV and DENV. Structural Chemistry. 31, 2189–2204. doi: 10.1007/s11224‐ 020‐01577‐x. (Fareeha Riaz (Life Sciences/SSC) Abstract: Zika and dengue virus are flaviviruses which with the passage of time have become a serious challenge affecting millions of people around the world. To lessen the impact of these viral infections globally and to combat these virus‐associated epidemics in the future, new medical findings and pharmacological approaches are needed. The phytochemicals extracted from a variety of various plants consist of amazing medicinal properties and can be used in the production of novel anti‐viral drugs. The two domains of NS5 protein (NS5 MTase and NS5 RdRp) can be targeted in the clinical trials to produce effective novel inhibitors against Zika and Research Outlook 2020 | 60
dengue fever. Herein, we aim at using a wide variety of phytochemicals (n = 2035) as inhibitors against NS5 protein from DENV and ZIKV. Absorption, distribution, metabolism, excretion, and toxicity (ADMET) properties of the selected compounds were studied to evaluate the pharmacological characteristics. Molecular docking was carried out to determine the binding properties of these ligands with NS5 protein and reactivity was analyzed using molecular orbital energy descriptors. A total of 108 compounds were found suitable in ADMET and from 108 compounds, 35 compounds with the highest in the case of NS5 MTase from ZIKV and DENV were selected. While for NS5 RdRp, 29 compounds were selected. Those compounds, which exhibited remarkable binding affinities values against the proteins of both the ZIKV and 4 serotypes of DENV simultaneously, were predominantly selected in this study. It is concluded that these compounds can be used in clinical trials for the production of a mutual anti‐viral drug against both DENV and ZIKV. Keywords: DENV, ZIKV, NS5, Phytochemicals, In silico analysis, CADD.
38. Nawaz, M. S., Arshad, A., Rajput, L., Fatima, K., Ullah, S., Ahmad, M., & Imran, A. (2020). Growth‐Stimulatory Effect of Quorum Sensing Signal Molecule N‐Acyl‐Homoserine Lactone‐Producing Multi‐Trait Aeromonas spp. on Wheat Genotypes Under Salt Stress. Frontiers in microbiology, 11, 553621. https://doi.org/10.3389/fmicb.2020.553621. (Kaneez Fatima (Life Sciences/SSC) Abstract: Salinity is one of the major threats to agricultural productivity worldwide. Soil and plant management practices, along with inoculation with plant‐beneficial bacteria, play a key role in the plant’s tolerance toward salinity stress. The present study demonstrates the potential of acyl homoserine lactone (AHL)‐producing plant growth promoting rhizobacteria (PGPR) strains of Aeromonas sp., namely, SAL‐17 (accession no. HG763857) and SAL‐21 (accession no. HG763858), for growth promotion of two wheat genotypes inherently different for salt tolerance potential. AHLs are the bacterial signal molecules that regulate the expression of various genes in bacteria and plants. Both Aeromonas spp., along with innate plant‐growth‐promoting (PGP) and salt tolerance traits, showed AHL production which was identified on tandem mass spectrometry as C6‐HSL, 3‐OH‐C5‐HSL, 3‐ OH‐C6‐HSL, 3‐oxo‐C7‐HSL C10‐HSL, 3‐oxo‐C10‐HSL, 3‐OH‐C10‐HSL, 3‐oxo‐C12‐HSL and C6‐HSL, and 3‐oxo‐C10‐ HSL. The exogenous application of purified AHLs (mix) significantly improved various root parameters at 200 mM NaCl in both salt‐sensitive (SSG) and salt‐tolerant (STG) genotypes, where the highest increase (≈80%) was observed where a mixture of both strains of AHLs was used. Confocal microscopic observations and root overlay assay revealed a strong root colonization potential of the two strains under salt stress. The inoculation response of both STG and SSG genotypes was evaluated with two AHL‐producing strains (SAL‐17 and SAL‐21) and compared to non‐AHL‐producing Aeromonas sp. SAL‐12 (accession no. HG763856) in saline (EC = 7.63 ms/cm2) and non‐ saline soil. The data reveal that plants inoculated with the bacterial consortium (SAL‐21 + SAL‐17) showed a maximum increase in leaf proline content, nitrate reductase activity, chlorophyll a/b, stomatal conductance, transpiration rate, root length, shoot length, and grain weight over non‐inoculated plants grown in saline soil. Both STG and SSG showed relative effectiveness toward inoculation (percent increase for STG: 165–16%; SSG: 283–14%) and showed a positive correlation of grain yield with proline and nitrate reductase activity. Furthermore, principal component analysis (PCA) and categorical PCA analysis clearly showed an inoculation response in both genotypes, revealing the effectiveness of AHL‐producing Aeromonas spp. than the non‐AHL‐ producing strain. The present study documents that the consortium of salt‐tolerant AHL‐ producing Aeromonas spp. is equally effective for sustaining the growth of STG as well as SSG wheat genotypes in saline soil, but biosafety should be fully ensured before field release. Keywords: AHLs, wheat, Aeromonas, PGPR – plant growth‐promoting rhizobacteria, halophilic.
39. Lal, A., Kil, E.‐J., Rauf, K., Ali, M., & Lee, S. (2020). First Report of Papaya leaf curl virus Associated with Leaf Curl Disease in Cestrum nocturnum in Pakistan. Plant Disease, 104(11), 3089. doi: 10.1094/pdis‐12‐19‐2681‐pdn. (Kainat Rauf, Muhammad Ali (Life Sciences/SSC) (Disease Notes) Research Outlook 2020 | 61
Abstract: Not available. Keywords: not available.
40. Lal, A., Kil, E.‐J., Vo, T. T. B., Fadhila, C., Ho, P. T., Ali, M., . . . Lee, S. (2020). First Report of Duranta leaf curl virus Infecting Ficus virens Showing Leaf Curl Symptoms in Pakistan. Plant Disease, 104(7), 2034. doi: 10.1094/pdis‐12‐ 19‐2719‐pdn. (Muhammad Ali (Life Sciences/SSC) (Disease Notes) Abstract: Not available. Keywords: not available.
41. Raza, A., Khaliq, A., & Amir, A. (2020). Tragic outbreak of human immunodeficiency virus infection among children in Sindh, Pakistan. Public Health, 178, 5‐6. doi: https://doi.org/10.1016/j.puhe.2019.08.014. (A. Khaliq, Anam Amir (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
42. Sadia, H., Bhinder, M. A., Irshad, A., Zahid, B., Ahmed, R., Ashiq, S., . . . Akbar, A. (2020). Determination of expression profile of p53 gene in different grades of breast cancer tissues by real time PCR. African health sciences, 20(3), 1273‐1282. doi: 10.4314/ahs.v20i3.32. (Asma Irshad (Life Sciences/SSC) Abstract: Background: Pakistan has a high incidence of breast cancer in Asia, where annually 16,232 deaths are reported. There are many exogenous and endogenous risk factors that affect the tumor suppressor genes and oncogenes. The p53 gene is a tumor suppressor gene and it has a role to protect the whole genome from external and internal stresses, which causes damages to the genome. Objective: The aim of the current study was to investigate the p53 gene expression by using the real‐time PCR technique in different grades of breast cancer as compared to the normal tissue. Methods: Fresh Modified Radical Mastectomy (MRM) samples (grade1‐grade3) were collected from different hospitals of the Lahore. The project was approved by an ethical review committee of Jinnah Hospital, Lahore. And before sampling an informed consent was obtained from patients and clinicians. RNA from fresh biopsies was extracted by Qiagen extraction kit and cDNA was formed. Real time PCR performed by using SYBR green master mix (ABI) and the data was evaluated by using Livak method. Statistical analysis was done by using Microsoft Excel. Results: There was an abnormal gene expression of p53 in all grades of the breast tumors. Non‐significant (p>0.05) difference of down and up regulation of p53 in different grades of breast tumor was found. However, as a whole up‐regulation was more than down‐regulation with significant difference (p<0.0011). Conclusion: The abnormal expression of p53 shows that there are some genetic and epigenetic factors which are the primal cause of an abnormal gene expression. It is recommended that perform next generation sequencing (NGS) of the gene to find out the mutations causing the abnormal behavior of p53 gene. Keywords: Breast cancer, up‐regulation, down‐regulation, real‐time PCR, Punjab, Pakistan, p53 gene.
43. Khan, M. U., Sadia, H., Irshad, A., Baig, A. A., Ashiq, S., Zahid, B., Sheikh, R., Roshan, S., Ali, A., Shamas, S., Bhinder, M. A., & Ahmad, R. (2020). Detection, quantification and genotype distribution of HCV patients in Lahore, Pakistan by real‐time PCR. African health sciences, 20(3), 1143–1152. https://doi.org/10.4314/ahs.v20i3.16. (Asma Irshad (Life Sciences/SSC) Abstract: Background: Hepatitis C virus (HCV) is considered as “Viral Time Bomb” suggested by the World Health Organization and if it is not treated timely, it will lead towards cirrhosis and hepatocellular carcinoma (HCC). Objective: The purpose of the present research is to study possible risk factors, frequent genotypes of HCV and its asso‐ ciation with different age groups. Research Outlook 2020 | 62
Methods: Suspected blood samples from HCV patients were collected from different hospitals of Lahore, Pakistan. Out of 1000 HCV suspected samples, 920 samples were found HCV positive detected by Anti‐HCV ELISA, CobasR. kit. The quantification of HCV load was determined by HCV quantification kit and LINEAR ARRAY KIT (Roche) was used for genotype determination by Real‐Time PCR (ABI). Statistical analysis was done by using Microsoft Excel. Results: Out of 920 subjects, 77 subjects (8.4%) were false positive and they were not detected by nested PCR. Three PCR positive samples were untypeable. Genotype 3 was predominant in Lahore which was 83.5%, whereas type 1 and 2 were 5.1% and 0.7% respectively. There were also mixed genotypes detected, 1 and 3 were 0.4%, 2 and 3 were 1.41% and 3 and 4 were 0.2% only. Male were more infected of HCV in the age <40 years and females >40years. Conclusion: The major risk factor for HCV transmission is by use of unsterilized razors/blades. It is necessary to spread awareness among the general population of Pakistan about HCV transmission risk factors. Regular physical examination at least once a year is recommended, so that early detection of HCV could be done. Keywords: Hepatitis C virus, hepatocellular carcinoma, quantification, genotype, real‐time PCR.
44. Zahid, M., Irshad, A., Shakoor, S., Samiullah, T. R., Shahid, N., Iqbal, A., . . . Rao, A. Q. (2020). Engineered Recombinant NDV‐Fusion Protein and Its Polyclonal Antibodies Production. Pakistan Veterinary Journal, 40(4), 499‐503. doi: 10.29261/pakvetj/2020.034. (Asma Irshad (Life Sciences/SSC) Abstract: Antibodies have important role in biological research and diagnosis. Polyclonal antibodies can be produced against more than one epitope of an antigen. Newcastle disease (ND) is one of the most devastating diseases that considerably effects the global poultry industry. Newcastle disease virus (NDV) possess Fusion (F) protein for the attachment and pathogenicity. In the present study TA plasmid having F gene was restricted by EcoR1 and it was ligated into pET30a expression vector. The F gene ligated pET30a was transformed in BL21DE3 expression strain. After the expression of NDV F protein, it was verified by the appearance of 67 kDa band on SDS‐PAGE gel and western blot. The F protein was partially purified by the column of 70 kDa cut. The recombinant F protein was used for the generation of polyclonal antibodies. Two groups (experimental group and negative control group) of 3 months old rabbits were used. Two doses of recombinant F protein with interval of 15 days were injected subcutaneously for production of antibodies against the F protein. Antibodies were obtained from serum taken after scarifying the rabbits. Production of polyclonal antibodies was confirmed through Dot Blot Assay and ELISA. In this study maximum antibody titer was estimated to be 4.676 (OD at 450 nm) in case of using concentrated antibody. Produced polyclonal antibodies can be further purified in order to use as tools in biomedical and biochemical researches and diagnostic kits. Keywords: Immunoglobulin, Newcastle disease virus, Poultry, Protein, Vaccine.
45. Khan, K., Quispe, C., Javed, Z., Iqbal, M. J., Sadia, H., Irshad, A,. . . Sharifi‐Rad, J. (2020). Resveratrol, curcumin, paclitaxel and miRNAs mediated regulation of PI3K/Akt/mTOR pathway: go four better to treat bladder cancer. Cancer Cell International, 20(1), 560. doi: 10.1186/s12935‐020‐01660‐7. (Asma Irshad (Life Sciences/SSC) Abstract: Bladder cancer (BC) is a leading cause of death among urothelial malignancies that more commonly affect male population. Poor prognosis and resistance to chemotherapy are the two most important characteristics of this disease. PI3K/Akt/mTOR signaling pathway has been considered pivotal in the regulation of proliferation, migration, invasiveness, and metastasis. Deregulation of PI3K/Akt/mTOR signaling has been found in 40% of bladder cancers. Several microRNAs (miRNAs) have been reported to interact with the PI3K/Akt/mTOR signaling pathway with a different possible role in proliferation and apoptosis in bladder cancer. Thus, miRNAs can be used as potential biomarkers for BC. Natural compounds have been in the spotlight for the past decade due to their effective anti‐proliferative capabilities. However, little is known of its possible effects in bladder cancer. The aim of this review is to discuss the interplay between PI3K/Akt/mTOR, miRNAs, and natural Research Outlook 2020 | 63
compounds and emphasize the importance of miRNAs as biomarkers and resveratrol, curcumin and paclitaxel as a possible therapeutic approach against bladder cancer. Keywords: mTOR, miRNAs, Biomarkers, Natural therapeutic, Drug resistance.
46. Rex, O. C., & Sheik, I., Sarawr, N., Irshad, A, (2020). COVID‐19: A Colossal Threat to Fundamental Rights of Humans. International Journal of Humanities & Social Science: Insights & Transformations [ISSN: 2581‐3587 (online)], 5(2). (Asma Irshad (Life Sciences/SSC) Abstract: It is quite apparent that the outbreak of COVID‐19 otherwise known as Coronavirus is accompanied by a series of issues. And without equivocation, one of the issues is the threat the virus is posing to the fundamental rights of human beings. In respect to what is stipulated in the United Nation’s Universal Declaration of Human Rights, humans have the right to life, freedom of worship, freedom of movement, right to education, freedom of opinion, and expression, etc. The rights and freedoms are originally intrinsic, basic, and inalienable. They are the sine qua non for a peaceful and just world. Contrariwise, COVID‐19 is suffocating these rights, the cardinal rights of humans. Howbeit, data for this study is generated from secondary sources for an effective analysis of how the novel virus is affecting the fundamental rights of humans. Keywords: COVID‐19, Threat, Fundamental Human Rights.
47. Aisha, K., Tariq, M., Simsek, S., Afzal, M. S., Harandi, M. F., Shahzad, A., . . . Ahmed, H. (2020). Neglected Tropical Diseases in Pakistan: A Story of Neglect. Iranian Journal of Parasitology, 15(4), 618‐620. (Muhammad Sohail Afzal (Life Sciences/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
48. Khan, R., Naseem, T., Hussain, M. J., Hussain, M. A., & Malik, S. S. (2020). Possible Potential Outcomes from COVID‐19 Complications on Testes: Lesson from SARS Infection. JCPSP‐Journal of the College of Physicians and Surgeons Pakistan, 30(10), 118‐120. doi: 10.29271/jcpsp.2020.supp2.118. (Tayyaba Naseem (Biochemistry/SSC) Abstract: Coronavirus infection disease‐2019 (COVID‐19) gained worldwide fame after deadly outbreak in China and its subsequent spread to many countries. So far, COVID‐19 is not fully contained, and new cases are arising on daily bases in various countries. Due to zoonotic nature and human‐to‐human spread, COVID‐19 is considered pandemic with more causalities in developing countries. Full genome analysis revealed its resemblance with severe acute respiratory syndrome (SARS) virus with minor variation in non‐structural proteins. Both viruses use the common angiotensin converting enzyme (ACE2) receptor to attach to the epithelial cells of the target organs. Currently, COVID‐19 patients are treated with drugs that are used for lungs infections. However, ACE2 has high expression in other human organs such as kidney and testes. Thus, it is assumed that, like SARS, it may have adverse effects on other vital organs, which have dominant expression of ACE2. In testis, SARS affected patients displayed peritubular fibrosis, extensive germ cell disruption, damage of blood‐testis barrier integrity and more frequent occurrence of apoptosis. Here, we critically discuss the possible adverse effects of COVID‐19 on the testes of patients along with future precautions to overcome the complications of reproductive organs. Keywords: COVID‐19, SARS, ACE2, Testes.
49. Wahid, B. (2020). Role of SOCS1 Gene in Chronic Hepatitis C Virus Patients: A Mini‐Review. Journal of Interferon & Cytokine Research, 40(9), 454‐459. doi: 10.1089/jir.2018.0109. (Braira Wahid (Life Sciences/SSC) Abstract: Hepatitis C virus (HCV) is a global health problem, with an estimated bioburden of >180 million. Every year about 350,000 people die from HCV‐associated liver complications such as cirrhosis and cancer (e.g., hepatocellular carcinoma). Pakistan has the second highest prevalence of HCV. Treatment of this life‐threatening
Research Outlook 2020 | 64
disease has been a challenge, but recent developments in direct‐acting antivirals have offered hope to many. Although direct‐acting antivirals have dramatically improved viral clearance, their exorbitant costs put them out of reach for patients in developing countries. Thus, interferon therapy is still being used in Pakistan. Specifically, interferon‐stimulating genes can alter treatment response. For example, interferons induce expression of many antiviral genes through signal transducer and activator of transcription/Janus kinase signaling. Suppressor of cytokine signaling genes play an eminent role in the inhibition of cytokine signaling pathways and regulation of both adaptive and innate immunity. The present review examines expression of suppressor of cytokine signaling‐ 1 in HCV‐treated patients. Keywords: SOCS1, hepatitis C virus (HCV), direct‐acting antiviral (DAA) drugs, interferons.
50. Mateen, R. M., & Tarig, A. (2020). The Practice of Forensic Science in Pakistan. Forensic Science Review, 32(2), 84+. (Rana Muhammad Mateen (Life Sciences/SSC) Abstract: Besides other traditional crimes, Pakistan in the past has suffered from terrorist attacks and racist activism. The majority of investigations and analyses were conducted by the police, based on traditional investigation procedures. These procedures often led to the loss of precious evidence, or in most of the cases, contamination of the physical evidence. Due to increases in eyewitnesses’ false statements, the judiciary system in Pakistan called for science‐based investigation [1]. The need for modern ways of investigation has led to the establishment of forensic agencies in Pakistan. Keywords: not available.
51. Chaudry, S. N., Hussain, W., & Rasool, N. (2020). Inhibitory role of selective phytochemicals against HIV‐2 protease: a study of molecular docking, ADMET and DFT computations. International Journal of Computational Biology and Drug Design, 13(4), 390‐414. doi: 10.1504/ijcbdd.2020.111056. (Rana Muhammad Mateen (Life Sciences/SSC) Abstract: HIV/AIDS caused by human immune deficiency virus (HIV), has become a significant problem for human lives. Plant extracted compounds are worthy because of their anti‐viral, anti‐fungal, anti‐bacterial potential. This research aimed at in silico drug discovery against HIV‐2 protease. A total of 2750 phytochemicals from various medicinal important plants were selected for the current study. The ADMET, molecular docking, DFT approaches were used to determine potential inhibitory characteristics of these phytochemicals. The ADMET analysis and molecular docking approaches resulted in selection of twenty phytochemicals Oxyresveratrol, Paprarine, Osajin, Eryvarin R, 12S‐hydroxyandrographolide, 5, 7, 3´, 4´‐tetrahydroxyflavone, Hydroxymunduserone, Diprenyleriodictyol, Caffeic Acid, ApigeninB, 3‐methoxy‐4‐hydroxyienzoic acid, Estafin, Feruloyltyramine, SigmoidinB, (+)‐medioresinol, Tanaparthe, Xylan, Epoxy, Paprafumine, EryvarinQ which proved to be potential inhibitor against HIV‐2 protease and can be opted for additional in vivo and in vivo studies to gain access to their inhibitory effects against HIV‐2 protease. Above mentioned 20 phytochemicals showed binding affinity ≥8.5 kcal/mol showed effective inhibition against HIV‐2. Furthermore, DFT approach revealed high reactivity for these 20 phytochemicals in binding cavity of HIV‐2 protease based on ELUMO, EHOMOand band energy gap. These 20 phytochemicals are novel potential inhibitors against HIV‐2 protease promising clinical applications. For commercial‐scale applications of theses mentioned phytochemicals their efficacy, safety, reactivity, can be checked by in vitro and in vivo analysis as a potential inhibitor against HIV‐2 protease in humans. The development of reported phytochemicals as potential drugs for HIV‐2 protease would be therapeutically and economically feasible. This study motivates researchers to find out potential inhibitors (extracted from plants) for HIV‐2 protease for better treatment of HIV/AIDS. Keywords: ADMET, absorption, distribution, metabolism, excretion, toxicity, HIV‐2 protease, DFT, density functional theory, molecular docking, phytochemicals.
Research Outlook 2020 | 65
52. Khan, A., Sajid, R., Gul, S., Hussain, A., Zehri, M. T., Naz, S. Afzal, M. S., . . . Ahmed, H. (2020). Epidemiological and pathological characteristics of Cutaneous Leishmaniasis from Baluchistan Province of Pakistan. Parasitology, 148(5), 591‐597. doi: 10.1017/S0031182020002413. (Muhammad Sohail Afzal (Life Sciences/SSC) Abstract: Cutaneous Leishmaniasis (CL) is considered a neglected tropical disease which in Pakistan can now be considered as a growing public health problem. The exact figures on the magnitude of the disease are lacking both at the national and regional level and only a few health centres are available for diagnosis of CL. The present study was designed to identify the epidemiology of CL infection from August 2018 to December 2019 and to assess clinical aspects of CL in Baluchistan Province of Pakistan. A total of 4072 clinically suspected CL cases were analysed statistically. The highest number of CL cases were reported in May, followed by April, January and then July, February and June and the lowest number of cases were observed in March and November. The highest prevalence rate was found in males where 38% of reported cases were aged 0–9 years. The majority (24.4%) of lesions were found on the hands followed by the face in which cheeks, ears and nose were the effected organs. About 50% of the participants have single lesion while 14% of the participants had two and nearly 3% of the participants have six lesions. The atypical clinical presentations were observed in Baluchistan and common unusual presentations were lupus erythematosus. The study findings suggest that more epidemiological studies and health education campaigns are needed for the population awareness regarding CL in Baluchistan. It is recommended that risk factors should be evaluated to establish control and management strategies to prevent disease at the individual and community level. Keywords: Clinical features, Cutaneous Leishmaniasis, Leishmania tropica, Pakistan.
53. Sheikhs, N. N., Qurat‐ul‐ain, & Saba Altaf. (2020). Production of Extracellular Protease from Bacterial Co‐cultures using Solid State Fermentation. BioScientific Review, 2(4), 13‐23. https://doi.org/10.32350/bsr/2020/24/726. (Nabiha Naeem, Qurat‐ul‐ain, Saba Altaf (Life Sciences/SSC) UMT JOURNAL Abstract: Proteases (also known as peptidasesor proteinases) are hydrolytic enzymes that cleave proteins into amino acids. They comprise 60% of the totalindustrial usage of enzymes worldwide and can be obtained from many sources. Thecurrent study aims to isolate and screen protease‐producing bacterial strains from the soil and to produce protease from the bacterial co‐culturesusing solid‐state fermentation (SSF). Primary screening of the protease‐producing bacterial strains was carriedout on skim milk agar and they were sub‐ cultured and preserved on the nutrient agar for further testing. Thirty‐two compatibility tests of twenty‐seven bacterial isolates wereperformed and SSF was carried out.Afterward,absorbancewastakenat660nm against tyrosine as standard. According totheresults, the bacterial co‐culture 19 showed the highest absorbance withan enzyme activity of 10.2 U/ml. The bacterial strains of the co‐culture 19 were identified throughmorphological and biochemical tests. Bacterial strain 1 was observed as cocciandirregular,while bacterial strain 2 was bacillus and rod‐shaped. Both strainswerepositive for gram staining, catalase test, casein hydrolysis test and methyl red test. Asforendosporestaining, bacterialstrain1 was sporeforming while bacterial strain 2 was a non‐spore former. It was concluded thatthe bacterialco‐culture19canactasa potent co‐culture for protease production. Compatibility test was carried out to enhance the production of protease by utilizing cheap and readily available agro‐waste products,which benefit theindustry by being cost effective and the environment by beingeco‐friendly. Keywords: bacterial co‐culture, enzyme assays, hydrolytic enzymes, proteases, solid‐state fermentation.
54. Amir., A, Ansari, I, Arif, F., Bano, S., Amir, F., & Raza, A. (2020). A Review on Phyto‐pharmacological Significance of Ajwa pits (Phoenix dactylifera L.). BioScientific Review, 2(3), 26‐45. https://doi.org/10.32350/bsr/2020/23/409. (Anam Amir, Imama Ansari, Fasiha Arif, Sughra Bano, Fariha Amir, Umair Ahmad, Ali Raza (Life Sciences/SSC) UMT JOURNAL
Research Outlook 2020 | 66
Abstract: Phoenix dactylifera L. (Ajwa date) is a natural plant that belongs to the Arecaceae family and consumed as a fruit. It is cultured all over the world especially in desert areas like Arab regions and has nutritional significance and pharmacological values. P. dactylifera L. dominates itself from other dates because of its enrichment in dietary fibers, vitamins, minerals and sugars. The study exhibits that P. dactylifera L. contains certain phytochemicals including phenols and flavonoids which act as antimicrobial agents. The distinctive profile of phytochemicals in P. dactylifera L.is the reason for its frequent use as a medicinal plant. In vivo and in vitro studies have been performed to understand the complete nature of P. dactylifera L. This review article gives an overview of the nutritional significance, pharmacological actions, life stages and phytochemical mechanism of P. dactylifera L. Keywords: Ajwa pits, antimicrobial agent, nutritional significance, Phoenix dactylifera L., phytochemicals.
55. Akhtar, A., Choudhry, S. N., Mateen, R. M., & Hussain, M. (2020). A Comprehensive In Silico Analysis of Deleterious SNPs of Paraplegin Protein Associated with Hereditary Spastic Paraplegia through Mitochondrial Dysfunction. BioScientific Review, 2(2), 1‐14. https://doi.org/10.32350/BSR.0202.01. (Ammara Akhtar, Sobia Nazir Choudhry, Rana Muhammad Mateen, Mureed Hussain (Life Sciences/SSC) UMT JOURNAL Abstract: Hereditary spastic paraplegia (HSP) is a heterogenous neurological disorder primarily associated with progressive spasticity. Paraplegin is a mitochondrial protein and mutations in this protein can lead to HSP. In this study, in silico analysis was carried out to identify the pathogenic variants of SPG7 (paraplegin protein). To find novel pathogenic mutations, missense and splicing variants were collected from gnomAD database and passed through a detailed and stringent analysis with the help of a variety of bioinformatic tools. The list of mutations was examined and compared in ClinVar. Altogether, 14 missense mutations and 18 splicing mutations were obtained and these mutations were predicted to have the potential of disrupting the normal structural and functional properties of paraplegin protein. Keywords: in silicoanalysis, hereditary spastic paraplegia(HSP), paraplegin, SNPs, SPG7.
56. Chaudry, S. N., Akhtar, A., Naeem, A., & Husaain, D. M. (2020). In Silico Analysis of Variants of Uncertain Significance in AP4S1 Gene. BioScientific Review, 2(1), 01–09. https://doi.org/10.32350/BSR.0201.01. (Sobia Nazir Chaudry, Ammara Akhtar, Ayman Naeem, Mureed Hussain (Life Sciences/SSC) UMT JOURNAL Abstract: Hereditary spastic paraplegia is a group of heterogeneous neurological disorders with genetic etiologies. It is characterized by spasticity in lower limbs along with neurological complications. Sequencing technologies have identified numerous disease causing variants in AP4S1 gene. However, many very low frequency variations in AP4S1 have the potential to cause hereditary spastic paraplegia in a recessive inheritance manner. This study was designed to identify these potential disease causing variants in AP4S1 gene using in silico tools. These tools predict the effects of deleterious variants on protein function and pre‐mRNA splicing. To predict the pathogenicity of missense variants PhD‐SNPg, PROVEAN, SNPs&GO, and CADD were used. Splice site variants were analyzed using Spliceman, SPiCE, and Human Splice Finder (HSF). In silico analysis identified six missense and five splice site variants with the potential to cause hereditary spastic paraplegia. Keywords: AP4S1, heredity spastic paraplegia, in silico prediction, SNPs. Book/Book Chapters 1. Rauf, K., Rahman, R., Saeed, A., Ali, M., Noureen, F., Amir, R., & Gul, A. (2020). Chapter 22 ‐ Next‐generation sequencing in bread wheat. In M. Ozturk & A. Gul (Eds.), Climate Change and Food Security with Emphasis on Wheat (pp. 311‐320): Academic Press. (Kainat Rauf, Rabia Rahman, Muhammad Ali (Life Sciences/SSC) Abstract: Bread wheat is one of the most valuable cereal crops in the world. In the past 40 years, wheat yield and production has increased twice that can be attributed to selection breeding. However, to exploit the full potential of wheat to feed the growing world population, it is necessary to know the encoded genomic sequence
Research Outlook 2020 | 67
information. Unfortunately, the huge genome of bread wheat, i.e., approximately 17 gigabases—five times larger than the human genome—makes it difficult to undertake conventional sequencing methodologies. Next‐ generation sequencing (NGS) potentially can sequence the extensive genome in a relatively short time span. A gold standard quality reference genome of hexaploid wheat, Refseq V1 was settled that represents 94% of the wheat genome. Furthermore, NGS may provide assistance to attain different reference genomes of bread wheat and to study genome‐wide associations, population genetics, and, but not limited to, epigenetic functionalities. Looking into the importance of wheat genomics and the NGS, this study compiles and explores the current knowledge considering application of NGS in wheat research. Keywords: Illumina, Pyrosequencing, Transposable elements, Yeast artificial chromosomes.
2. Liaqat, N., Liaqat, A., Ali, M., Qayyum, Z., Amir, R., Siddique, R., . . . Budak, H. (2020). Chapter 24 ‐ Wheat genomics and genome editing. In M. Ozturk & A. Gul (Eds.), Climate Change and Food Security with Emphasis on Wheat (pp. 331‐346): Academic Press. (Nida Liaqat, Muhammad Ali (Life Sciences/SSC) Abstract: Wheat is an important staple crop cultivated throughout the world. It has a complex genome with multiple copies of a gene. Due to the growing world population and increasing food demand, it is the need of time to increase the production capability of wheat crop. Apart from that climate change with sudden floods and drought conditions, serious attention is needed with modification in wheat. The genome of bread wheat contains dwarfing genes, a large amount of repetitive DNA, functional protein‐coding gene, and rust resistance genes. Several strategies have been in use for improving the quality and production of wheat, and success has been achieved with these approaches. In situ hybridization helped to get improved bread wheat. Nowadays, genome editing at gene level has been started with approaches like zinc‐finger nucleases, transcription activator‐like effector nuclease, and clustered regularly interspaced short palindromic repeats. These approaches have been successfully used in editing wheat genome to get heritable variations for creating diversity and precision breeding. Keywords: CRISPR, DNA, hybridization, nuclease, wheat, zinc‐finger nucleases.
3. Saleem, H., Mohsin, H., Tanvir, R., & Rehman, Y. (2020). Culturable Endophytic Fungal Communities Associated with Cereal Crops and Their Role in Plant Growth Promotion. In A. N. Yadav, J. Singh, A. A. Rastegari & N. Yadav (Eds.), Plant Microbiomes for Sustainable Agriculture (pp. 53‐77). Cham: Springer International Publishing. (Yasir Rehman (Life Sciences/SSC) Abstract: Many microorganisms are known to live in association with plants. Endophytes are the microorganisms that live in the internal tissues of plants. Endophytic fungi hold great importance for the roles that they play in association with the host plants. Endophytes are known to promote the growth of the host plants by various activities such as detoxification of toxic compounds, protection against pathogens, and production of plant growth promoting hormones. Many biotechnologically important metabolites are also produced by endophytes such as anticancer and antimicrobial compounds. There is a rich diversity of endophytes that needs to be explored for biotechnological purposes. This chapter focuses on the endophytic fungi of cereal crops and the roles they play. Keywords: Cereal crops, Endophytic, Fungal communities, Plant growth promotion, Sustainable agriculture. Conference Proceedings 1. Sarwar, N., Nasir, J., Shah, S. Z. H., Ahsan, A., Malik, S., Nasir, S., . . . Irshad, A. (2020). Prediction and Analysis of Sun Shower Using Machine Learning. Paper presented at the Intelligent Technologies and Applications, Singapore. (Asma Irshad (Life Sciences/SSC) Abstract: Climate is the absolute most occasions that influence the human life in each measurement, running from nourishment to fly while then again it is the most tragic wonders. In this manner, expectation of climate
Research Outlook 2020 | 68
wonders is of significant enthusiasm for human culture to keep away from or limit the devastation of climate risks. Climate forecast is unpredictable because of clamor and missing qualities dataset. Various endeavors were made to make climate forecast as precise as would be prudent, yet at the same time the complexities of commotion are influencing exactness. In this paper, the five‐year rainfall record of weather is used for predicting the rainfall by calculating the performance and accuracy through 10 cross‐fold validation technique. Its initial step is gathering, isolating, sorting, and detachment of datasets dependent on future vectors. Arrangement strategy has numerous calculations, some of them are Support Vector Machine (SVM), Naïve Bayes, Random Forest, and Decision Tree. Prior to the execution of each strategy, the model is made and afterward preparing of dataset has been made on that model. Learning the calculation created model must be fit for both the information dataset and estimate the records of class name. Various classifiers, for example, Linear SVM, Ensemble, Decision tree has been utilized and their precision and time broke down on the dataset. At last, all the calculation and results have been determined and analyzed in the terms of accuracy and execution time. Keywords: Classification, Naïve Bayes, Decision tree, SVM, Confusion matrix.
2. Nasir, J., Ahsan, A., Sarwar, N., Rafique, W., Malik, S., Shah, S. Z. H., . . . Irshad, A. (2020). Classification and Prediction Analysis of Diseases and Other Datasets Using Machine Learning. Paper presented at the Intelligent Technologies and Applications, Singapore. (Asma Irshad (Life Sciences/SSC) Abstract: Classification is one of the most used machine learning technique especially in the prediction of daily life things. Its first step is grouping, dividing, categorizing, and separation of datasets based on future vectors. Classification procedure has many algorithms, some of them are Random Forest, Naïve Bayes, Decision Tree and Support Vector Machine. Before the implementation of every technique, the model is created and then training of dataset has been made on that model. Learning the algorithm‐generated model must be fit for both the input dataset and forecast the records of class label. Many models are available for prediction of a class label from unknown records. In this paper, different classifiers such as Linear SVM, Ensemble, the Decision tree has been applied and their accuracy and time analyzed on different datasets. The Liver Patient, Wine Quality, Breast Cancer and Bupa Liver Disorder datasets are used for calculating the performance and accuracy by using 10 cross‐fold validation technique. In the end, all the applied algorithm results have been calculated and compared in the terms of accuracy and execution time. Keywords: Classification, Naïve Bayes, DT, SVM, CM, Scattered plot. Department of Chemistry Research Articles 1. Iqbal, S., Bahadur, A., Anwer, S., Ali, S., Saeed, A., Muhammad Irfan, R., . . . Javed, M., Shoaib, M. (2020). Shape and phase‐controlled synthesis of specially designed 2D morphologies of l‐cysteine surface capped covellite (CuS) and chalcocite (Cu2S) with excellent photocatalytic properties in the visible spectrum. Applied Surface Science, 526, 146691. doi: https://doi.org/10.1016/j.apsusc.2020.146691. (Mohsin Javed (Chemistry/SSC) Abstract: Two dimensional (2D) nanomaterials have interesting properties due to their lateral dimensions. Pure self‐assembled l‐cysteine stabilized covellite nanoplates (CuS@L‐Cys NPs) and l‐cysteine stabilized chalcocite
nano leaves (Cu2S@L‐Cys NLs) were synthesized by using a template free, the facile hydrothermal route with the best control of size, phase purity structure, morphology, and electrochemical properties. Novel CuS@L‐Cys NPs
and Cu2S@L‐Cys NLs snowflakes dendrites were synthesized by varying synthetic parameters such as solvent, temperature (100–180 °C), reaction time (8–24 h), pH of reaction medium (7–14), the concentration of base (0.1–
2.4 mL NH3) and concentration of thiourea (1–4 mmol). By changing these factors, different morphologies such as irregular, regular, trigonal, hexagonal leaf and snowflakes dendrites like shapes were observed. CuS@L‐Cys
NPs and Cu2S@L‐Cys NLs were fabricated by using water and ethylenediamine (EDA) as solvent respectively.
Research Outlook 2020 | 69
CuS@L‐Cys NPs and Cu2S@L‐Cys NLs were investigated for potential photocatalytic applications in methyl orange (MO) degradation under visible light with a detailed mechanism. The noteworthy, unique bandgap of 2 eV and the special morphology of CuS@L‐Cys NPs increases the active sites for adsorption of dye, which causes extraordinary degradation activity. Furthermore, the l‐cysteine (L‐Cys) protective layer could efficiently alleviate
the photocorrosion of CuS and Cu2S, giving rise to excellent stability. Keywords: CuS, Snowflakes dendrites morphology, NanosheetDye degradation, Photocatalyst.
2. Kosar, N., Shehzadi, K., Ayub, K., & Mahmood, T. (2020). Nonlinear optical response of sodium based superalkalis decorated graphdiyne surface: A DFT study. Optik, 218, 165033. doi: https://doi.org/10.1016/j.ijleo.2020.165033. (Naveen Kosar (Chemistry/SSC) Abstract: In the current study, structural, electronic, optical and nonlinear optical properties of superalkalis
doped graphdiyne (GDY) complexes (Na2Y@GDY, Y = SH, OCH3, SCH3, CN and N3) are investigated. Our results
show that superalkalis cluster preferably adsorb on the hollow cavity of GDY nanosheet. Na2CN@GDY is thermodynamically stable among all considered complexes. NBO analysis reveals the transfer of charge from superalkalis to GDY is analyzed through. Doping of superalkalis on GDY significantly reduces the HOMO‐LUMO 4 gap of GDY. Na2OCH3@GDY complex has the lowest H‐L gap (3.77 eV) with remarkable βo (6.17 × 10 au) value. The doping of GDY with superalkali introduces excess electrons into the system which significantly reduces the HOMO‐LUMO gap by generating new HOMO orbitals. The involvement of superalkalis in diffusion of excess electrons towards GDY is confirmed through PDOS spectral analysis. Furthermore, the two‐level model and first
hyperpolarizability (βvec) justified NLO properties of superalkalis doped GDY. According to the two‐level model, the ΔE is the key factor for the enhancement of first hyperpolarizability values of all newly designed complexes. Keywords: superalkalis, graphdiyne, nonlinear optical properties, hyperpolarizability.
3. Shahid, M., Farooqi, Z. H., Begum, R., Arif, M., Irfan, A., & Azam, M. (2020). Extraction of cobalt ions from aqueous solution by microgels for in‐situ fabrication of cobalt nanoparticles to degrade toxic dyes: A two fold‐ environmental application. Chemical Physics Letters, 754, 137645. doi: https://doi.org/10.1016/j.cplett.2020.137645. (Muhammad Arif (Chemistry/SSC) Abstract: Microgels were obtained by method of free radical precipitation polymerization and characterized by TEM, DLS and FTIR. Adsorption of Co2+ ions was studied under various conditions of pH, concentration of metal ions and that of microgels. Different adsorption isotherms were applied to study mechanism of adsorption process. Kinetics and mechanism of the adsorption process was investigated by pseudo 1st order, pseudo 2nd order and intra‐particle diffusion modeling. In situ reduction of Co2+ ions loaded into the polymer microgel was carried out to get hybrid system for catalytic degradation of 4‐nitrophenol, Eosin and Methylene blue. Keywords: polymer microgels, heavy metal ion recovery, cobalt nanoparticles, catalytic degradation of dyes.
4. Iqbal, S., Iqbal, M. M., Javed, M., Bahadur, A., Yasien, S., Najam ud, d., . . . Naveed, A., Liu, G. (2020). Modified QuEChERS extraction method followed by simultaneous quantitation of nine multi‐class pesticides in human blood and urine by using GC‐MS. Journal of Chromatography B, 1152, 122227. doi: https://doi.org/10.1016/j.jchromb.2020.122227. (Muhammad Muntazir Iqbal, Mohsin Javed, Naveed Ahmad (Chemistry/SSC) Abstract: Organophosphate, carbamate and pyrethroid pesticides are the most common insecticides used worldwide. They may cause chronic poisoning in farmers and acute poisoning in homicidal or suicidal cases. The determination of trace levels of these pesticides in human blood and urine is very challenging. This study focuses on a simultaneous quantitation method that was developed and validated for multi‐class nine pesticides belonging to organophosphate, carbamate and pyrethroid classes in human blood and urine. Target pesticides were extracted from blood and urine using a modified QuEChERS (Quick, Easy, Cheap, Effective, Rugged and Safe) Research Outlook 2020 | 70
extraction method. Capillary column DB‐35 ms (15 m × 0.25 mm, 0.25 µm) was used for chromatography with a 0.079 ml/min flow rate of carrier gas at constant pressure mode. Quantitation of sulfotep, phorate, carbofuran, chlorpyriphos, profenophos, triazophos, pyriproxyfen, lambda‐cyhalothrin and permethrin was performed by mass spectrometer equipped with electron impact ionization source using selected ion monitoring (SIM) mode. The lower and upper limits of quantitation for all nine pesticides were 0.01 mg/L and 2.0 mg/dL respectively. The proposed method was proved to be simple, fast, sensitive, and robust. It has been applied to the analysis of 9 pesticides samples. Keywords: multi‐class pesticides, quantitation, QuEChERS extraction, GC‐MSHuman blood and urine.
5. Khan, S. A., Shahid, S., & Lee, C.‐S. (2020). Green Synthesis of Gold and Silver Nanoparticles Using Leaf Extract of Clerodendrum inerme; Characterization, Antimicrobial, and Antioxidant Activities. Biomolecules, 10(6), 835. (Sammia Shahid (Chemistry/SSC) Abstract: Due to their versatile applications, gold (Au) and silver (Ag) nanoparticles (NPs) have been synthesized by many approaches, including green processes using plant extracts for reducing metal ions. In this work, we propose to use plant extract with active biomedical components for NPs synthesis, aiming to obtain NPs inheriting the biomedical functions of the plants. By using leaves extract of Clerodendrum inerme (C. inerme) as both a reducing agent and a capping agent, we have synthesized gold (CI‐Au) and silver (CI‐Ag) NPs covered with biomedically active functional groups from C. inerme. The synthesized NPs were evaluated for different biological activities such as antibacterial and antimycotic against different pathogenic microbes (B. subtilis, S. aureus, Klebsiella, and E. coli) and (A. niger, T. harzianum, and A. flavus), respectively, using agar well diffusion assays. The antimicrobial propensity of NPs further assessed by reactive oxygen species (ROS) glutathione (GSH) and FTIR analysis. Biofilm inhibition activity was also carried out using colorimetric assays. The antioxidant and cytotoxic potential of CI‐Au and CI‐Ag NPs was determined using DPPH free radical scavenging and MTT assay, respectively. The CI‐Au and CI‐Ag NPs were demonstrated to have much better antioxidant in terms of %DPPH scavenging (75.85% ± 0.67% and 78.87% ± 0.19%), respectively. They exhibited excellent antibacterial, antimycotic, biofilm inhibition and cytotoxic performance against pathogenic microbes and MCF‐7 cells compared to commercial Au and Ag NPs functionalized with dodecanethiol and PVP, respectively. The biocompatibility test further corroborated that CI‐Ag and CI‐Au NPs are more biocompatible at the concentration level of 1–50 µM. Hence, this work opens a new environmentally‐friendly path for synthesizing nanomaterials inherited with enhanced and/or additional biomedical functionalities inherited from their herbal sources. Keywords: green synthesis, C. inerme, gold, silver, antibacterial, antimycotic, antioxidant.
6. Iqbal, S., Javed, M., Bahadur, A., Qamar, M. A., Ahmad, M., Shoaib, M., Ahmad, N., . . . Li, H. (2020). Controlled synthesis of Ag‐doped CuO nanoparticles as a core with poly(acrylic acid) microgel shell for efficient removal of methylene blue under visible light. Journal of Materials Science: Materials in Electronics, 31(11), 8423‐8435. doi: 10.1007/s10854‐020‐03377‐9.(Mohsin Javed, Muhammad Azam Qamar, Madiha Ahmad, Naveed Ahmad (Chemistry/SSC) Abstract: Nowadays, constructing a narrow bandgap nanocomposite photocatalyst that can degrade contamination under visible light is critical but challenging. In this report, poly (acrylic acid) microgel (PAA) based nanocomposites (Ag@CuO/PAA NC) were constructed via free radical solution polymerization by varying the concentration of silver‐doped copper oxide nanoparticles (Ag@CuO NPs) from 0 to 12%. As prepared Ag@CuO and Ag@CuO/PAA were characterized by X‐ray difraction spectroscopy, scanning electron microscopy, transmission electron microscopy, energy dispersive X‐ray and X‐ray photoelectron spectroscopy. The size of Ag@CuO NPs was found to be 30–50 nm. The photocatalytic activity of CuO is increased by Ag doping and C3 NPs show the best photodegradation of methylene blue (MB). Then, 4% of Ag@CuO nanoparticles were incorporated into PAA microgel, the resultant nanocomposite showed a drastic increase in photodegradation of Research Outlook 2020 | 71
MB. Ag@ CuO/PAA NC completely degraded dye in only 30 min which was degraded up to 65% in 60 min. by Ag@CuO NPs. The successful combination of PAA with Ag@CuO boosts the photocatalytic activity because microgel provides a large surface to adsorb pollutants. Ag@CuO/PAA NC reused successfully for photodegradation of dye due to the recycling ability of microgels. This study gives a good insight into planning a signifcant visible‐light‐driven photocatalyst for environmental remediation. Keywords: not available.
7. Khan, S. A., Shahid, S., Shahid, B., Fatima, U., & Abbasi, S. A. (2020). Green Synthesis of MnO Nanoparticles Using Abutilon indicum Leaf Extract for Biological, Photocatalytic, and Adsorption Activities. Biomolecules, 10(5), 785. (Sammia Shahid, Basma Shahid, Urooj Fatima (Chemistry/SSC) Abstract: We report the synthesis of MnO nanoparticles (AI‐MnO NAPs) using biological molecules of Abutilon indicum leaf extract. Further, they were evaluated for antibacterial and cytotoxicity activity against different pathogenic microbes (Escherichia coli, Bordetella bronchiseptica, Staphylococcus aureus, and Bacillus subtilis) and HeLa cancerous cells. Synthesized NAPs were also investigated for photocatalytic dye degradation potential against methylene blue (MB), and adsorption activity against Cr(VI) was also determined. Results from Scanning electron microscope (SEM), X‐ray powder diffraction (XRD), Energy‐dispersive X‐ray (EDX), and Fourier‐transform infrared spectroscopy (FTIR) confirmed the successful synthesis of NAPs with spherical morphology and crystalline nature. Biological activity results demonstrated that synthesized AI‐MnO NAPs exhibited significant antibacterial and cytotoxicity propensities against pathogenic microbes and cancerous cells, respectively, compared with plant extract. Moreover, synthesized AI‐MnO NAPs demonstrated the comparable biological activities results to standard drugs. These excellent biological activities results are attributed to the existence of the plant’s biological molecules on their surfaces and small particle size (synergetic effect). Synthesized NAPs displayed better MB‐photocatalyzing properties under sunlight than an ultraviolet lamp. The Cr(VI) adsorption result showed that synthesized NAPs efficiently adsorbed more Cr(VI) at higher acidic pH than at basic pH. Hence, the current findings suggest that Abutilon indicum is a valuable source for tailoring the potential of NAPs toward various enhanced biological, photocatalytic, and adsorption activities. Consequently, the plant’s biological molecule‐mediated synthesized AI‐MnO NAPs could be excellent contenders for future therapeutic applications. Keywords: green synthesis, plant extract, biological activities, photocatalysis, adsorption.
8. Ashfaq, M., Anjum, M. A., Haider, M. S., Ali, M., Mubashar, U., Aslam, H.M.U., . . . Sajjad, M. (2020). Association of Cladosporium cladosporioides brown leaf spot of lady palm in Pakistan. JAPS, Journal of Animal and Plant Sciences, 30(2), 371‐376. doi: 10.36899/JAPS.2020.2.0060.(Hafiz Muhammad Umer Aslam (Chemistry/SSC) Abstract: Ladies palm (Rhapis excelsa L.) also known as broad leaf Lady palm is unique looking palm because of its appearance and beauty and, therefore, is commonly used for landscape purposes. Various fungal diseases are the major threat to Lady's palm that affects its growth and beauty. In the year 2016, diseased leaf samples were collected from different locations i.e. Pattoki, Chunian, Kot Radha Kishan, Nathoki and Grinkot of district Kasur, Punjab, Pakistan to identify the pathogen. Based on various morphological characteristics, the casual organisms Cladosporium cladosporioides were isolated, purified and identified with FCBP 1562 from collected samples. The identified pathogen was further confirmed by using molecular analysis. For this purpose, Internal Transcribed Spacer (ITS) primer pairs were used i.e. ITS1 by using universal primer pair ITS1 reverse primer (3' ‐ TCCTCCGCTTATTGATATGC‐5') and ITS1 forward primer (5' ‐ TCCGTAGGTGAACCTGCGG‐3') for identification of casual organism from total genomic DNA of the isolated causal fungus. The pathogen was re‐isolated and reconfirmed morphologically as Cladosporium cladosporioides from the artificially inoculated ladies palm plant leaves according to the Koch's postulates. To our knowledge Cladosporium cladosporioides was reported first time in Pakistan and causes chlorosis and necrosis of the lady's palm. The current study will be equally beneficial both for scientists and growers for controlling and management of this disease. Research Outlook 2020 | 72
Keywords: ladies palm, cladosporium cladosporioides, brown spot, disease, Pakistan.
9. Khan, S. A., Rizwan, K., Shahid, S., Noamaan, M. A., Rasheed, T., & Amjad, H. (2020). Synthesis, DFT, computational exploration of chemical reactivity, molecular docking studies of novel formazan metal complexes and their biological applications. Applied Organometallic Chemistry, 34(3), e5444. doi: 10.1002/aoc.5444. (Shakeel Ahmad Khan, Sammia Shahid, Hira Amjad (Chemistry/SSC) Abstract: The computational exploration of chemical reactivity and molecular docking of the synthesized formazan compounds (S1‐S6) were studied. Further, their antimicrobial activity against bacterial strains (S. epidermidis , B. cereus , K. pneumoniae and P. aeruginosa ) and against fungal strains (T. mentagrophytes , C. albicans , A. niger , S. cerevisiae and C. glabrata ) using agar diffusion method and antioxidant activity following DPPH inhibition assays were evaluated. Anticancer activity was executed in vitro model of human breast carcinoma (MCF‐7) cell line. The superior and enhanced antibacterial and antimycotic activities were exhibited by formazan compound (S4) by presenting maximum ZOIs and MICs values. While enhanced antioxidant in terms of percentage inhibition of DPPH and cytotoxic effect on human breast carcinoma‐cells demonstrated by formazan compound (S1) which was further validated by the results of molecular docking studies of (S1) with the human estrogen receptor protein. In order to compute quantum chemical reactivity descriptors from conceptual density functional theory (CDFT) point of view of this system, including chemical potential (μ), chemical hardness (η), electrophilicity (ω), condensed Fukui function and dual descriptors are calculated at the same level of calculation. The most active sites of these molecules are determined and correlated with experimental data. The present investigation displays that formazans compounds could be potential drug candidate that constrains the growth of microbial strains, possess ability to cause cytotoxic effect on carcinoma cells and act as effective scavenger for free radical species. Keywords: anticancer, antimicrobial, DFT studies, formazan, molecular docking.
10. Ahmad, M. Z., Bhatti, I. A., Qureshi, K., Ahmad, N., Nisar, J., Zuber, M., . . . Iqbal, M. (2020). Graphene oxide supported Fe2(MoO4)3 nano rods assembled round‐ball fabrication via hydrothermal route and photocatalytic degradation of nonsteroidal anti‐inflammatory drug. Journal of Molecular Liquids, 301, 112343. doi: https://doi.org/10.1016/j.molliq.2019.112343.(Khizar Qureshi (Chemistry/SSC) (SKT Campus) Abstract: Graphene oxide (GO) supported iron molybdate (Fe2(MoO4)3) was prepared via hydrothermal route, which were characterized by X‐rays diffraction technique (XRD), scanning electron microscopy (SEM), EnergyDispersive X‐Ray (EDX), zeta sizer, UV–visible and atomic force microscopy (AFM) techniques. Photocatalytic activity (PCA) was evaluated by degrading the diclofenac sodium (DS) under solar light irradiation. Central composite design (CCD) was employed under response surface methodology (RSM) for the optimization of process variables such as pH, H2O2, DS concentration and catalyst load for maximum drug degradation. At optimum conditions, up to 96% DS degradation was achieved (2 h irradiation, 6% H2O2 concentration, 10 mg/L DS concentration, 0.45 g/L catalyst dose and 4.5 pH). The statistical analysis revealed the adequacy of developed model for the degradation of DS drug. The actual and predicted degradation values correlated well with each other with very low residual value. The model fitness was based on insignificant “lack of fit test” and higher value R2 . Results revealed that the hydrothermal route is an efficient route for the fabrication of GO/Fe2(MoO4)3 round‐ball microstructures, which showed promising PCA and it could possibly be used for the degradation of DS drug in wastewater. Keywords: graphene oxideiron molybdate, hydrothermal route, round‐ball microstructures, photocatalytic activity, response surface methodology.
Research Outlook 2020 | 73
11. He, Q., Shahid, M., Jiao, X., Gann, E., Eisner, F. D., Wu, T., . . . Heeney, M. (2020). Crucial Role of Fluorine in Fully Alkylated Ladder‐Type Carbazole‐Based Nonfullerene Organic Solar Cells. ACS Applied Materials & Interfaces, 12(8), 9555‐9562. doi: 10.1021/acsami.0c00981.(Munazza Shahid (Chemistry/SSC) Abstract: Two fused ladder‐type nonfullerene acceptors, DTCCIC and DTCCIC‐4F, based on an electron‐donating alkylated dithienocyclopentacarbazole core flanked by electron‐withdrawing nonfluorinated or fluorinated 1,1‐ dicyanomethylene‐3‐indanone (IC or IC‐4F), are prepared and utilized in organic solar cells (OSCs). The two new molecules reveal planar structures and strong aggregation behavior, and fluorination is shown to red‐shift the optical band gap and downshift energy levels. OSCs based on DTCCIC‐4F exhibit a power conversion efficiency of 12.6%, much higher than that of DTCCIC‐based devices (6.2%). Microstructural studies reveal that while both acceptors are highly crystalline, bulk heterojunction blends based on the nonfluorinated DTCCIC result in overly coarse domains, while blends based on the fluorinated DTCCIC‐4F exhibit a more optimal nanoscale morphology. These results highlight the importance of end group fluorination in controlling molecular aggregation and miscibility. Keywords: organic solar cells, nonfullerene acceptors, carbazole, fluorine effect, fully alkylated side chains.
12. Qamar, M. A., Shahid, S., & Javed, M. (2020). Synthesis of dynamic g‐C3N4/Fe@ZnO nanocomposites for environmental remediation applications. Ceramics International. 46(14), 22171‐22180. doi: https://doi.org/10.1016/j.ceramint.2020.05.294.(Muhammad Azam Qamar, Sammia Shahid, Mohsin Javed (Chemistry/SSC) Abstract: An effective g‐C3N4/Fe@ZnO heterostructured photocatalyst was synthesized by a simple chemical co‐ precipitation method and characterized by X‐ray diffraction, Fourier transform infrared spectroscopy, transmission electron microscopy and ultraviolet‐visible spectroscopy. Transmission electron microscopy revealed that 7‐8 nm‐sized 1%Fe@ZnO nanoparticles were evenly distributed on g‐C3N4 nanosheets to form a hybrid composite. The photocatalytic effectiveness of the composites was assessed against methylene blue dye, and it was found that the 50%g‐C3N4/Fe@ZnO photocatalyst was more efficient in harvesting solar energy to degrade dye than the ZnO, 1%Fe@ZnO, g‐C3N4, g‐C3N4/ZnO and (25, 40, 50, 60 & 75 wt.%) g‐C3N4/Fe@ZnO samples. The antibacterial competency of the samples was also explored against Gram‐positive (Bacillus subtilis, Staphylococcus aureus and Streptococcus salivarius) and Gram‐negative (Escherichia coli) bacteria through the well diffusion method. The 50%g‐C3N4/Fe@ZnO nanocomposite exhibited a superior antibacterial action compared to that of the rest of the samples. The exceptionally improved photocatalytic and antimicrobial efficiency of the 50%g‐C3N4/Fe@ZnO composite was primarily accredited to the synergic outcome of the interface established between Fe@ZnO nanoparticles and gC3N4 nanosheets. Keywords: photocatalyst, graphitic carbon nitride, broad spectrum antibacterial, fe nanocomposite.
13. Arif, M., Javed, M., & Hamid, R. (2020). Breast Cancer in Pakistan: Alarming Situation of Breast Cancer in Near Future. Iranian journal of public health, 49(4), 812‐813. (Muhammad Arif, Mohsin Javed, Hamid Raza (Chemistry/SSC) (Letter to editor) Abstract: Not available. Keywords: not available.
14. Shahid, S., Fatima, U., Rasheed, M. Z., Asghar, M. N., Zaman, S., & Sarwar, M. N. (2020). Enhanced sunlight‐driven photocatalytic performance of Ag–ZnO hybrid nanoflowers. Applied Nanoscience, 10(1), 187‐197. doi: 10.1007/s13204‐019‐01076‐4. (Sammia Shahid, Urooj Fatima, Muhammad Zaheer Rasheed (Chemistry/SSC) Abstract: Photocatalytic materials such as Ag‐coated ZnO nanofowers, pristine ZnO nanofowers and ZnO nanorods were synthesized by template‐assisted method for the treatment of industrial waste water through photocatalysis. Electropolishing and anodization lead to the formation of alumina template. After that, Research Outlook 2020 | 74
hydrothermal treatment was carried out for the growth of ZnO nanofowers and nanorods on the template. The morphology of synthesized samples was investigated by scanning electron microscope, X‐ray difraction patterns and energy‐dispersive X‐ray spectroscopy. XRD patterns of samples clearly indicate the well crystalline structure of synthesized materials. The presence of Ag in Ag‐coated ZnO nanofowers was confrmed by EDS spectral analysis and X‐ray difraction patterns. Grain size was found to be in the range of 10–25 nm as calculated by Scherer’s formula from XRD patterns. The sunlight‐driven photocatalytic activity of Ag‐coated ZnO nanofowers, ZnO nanofowers and ZnO nanorods was investigated and compared with each other. In addition, the stability and recovery of photocatalyst were also checked. Photocatalytic degradation experiment results indicated that Ag‐ coated ZnO nanofowers had highest photocatalytic activity towards methylene blue dye. Keywords: pristine ZnO nanofowers, hydrothermal synthesis, anodization, photocatalysis.
15. Ahmad, A., Hussain, S., Rao, S. M., Asghar, A., Irshad, M., Javed, M., . . . Kausar, H. S. (2020). Comparative Studies of Lead and Heavy Metals Concentrations in Pakistan Soil and Its Toxic Effects. Polish Journal of Environmental Studies, 29(4), 2533‐2542. doi: DOI: 10.15244/pjoes/106028. (Mohsin Javed (Chemistry/SSC) Abstract: A study was conducted to determine qualitative and quantitative lead contamination in soil along two major roadsides (Motorway M‐2 and National Highway N‐5) of Thokar Niaz Baaig (TNB) in Lahore, and adjoining
areas of the Hudiara drain in Pakistan by employing the digestion method using HCl/HNO3 at 1:4. The characterization of lead (Pb) was performed by atomic absorption spectroscopy. High deposition of lead was observed along the soil of linking roads of rather populated towns of Lahore, Pakistan, and the soil irrigated by the wastewater of Hudiara drain. The lead contents originated mainly from vehicular emissions, urban pollution and industrial effluents, and may lead to a rise of lead levels in the vegetation of associated areas. The present study also explores a comparison of heavy metal (Pb, Cu, Cd, Zn, Ni, Fe, Mn, Cr, Ti) concentrations in different areas of Pakistan and its adverse effects on plant growth. There is a need to strictly monitor the water quality in the Hudiara drain; its wastewater should be avoided for irrigation purposes. Some fungal strains can also be used to control the heavy metal concentration in such polluted water. However, some beneficial effects of Hudiara drain wastewater as a nutritional source for plants have also been suggested. It is important to establish the proper nutrition conditions in areas of contaminated soil. Keywords: lead, heavy metals, soil, Pakistan, toxic.
16. Rauf, A., Shah, A., Munawar, K. S., Ali, S., Nawaz Tahir, M., Javed, M., & Khan, A. M. (2020). Synthesis, physicochemical elucidation, biological screening and molecular docking studies of a Schiff base and its metal(II) complexes. Arabian Journal of Chemistry, 13(1), 1130‐1141. doi: https://doi.org/10.1016/j.arabjc.2017.09.015. (Mohsin Javed (Chemistry/SSC) Abstract: A Schiff base 1‐((3‐nitrophenylimino)methyl)naphthalen‐2‐olate (HL) and its two novel complexes with Zn(II) and Co(II) metals were successfully synthesized and characterized by FTIR, 1H NMR, 13C NMR, elemental analysis, magnetic susceptibility, TGA and EIS‐MS. Crystal of Schiff base was also characterized by X‐ray analysis and experimental parameters were found in line with the theoretical parameters. Quantum mechanical approach was also used to compare structural and calculated parameters and to ensure the geometry of metal complexes. The photometric behaviors of all the synthesized compounds were investigated in a wide pH range using BR buffers. Appearance of isosbestic point suggested the existence of Schiff base molecules in different tautomeric forms. Binding of synthesized complexes with calf thymus DNA was explored by photometric and voltammetric titrations and binding constants were calculated. The results indicated that ligand and its metal complexes bind to DNA by intercalation mode. Docking studies indicate their binding possibilities with topoisomerase II. Moreover, all these prepared compounds were screened for enzyme inhibition, antibacterial, cytotoxic and in vivo antidiabetic activities and found active against one or other activity. This effort just provides
Research Outlook 2020 | 75
preliminary data for some biological properties and which can act as foundation stone for their application in drug development. Keywords: schiff base‐metal complexes, spectroscopy, x‐ray analysis, dna binding, molecular docking.
17. Gillani, S. S., Munawar, M. A., Khan, K. M., & Chaudhary, J. A. (2020). Synthesis, characterization and applications of poly‐aliphatic amine dendrimers and dendrons. Journal of the Iranian Chemical Society. 17, 2717–2736. doi: 10.1007/s13738‐020‐01973‐4. (Jamil Anwar Chaudhary (Chemistry/SSC) Abstract: In the current era, the dendrimers have vast potential applications in the area of electronics, healthcare, pharmaceuticals, biotechnology, engineering products, photonics, drug delivery, catalysis, electronic devices, nanotechnologies and environmental issues. This review recaps the synthesis, characterization and applications of poly‐aliphatic amine dendrimers. Keywords: dendrons, dendrimers, synthesis, characterizations, electronic devices, environmental, catalysis, drug delivery.
18. Qamar, M. A., Shahid, S., Javed, M., Iqbal, S., Sher, M., & Akbar, M. B. (2020). Highly efficient g‐C3N4/Cr‐ZnO nanocomposites with superior photocatalytic and antibacterial activity. Journal of Photochemistry and Photobiology A: Chemistry, 401, 112776. doi: https://doi.org/10.1016/j.jphotochem.2020.112776. (Muhammad Azam Qamar, Sammia Shahid, Mohsin Javed, Mudassar Sher (Chemistry/SSC) Abstract: Currently, fabricating a narrow bandgap photocatalyst that can degrade pollutants in natural sunlight is critical but inspiring. In this study, a hybrid g‐C3N4/Cr‐ZnO nanocomposite was synthesized by a simple chemical coprecipitation method and its photocatalytic and antimicrobial properties were explored. In the first step, the photocatalytic efficiency of Cr‐ZnO (1−9 wt. %) nanopar cles were carried out to find out the op mum doping of Cr into ZnO. The as‐prepared 5% Cr‐ZnO nanoparticles demonstrated the best optical absorption of sunlight and methylene blue degradation and in the second step; these were dispersed on g‐C3N4 nanosheets as an active component to form ternary heterostructured photocatalyst. The nanoparticles and composite photocatalysts were characterized by X‐ray diffraction spectroscopy, energy‐disperse X‐ray spectroscopy, transmission electron microscopy, Fourier transform infrared spectroscopy and ultraviolet‐visible spectroscopy. The optimized composite (60 %g‐C3N4/5%Cr‐ZnO) performed enhanced harvesting of solar energy compared to ZnO, g‐C3N4 and gC3N4/ZnO composite, achieving 93 % methylene blue dye degradation in 90 min. The improved photocatalytic activity of composite can be attributed to the better absorption and electron‐hole pair separation between g‐C3N4 and Cr‐ZnO. The photocatalytic stability of the composite was testified by cyclic tests. The antibacterial aptitude of the samples was investigated against Gram‐negative (Escherichia coli) and Gram‐ positive (Bacillus subtilis, Staphylococcus aureus and Streptococcus salivarius) bacteria applying diffusion well method. The 60 %g‐C3N4/ 5%Cr‐ZnO nanocomposite exhibits higher antibacterial activity compared to other samples. The enriched photocatalytic and antimicrobial activities of the composite may be predominantly ascribed to the synergistic effect of the heterojunction developed between g‐C3N4 and Cr‐ZnO. Keywords: water pollution, photodegradation, antibacterial, Cr‐ZnO, composite.
19. Riaz, T., Mughal, P., Shahzadi, T., Shahid, S., & Abbasi, M. A. (2020). Green synthesis of silver nickel bimetallic nanoparticles using plant extract of Salvadora persica and evaluation of their various biological activities. Materials Research Express, 6(12), 1250k1253. doi: 10.1088/2053‐1591/ab74fc. (Sammia Shahid (Chemistry/SSC) Abstract: Metallic nanoparticles play vital role in the field of science, medicine, food and technology. Various strategies have been used for the synthesis of bimetallic nanoparticles to improve the physical and chemical properties of monometallic nanoparticles. The present study describes synthesis of Ag‐Ni bimetallic nanoparticles, using aqueous extract of Salvadora persica. Silver and nickel ions were reduced by secondary Research Outlook 2020 | 76
metabolites within the extract which act as reducing as well as capping agents. UV‐Visible spectrum produced an absorbance band in the range of 400 nm to 450 nm due to electronic transitions associated with resonance of surface electrons that was an indication of the formation of nanoparticles. Scanning Electron Microscopy (SEM) and X‐Ray diffraction spectroscopy (XRD) were used for the determination of morphology and dimension of nanoparticles. Particle dimension of synthesized nanoparticles was 23.67 nm. Energy dispersive X‐ray spectroscopy (EDX) was used for the elemental analysis that showed the presence of silver and nickel in elemental form. Fourier Transform Infrared Microscopy (FTIR) was used for the functional group analysis. Synthesized Ag‐Ni bimetallic nanoparticles were assessed for the estimation of their antioxidant potential by three methods i.e DPPH free radical scavenging mechanism, phosphomolybdenum complex method and determination of phenolic contents. Percent scavenging activity of synthesized Ag‐Ni bimetallic nanoparticles was observed as 70.5% at 1500µg/mL concentration. Total antioxidant activity calculated for synthesized nanoparticles was 0.6479 against BHT as a reference. Total phenolic contents of green synthesized nanoparticles were calculated to be 74.5 mg/g GAE. Different parameters like temperature, pH, effect of adsorbent concentration, time of contact, and concentration of adsorbate, were optimized for the utmost removal of congo red dye and chromium (VI). Keywords: not available.
20. Akram, M., Asghar, M. N., Saleem Khan, M., Shahid, S., Abdur Rahman, H. M., & Nadeem, I. (2020). Development and validation of an economical uric acid‐Fe3+/Fe2+‐ferrozine‐based colorimetric assay to estimate uric acid level of pure and biological samples. Bioscience, Biotechnology, and Biochemistry, 84(10), 1967‐1974. doi: 10.1080/09168451.2020.1781593. (Sammia Shahid (Chemistry/SSC) Abstract: This work presents the development and validation of a simple, rapid, and cost‐effective spectrophotometric method for quantitative analysis of uric acid in biological samples. The method relies upon uric acid‐led reduction of Fe(III) to Fe(II) of sample/standard solutions which stoichiometrically engages ferrozine to form a magenta‐colored complex. Different parameters including pH, metal and chelator concentrations, temperature, etc., were optimized for the maximum intensity and stability of the complex. The uric acid concentrations of synthetic/plasma solutions were determined by comparing the color intensity of 2+ Fe(ferrozine)3 complex produced by test solution with the standard curve formed by known uric acid concentrations. The method was validated in accordance with ICH guidelines and subjected to human plasma analysis. The results obtained were compared with a reference (enzymatic) method which revealed that there was no significant difference between the two methods at 95% confidence level. The method is highly specific, precise, linear, accurate, and robust. An economical and validated colorimetric method based on reduction of Fe(III) to Fe(II) by uric acid in sample/standard solutions which stoichiometrically combines with ferrozine to form a colored complex, is reported for estimation of uric acid in pure and biological samples. Keywords: uric acid, ich guidelines, ferrozine.
21. Altaf, F., Gill, R., Batool, R., Zohaib Ur, R., Majeed, H., Abbas, G., & Jacob, K. (2020). Synthesis and applicability study of novel poly(dopamine)‐modified carbon nanotubes based polymer electrolyte membranes for direct methanol fuel cell. Journal of Environmental Chemical Engineering, 8(5), 104118. doi: https://doi.org/10.1016/j.jece.2020.104118.(Hammad Majeed (Chemistry/SSC) (SKT Campus) Abstract: Novel sulfonated polysulfone (SPS) based composite polymer electrolyte membranes (PEMs) filled with polydopamine modified carbon nanotubes (PD‐CNTs) have been prepared using the phase inversion technique. The present study reports the development of novel and cost‐ efficient nanocomposite materials with excellent properties for polymer electrolyte membranes preparation. The progress is noteworthy towards the synthesis of economical organic‐inorganic nanocomposites through which fuel cell related properties can be tailored. The applicability of prepared PEMs for direct methanol fuel cell (DMFC) has been investigated in terms of water Research Outlook 2020 | 77
uptake, methanol permeability, and proton conductivity by changing the filler content (0.5–1.0 wt. %). The carbon nanotubes were surface functionalized using polydopamine (PD) as the modifying agent. The resultant functionalized carbon nanotubes (PD‐CNTs) have been incorporated into SPS polymer matrix to prepare the composite PEMs. The functional groups, structural properties, elemental analysis, morphological and topographical aspects of the resulting composite membranes were characterized using Fourier transform infrared spectroscopy (FTIR), X‐ray diffraction (XRD), Energy dispersive X‐ray spectrometer (EDS), Scanning electron microscopy (SEM), and Transmission electron microscopy (TEM), respectively. It was found that PD served as an outstanding glue because of its adhesive qualities, facilitated the homogeneous dispersion of CNTs into the polymer matrix, and created new proton‐conducting pathways in the subsequent membranes. A detailed analysis showed that water uptake and proton‐conducting properties of the engineered PEMs have been improved significantly. Composite membarne (0.5 wt. % PD‐CNTs) showed 43 % increase in proton conductivity compared to the pristine SPS membrane, increasing from 0.085 S/cm for pristin to 0.1216 S/cm for the composite membrane at 80 °C. The prepared PEMs also showed an impressive 75 % decrease in methanol permeability (5.68 × 10−7 cm2/s) compared to recast Nafion®117 membarne (23.00 × 10−7 cm2/s). These results demonstrated the immense potential of polydopamine functionalized CNTs based PEMs for DMFC application. The ability of the newly synthesized membrane to retain water, and its capability to give a structural framework for maximum proton conductivity with reduced fuel crossover towards the catalyst are the significant advances from the present study. Keywords: polymer electrolyte membranes, carbon nanotubes, polydopamine, functionalization, phase inversion, proton conductivity.
22. Iqbal, S., Bahadur, A., Anwer, S., Shoaib, M., Liu, G., Li, H., . . . Javed, M., Khalid, B. (2020). Designing novel morphologies of l‐cysteine surface capped 2D covellite (CuS) nanoplates to study the effect of CuS morphologies on dye degradation rate under visible light. CrystEngComm, 22(24), 4162‐4173. doi: 10.1039/D0CE00421A. (Mohsin Javed (Chemistry/SSC) Abstract: Pure self‐assembled L‐cysteine stabilized covellite nanoplates (CuS@L‐Cys NPs) with the best control over size, phase purity structure, morphology, and electrochemical properties were synthesized using a facile, template‐free hydrothermal route. The effects of temperature (100–180 °C), reaction time (8–24 h), pH of
reaction medium (7–14), concentration of base (0.1–2.4 mL NH3) and concentration of thiourea (1–4 mmol) on the morphologies of CuS@L‐Cys nanoplates were studied. The photocatalytic performance of CuS@L‐Cys NPs under visible light was studied using methyl orange (MO) as a model dye. CuS@L‐Cys NPs were reused successfully for the photodegradation of dye due to the recycling ability of CuS@L‐Cys NPs. The hydroxyl radicals (˙OH) generated by CuS@L‐Cys NPs were detected using terephthalic acid (TA) as a probe molecule through the photoluminescence (PL) technique. The successful capping of L‐Cys on the surface of CuS NPs was confirmed by FTIR spectroscopy. The BET surface areas of the hexagonal CuS@L‐Cys NPs and oblong CuS@L‐Cys NPs were measured to be 11.87 and 5.66 m2 g−1, respectively. The optical band gaps of the hexagonal CuS@L‐Cys NPs (2.0 eV) and oblong CuS@L‐Cys NPs (2.04 eV) were determined according to direct bandgap calculations. These results support the presence of hexagonal CuS@L‐Cys NP catalysts as efficient accelerators of the photodegradation of MO. Furthermore, the L‐cysteine (L‐Cys) protective layer could efficiently alleviate the photocorrosion of CuS, giving rise to excellent stability. The high photocatalytic activity of the hexagonal CuS@L‐ Cys NPs can be ascribed to the reduction of photoinduced electron–hole pair recombination and high specific surface area, as confirmed by BET for other representative samples. Keywords: CuS, covellite, hexagonal nanosheet, methyl orange, novel morphology, photocatalysis.
Research Outlook 2020 | 78
23. Javed, M., & Hussain, S. (2020). Synthesis, Characterization and Photocatalytic applications of P (Aac) Microgels and Its Composites of Ni Doped Zno Nanorods. Digest Journal of Nanomaterials and Biostructures. 15(1). 217‐ 230. (Mohsin Javed (Chemistry/SSC) Abstract: ZnO nanorods and Ni doped ZnO nanorods with various concentration of nickel 0%, 5%, 10%, 15%, 20%, 25% were prepared by co‐precipitation method. By added zinc acetate dehydrate and nickel nitrate as zinc and nickel precursor in presence of Ammonia solution. Microgels of p(AAc) and its composites of Ni doped ZnO nanorods were synthesized by inverse phase polymerization method under N2 gas atmosphere. Optical structure and morphology of Ni doped ZnO nanorods and its composite with p(AAc) were determined by XRD, TEM, SEM, FTIR and UV‐Visible spectrometer. The photocatalytic activity of the samples was testified by using Tungsten lamp of 500 W via photo‐degradation of methylene blue (MB) as a standard dye. It was observed that the composite of p(AAc) microgels with Ni doped ZnO nanorods show much enhanced photocatalytic performance as compared to any other individual particle acting as alone. The enhanced photocatalytic activity is due to enhanced surface area, surface roughness and decreasing band gap. Keywords: ZnO nanorods, Ni doping, p(AAc) microgels, Characterization, Photocatalytic. 24. Yousaf, A., & Shahid, S. (2020). The study of Anethum graveolens L. (Dill) in the case of Diabetes mellitus (DM). Asian Journal of Research in Pharmaceutical Sciences. 10 (4). 248‐256. doi: 10.5958/2231‐5659.2020.00045.4. (Aqsa Yousaf, Sammia Shahid (Chemistry/SSC) Abstract: Anethuem graveolens (dill) is a traditional herb used for flavouring the food materials. It is used as herbal medicine and aromatic herb for the treatment of flatulence, indigestion, bad breath, lactation motivation, stomachache, insomnia, gastrointestinal complications, intestinal spasms. Anethum graveolens possess significant pharmacological activities, particularly in diabetes mellitus and cardiovasculars disorders. Aerial parts of the plant are famous for its clinical importance. Now, Fresh leaves and seeds in dried form of Anethum graveolens are frequently used for the treatment of diabetes mellitus and cardiovascular problems. Anethum graveolens also has hypolipidemic and hypoglycemic effects and it reduce the glucose level in blood. It has some important therapeutic effects and used in Iranian folk medicine as an anti‐hypercholesterolaemic plant. Limonene and Carvone are the most important constituents of A. graveolens that suppress the cyclooxygenase 1 and 2 pathways and prevent the release of inflammatory mediators. It has also antiglycation and antioxidant properties in form of dill tablet. It is a herbal medicine used as hypolipidemic agent in Iran. Anethum graveolens is best known as a reducer of glucose, cholesterol and lipid in traditional medicines. It is favorable for the reduction of hypoglycemia and lipid disorders in diabetic patients. AG have the different pharmacological effects such as antimicrobial, antispasmodic, antisecretary, anticancer, antigastric irritation, anti‐inflammatory, antioxidant and mucosal protective effects. Keywords: Anethum graveolens (dill), herbal medicine, Diabetes mellitus, hypolipidemic agent, Pharmacological properties.
25. Iqbal, S., Khalid, S., & Shahid, S. (2020). Pharmacological Properties of Rosa damascene. Asian Journal of Research in Pharmaceutical Sciences. 10(3):183‐186. doi: 10.5958/2231‐5713.2020.00031.8. (Sana Iqbal, Sehrish Khalid, Sammia Shahid (Chemistry/SSC) Abstract: An Ornamental plant Rosa Damascena is being used from ancient times to cure many infectious disorders. It has excellent natural potential against inflammatory diseases. Juice from fresh rose petals contains outstanding antioxidant properties with no side‐effects. Its flower has many therapeutic effects that includes relief from chest and abdominal pain and strengthening. Rosa damascena has numerous pharmacological applications having anti‐oxidant, anticancer, antimicrobial and antidepressant potential. Dried rose petals can be used as an alternative litter material to enhance broiler production and performance. Even distilled waste material of Rosa damascena from industry can be used as an excellent feed for some animals. Keywords: Rosa damascena, anti‐oxidant, therapeutic effects, anti‐depressant. Research Outlook 2020 | 79
26. Sabir, S., Sadia, H., Ishfaq, M., & Shahid, S. (2020). Tribulus Terrestris: A Pharmacological Review. International journal of research in pharmacy and chemistry (IJRPC), 10(3), 276‐279. doi: https://dx.doi.org/ 10.33289/IJRPC.10.3.2020.10(65). (Sidra Sabir, Halima Sadia, Maham Ishfaq, Sammia Shahid (Chemistry/SSC) Abstract: Most of the plants are used as medicine. These plants have different constituents to cure diseases. Tribulus.terrestris is belongs to the family zygophyllaceae. The part of plant which is used as medicine is leaves fruits and sometime whole plant. T.terrestris have flavonoids, alkaloids, saponins, and flavonol glycosides. Plant also contain flower which is used as medicine. T.terrestris is actually shady plant and grew across the road and also in different crops. In this review article the pharmacological activities of T.terrestris is highlighted like antibacterial, in vivo antiviral, antioxidant, antihyperglycaemic activity, hepatoprotective, antimicrobial activity, antifungul activity, vascular protective effect, analgesic activity, anti ischemic cardioprotection, antihypertensive activity, and antihyperlipidemic activity. T.terrestris gives effective results against these pharmacological activities. Keywords: T.terrestris, pharmacological, Saponins and Flavonoids.
27. Ahsen, M. O., Khalid, H. D., & Shahid, S. (2020). Assessment on Biological Activities of Adhatoda Vesica: A Review. International journal of research in pharmacy and chemistry (IJRPC), 10(3), 273‐275. doi: https://dx.doi.org/ 10.33289/IJRPC.10.3.2020.10(58). (Muhammad Owais Ahsen, Hafiz Dawood Khalid, Sammia Shahid (Chemistry/SSC) Abstract: In healthcare system the medicinal plants are most commonly used in a whole world. The metabolites that is present in the extract of herbal plants that contain different chemical substance that may produce different therapeutic effects. The Adhatoda Vesica herbal plant that is most commonly used is a southeast region for the treatment of different microbial diseases. The methanolic extract of leaf and synthesis of AgNPs is able for the curing of different skin diseases and wound healing purpose. The Adhatoda Vesica plant contains a number of secondary metabolites such as alkaloids. saponins, amino acids, carbohydrate, flavonoids and proteins etc. A prolonged intense look of literature data revealed some important biological activities like antibacterial, anti‐inflammatory, antifertility, anti‐ulcer, anti‐tissue, anti‐typhoid and anti oxidant, Immunomodulatory, hepatoprotective, and wound healing. The pharmacological and phytochemical review of AdhatodaVesica realized the importance of the medicinal plants. Keywords: adhatodavesica, microbiological activity, phytochemistry and metabolites.
28. Amiza, Yaseen, G., & Shahid, S. (2020). Comprehensive Review on Phytopharmacological Potential of Gymnema sylvestre. Asian Journal of Pharmacy and Technology. 10(3), 217‐ 220. doi: 10.5958/2231‐5713.2020.00036.7. (Amiza, Ghazala Yaseen, Sammia Shahid (Chemistry/SSC) Abstract: Therapeutic plants are of great interest as revolutionizing therapeutic agents in recent years for the treatment of several diseases. Gymnema sylvestre is commonly cultivated in India, member of the Apocynaceae family and also distributed in the various regions of Asia, Australia and Africa. It is extensively used in the Ayurvedic and traditional drug system, also it is the most promising plant used to cure diabetes mellitus. It is used as sweet paralyzing agent due to the existence of important phytochemicals constituents like gurmarin, gymnemic acids and gymneasaponins. It explore a wide range of health‐giving effects as an effectual natural remedy for diabetes, bronchitis and leukodema. It has been reported that G.sylestre has anti‐diabetes, anti‐ obesity, antiviral, antidote of snake venom, anti‐microbial and hypolipidaemic activities. This review has explore different phytochemicals as well as pharmacological potential of G.sylvestre. Keywords: gymnema sylvestre, phytochemistry, pharmacology, diabetes mellitus therapeutic effects.
Research Outlook 2020 | 80
29. Maqsood, A., Munir, A., & Shahid, S. (2020). A Phytopharmacological Evaluation of Cassia fistula. A Comprehensive Review. International Journal of Pharmaceutical Sciences Review and Research. 62(2), 45‐53. (Ayesha Maqsood, Ayesha Munir, Sammia Shahid (Chemistry/SSC) Abstract: The aim of this study is to provide a comprehensive and recent review on Cassia fistula’s traditional medicinal uses, pharmacognostical studies, Phytochemical profile and pharmacological activities. Cassia fistula (Amaltas), a golden shower tree belongs to Leguminosae family with 8‐15 m height. Cassia fistula stem is greenish grey, reddish brown root, compound leaf, 3‐8 pair of leaflets, cylindrical pods and ovoid seeds. Phenol, alkaloids, lipids, proteins, flavonoids and carbohydrates are bioactive constituent of Cassia fistula. It is more significant in curing different ailments and acts as antifungal, antibacterial, analgesic, hepatoprotective, anti‐inflammatory etc. Keywords: cassia fistula, traditional uses, phytochemicals, pharmacognosy, pharmacological activities.
30. Maqsood, A., & Shahid, S. (2020). Evaluation of Traditional Medicinal Uses, Phytochemical and Pharmacological Activities of Cassia angustifolia (Senna): A Recent Review. Global Journal for Pharma and Allied Sciences. 1(2), 18‐ 23. (Ayesha Maqsood, Sammia Shahid (Chemistry/SSC) Abstract: Herbal medicines are used traditionally in treatment of disorders with less side effects. Cassia angustifolia is medicinal plant having effective biological potential. It belongs to Leguminosae family. It is small herb with height of 2.3 feet. It mostly cultivated in Saudi Arabia, Egypt, Yemen, India, Bangladesh and Pakistan in warm weather conditions. Main objective of this study is to provide a more recent literature work on traditional medicinal uses, phytochemical constituents as well as pharmacological aspects of C. angustifolia. It is traditionally used as laxative due to anthraquinone derivatives. It also shows synergetic effects against constipation. Present review provides a recent information about pharmacological properties of C. angustifolia because of its medicinally important phytochemicals. Keywords: cassia angustifolia, traditional medicinal use, phytochemistry, pharmacological activities.
31. Abubakar, M., Mehvish, R., & Shahid, S. (2020). Novel Pharmacological Activities and Agents of Morusalba. International journal of research in pharmacy and chemistry (IJRPC), 10(4), 318‐330. doi: https://dx.doi.org/ 10.33289/IJRPC.10.4.2020.10(78). (Muhammad Abubakar, Rooma Mehvish, Sammia Shahid (Chemistry/SSC) Abstract: M. alba belongs to Moraceae family commonly known as mulberry in Pakistan locally known as Shahtoot, had very old medicinal background. In old Chinese medicine mulberry has been used for treatment of number of diseases including cancer, in inflammation and for treatment of viral infections. M. albais a reach plant contains many useful chemical constituents as flavonoids, glycosides, flavones, Flavonols, alkaloids and many other pharmacological compounds. These Compounds are used for treatment of many bacterial and viral disease. This study mainly emphasis the number of chemicals can be isolated from mulberry and possible pharmacological uses of active constituents of M. alba including antiulcer, anti‐cancer, antifungal, antibacterial, skin caring, hepatoprotective, Cardioprotective and other medicinal uses of M. alba. Keywords: Pharmacological, Alkaloids, Phytochemicals, Flavonoids, Glycosides and M. alba.
32. Khan, S., Yar, M., Kosar, N., Ayub, K., Arshad, M., Zahid, M. N., & Mahmood, T. (2020). First‐principles study for exploring the adsorption behavior of G‐series nerve agents on graphdyine surface. Computational and Theoretical Chemistry, 1191, 113043. doi: https://doi.org/10.1016/j.comptc.2020.113043. (Naveen Kosar (Chemistry/SSC) Abstract: Easy and effective detection of health hazards chemical warfare agents (CWA) is vital for the good human health and safe environment. Here, we report the sensing of G type nerve agents, such as GA(tabun), GB(sarin), GD(soman) and GF(cyclosarin) on graphdiyne (GDY) using DFT and QTAIM analyses. The sensing results reveal the physisorption of analytes at the triangular portion of graphdiyne surface. Among all, GA shows the highest interaction energy of −16.31 kcal/mol. SAPT0 analysis reveals the least contribution of repulsive component (exchange) in GA@GDY complex. The change in HOMO‐LUMO energy gap and charge transfer (NBO) Research Outlook 2020 | 81
also support the sensitivity of graphdiyne toward considered analytes. QTAIM and NCI analyses reveal that the type of noncovalent interactions are mainly van der Waals in nature. A short recovery time of 0.63 µs at 298 K for desorption of GF from GDY shows that GDY can act as better surface as sensor study for GF. Keywords: Nerve agents, G‐type, Sensing, DFT, QTAIM.
33. Javed, M., Abid, M., Hussain, S., Shahwar, D., Arshad, S., Ahmed, N., . . . Harron, S. (2020). Synthesis, Characterization And Photocatalytic Applications Of S‐Doped Graphitic Carbon Nitride Nanocomposites With Nickel Doped Zinc Oxide Nanoparticles. Digest Journal of Nanomaterials and Biostructures, 15(4), 1097‐1105. (Mohsin Javed, D. Shahwar, S. Arshad, N. Ahmad, Muhammad Arif, H. Khan, Sohail Nadeem, Hamid Raza, S. M. Harron (Chemistry/SSC) Abstract: Coprecipitation method was adopted for the synthesis of undoped and Ni‐doped zinc oxide nanoparticles. The photocatalytic activity of the synthesized particles was examined by degradation of methylene blue under UV bulb. The S‐doped graphitic carbon nitride was obtained by calcination of thiourea and composites were formed with S‐doped graphitic carbon nitride and nickel doped zinc oxide nanoparticles using liquid exfoliation method. The ethanol and water were used as solvents for the liquid exfoliation. The photocatalytic activity was performed under UV and visible light by using a UV‐visible spectrophotometer with different concentrations of composites for the degradation of methylene blue. The doping of nickel on zinc oxide nanoparticles and formation of sulfur doped graphitic carbon nitride composites were confirmed by FTIR and XRD analyses. The FTIR analysis sowed a signal at 838cm‐1 due to the presence of Ni‐O bond. The peaks at 3649cm‐1 and 3735cm‐1 confirmed the presence of amide group. The shift in absorption maxima from 364nm to 376nm (red shift) in UV spectrum was a confirmation of increased Ni content. The different concentrations of composites showed great impact on the degradation of methylene blue. Keywords: Photocatalytic, Nanocomposites, S‐doped graphitic carbon nitride, Ni‐doped, ZnO.
34. Arif, M., Munawar, K. S., Ali, S., Raza, H., & Ashfaq, M. (2020). Synthesis and Optical Study of Sensitive and Selective Detection of Fe (III) ions Based on Solvents. Egyptian Journal of Chemistry, 63(10), 4029‐4038. doi: DOI: 10.21608/EJCHEM.2020.32047.2680. (Muhammad Arif, Hamid Raza (Chemistry/SSC) Abstract: This study accentuates the synthesis and characterization of vanillin azo dye conjugate based on naked‐ eye colored chemodosimeters. Vanillin azo dye conjugate exhibited high selectivity and sensitivity in absorbance for detection of Fe(III) ions in all solvents which can be observed simply by naked eye. Mostly the variation occurs in hypochromic shift of different metals with ligand but Fe(III) ions show hypsochromic in all solvents. It was found that the selectivity is more prominent in non‐polar or less polar solvents like Chloroform, diethyl ether etc but less protruding in more polar solvents such as DMSO. The detection limit of the synthesized ligand with Fe(III) ions probe was shown by dilution method up to 0.39 ppm. The formation of complexes with azo dye was also affected by dielectric constant of the solvents. Keywords: Solvent polarity, Fe (III), Azo dye, Naked eye detection, Chemosensors.
35. Javed, M., Shoaib, M., Iqbal, Z., Khan, M. A., Hussain, S., & Amjad, M. (2020). Phytochemical and Biological Studies on Curcuma longa L. in Pattoki (Kasur), Pakistan: Chemical and Biological studies of Curcuma longa. Proceedings of the Pakistan Academy of Sciences: B. Life and Environmental Sciences, 57(2), 59–66. Retrieved from http://ppaspk.org/index.php/PPAS‐B/article/view/38. (Mohsin Javed, Madiha Shoaib (Chemistry/SSC) Abstract: Curcuma longa (Turmeric, Haldi) is an important medicinal and traditional plant belonging to the family Zinger beraceae. Current studies were performed to explore the phytochemical composition, nutritional value, antioxidant and antimicrobial potential of Curcuma longa rhizome collected from Pattoki (Kasur), Pakistan. Phytochemical investigations have shown the presence of secondary metabolites such as
Research Outlook 2020 | 82
saponins, terpenoids, glycosides, tannins, and alkaloids. The extract displayed fantastic antioxidant potential with 70.34% total phenolic content (TPC). The highest antioxidant potential 87.92% was observed with a 50μg/mL concentration of methanolic extract. The plant extract has shown an excellent nutritional potential due to the presence of significant quantities of carbohydrates, protein, fibers, fat, and energy content of 101.12 Kcal/100g. However, it displayed insignificant antimicrobial potential against tested bacterial (Staphylococcus aureus, Bacillus subtilis, Salmonella typhi, and Escherichia coli) and fungal (Fusarium oxysporum, Aspergillus niger, Aspergillus flavus, and Alteraria alternata) strains. Keywords: curuma longa, chemical ingredients, antioxidant, antibacterial, antifungal.
36. Qaddir, I., Majeed, A., Hussain, W., Mahmood, S., & Rasool, N. (2020). An in silico investigation of phytochemicals as potential inhibitors against non‐structural protein 1 from dengue virus 4. Brazilian Journal of Pharmaceutical Sciences, 56. (Iqra Qaddir (Chemistry/SSC) Nouman Rasool (INFS/SST) Abstract: Dengue fever has emerged as a big threat to human health since the last decade owing to high morbidity with considerable mortalities. The proposed study aims at the in silico investigation of the inhibitory action against DENV4‐NS1 of phytochemicals from two local medicinal plants of Pakistan. Non‐Structural Protein 1 of Dengue Virus 4 (DENV4‐NS1) is known to be involved in the replication and maturation of viron in the host cells. A total of 129 phytochemicals (50 from Tanacetum parthenium and 79 from Silybum marianum) were selected for this study. The tertiary structure of DENV4‐NS1 was predicted based on homology modelling using Modeller 9.18 and the structural stability was evaluated using molecular dynamics simulations. Absorption, distribution, metabolism, excretion and toxicity (ADMET) along with the drug‐likeness was also predicted for these phytochemicals using SwissADME and PreADMET servers. The results of ADMET and drug‐likeness predictions exhibited that 54 phytochemicals i.e. 25 from Tanacetum parthenium and 29 from Silybum marianum showed effective druglikeness. These phytochemicals were docked against DENV4‐NS1 using AutoDock Vina and 18 most suitable phytochemicals with binding affinities ≤ ‐6.0 kcal/mol were selected as potential inhibitors for DENV4‐NS1. Proposed study also exploits the novel inhibitory action of Jaceidin, Centaureidin, Artecanin, Secotanaparthenolide, Artematin, Schizolaenone B, Isopomiferin, 6, 8‐Diprenyleriodictyol, and Anthraxin against dengue virus. It is concluded that the screened 18 phytochemicals have strong inhibition potential against Dengue Virus 4. Keywords: DENV4‐NS1, Phytochemicals, Molecular Docking, Molecular Dynamics Simulations, Druglikeness. Conference Paper 1. Afzal, M. I., Shahid, S. (2020). Facile fabrication and characterization of cadmium sulfide nanowires on Anodized Aluminum Oxide templates. Paper presented at the 1st Third International Symposium on Materials, Electrochemistry and Environment (CIMEE20）held on 17‐19 September, 2020 at Beirut Lebanese University. (Malik Imran Afzal, Sammia Shahid (Chemistry/SSC) Abstract: Cadmium sulfide nanowires have unique electrical and optical properties and applications. To obtain cadmium sulfide nanowires with regular and good aspect ratio, they were be synthesized by template synthesis method. Porous anodized aluminium oxide is most promising template with regular hexagonal shapes. Their aspect ratio was controlled by controlling anodization voltage and temperature of the electrolyte. In this research, comparatively low purity aluminium was used to prepare nanotemplates at 5‐6°C in 1M phosphoric acid and cadmium sulfide was deposited electrochemically using a co‐solution of thiourea, cadmium acetate and ammonium acetate. pH was maintained at 11 in heat bath at 75°C with the help of aqueous ammonia solution. Both porous anodized alumina and cadmium sulfide nanowires were characterized suing XRD, TEM and SEM. A good quality nanowires were obtained in bunches with reasonably high aspect ratio. It was concluded good
Research Outlook 2020 | 83
quality nanomaterials can be obtained by controlling reaction parameters even by using commercial grade aluminum templates. Keywords: Aluminum Oxide templates, Cadmium sulfide, electro‐deposition.
2. Aslam, A., Shahid, S. (2020). Comparative study of Synthesis of ZnO Thin flims by Sol‐Gel technique for biosensor applications. Paper presented at the 3rd International Conference on Chemistry Virtual (ICC) Virtual, September 21‐22, 2020, Lahore Garrison University , Lahore. (Asma Aslam, Sammia Shahid (Chemistry/SSC) Abstract: C Nano‐structured metal oxide based semiconductors have attracted much attention due to their interesting properties and potential applications [1]. ZnO is the most important sensing material because of its high gas sensitivity, high absorption ratio, high stability, non‐toxicity and low cost. There are various processes available for deposition of ZnO thin flims, among those sol‐gel process is most useful because of its simplicity, low cost ant ability to operate at room temperature [2]. The structural and morphological characterizations of the synthesized ZnO was carried out by Scanning electron microscopy (SEM), powder X‐ray diffraction (XRD), Fourier transform infrared spectrophotometer (FT‐IR), and UV–vis spectrophotometer which confirmed that the synthesized product is type well structure with an average diameter of 58.61nm [3]. ZnO semiconductor thin films with average nano crystallite size in the range 20–30 nm have been successfully synthesized using the sol–gel dip‐coating technique, utilizing zinc acetate precursor. The results thus indicate that ZnO thin films can be used as biosensors for SOR and potentially for characterizing the antioxidant properties of fluids [4]. The result also indicates that microstructure of the film is clearly related to the electrical property. Improvements of the film crystallinity and the interface between the semiconductor and gate dielectric are observed at high annealing temperature [5]. Keywords: not available. Department of Physics Research Articles 1. Ali, H., Soleimani, H., Yahya, N., Khodapanah, L., Sabet, M., Demiral, B. M. R., Hussain, T., . . . Adebayo, L. L. (2020). Enhanced oil recovery by using electromagnetic‐assisted nanofluids: A review. Journal of Molecular Liquids, 309, 113095. doi: https://doi.org/10.1016/j.molliq.2020.113095. (Tanvir Hussain (Physics/SSC) (Review) Abstract: Applications of nanotechnology have grown enormously in recent years in various fields, such as drug delivery, energy storage, information technology, electronic devices and petroleum industry. The petroleum industry is using nanotechnology in a variety of applications, but the use of nanofluids with base fluid in the presence of the electromagnetic field in the reservoir for enhanced oil recovery (EOR) is a novel technique. After primary and secondary recovery from the reservoir, there is still an estimated amount of 50% oil remains there in most reservoirs, which cannot be extracted by conventional methods. Some studies regarding the magnetic and dielectric nanofluids in the presence of electromagnetic radiation have been carried out to recover the residual oil from depleted oil reservoirs. Such studies have shown promising results and yielded a consistent improvement in comparison to the conventional polymers and brine used in the industrial practice. However, some challenges like low sweep efficiency, potential formation damage, rheological improvement and high costs affect the further application of nanofluids for EOR technologies. The current study is a review of the activation of nanofluids using electromagnetic radiation for enhanced oil recovery, and the evaluation of mechanisms adopted for the prospects of this technology. Keywords: enhanced oil recovery, electromagnetic field, rheology, nanofluid, core‐flooding.
Research Outlook 2020 | 84
2. Li, G., Ain, Q., Li, S., Saeed, M., Papp, D., Kamperidis, C., & Hafz, N. A. M. (2020). Control of electron beam energy‐ spread by beam loading effects in a laser‐plasma accelerator. Plasma Physics and Controlled Fusion, 62(5), 055004. doi: 10.1088/1361‐6587/ab7c50. (Quratul Ain (Physics/SSC) Abstract: We present experimental results from a laser wakefield electron accelerator driven by 70 TW ultrashort laser pulses in Helium and Helium–Nitrogen gaseous plasmas with two different Nitrogen concentrations, showing distinct electron‐beam qualities. In order to get a clear view of the involved phenomenon, two‐ dimensional particle‐in‐cell simulations are performed which not only agreed with the experimental results but also provided an investigation on the evolution of accelerating structures. The experimental and simulation results depict that the beam loading effect can strongly modify the longitudinal accelerating electric field of the wake wave, imposing diametrically opposite effects on the final electron‐beam qualities, especially the energy‐ spread, in the Helium–Nitrogen gas mixtures with different Nitrogen concentrations. In the Helium–Nitrogen‐ mixed plasma with a lower Nitrogen concentration (0.5%), if appropriately controlled, the beam loading effect can be employed to flatten the accelerating electric field for reducing the electron‐beam energy spread. In contrast, in the Helium–Nitrogen‐mixed plasmas with a higher Nitrogen concentration (5%), the accelerating electric field of the wake is locally reversed by the self‐fields of the overloaded electron bunch, and the correspondingly generated negative‐slope region of electric field increases the electron‐beam energy‐spread. Keywords: laser wakefield acceleration, ionization injection, experimental laser plasma acceleration.
3. Wahab, A., Sabir, B., Kattan, N. A., Yaqoob, N., Algrafy, E., Murtaza, G., . . . Jamil, I. (2020). Ab initio study of electronic, optical and thermoelectric character of intermetallic compounds XGa3 (X = Fe, Ru, Os). Optical and Quantum Electronics, 52(4), 219. doi: 10.1007/s11082‐020‐02332‐6. (A. Wahab, Muhammad Imran Jamil (Physics/SSC)
Abstract: The electronic, optical and thermoelectric response of inter‐metallic semiconductor MGa3 (M = Fe, Ru, Os) in the tetragonal phase have been evaluated using PBEsol–mBJ approximation under the framework of DFT. The electronic properties demonstrate the indirect band gap values of these materials. The optical behavior predicted in terms of dielectric function, extinction coefficient, refractive index, optical conductivity, absorption coefficient, energy loss factor, and reflectivity. Moreover, the development of studied materials by changing the temperature is investigated by calculating the thermoelectric properties using BoltzTraP code. Therefore, ab initio calculations of the novel compounds is beneficial for the industry for their promising applications in energy renewable devices. Keywords: intermetallic compounds, modified becke–johnson potential, narrow band gap, refractive index, optical conductivity, power factor.
4. Gilani, S. M. S., Jamil, M. I., Masud, B., & Akram, F. (2020). ρJ/ Ψ scattering in an improved many‐body potential. The European Physical Journal A, 56(2), 66. doi: 10.1140/epja/s10050‐020‐00067‐2. (Muhammad Imran Jamil (Physics/SSC) Abstract: We calculate the cross sec ons for the processes ρJ/ ψ→ DDˉ , ρJ/ ψ→ DDˉ 0 ∗ (D0 ∗Dˉ) and ρJ/ ψ→ D0 ∗Dˉ 0 ∗ by modifying the usual sum of two‐body interaction through a four‐body form factor whose parameters are fitted to the relevant lattice QCD simulations. We use the formalism of the resonating group method, with the Born approximation utilized to decouple the resulting integral equations. Cross sections with using the realistic Cornell potential for each of the two‐body interactions in the Hamiltonian are reported and are compared to those obtained through the quadratic potential. It is found that using four‐body form factor, there is a significant suppression in the cross sections as compared to the more popular sum of two‐body interaction. We find that total dissociation cross section of J/ψJ/ψ by ρρ meson is of the order of 0.1 mb for the most reliable case of Cornell potential with four‐body form factor. Keywords: not available. Research Outlook 2020 | 85
5. Khan, Z. S., Rizwan, M., Hafeez, M., Ali, S., Adrees, M., Qayyum, M. F., . . . Sarwar, M. A. (2020). Effects of silicon nanoparticles on growth and physiology of wheat in cadmium contaminated soil under different soil moisture levels. Environmental Science and Pollution Research, 27(5), 4958‐4968. doi: 10.1007/s11356‐019‐06673‐y. (Muhammad Hafeez (Physics/SSC) Abstract: Soil degradation with different stress conditions like accumulation of cadmium (Cd) contents in soil and drought stress has become one of the most dangerous issues that obstruct the sustainable agriculture production. Silicon nanoparticles (Si NPs) play beneficial roles in combating various biotic and abiotic stresses but their role under combined metal and drought stress is not studied. A pot study was designed to determine the effect of Si NPs on wheat (Triticum aestivum L.) growth and uptake of Cd grown in Cd contaminated soil with different water levels under ambient conditions. Four different levels of Si NPs (0, 25, 50, and 100 mg/kg) were applied in the soil before 1 week of wheat sowing and two water levels (70% and 35% soil water‐holding capacity) were introduced after 50 days of seed sowing for the remaining growth period. The lowest biomass, yield, and photosynthesis were observed in the control plants while oxidative stress and the highest Cd concentrations in shoots, roots, and grains were observed in the control plants, and the drought stress further enhanced this effect on the plants. The Si NPs treatments improved the plant growth indicators and photosynthesis, and reduced the Cd concentrations in wheat tissues, especially in grains either without or with drought stress. The Si NPs reduced the oxidative stress in leaves as was indicated by the reduced production of hydrogen peroxide, electrolyte leakage, and malondialdehyde contents, and increase in superoxide dismutase and peroxidase activities. The improvement in wheat growth and a reduction in oxidative stress and Cd concentration in tissues were dependent on the levels of Si NPs and the effect was the highest with the highest level of NPs used. Keywords: silicon, cadmium, drought, wheat, nanoparticles, yield, oxidative stress.
6. Ahmad, I., Ashraf, M., Khan, Y., Khawaja, E. E., Ali, Z., Abbas, T. A., . . . Akhtar, S. M. J. (2020). Effects of preparation conditions on the optical properties of niobium oxide thin films. Inorganic and Nano‐Metal Chemistry, 50(1), 22‐27. doi: 10.1080/24701556.2019.1661462. (Imtiaz Ahmad, Ehsan E. Khawaja (Physics/SSC) Abstract: Major deposition parameters, including oxygen partial pressure and substrate temperature main‐ tained during film deposition, affect the optical properties of electron beam evaporated niobium oxide films. All the films deposited were found to be amorphous as revealed by the X‐ray diffrac‐ tion study. A method requiring measurements at normal incidence of transmission from two films of different thicknesses prepared under identical conditions was used to determine the optical constants. Substantial changes in the optical constants and optical bandgap energy were observed following changes in the preparation conditions. These variations are related to the corresponding compositional changes, as observed by Rutherford Backscattering Spectroscopy, in the atomic ratio of oxygen to niobium in the films prepared under different conditions. Keywords: optical properties, large bandgap material, niobium oxide, thin films.
7. Bakar, A., Afaq, A., Khan, M. F., ul Aarifeen, N., Imran Jamil, M., & Asif, M. (2020). Insight into the structural, vibrational and thermodynamic properties of SmX (X = S, Se, Te) chalcogenides: First‐principles investigations. Physica B: Condensed Matter, 576, 411715. doi: https://doi.org/10.1016/j.physb.2019.411715. (Muhammad Faizan Khan, M. Imran Jamil (Physics/SSC) Abstract: In this research work, Samarium based Chalcogenides are studied for structural, vibrational and thermodynamic properties. The structural optimization is performed by using Generalized Gradient Approximation as an exchange correlation potential in Density Functional Theory (DFT) and vibrational properties are computed by using norm‐conserving Martins–Troullier pseudo‐potential in Density Functional Perturbation Theory (DFPT). The Quasi Harmonic Debye model is used for the investigation of thermodynamic properties in Research Outlook 2020 | 86
temperature range 0–1000 K in Gibbs‐code. There is no imaginary phonon frequency in phonon dispersion curves of SmS, SmSe and SmTe proving the dynamical stability. SmS has the largest while SmTe has the smallest phonon band gap which somehow suggests the polar property of these materials. For all Chalcogenides, acoustic phonon modes near the gamma point have a linear behavior. At low temperature, Cv is a function of T3 while for higher temperatures it asymptotically tends to a constant as expected. Keywords: density functional theory, chalcogenides, dispersion relations, phonon density of states, debye temperature, specific heat.
8. Adrees, M., Khan, Z. S., Ali, S., Hafeez, M., Khalid, S., ur Rehman, M. Z., . . . Rizwan, M. (2020). Simultaneous mitigation of cadmium and drought stress in wheat by soil application of iron nanoparticles. Chemosphere, 238, 124681. doi: https://doi.org/10.1016/j.chemosphere.2019.124681. (Muhammad Hafeez (Physics/SSC) Abstract: Excess amount of cadmium (Cd) in arable soils and shortage of good quality water are the major abiotic factors affecting the crop yield which needs immediate solution to feed the increasing population worldwide. Recently, nanoparticles (NPs) are widely used in various industries including agriculture which is due to the unique properties of NPs. Among NPs, iron (Fe) NPs might be used to alleviate the abiotic stresses in crops but limited informations are available in the literature about the role of Fe‐NPs in crops under metal stress. The present study was designed to highlight the efficiency of Fe‐NPs on Cd accumulation in Cd and drought‐stressed wheat. Wheat plants were grown in Cd‐contaminated soil after the supply of different levels of Fe‐NPs and two water regimes were introduced in the soil in latter growth stages of the plants. Cadmium and drought stress negatively affected the wheat photosynthesis, yield and caused oxidative stress in leaves with excess accumulation of Cd in grains and other plant tissues. The NPs improved the photosynthesis, yield, Fe concentrations and diminished the Cd concentrations in tissues. The NPs alleviated the oxidative stress in leaves and the efficiency depends on the NPs concentrations applied in the soil. The results obtained indicated that Fe‐ NPs may be employed aiming to get wheat grains with excess Fe and decreased Cd contents. However, field investigations with various sizes, shapes and levels of NPs are needed before final recommendations to the farmers. Keywords: cadmium, water shortage, nanoparticles, iron, cereals.
9. Hafiz, N. A. M., Li, G., Li, S., Ain, Q., Gao, K., Saeed, M., . . . Kamperidis, C. (2020). Enhanced laser wakefield acceleration using dual‐color relativistic pulses. Plasma Physics and Controlled Fusion, 62(9), 1‐13. doi: 10.1088/1361‐6587/aba481. (Qurat‐ul‐ain (Physics/SSC) Abstract: In a recent article by Li et al (2019 Sci. Adv. 5. eaav7940), experimental results from a dual‐color laser wakefield acceleration (LWFA) were presented. In the present paper we, primarily, focus on detailed simulation studies of such a scheme in the self‐injection and ionization injection regimes, respectively. The spatiotemporally‐ overlapped 30 fs dual‐color laser pulses are at fundamental (FL, 800 nm, 'red') and second‐harmonic (SH, 400 nm, 'blue') wavelengths. They are (a) co‐propagating in an under‐dense plasma, (b) relativistically intense (I > 1018 W cm−2) and (c) having relatively high‐energy (multi‐Joule, loose focusing) and low‐energy (sub‐Joule, tight
focusing), respectively. The basic concept of the scheme is the fact that the depletion length (L pd) for a relativistic laser pulse in an under‐dense plasma has an inverse quadratic dependence on the laser wavelength (∝1/λ 2). Here, first by using a single FL 77 TW/30 fs laser pulse to drive a LWFA, an electron beam was accelerated up to ~400 MeV from a background plasma having an electron density of 1019 cm−3. Then, by driving the same LWFA by co‐propagating 'blue' 7 TW/30 fs and 'red' 70 TW/30 fs laser pulses, the electron energy reached ~700–800 MeV (maximum). The simulations confirm that in such a dual‐color LWFA scheme, the role of the SH laser pulse is post‐accelerating electrons after a rapid depletion of the FL laser pulse in the plasma. Furthermore, the SH pulse assists the ionization‐injection of the electrons which is an additional benefit of the dual‐color LWFA scheme. Research Outlook 2020 | 87
Keywords: dual‐color laser‐plasma accelerator, laser wakefield acceleration, self‐injection, ionization injection, PIC simulation.
10. Nabi, G., Kamran, M. A., Usman, Z., Majid, A., Alharbi, T., Abdullah, A., . . . Shah, T.‐U.‐H. (2020). Substitutional site effects of Cr(II) ions on optical and magnetic properties of 1D CdS semiconductor nanoneedles for optoelectronic and spintronic applications. Inorganic Chemistry Communications, 121, 108224. doi: https://doi.org/10.1016/j.inoche.2020.108224. (Ali Abdullah (Physics/SSC) (SKT Campus) Short communication Abstract: Spin controlled diluted magnetic semiconductors (DMSs) could bring revolution in the processing speed as well as in enhancing the storage capacity. To achieve its industrial application, several impurities have been doped from the 3d/4f into semiconductors, however, Cr has not yet been doped into CdS 1D nanostructures. Here, in the present study, we report on the Cr‐doped CdS 1D nanoneedles synthesized by CVD and studied its optical and magnetic properties. The successful incorporation of Cr‐ions into CdS confirmed by EDX and XRD. Along with the increase in Cr‐ions concentration, first PL‐peak shifted from 514.1 to 558.3 nm associated with the formation of excitonic magnetic polarons (EMPs) and the second peak centered at 993.8 nm may correspond to the aggregation of Cr‐ions. For the first time, we tuned CdS emission up to ~ 482 nm covering visible spectral region up to near‐infrared (NIR) region. With increasing the Cr‐ions concentration up to 6.2%, saturation magnetization (Ms) was significantly enhanced from 0.614 × 10−3 Am2/kg to 0.987 × 10−3 Am2/kg. These findings will promote their future applications in the optoelectronic and spintronic devices. Keywords: Cr, CdS, DMS, Optical, Magnetic.
11. Hussain, T., Junaid, M., & Qayyum, H. A. (2020). Preparation of Ba‐doped SrTiO3 photocatalyst by sol‐gel method for hydrogen generation. Chemical Physics Letters, 754, 137741. doi: https://doi.org/10.1016/j.cplett.2020.137741. (Tanvir Hussain, M. Junaid (Physics/SSC) Abstract: Increasing energy demands and its impact on the environment make it necessary to look for alternative renewable energy sources. Hydrogen is considered as energy vector but on earth, free hydrogen is not available
and found in the compound state. In this study, BaxSr1‐xTiO3 (x = 0.00, 0.05, 0.10 and 0.20) photocatalysts are prepared by sol‐gel method for water splitting. XRD patterns showed the formation of the pure cubic structure
of SrTiO3. It was observed that the optical absorption of SrTiO3 was increased by increasing Ba content. Solar to
hydrogen conversion efficiency of SrTiO3 photocatalyst were increased by increasing Ba doping. Keywords: renewable energy source, photocatalyst, water splitting, bandgap, optical absorption, photocurrent.
12. Shaikh, M. N., Qayyum, Z., & Antonis, P. (2020). Development of a Comprehensive Matlab/Simulink Based Model for High‐Efficiency 2nd Generation Photovoltaic (PV) Modules. Current Nanoscience, 16(4), 568‐577. doi: http://dx.doi.org/10.2174/1573413715666190130161402. (Qayyum Zafar (Physics/SSC) Abstract: Background: The accurate energy yield prediction of a PV system under various environmental conditions is important for designing a high‐performance PV system. Objective: The robust and cost‐effective digital simulation studies on PV systems have the advantage in comparison to studies based on measurements because they provide the opportunity for sensitivity analysis on various design parameters of the PV system. Methods: Herein, we present the development and implementation of a generalized photovoltaic computational model using Matlab/Simulink software package. The model is based on the equivalent diode circuit approach. It is designed to simulate two ubiquitous and high performing 2nd generation photovoltaic (PV) modules constructed with Cadmium Telluride (CdTe) and Copper Indium Gallium di‐Selenide (CIGS) photoactive thin films, respectively. The values of key input parameters to the simulator, i.e., parallel resistor (Rp) and series resistor (Rs) have been computed by an efficient Newton‐Raphson iteration method.
Research Outlook 2020 | 88
Results: The output current‐voltage (I‐V) and power‐voltage (P‐V) characteristic curves of the aforementioned PV modules have been simulated by taking two input variables (ambient irradiance and temperature) into consideration. The electrical performance of both PV modules under various environmental conditions have been mathematically investigated by the solution of classical non‐linear equations. Conclusion: The developed PV model has been validated with the experimental results obtained from standard PV module datasheets provided by manufacturers. The relative error between the simulated and experimental values of various photovoltaic parameters for CdTe and CIGS PV modules at Standard Test Conditions (STC) has been observed to be below 3%. Keywords: 2nd generation photovoltaic (PV) modules, equivalent diode circuit, photovoltaic parameters, computational modelling, Newton‐Raphson iteration method, Matlab/SimulinkEER.
13. Nofal, M. M., Aziz, S. B., Hadi, J. M., Abdulwahid, R. T., Dannoun, E., Qayyum, Z., Marif, A. S., . . . Kadir, M. (2020). Synthesis of Porous Proton Ion Conducting Solid Polymer Blend Electrolytes Based on PVA: CS Polymers: Structural, Morphological and Electrochemical Properties. Materials, 13(21), 4890. (Qayyum Zafar (Physics/SSC) Abstract: In this study, porous cationic hydrogen (H+) conducting polymer blend electrolytes with an amorphous
structure were prepared using a casting technique. Poly(vinyl alcohol) (PVA), chitosan (CS), and NH4SCN were used as raw materials. The peak broadening and drop in intensity of the X‐ray diffraction (XRD) pattern of the electrolyte systems established the growth of the amorphous phase. The porous structure is associated with the amorphous nature, which was visualized through the field‐emission scanning electron microscope (FESEM) images. The enhancement of DC ionic conductivity with increasing salt content was observed up to 40 wt.% of the added salt. The dielectric and electric modulus results were helpful in understanding the ionic conductivity
behavior. The transfer number measurement (TNM) technique was used to determine the ion (tion) and electron
(telec) transference numbers. The high electrochemical stability up to 2.25 V was recorded using the linear sweep voltammetry (LSV) technique. Keywords: porous polymer electrolyte, XRD and morphology, impedance, electrical properties, TNM, LSV.
14. Ahmad, M., Ahmad, M. K., Nafarizal, N., Soon, C. F., Suriani, A. B., Iqbal, M. A., . . . Jabeen, M. (2020). Adsorption effect of NO2 on ZnO (100 nm) nanowires, leading towards reduced reverse leakage current and voltage enhancement. Bulletin of Materials Science, 43(1), 267. doi: 10.1007/s12034‐020‐02237‐w. (Muhammad Azhar Iqbal (Physics/SSC) Abstract: Here, we report the adsorption effect of NO2 on ZnO (100 nm) nanowires. We have studied the effect of adsorbed NO2 molecules on ZnO nanowire‐based energy harvester for an exposure time of 1, 2, 3, 4, 5 and 6 h in a sealed chamber at 50 ppm which yielded piezoelectric voltage of 543.6 mV, 834.6 mV, 1.071 V, 1.78 V, 1.969 V and 2.835 V, respectively. We have thoroughly investigated the behaviour of ZnO nanowires in the presence of NO2 and observed a maximum output piezoelectric voltage of 2.835 V with a power density 158.2 mW cm−2. This is the first me that ZnO‐based piezoelectric energy harvester is being used for the voltage enhancement in the presence of NO2. We have used vertically integrated nanowire generator (VING) structure. X‐ray diffraction pattern revealed the growth orientation of ZnO nanowires were along the c‐axis from the substrate. ZnO nanowires were grown on indium tin oxide‐coated polyethylene terephthalate substrates via a hydrothermal route. Surface morphology has been examined by scanning electron microscopy images and diameter of ZnO nanowires was found to be around 100 nm. Piezoelectric voltage has been generated by the VING by applying minute external force of ~50 nN. Periodic output voltage peaks were being measured by picoscope 5204. Keywords: Piezoelectric potential, VING, nanogenerator, adsorption of NO2.
Research Outlook 2020 | 89
15. Erum, N., & Iqbal, M. A. (2020). Elastomechanical and Magneto‐Optoelectronic Investigation of RbCoF3: An ab initio DFT Study. Acta Physica Polonica, A., 138(3), 509‐517. doi: 10.12693/APhysPolA.138.509. (Muhammad Azhar Iqbal (Physics/SSC) Abstract: In this study, within the framework of density functional theory by using full potential linearized augmented plane wave method comprehensive ab initio calculations are done, in order to investigate structural, elastic, mechanical, and magneto‐optoelectronic aspects of RbCoF3 fluoro‐perovskite. Investigated structural properties by analytical methods as well as density functional theory establish to be similar in comparison with results of experimental data. The elastic and mechanical properties confirmed that RbCoF3 is elastically stable, as well as anisotropic. Furthermore, by calculating the Debye temperature θD, thermal behavior of the compound is explored. However, spin dependent magnetoelectronic parameters expose that exchange splitting is ruled by Co 3d orbital. The optimizations of stable magnetic phase authenticates the low temperature experimental observations. The optical spectra also deliver various linear optical parameters. Therefore, the current investigation signifies a valuable approach to analyze the comprehensive data about structural magneto‐ electronic and optical properties that can create a prospect to comprehend profuse physical occurrences, in addition to this, authorize material scientists to implement this materials for spintronic applications. Keywords: fluoro‐perovskites, first‐principles study, magneto‐electronic property, optical property.
16. Shahid, R., Khalid, S., & Shahzadi, S. (2020). Morphologies of silver nanoparticles (Ag NPs) synthesized by hydrothermal and laser ablation techniques. Surface Review and Letters, 27(12), 2050015. doi: 10.1142/s0218625x20500158. (Rehana Shahid, Sidra Khalid, Shamaila Shahzadi (Physics/SSC) Abstract: Silver nanoparticles (Ag NPs) are prepared using two different techniques namely hydrothermal and laser ablation methods. The purpose of this study is to find a more suitable method to prepare Ag NPs through comparison that can give stable and size‐controlled silver nanoparticles. Techniques used for observations are X‐ ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM) and energy‐ dispersive X‐ray spectroscopy (EDX). Comparison of results exhibited that hydrothermal process is a more suitable method to prepare silver nanoparticles with smaller uniform size and better yield as compared to laser ablation method. Also, at low temperature, NPs obtained using hydrothermal process provide better control on morphology, high purity and narrow size distribution. Keywords: Agglomeration, stabilizing agent, morphology, hydrothermal, Ag NPs, sample S3. School of Systems and Technology (SST) Department of Computer Science Research Articles 1. Javed, M. U., Javaid, N., Aldegheishem, A., Alrajeh, N., Tahir, M., & Ramzan, M. (2020). Scheduling Charging of Electric Vehicles in a Secured Manner by Emphasizing Cost Minimization Using Blockchain Technology and IPFS. Sustainability, 12(12), 5151. (Muhammad Ramzan (Computer Science/SST) Abstract: In this work, Electric Vehicles (EVs) are charged using a new and improved charging mechanism called the Mobile‐Vehicle‐to‐Vehicle (M2V) charging strategy. It is further compared with conventional Vehicle‐to‐ Vehicle (V2V) and Grid‐to‐Vehicle (G2V) charging strategies. In the proposed work, the charging of vehicles is done in a Peer‐to‐Peer (P2P) manner; the vehicles are charged using Charging Stations (CSs) or Mobile Vehicles (MVs) in the absence of a central entity. CSs are fixed entities situated at certain locations and act as charge suppliers, whereas MVs act as prosumers, which have the capability of charging themselves and also other vehicles. In the proposed system, blockchain technology is used to tackle the issues related with existing systems, such as privacy, security, lack of trust, etc., and also to promote transparency, data immutability, and a tamper‐
Research Outlook 2020 | 90
proof nature. Moreover, to store the data related to traffic, roads, and weather conditions, a centralized entity, i.e., Transport System Information Unit (TSIU), is used. It helps in reducing the road congestion and avoids roadside accidents. In the TSIU, an Inter‐Planetary File System (IPFS) is used to store the data in a secured manner after removing the data’s redundancy through data filtration. Furthermore, four different types of costs are calculated mathematically, which ultimately contribute towards calculating the total charging cost. The shortest distance between a vehicle and the charging entities is calculated using the Great‐Circle Distance formula. Moving on, both the time taken to traverse this shortest distance and the time to charge the vehicles are calculated using real‐time data of four EVs. Location privacy is also proposed in this work to provide privacy to vehicle users. The power flow and the related energy losses for the above‐mentioned charging strategies are also discussed in this work. An incentive provisioning mechanism is also proposed on the basis of timely delivery of credible messages, which further promotes users’ participation. In the end, simulations are performed and results are obtained that prove the efficiency of the proposed work, as compared to conventional techniques, in minimizing the EVs’ charging cost, time, and distance. Keywords: blockchain, M2V, IPFS, charging scheduling, great‐circle distance.
2. Farooq, M. S., Khan, M., & Abid, A. (2020). A framework to make charity collection transparent and auditable using blockchain technology. Computers & Electrical Engineering, 83, 106588. doi: https://doi.org/10.1016/j.compeleceng.2020.106588. (Muhammad Shoaib Farooq, Misbah Khan, Adnan Abid (Computer Science/SST) Abstract: Charity is considered as a moral obligation throughout the world, and a huge amount of money comes into circulation in the name of charity. In most of the cases, the charity collection processes are not transparent, and due to this the charitable organizations struggle to gain donors’ trust and interest. This article presents a blockchain‐based charity management platform that aims to provide a transparent, secure, auditable, and efficient system. The proposed platform comprehensively covers charity collection process using crypto wallets, Initial Coin Offering (ICO), economic model, and introduces CharityCoin (CC) as a digital currency. Furthermore, smart‐contracts for pertinent use cases have also been provided, which include exchanging fiat currency to CC, buying and selling CC, transferring CC to organizations and individuals, and call for donations. Finally, the performance evaluation shows that proposed architecture scales well for large data size. Keywords: blockchain charity solution, secure charity collection, creating trust in charity processes, auditable charity process, adding transparency in charity collection, smart contract.
3. Tehseen, R., Farooq, M. S., & Abid, A. (2020). Earthquake Prediction Using Expert Systems: A Systematic Mapping Study. Sustainability, 12(6), 1‐32. (Rabia Tehseen, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: Earthquake is one of the most hazardous natural calamity. Many algorithms have been proposed for earthquake prediction using expert systems (ES). We aim to identify and compare methods, models, frameworks, and tools used to forecast earthquakes using different parameters. We have conducted a systematic mapping study based upon 70 systematically selected high quality peer reviewed research articles involving ES for earthquake prediction, published between January 2010 and January 2020.To the best of our knowledge, there is no recent study that provides a comprehensive survey of this research area. The analysis shows that most of the proposed models have attempted long term predictions about time, intensity, and location of future earthquakes. The article discusses different variants of rule‐based, fuzzy, and machine learning based expert systems for earthquake prediction. Moreover, the discussion covers regional and global seismic data sets used, tools employed, to predict earth quake for different geographical regions. Bibliometric and meta‐information based analysis has been performed by classifying the articles according to research type, empirical type,
Research Outlook 2020 | 91
approach, target area, and system specific parameters. Lastly, it also presents a taxonomy of earthquake prediction approaches, and research evolution during the last decade. Keywords: expert systems, systematic mapping study (sms), earthquake prediction, seismic data, early‐warning systems.
4. Manzoor, A., Hussain, M., & Mehrban, S. (2020). Performance Analysis and Route Optimization: Redistribution between EIGRP, OSPF & BGP Routing Protocols. Computer Standards & Interfaces, 68, 103391. doi: https://doi.org/10.1016/j.csi.2019.103391. (Atif Manzoor, Muzammil Hussain, Sobia Mehrban (Computer Science/SST) Abstract: Routing is the process of data path selection of IP networks. Routers perform path selection on the basis of routing tables stored in their memory. Routing table contains IP routes for route transformation via the best path in the networks. Service providers use different routing protocols in their enterprise networks. These routing‐protocols have the limitation of non‐convergence in the networks. Route redistribution is the technique which overcomes this limitation. Due to this technique, service providers can get optimized communication with IP networks where multiple routing protocols are being used. This research article focuses on the performance and redistribution of different routing protocols in medium or enterprise IP networks. A simulated network model is established in GNS3 simulator. Five Cisco‐7200 series routers and a switch is used in this simulated topology. All these routers are directly connected with each other via serial links. Routing protocols EIGRP, OSPF and BGP are used in this topology and then configured route redistribution on these routers. Different types of data traffic are generated and passed through the network in order to analyze network convergence, throughput and packet delay by the use of software wire shark network analyzer and debug command. EIGRP is better in convergence and through put whereas OSPF is better in packet delay. Keywords: routing protocol, EIGRP, OSPF, BGP, redistribution, administrative distance, convergence, packet delay, throughput.
5. Farooq, M. S., Riaz, S., Abid, A., Umer, T., & Zikria, Y. B. (2020). Role of IoT Technology in Agriculture: A Systematic Literature Review. Electronics, 9(2), 319. (Muhammad Shoaib Farooq, Shamyla Riaz, Adnan Abid (Computer Science/SST) Abstract: The growing demand for food in terms of quality and quantity has increased the need for industrialization and intensification in the agriculture field. Internet of Things (IoT) is a highly promising technology that is offering many innovative solutions to modernize the agriculture sector. Research institutions and scientific groups are continuously working to deliver solutions and products using IoT to address different domains of agriculture. This paper presents a systematic literature review (SLR) by conducting a survey of IoT technologies and their current utilization in different application domains of the agriculture sector. The underlying SLR has been compiled by reviewing research articles published in well‐reputed venues between 2006 and 2019. A total of 67 papers were carefully selected through a systematic process and classified accordingly. The primary objective of this systematic study is the collection of all relevant research on IoT agricultural applications, sensors/devices, communication protocols, and network types. Furthermore, it also discusses the main issues and challenges that are being investigated in the field of agriculture. Moreover, an IoT agriculture framework has been presented that contextualizes the representation of a wide range of current solutions in the field of agriculture. Similarly, country policies for IoT‐based agriculture have also been presented. Lastly, open issues and challenges have been presented to provide the researchers promising future directions in the domain of IoT agriculture. Keywords: internet of things, agriculture, devices/sensors, agricultural applications, communication protocols.
Research Outlook 2020 | 92
6. Nadeem, M. W., Ghamdi, M. A. A., Hussain, M., Khan, M. A., Khan, K. M., Almotiri, S. H., & Butt, S. A. (2020). Brain Tumor Analysis Empowered with Deep Learning: A Review, Taxonomy, and Future Challenges. Brain sciences, 10(2). (Muhammad Waqas Nadeem, Muzammil Hussain (Computer Science/SST) Abstract: Deep Learning (DL) algorithms enabled computational models consist of multiple processing layers that represent data with multiple levels of abstraction. In recent years, usage of deep learning is rapidly proliferating in almost every domain, especially in medical image processing, medical image analysis, and bioinformatics. Consequently, deep learning has dramatically changed and improved the means of recognition, prediction, and diagnosis effectively in numerous areas of healthcare such as pathology, brain tumor, lung cancer, abdomen, cardiac, and retina. Considering the wide range of applications of deep learning, the objective of this article is to review major deep learning concepts pertinent to brain tumor analysis (e.g., segmentation, classification, prediction, evaluation.). A review conducted by summarizing a large number of scientific contributions to the field (i.e., deep learning in brain tumor analysis) is presented in this study. A coherent taxonomy of research landscape from the literature has also been mapped, and the major aspects of this emerging field have been discussed and analyzed. A critical discussion section to show the limitations of deep learning techniques has been included at the end to elaborate open research challenges and directions for future work in this emergent area. Keywords: deep learning, brain tumor, computer vision, bioinformatics, segmentation, medical images, review.
7. Abid, A., Ali, W., Farooq, M. S., Farooq, U., Khan, N. S., & Abid, K. (2020). Semi‐Automatic Classification and Duplicate Detection From Human Loss News Corpus. IEEE Access, 8, 97737‐97747. doi: 10.1109/ACCESS.2020.2995789. (Adnan Abid, Waqas Ali, Muhammad Shoaib Farooq, Nabeel Sabir Khan (Computer Science/SST) Uzma Farooq (Software Engineering/SST) Abstract: Automatic news repository collection systems involve a news crawler that extracts news from different news portals, subsequently, these news need to be processed to figure out the category of a news article e.g. sports, politics, showbiz etc. In this process there are two main challenges first one is to place a news article under the right category of news, while the second one is to detect a duplicate news, i.e. when the news are being extracted from multiple sources, it is highly probable to get the same news from many different portals, resulting into duplicate news; failing to which may result into inconsistent statistics obtained after pre‐processing the news text. This problem becomes more pertinent when we deal with human loss news involving crime, accident etc. related news articles. As the system may count the same news many times resulting into misleading statistics. In order to address these problems, this research presents the following contributions. Firstly, a news corpus comprising of human loss news of different categories has been developed by gathering data from different sources of well‐known and authentic news websites. The corpus also includes a number of duplicate news. Secondly, a comparison of different classification approaches has been conducted to empirically find out the best suitable text classifier for the categorization of different sub‐categories of human loss news. Lastly, methods have been proposed and compared to detect duplicate news from the corpus by involving different pre‐ processing techniques and widely used similarity measures, cosine similarity, and Jaccard’s coefficient. The results show that conventional text classifiers are still relevant and perform well in text classification tasks as MNB has given 89.5% accurate results. While, Jaccard coefficient exhibits much better results than Cosine similarity for duplicate news detection with different pre‐processing variations with an average accuracy of 83.16%. Keywords: Information retrieval, news classification, news similarity, duplicate detection, security profiling.
8. Khan, N. S., Abid, A., & Abid, K. (2020). A Novel Natural Language Processing (NLP)–Based Machine Translation Model for English to Pakistan Sign Language Translation. Cognitive Computation, 12, 748–765. doi: https://doi.org/10.1007/s12559‐020‐09731‐7. (Nabeel Sabir Khan, Adnan Abid (Computer Science/SST)
Research Outlook 2020 | 93
Abstract: Background/Introduction The deaf community in the world uses a gesture‐based language, generally known as sign language. Every country has a different sign language; for instance, USA has American Sign Language (ASL) and UK has British Sign Language (BSL). The deaf community in Pakistan uses Pakistan Sign Language (PSL), which like other natural languages, has a vocabulary, sentence structure, and word order. Majority of the hearing community is not aware of PSL due to which there exists a huge communication gap between the two groups. Similarly, deaf persons are unable to read text written in English and Urdu. Hence, the provision of an effective translation model can support the cognitive capability of the deaf community to interpret natural language materials available on the Internet and in other useful resources. Methods This research involves exploiting natural language processing (NLP) techniques to support the deaf community by proposing a novel machine translation model that translates English sentences into equivalent Pakistan Sign Language (PSL). Though a large number of machine translation systems have been successfully implemented for natural to natural language translations, natural to sign language machine translation is a relatively new area of research. State‐of‐the‐art works in natural to sign language translation are mostly domain specific and suffer from low accuracy scores. Major reasons are specialised language structures for sign languages, and lack of annotated corpora to facilitate development of more generalisable machine translation systems. To this end, a grammar‐based machine translation model is proposed to translate sentences written in English language into equivalent PSL sentences. To the best of our knowledge, this is a first effort to translate any natural language to PSL using core NLP techniques. The proposed approach involves a structured process to investigate the linguistic structure of PSL and formulate the grammatical structure of PSL sentences. These rules are then formalised into a context‐free grammar, which, in turn, can be efficiently implemented as a parsing module for translation and validation of target PSL sentences. The whole concept is implemented as a software system, comprising the NLP pipeline and an external service to render the avatar‐based video of translated words, in order to compensate the cognitive hearing deficit of deaf people. Results and Conclusion The accuracy of the proposed translation model has been evaluated manually and automatically. Quantitative results reveal a very promising Bilingual Evaluation Understudy (BLEU) score of 0.78. Subjective evaluations demonstrate that the system can compensate for the cognitive hearing deficit of end users through the system output expressed as a readily interpretable avatar. Comparative analysis shows that our proposed system works well for simple sentences but struggles to translate compound and compound complex sentences correctly, which warrants future ongoing research. Keywords: machine translation, natural language processing, deaf people communication, Pakistan sign language, cognition, rule‐based translation.
9. Khawaja, I. A., Abid, A., Farooq, M. S., Shahzada, A., Farooq, U., & Abid, K. (2020). Ad‐Hoc Collaboration Space for Distributed Cross Device Mobile Application Development. IEEE Access, 8, 62800‐62814. doi: 10.1109/ACCESS.2020.2980319. (Imran Abbas Khawaja, Adnan Abid, Muhammad Shoaib Farooq, Adnan Shahzada (Computer Science/SST) Uzma Farooq (Software Engineering/SST) Abstract: In last few years, a tremendous increase has been observed in the usage of portable electronic devices including smart phones, tablets, laptops, and wearables. These devices are produced by different manufacturers and work on different platforms. People surrounded by these devices need to interact with them during the meeting, presentation, class room and lots of other collaborative activities to share and receive information across the devices. Recent research trends lead towards better utilization of these mobile devices by connecting them together, whereas the interaction among these devices is still device centric and is dependent on expensive fixed software and hardware infrastructure. However, ad‐hoc settings, where fixed infrastructure services do not exist, or may suspend the interaction across these devices, require specialized collaborative space. This research presents an architectural framework, named Ad‐hoc Collaborative Space (ACS) that provides an abstraction layer by hiding the complexities of ad‐hoc environment thus resulting into reduced application development time by Research Outlook 2020 | 94
providing the easy to use API's. The experimental evaluation based on different operating parameters shows that the proposed framework efficiently manages service registration, service discovery, synchronization, and connectivity between different devices. Keywords: cross‐device, collaborative applications, distributed interface, wifi direct, ad‐hoc network, ad‐hoc collaboration space.
10. Obaid, I., Farooq, M. S., & Abid, A. (2020). Gamification for Recruitment and Job Training: Model, Taxonomy, and Challenges. IEEE Access, 8, 65164‐65178. doi: 10.1109/ACCESS.2020.2984178. (Iqra Obaid, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: The recruitment, engagement, and training of the employees are among the core and critical roles for running an organization successfully. Gamification has been proven to be a promising tool that offers many innovative solutions for various domains. This study presents a systematic literature review (SLR) of research studies involving gamification for recruitment, engagement, and training of employees. The SLR has been synthesized by reviewing carefully selected research studies published between 2014 and 2019 in well‐reputed venues. Apart from reviewing the state‐of‐the‐art studies on gamified solutions for recruiting and job training problems, a taxonomy of gaming elements based on the context of use in different environments has also been proposed. Similarly, the gamification model to develop gamified solutions to problems has also been presented. Lastly, the research gaps in terms of open issues have been presented to provide future directions for the researchers in the area of gamified solutions for recruitment and job training. Keywords: gamification, recruitment, employee engagement, employee training, gaming elements.
11. Aziz, O., Farooq, M. S., Abid, A., Saher, R., & Aslam, N. (2020). Research Trends in Enterprise Service Bus (ESB) Applications: A Systematic Mapping Study. IEEE Access, 8, 31180‐31197. doi: 10.1109/ACCESS.2020.2972195. (Omer Aziz, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: In recent years, enterprise service bus (ESB) has become a favorable adoption as a technology category in the IT industry as it provides secure and guaranteed delivery of services. The elasticity of Enterprise Service Bus (ESB) enables numerous applications to exchange information makes it a significant middleware layer responsible for transferring information in a Service‐Oriented Architecture (SOA). ESB is presently the utmost promising tactic for the integration of business applications in distributed and diverse environments. It also offers essential infrastructure support for transforming messages or data, intelligent routing, and protocol transformation. The idea of ESBs emerged from the requirements to move out from traditional integration patterns, that becomes difficult to manage with the passage of time. Our study aim is to understand and provide ongoing research topics, challenges and future directions concerning ESB applications. A systematic mapping study (SMS) is therefore implemented to categorize the selected papers into the following classification: contribution type, ESB applications, research type and their approaches. We have extracted a total of twenty‐ two papers for this systematic study and they are classified according to defined criteria. The findings of this SMS are discussed and researchers were provided with suggestions on possible directions for future research. Keywords: Enterprise service bus (ESB), applications, classification, service oriented architecture (SOA), systematic mapping study (SMS), criteria.
12. Ishaq, K., Zin, N. A. M., Rosdi, F., Abid, A., & Ali, Q. (2020). Usefulness of Mobile Assisted Language Learning in Primary Education. (IJACSA) International Journal of Advanced Computer Science and Applications, 11(1), 384‐395. (Adnan Abid, Qasim Ali (Computer Science/SST) Abstract: Literacy & Numeracy Drive (LND) is a mobile application that is used in public sector primary schools in Punjab province, Pakistan to teach students of Grade 03 on a tablet for learning languages and Mathematics. Persons designated the role of a Monitoring & Evaluation Assistant (MEA) visit every school allocated by Research Outlook 2020 | 95
authorities once in a month and select 07‐10 students randomly to evaluate them on his own tablet by asking multiple questions related to English, Urdu and Mathematics. After the evaluation, MEA has to upload the result on the official portal for the respective school. This study aims to evaluate the effectiveness of LND for its usefulness, usability, accessibility, content, and assessments by involving students and teachers using this application in different schools. A mixedmethod study has been adopted in which 57 teachers and nearly 300 students from different locations of the district and from different schools have been selected, to measure the effectiveness of LND and evaluate the effectiveness with the help of interviews and questionnaires. The result reveals, in its current form, the LND application is not effective and needs improvement in usability, design, content, accessibility, infrastructure, and assessment. Furthermore, teachers recommend that game‐based learning consists of an interactive interface, phonics, animations. As the more interactive and attractive presentation of the content and variations in the assessment may increase students’ involvement and will make this application more effective and will produce good results. Keywords: literacy and numeracy drive, monitoring and evaluation assistant, assessment, usability, content, design, infrastructure.
13. Saba, A., Adeel, A., Waqar, H., Nouman, R., & Yaser, D. K. (2020). Identification of Lysine Carboxylation Sites in Proteins by Integrating Statistical Moments and Position Relative Features via General PseAAC. Current Bioinformatics, 15(5), 396‐407. doi: http://dx.doi.org/10.2174/1574893614666190723114923. (Saba Amanat, Adeel Ashraf, Waqar Hussain, Yaser Daanial Khan (Computer Science/SST) Nouman Rasool (Life Sciences/SSC) Abstract: Carboxylation is one of the most biologically important post‐translational modifications and occurs on lysine, arginine, and glutamine residues of a protein. Among all these three, the covalent attachment of the carboxyl group with the lysine side chain is the most frequent and biologically important type of carboxylation. For studying such biological functions, it is essential to correctly determine the lysine sites sensitive to carboxylation. Objective: Herein, we present a computational model for the prediction of the carboxylysine site which is based on machine learning. Methods: Various position and composition relative features have been incorporated into the PseAAC for construction of feature vectors and a neural network is employed as a classifier. The model is validated by jackknife, cross‐validation, self‐consistency, and independent testing. Results: The results of the self‐consistency test elaborated that model has 99.76% Acc, 99.76% Sp, 99.76% Sp, and 0.99 MCC. Using the jackknife method, prediction model validation gave 97.07% Acc, while for 10‐fold cross‐validation, prediction model validation gave 95.16% Acc. Conclusion: The results of independent dataset testing were 94.3% which illustrated that the proposed model has better performance as compared to the existing model PreLysCar; however, the accuracy can be improved further, in the future, due to the increasing number of carboxylysine sites in proteins. Keywords: Carboxylation, Carboxylysine, Statistical Moments, PseAAC, 5‐step rule.
14. Alsubhi, K., Ashraf, M. U., & Ilyas, I. (2020). HBLP: A Privacy Protection Framework for TIP Attributes in NTTP‐Based LBS Systems. IEEE Access, 8, 67718‐67734. doi: 10.1109/ACCESS.2020.2985659. (Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: Nowadays, location‐based services are being widely popularized due to their massive usage in current and emerging technologies. These services are based on searching out areas of interest which are likely to be accessed by users. Despite helping users worldwide, Location Based Services (LBSs) Systems endanger users' privacy because a user must provide personal information in order to use the services. Users thus become easy prey for assailants to access their social and personal lives. This problem is a giant issue for contemporary technologies because they are increasingly being used with the passage of time. Many existing solutions have attempted to resolve the challenges, but they face some serious dilemmas regarding the preservation of privacy. In order to address the privacy challenges in LBS systems, in this paper we have introduced a new Hierarchy Research Outlook 2020 | 96
Based Location Privacy (HBLP) model that protects the user's privacy, including the user's query time and identity and location information. The proposed model protects the user's privacy by using pseudo identity exchange, an aggregation protocol, and the concepts of Forest User (FU), Tree User (TU), and Child Users (CU) with k‐anonymity and t‐closeness, which is a reasonable combination for privacy provision for a user's query time, identity, and location. In order to evaluate the privacy protection level, we implemented the HBLP model in a Riverbed (Opnet) simulation and compared the results with existing state‐of‐the‐art privacy‐provisioning methods. The results showed that HBLP protected all the privacy attributes when a user interacts with an LBS system. Keywords: location based services, user privacy, NTTP, point of interest.
15. Ali, B., Tayyaba, S., Ashraf, M. W., Nawaz, M. W., Mushtaq, M. T., Akhlaq, M., & Wasim, M. F. (2020). Fuzzy simulation, synthesis, characterization and voltage measurements of zinc oxide nano‐rods based nanogenerators. Digest Journal of Nanomaterials & Biostructures (DJNB), 15(2), 289‐297. (Muhammad Tahir Mushtaq (Computer Science/SST) Abstract: Harvesting the mechanical energy from environment sources such as wavy motion of plant leaves and branches could power up the low power consumption electrical devices and sensors. Such low power energy harvesting devices will replace the batteries especially at the remote areas where the replacement of batteries is very expensive or sometimes impossible. An environment friendly nano generator using ZnO nanorods can be built easily and useful for energy generation. Although, performance of harvesting ZnO piezoelectric nanorods have gradually improved even then their power is insufficient for real devices. However, the integration of nanogenerator devices for energy harvesting into a single power source is necessary. Therefore, its simulation using MATLAB fuzzy logic and fabrication is presented in this paper with a very low error of 0.24 % which shows its excellence in performance by presenting new technique of energy generation with plant leave movement. The fabricated ZnO nano‐wires on aluminum substrate connected in series and parallel were also tested and the results are closely in contrast to the stimulated results. The nano‐generator shows an enhanced voltage when connected in series and a high current value when connected in parallel. The nano‐generator give a voltage of 0.695 mV when connected in series and a current density of 25 nA cm‐2when connected in parallel. Keywords: nano‐rods, nano‐generator, piezoelectric material, matlab, fuzzy logic controller, zinc oxide.
16. Ahmed, S., Asim, M. M., Mehmood, N. Q., Ali, M., & Shahzaad, B. (2020). Implementation of Class‐Based Low Latency Fair Queueing (CBLLFQ) Packet Scheduling Algorithm for HSDPA Core Network. KSII Transactions on Internet & Information Systems, 14(2). (Babar Shahzaad (Computer Science/SST) Abstract: To provide a guaranteed Quality of Service (QoS) to real‐time traffic in High‐Speed Downlink Packet Access (HSDPA) core network, we proposed an enhanced mechanism. For an enhanced QoS, a Class‐Based Low Latency Fair Queueing (CBLLFQ) packet scheduling algorithm is introduced in this work. Packet classification, metering, queuing, and scheduling using differentiated services (DiffServ) environment was the points in focus. To classify different types of real‐time voice and multimedia traffic, the QoS provisioning mechanisms use different DiffServ code points (DSCP).The proposed algorithm is based on traffic classes which efficiently require the guarantee of services and specified level of fairness. In CBLLFQ, a mapping criterion and an efficient queuing mechanism for voice, video and other traffic in separate queues are used. It is proved, that the algorithm enhances the throughput and fairness along with a reduction in the delay and packet loss factors for smooth and worst traffic conditions. The results calculated through simulation show that the proposed calculations meet the QoS prerequisites efficiently. Keywords: Packet Classification, Marking, Scheduling, QoS and DiffServ.
Research Outlook 2020 | 97
17. Ul‐Amin, R., Sventek, J., Mackenzie, L., & Abid, A. (2020). Smart and intelligent network selection approach to support location‐dependent and context‐aware service migration. Journal of Ambient Intelligence and Smart Environments, 12, 219‐237. doi: 10.3233/AIS‐200559. (Adnan Abid (Computer Science/SST) Abstract: Vehicular networking has gained considerable interest within the research community and industry. The automotive industry is supporting the notion of pervasive connectivity by agreeing to equip vehicles with devices required for vehicular ad hoc networking. Equipped with these devices, mobile nodes in vehicular ad hoc networks (VANETs) are capable of hosting many types of applications as services for other nodes in the network. This research focuses on addressing the challenges of location‐dependence, intermittent network connectivity and irregular network traffic flows in unplanned areas for VANETs to host and operate non‐safety‐critical VANETs services. We assume unplanned areas as the one that lack communication infrastructure and planning. Such areas observe irregular vehicular traffic on the roads as well as on the networks. This research investigates the shortcomings of location‐dependence, intermittent network connectivity and irregular network traffic flows and addresses them by exploiting location‐dependent service migration over an integrated network in an efficient and cost‐effective manner. Keywords: LDCAMS, cooperative & cost effective network selection algorithm (CACENSA), VANET deployment, VANET services, network Integration, WAVE, UMTS.
18. Mehrban, S., Nadeem, M. W., Hussain, M., Ahmed, M. M., Hakeem, O., Abbas, F., . . . Hassan, M. (2020). Towards Secure FinTech: A Survey, Taxonomy, and Open Research Challenges. IEEE Access, 8, 23391‐23406. doi: 10.1109/ACCESS.2020.2970430. (Sobia Mehrban, Muhammad Waqas Nadeem, Muzammil Hussain, Owais Hakeem, Fakhar Abbas, Mujtaba Hassan (Computer Science/SST) Abstract: Financial Technology (FinTech) has attracted a wide range of attention and is rapidly proliferating. As a result of its consistent growth new terms have been introduced in this domain. The term ‘FinTech’ is one such terminology. This term is used for describing various operations that are being frequently employed in the financial technology sector. These operations are usually practiced in enterprises or organizations and provide requested services by using Information Technology based applications. The term does take into account various other sensitive issues, like, security, privacy, threats, cyber‐attacks, etc. This is important to note that the development of FinTech is indebted to the mutual integration of different state of the art technologies, for example, technologies related to a mobile embedded system, mobile networks, mobile cloud computing, big data, data analytics techniques, and cloud computing etc. However, this technology is facing several security and privacy issues that are much needed to be addressed in order to improve the acceptability of this new technology among its users. In an effort to secure FinTech, this article provides a comprehensive survey of FinTech by reviewing the most recent as well as anticipated financial industry privacy and security issues. It provides a comprehensive analysis of current security issues, detection mechanisms and security solutions proposed for FinTech. Finally, it discusses future challenges to ensure the security and privacy of financial technology applications. Keywords: FinTech, security, privacy, cyber security, threats, fraud detection, internet of things.
19. Arooj, A., Farooq, M. S., Umer, T., Rasool, G., & Wang, B. (2020). Cyber Physical and Social Networks in IoV (CPSN‐ IoV): A Multimodal Architecture in Edge‐Based Networks for Optimal Route Selection Using 5G Technologies. IEEE Access, 8, 33609‐33630. doi: 10.1109/ACCESS.2020.2973461. (Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Humans are blessed with the intelligence to create links, develop semantic metaphors and models for reasoning; construct rules for decision making; and to form bounded loops for interaction, socialization and knowledge sharing. But machines are inadequate with these extraordinary abilities rather, numerous algorithms and mathematical models can be used to connect physical resources with cyberspaces to control objects and, Research Outlook 2020 | 98
develop cognitive learning for optimal decision making. Connected users and devices in closed virtual and physical proximity give direction towards the plethora of real‐world applications for physical, social and, cyber computing. Because of the increase in social media networking and 5G communication links offer real‐time crowdsourcing and sensing as a complementary base for information. Proceeding this idea, in this study we have proposed Cyber‐Physical and Social Networks (CPSN) for two fundamental operations in IoV (Internet of Vehicles) as CPSN‐IoV; (1) to define conceptual architecture of CPSN‐IoV for data‐oriented network for smart infrastructure and, (2) to create the significant virtual space where the instances of smart vehicles, devices, and things will have meaningful links with the real world objects where, CPSN‐IoV will evolve, emerge, compete, and collaborate with all connected objects to strengthen the decision making process. To investigate the potential impact of our proposed study, we have simulated the taxicab trajectory data of the urban city of Portugal in OMNeT++ for the in‐depth understanding of road topology, connected vehicles and things, and their traffic trends; and users’ social media streams in respective edge for efficient route planning. The results of simulation demonstrate that our proposed framework has the ability to achieve human‐machine intellectual association for managing the smart environment. Keywords: CPSN, data fusion, IoV, IoT, knowledge discovery.
20. Naeem, M. A., Mehmood, E., Malik, M. G., & Jamil, N. (2020). Optimizing Semi‐Stream CACHEJOIN for Near‐Real‐ Time Data Warehousing. Journal of Database Management (JDM), 31(1), 20‐37. doi:10.4018/JDM.2020010102. (Erum Mehmood (Computer Science/SST) Abstract: Streaming data join is a critical process in the field of near‐real‐time data warehousing. For this purpose, an adaptive semi‐stream join algorithm called CACHEJOIN (Cache Join) focusing non‐uniform stream data is provided in the literature. However, this algorithm cannot exploit the memory and CPU resources optimally and consequently it leaves its service rate suboptimal due to sequential execution of both of its phases, called stream‐ probing (SP) phase and disk‐probing (DP) phase. By integrating the advantages of CACHEJOIN, in this paper we present two modifications in it. First is called P‐CACHEJOIN (Parallel Cache Join) that enables the parallel processing of two phases in CACHEJOIN. This increases number of joined stream records and therefore improves throughput considerably. Second is called OP‐CACHEJOIN (Optimized Parallel Cache Join) that implements a parallel loading of stored data into memory while the DP phase is executing. We present the performance analysis of both of our approaches with existing CACHEJOIN empirically using synthetic skewed dataset. Keywords: Near‐real‐time data warehousing, Semi‐stream join, Service rate optimization.
21. Awais, M., Ali, I., Alghamdi, T. A., Ramzan, M., Tahir, M., Akbar, M., & Javaid, N. (2020). Towards Void Hole Alleviation: Enhanced GEographic and Opportunistic Routing Protocols in Harsh Underwater WSNs. IEEE Access, 8, 96592‐96605. doi: 10.1109/ACCESS.2020.2996367. (Muhammad Ramzan (Computer Science/SST) Abstract: Internet of Things enabled Underwater Wireless Sensor Networks (IoT‐UWSNs) are quite useful in monitoring different tasks including: from instrument monitoring to the climate recording and from pollution control to the prediction of natural disasters. However, there are some challenges, which affect the performance of a network, i.e., void hole occurrence, high Energy Consumption (EC) and low Packet Delivery Ratio (PDR). Therefore, in this work, two energy efficient routing protocols are proposed to maximize the PDR by minimizing the ratio of void hole occurrence. Scalability analysis of the proposed routing protocols is also performed. Additionally, feasible regions are computed to check the optimality of the proposed protocol in terms of EC. Furthermore, proposed protocols are compared with benchmark routing protocols in counterparts. Simulation results clearly show that proposed routing protocols achieved 80‐81% higher PDR than GEographic and opportunistic routing with Depth Adjustment based topology control for communication Recovery (GEDAR) and Transmission Adjustment Neighbor‐node Approaching Distinct Energy Efficient Mates (TA‐NADEEM). Moreover, the ratio of void hole occurrence is minimized upto 30% approximately. Research Outlook 2020 | 99
Keywords: underwater wireless sensor networks, Internet of Things enabled harsh underwater WSNs, energy hole alleviation, enhanced geographic and opportunistic routing. 22. Khan, Y. D., Amin, N., Hussain, W., Rasool, N., Khan, S. A., & Chou, K.‐C. (2020). iProtease‐PseAAC(2L): A two‐layer predictor for identifying proteases and their types using Chou's 5‐step‐rule and general PseAAC. Analytical Biochemistry, 588, 113477. doi: https://doi.org/10.1016/j.ab.2019.113477. doi: https://doi.org/10.1016/j.ab.2019.113477. (Yaser Daanial Khan, Najm Amin (Computer Science/SST) Abstract: Proteases are a type of enzymes, which perform the process of proteolysis. Proteolysis normally refers to protein and peptide degradation which is crucial for the survival, growth and wellbeing of a cell. Moreover, proteases have a strong association with therapeutics and drug development. The proteases are classified into five different types according to their nature and physiochemical characteristics. Mostly the methods used to differentiate protease from other proteins and identify their class requires a clinical test which is usually time‐ consuming and operator dependent. Herein, we report a classifier named iProtease‐PseAAC (2L) for identifying proteases and their classes. The predictor is developed employing the flow of 5‐step rule, initiating from the collection of benchmark dataset and terminating at the development of predictor. Rigorous verification and validation tests are performed and metrics are collected to calculate the authenticity of the trained model. The self‐consistency validation gives the 98.32% accuracy, for cross‐validation the accuracy is 90.71% and jackknife gives 96.07% accuracy. The average accuracy for level‐2 i.e. protease classification is 95.77%. Based on the above‐ mentioned results, it is concluded that iProtease‐PseAAC (2L) has the great ability to identify the proteases and their classes using a given protein sequence. Keywords: Protease, PseAAC, statistical moments, 5‐step rule, prediction.
23. Omer, U., Muhammad Shoaib, F., & Abid, A. (2020). Cognitive Learning Analytics Using Assessment Data and Concept Map: A Framework‐Based Approach for Sustainability of Programming Courses. Sustainability, 12(17), 6990. doi: http://dx.doi.org/10.3390/su12176990. (Uzma Omer, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: Students of initial level programming courses generally face difficulties while learning the programming concepts. The learning analytics studies, in these courses, are mostly anecdotal on the aspect of assessment as less or no attention is given to assess learning at various cognitive levels of specific concepts. Furthermore, the existing work reflects deficiencies in examining the effect of learners’ cognitive performance on subsequent stages of the course. This gap needs to be addressed by introducing more granular and methodical approaches of cognitive analysis for sustaining the programming courses effectively in computer science and associated disciplines. In this article, a framework‐based approach is proposed for cognitive learning analytics on the concepts taught in initial level programming courses. The framework serves as a platform that provides structure to the concept data using the technique of concept mapping and examines learners’ cognitive propagation on related concepts using assessment data. Learners’ performance prediction has been examined on relatively higher‐level programming concepts through the metrics established from the cognitive maps of learners, acquired by deploying the related layers of framework. Overall maximum prediction accuracy range obtained was 64.81% to 90.86%, which was better than the prediction accuracies presented in most of the related studies. Keywords: learning analytics, sustainability, cognition, programming, performance prediction.
24. Manzoor, A., Ahmad, W., Ehatisham‐ul‐Haq, M., Hannan, A., Khan, M. A., Ashraf, M. U., . . . Alfakeeh, A. S. (2020). Inferring Emotion Tags from Object Images Using Convolutional Neural Network. Applied Sciences, 10(15), 5333. doi: http://dx.doi.org/10.3390/app10155333. (Abdul Hannan, Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: Emotions are a fundamental part of human behavior and can be stimulated in numerous ways. In real‐ life, we come across different types of objects such as cake, crab, television, trees, etc., in our routine life, which Research Outlook 2020 | 100
may excite certain emotions. Likewise, object images that we see and share on different platforms are also capable of expressing or inducing human emotions. Inferring emotion tags from these object images has great significance as it can play a vital role in recommendation systems, image retrieval, human behavior analysis and, advertisement applications. The existing schemes for emotion tag perception are based on the visual features, like color and texture of an image, which are poorly affected by lightning conditions. The main objective of our proposed study is to address this problem by introducing a novel idea of inferring emotion tags from the images based on object‐related features. In this aspect, we first created an emotion‐tagged dataset from the publicly available object detection dataset (i.e., “Caltech‐256”) using subject evaluation from 212 users. Next, we used a convolutional neural network‐based model to automatically extract the high‐level features from object images for recognizing nine (09) emotion categories, such as amusement, awe, anger, boredom, contentment, disgust, excitement, fear, and sadness. Experimental results on our emotion‐tagged dataset endorse the success of our proposed idea in terms of accuracy, precision, recall, specificity, and F1‐score. Overall, the proposed scheme achieved an accuracy rate of approximately 85% and 79% using top‐level and bottom‐level emotion tagging, respectively. We also performed a gender‐based analysis for inferring emotion tags and observed that male and female subjects have discernment in emotions perception concerning different object categories. Keywords: emotion recognition, convolutional neural network, deep learning, image emotion analysis, object categorization.
25. Hussain, A., Draz, U., Ali, T., Tariq, S., Irfan, M., Glowacz, A., . . . Rahman, S. (2020). Waste Management and Prediction of Air Pollutants Using IoT and Machine Learning Approach. Energies, 13(15), 1‐22. (Ayaz Hussain, Saman Tariq (Computer Science) (SKT Campus) Abstract: Increasing waste generation has become a significant issue over the globe due to the rapid increase in urbanization and industrialization. In the literature, many issues that have a direct impact on the increase of waste and the improper disposal of waste have been investigated. Most of the existing work in the literature has focused on providing a cost‐efficient solution for the monitoring of garbage collection system using the Internet of Things (IoT). Though an IoT‐based solution provides the real‐time monitoring of a garbage collection system, it is limited to control the spreading of overspill and bad odor blowout gasses. The poor and inadequate disposal of waste produces toxic gases, and radiation in the environment has adverse effects on human health, the greenhouse system, and global warming. While considering the importance of air pollutants, it is imperative to monitor and forecast the concentration of air pollutants in addition to the management of the waste. In this paper, we present and IoT‐based smart bin using a machine and deep learning model to manage the disposal of garbage and to forecast the air pollutant present in the surrounding bin environment. The smart bin is connected to an IoT‐based server, the Google Cloud Server (GCP), which performs the computation necessary for predicting the status of the bin and for forecasting air quality based on real‐time data. We experimented with a traditional model (k‐nearest neighbors algorithm (k‐NN) and logistic reg) and a non‐traditional (long short term memory (LSTM) network‐based deep learning) algorithm for the creation of alert messages regarding bin status and forecasting the amount of air pollutant carbon monoxide (CO) present in the air at a specific instance. The recalls of logistic regression and k‐NN algorithm is 79% and 83%, respectively, in a real‐time testing environment for predicting the status of the bin. The accuracy of modified LSTM and simple LSTM models is 90% and 88%, respectively, to predict the future concentration of gases present in the air. The system resulted in a delay of 4 s in the creation and transmission of the alert message to a sanitary worker. The system provided the real‐time monitoring of garbage levels along with notifications from the alert mechanism. The proposed works provide improved accuracy by utilizing machine learning as compared to existing solutions based on simple approaches. Keywords: internet of Things, air monitoring, forecasting, air pollutant, smart bin, machine learning.
Research Outlook 2020 | 101
26. Khan, J. A., Irfan, M., Irawan, S., Yao, F. K., Rahaman, M. S. A., Shahari, A. R., . . . Zeb, N. (2020). Comparison of Machine Learning Classifiers for Accurate Prediction of Real‐Time Stuck Pipe Incidents. Energies, 13(14), 1‐26. (Nazia Zeb (Computer Science/SST) Abstract: Stuck pipe incidents are one of the contributors to non‐productive time (NPT), where they can result in a higher well cost. This research investigates the feasibility of applying machine learning to predict events of stuck pipes during drilling operations in petroleum fields. The predictive model aims to predict the occurrence of stuck pipes so that relevant drilling operation personnel are warned to enact a mitigation plan to prevent stuck pipes. Two machine learning methodologies were studied in this research, namely, the artificial neural network (ANN) and support vector machine (SVM). A total of 268 data sets were successfully collected through data extraction for the well drilling operation. The data also consist of the parameters with which the stuck pipes occurred during the drilling operations. These drilling parameters include information such as the properties of the drilling fluid, bottom‐hole assembly (BHA) specification, state of the bore‐hole and operating conditions. The R programming software was used to construct both the ANN and SVM machine learning models. The prediction performance of the machine learning models was evaluated in terms of accuracy, sensitivity and specificity. Sensitivity analysis was conducted on these two machine learning models. For the ANN, two activation functions—namely, the logistic activation function and hyperbolic tangent activation function—were tested. Additionally, all the possible combinations of network structures, from [19, 1, 1, 1, 1] to [19, 10, 10, 10, 1], were tested for each activation function. For the SVM, three kernel functions—namely, linear, Radial Basis Function (RBF) and polynomial—were tested. Apart from that, SVM hyper‐parameters such as the regularization factor (C), sigma (σ) and degree (D) were used in sensitivity analysis as well. The results from the sensitivity analysis demonstrate that the best ANN model managed to achieve an 88.89% accuracy, 91.89% sensitivity and 86.36% specificity, whereas the best SVM model managed to achieve an 83.95% accuracy, 86.49% sensitivity and 81.82% specificity. Upon comparison, the ANN model is the better machine learning model in this study because its accuracy, sensitivity and specificity are consistently higher than those of the best SVM model. In conclusion, judging from the promising prediction accurateness as demonstrated in the results of this study, it is suggested that stuck pipe prediction using machine learning is indeed practical. Keywords: artificial neural networks, drilling operation, machine learning classifiers, RBF Kernel function, stuck pipe, support vector machines, sensitivity analysis.
27. Tehseen, R., Farooq, M. S., & Abid, A. (2020). Fuzzy Expert System for Earthquake Prediction in Western Himalayan Range. Elektronika Ir Elektrotechnika, 26(3), 4‐12. https://doi.org/10.5755/j01.eie.26.3.25744. (Rabia Tehseen, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: Fuzzy Expert System (FES) with application to earthquake prediction has been presented to reproduce the performance of a human expert in earthquake prediction using expert systems. This research aims to predict future earthquakes having a magnitude 5.5 or greater. Previous earthquake data from 2000 to 2019 have been collected for this purpose. Since the earthquake data for the specified region have been reported on different magnitude scales, suitable relationships were determined to obtain uniform data. The uniform data have been used to calculate seismicity indicators according to the guidelines provided by Gutenberg‐Richter’s scale for quantitative determination of earthquake features. The relationships among these seismic indicators have been used by the human expert to set the rule base of Fuzzy expert system. These rules have been mathematically validated and tested on instrumentally recorded earthquake data. The results obtained from the proposed FES presented 47 % accuracy in predicting future earthquakes that may occur in the 100 km radial area from 34.708 ° N, 72.5478 ° E. Keywords: expert system, fuzzy logic, earthquake prediction, seismic data.
Research Outlook 2020 | 102
28. Alsubhi, K., Imtiaz, Z., Raana, A., Ashraf, M. U., & Hayat, B. (2020). MEACC: an energy‐efficient framework for smart devices using cloud computing systems. Frontiers of Information Technology & Electronic Engineering, 21(6), 917‐930. doi: 10.1631/FITEE.1900198. (Zuhaib Imtiaz, Ayesha Raana, Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: Rapidly increasing capacities, decreasing costs, and improvements in computational power, storage, and communication technologies have led to the development of many applications that carry increasingly large amounts of traffic on the global networking infrastructure. Smart devices lead to emerging technologies and play a vital role in rapid evolution. Smart devices have become a primary 24/7 need in today’s information technology world and include a wide range of supporting processing‐intensive applications. Extensive use of many applications on smart devices results in increasing complexity of mobile software applications and consumption of resources at a massive level, including smart device battery power, processor, and RAM, and hinders their normal operation. Appropriate resource utilization and energy efficiency are fundamental considerations for smart devices because limited resources are sporadic and make it more difficult for users to complete their tasks. In this study we propose the model of mobile energy augmentation using cloud computing (MEACC), a new framework to address the challenges of massive power consumption and inefficient resource utilization in smart devices. MEACC efficiently filters the applications to be executed on a smart device or offloaded to the cloud. Moreover, MEACC efficiently calculates the total execution cost on both the mobile and cloud sides including communication costs for any application to be offloaded. In addition, resources are monitored before making the decision to offload the application. MEACC is a promising model for load balancing and power consumption reduction in emerging mobile computing environments. Keywords: offloading, smart devices, cloud computing, mobile computing, power consumption.
29. Malik, H., Farooq, M. S., Khelifi, A., Abid, A., Qureshi, J. N., & Hussain, M. (2020). A Comparison of Transfer Learning Performance Versus Health Experts in Disease Diagnosis From Medical Imaging. IEEE Access, 8, 139367‐ 139386. doi: 10.1109/ACCESS.2020.3004766. (Hassaan Malik, Muhammad Shoaib Farooq, Adnan Abid, Junaid Nasir Qureshi, Muzammil Hussain (Computer Science/SST) Abstract: Deep learning methods have huge success in task specific feature representation. Transfer learning algorithms are very much effective when large training data is scarce. It has been significantly used for diagnosis of diseases in medical imaging. This article presents a systematic literature review (SLR) by conducting a comparison of a variety of transfer learning approaches with healthcare experts in diagnosing diseases from medical imaging. This study has been compiled by reviewing research studies published in renowned venues between 2014 and 2019. Moreover, the data for the diagnosis performed by health care experts has also been acquired to perform a detailed comparative analysis for a wide range of diseases. The analysis has been performed on the basis of diseases, transfer learning approaches, type of medical imaging used. The comparative analysis is based on performance indices reported in studies which include diagnostic accuracy, true‐positive (TP), false‐ positive (FP), true‐negative (TN), false‐negative (FN) sensitivity, specificity, and the area under the receiver operating characteristic curve (AUROC). A total of5,188articles were identified out of which 63 studies were included. Among them 21 research studies contain sufficient data to construct the evaluation tables that enable process of test accuracy of transfer learning having sensitivity ranged from 71% to 100% (mean 85.25%) and specificity ranged from 64% to 100% (mean 81.92%). Furthermore, health experts having sensitivity ranged from 33% to 100% (mean 85.27%) and specificity ranged from 82% to 100% (mean 91.63%).This SLR found that diagnostic accuracy of transfer learning is approximately equivalent to the diagnosis of health experts. The results also revealed that convolutional neural networks (CNN) have been extensively used for disease diagnosis from medical imaging. Finally, inappropriate exposure of diseases in transfer learning studies restricts reliable elucidation of the outcomes of diagnostic accuracy. Keywords: transfer learning, heath experts, disease, medical imaging, SLR. Research Outlook 2020 | 103
30. Vistro, D. M., Attique‐Ur‐Rehman, Farooq, M. S., Abid, A., Idrees, M. (2020). Bayesian Net Password Strength Checker for Security Analysis of Cloud‐based Application. Journal of Advanced Research in Dynamical and Control Systems, 12(7), 1599‐1602. doi: 10.5373/JARDCS/V12SP7/20202263. (Attique‐Ur‐Rehman, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: Cloud computing plays an important role in modern world automation and digitalization. On one hand, now a days where people are able to perform their different kind of computing tasks with just one click, on the other hand they face a lot of security threats as the cyber criminals are also busy and active for 24 hours on cloud‐ based system for different purposes. So, the password is the main significant key which provides base to secure oneself from evil eyes while performing the cloud‐based activities. The proposed approach of this article is BNPSC (Bayesian Net Password strength checker), the AI based method is used to compute the complexity of password. For this purpose, the Bayesian net machine learning algorithm is used. The independent set test accuracy of proposed model is 100% and trained accuracy of proposed model is 99%. For simulation and results the dataset is taken from Kaggle. Keywords: AI, Cloud, Cloud Computing, Cloud Security, Password Complexity.
31. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. S., Idrees, M. (2020). Iot based big data analytics for cloud storage using edge computing. Journal of Advanced Research in Dynamical and Control Systems, 12(7), 1594‐1598. doi: 10.5373/JARDCS/V12SP7/20202262. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Deep Learning which is enhanced from machine learning is now associated with different applications have been provided its best to people and worked much better in the benefit of people. IoT (Internet of things) based smart devices like IoV (Internet of vehicles), sensors and cloud computing which are using deep learning algorithms needs efficient data storage and fast data transfer rate. However, we have seen that the techniques like edge computing which provides many benefits not used to cloud platform. Cloud computing using Big‐data analytics needs fast data transmission. Due to this reason high performance, Iot based devices, which needs huge data after every millisecond becomes slower and not able to give high performance. To tackle these issues edge computing will help us to increase the performance of different devices. Keywords: big‐data analytics, cloud computing, deep learning, edge computing, internet of things, internet of vehicles, mobile computing, sensors.
32. Mehmood, E., Abid, A., Farooq, M. S., & Nawaz, N. A. (2020). Curriculum, Teaching and Learning, and Assessments for Introductory Programming Course. IEEE Access, 8, 125961‐125981. doi: 10.1109/ACCESS.2020.3008321. (Erum Mehmood, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Learning to program involves acquisition of various skills including problem solving, fundamental design techniques as well as critical thinking. Generally, most of the novice programmers struggle to develop all these important skill. The research community has addressed the problem in many different ways while involving improvisations in curriculum, pedagogical methods, cognitive aspects, supporting tools, and in designing assessments. This research aims to analyze and synthesize the existing literature in the aforementioned areas. Research articles pertaining to the area of Introductory Programming Courses (IPC) have been found using appropriate search queries, while nearly 60 research articles, published in last ten years, have been carefully selected by employing a systematic filtering process. The scope of this work only covers the research conducted for IPC in higher education. Main findings of this study show that “solution proposal” and “evaluation research” have been reported as two main research types adopted by these studies. Moreover, pedagogy, language choice and students' performance analysis are the most frequently addressed aspects of IPC; whereas, curriculum contents, assessment design, and teaching/learning through tools have appeared as less addressed aspects of IPC.
Research Outlook 2020 | 104
Furthermore, a taxonomy of IPC has been presented based on the studied literature. Lastly, general considerations and future research directions have been presented for the practitioners and researchers in this area. Keywords: Introductory programming, higher education, programming education curriculum, language choice, systematic review.
33. Ishaq, K. M., Azan, N., Rosdi, F., Abid, A., & Ali, Q. (2020). Usability of Mobile Assisted Language Learning App. International Journal of Advanced Computer Science and Applications, 11(1). 354‐363. (Adnan Abid, Qasim Ali (Computer Science/SST) Abstract: The aim of this study is to evaluate the usability of Mobile Assisted Language Learning i.e. Literacy and Numeracy Drive (LND) which is smartphone application to learn language and mathematics in public sector primary schools of Punjab, the biggest province of Pakistan. In this study, usability tests were conducted which included surveys of questionnaires from teachers and students. The user experience, reliability, and performance of mobile application assessed, along with user satisfaction. The LND mobile application has not been found to be successful, with a poor user interface and requires improvement. The "Using Experience," "Ease of Use" and "Usefulness" variables have been the lowest scorers in terms of user experience. Mobile device specifications were not simple and confusing; the services provided by the LND were not appealing and effective for students or teachers. This research suggested several improvements in the usability and functionality of this LND application based on assessed user experience. Many schools have chosen to use mobile apps for the teaching and evaluation of language at school. The use of mobile‐assisted learning at public sector schools in Punjab, invites us to gauge the usability and effectiveness of this approach at such a huge scale which will make it more effective. Keywords: Literacy and numeracy drive, usability, user experience, mobile app, assessment, public school.
34. Ishaq, K., Rosdi, F., Zin, N. A. M., & Abid, A. (2020). Usability and Design Issues of Mobile Assisted Language Learning Application. (IJACSA) International Journal of Advanced Computer Science and Applications, 11(6). 86‐94. (Adnan Abid (Computer Science/SST) Abstract: This paper aims to look at teachers, government officials, and students for Literacy & Numeracy Drive (LND), a smartphone app for students in Punjab province, Pakistan, to teach languages and math. Furthermore, to recognize LND usability and design problems while its use for grade three in schools. As the usability and design issues of LND were not discussed since the launch of this application. The methodology for this study is the questionnaire for teachers and semi‐structured interviews for government officials of District Sheikhupura and students. The result shows that LND has various usability and design problems in its current form, i.e., buttons, icons, color schemes, sluggish performance, and fonts. Besides, teachers, government officials, and students suggested that game‐based learning consists of an interactive interface, phonics, key animations to be created and adopted. Highly engaging and appealing delivery of the curriculum and improvements in the appraisal will improve the participation of students and deliver better outcomes. Keywords: educational technology, language learning, literacy and numeracy drive, mobile application (app), m‐ learning, usability, user interface design.
35. Naeem, A., Farooq, M. S., Khelifi, A., & Abid, A. (2020). Malignant Melanoma Classification Using Deep Learning: Datasets, Performance Measurements, Challenges and Opportunities. IEEE Access, 8, 110575‐110597. doi: 10.1109/ACCESS.2020.3001507. (Ahmad Naeem, Muhammad Shoaib Farooq, Adnan Abid (Computer Science/SST) Abstract: Melanoma remains the most harmful form of skin cancer. Convolutional neural network (CNN) based classifiers have become the best choice for melanoma detection in the recent era. The research has indicated that classifiers based on CNN classify skin cancer images equivalent to dermatologists, which has allowed a quick and life‐saving diagnosis. This study provides a systematic literature review of the latest research on melanoma Research Outlook 2020 | 105
classification using CNN. We restrict our study to the binary classification of melanoma. In particular, this research discusses the CNN classifiers and compares the accuracies of these classifiers when tested on non‐published datasets. We conducted a systematic review of existing literature, identifying the literature through a systematic search of the IEEE, Medline, ACM, Springer, Elsevier, and Wiley databases. A total of 5112 studies were identified out of which 55 well‐reputed studies were selected. The main objective of this study is to collect state of the art research which identify the recent research trends, challenges and opportunities for melanoma diagnosis and investigate the existing solutions for the diagnosis of melanoma detection using deep learning. Moreover, proposed taxonomy for melanoma detection has been presented that summarizes the broad variety of existing melanoma detection solutions. Lastly, proposed model, challenges and opportunities have been presented which helps the researchers in the domain of melanoma detection. Keywords: deep learning, CNN, skin cancer, melanoma, detection, diagnosis.
36. Attique, M., Farooq, M. S., Khelifi, A., & Abid, A. (2020). Prediction of Therapeutic Peptides Using Machine Learning: Computational Models, Datasets, and Feature Encodings. IEEE Access, 8, 148570‐148594. doi: 10.1109/ACCESS.2020.3015792. (Muhammad Attique, Muhammad Shoaib Farooq, Adnan Abid(Computer Science/SST) Abstract: Peptides, short‐chained amino acids, have shown great potentials toward the investigation and evolution of novel medications for treatment or therapy. The wet‐lab based discovery of potential therapeutic peptides and eventually drug development is a hard and time‐consuming process. The computational prediction using machine learning (ML) methods can expedite and facilitate the discovery process of potential prospects with therapeutic effects. ML approaches have been practiced favorably and extensively within the area of proteins, DNA, and RNA to discover the hidden features and functional activities, moreover, recently been utilized for functional discovery of peptides for various therapeutics. In this paper, a systematic literature review (SLR) has been presented to recognize the data‐sources, ML classifiers, and encoding schemes being utilized in the state‐of‐ the‐art computational models to predict therapeutic peptides. To conduct the SLR, fourty‐one research articles have been selected carefully based on well‐defined selection criteria. To the best of our knowledge, there is no such SLR available that provides a comprehensive review in this domain. In this article, we have proposed a taxonomy based on identified feature encodings, which may offer relational understandings to researchers. Similarly, the framework model for the computational prediction of the therapeutic peptides has been introduced to characterize the best practices and levels involved in the development of peptide prediction models. Lastly, common issues and challenges have been discussed to facilitate the researchers with encouraging future directions in the field of computational prediction of therapeutic peptides. Keywords: anti‐angiogenic, anti‐cancer, anti‐inflammatory, anti‐microbial, feature extraction, encodings, machine learning, peptide therapeutics.
37. Ashraf, M. U., Jambi, K. M., Arshad, A., Aslam, R., & Ilyas, I. (2020). M2C: A Massive Performance and Energy Throttling Framework for High‐Performance Computing Systems. (IJACSA) International Journal of Advanced Computer Science and Applications, 11(7). 529‐541. (Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: At the Petascale level of performance, HighPerformance Computing (HPC) systems require significant use of supercomputers with the extensive parallel programming approaches to solve the complicated computational tasks. The Exascale level of performance having 1018 calculations per second is another remarkable achievement in computing with a fathomless influence on everyday life. The current technologies are facing various challenges while achieving ExaFlop performance through energy‐efficient systems. Massive parallelism and power consumption are vital challenges for achieving ExaFlop performance. In this paper, we have introduced a novel parallel programming model that provides massive performance under power Research Outlook 2020 | 106
consumption limitations by parallelizing data on the heterogeneous system to provide coarse grain and fine‐grain parallelism. The proposed dual‐hierarchical architecture is a hybrid of MVAPICH2 and CUDA, called the M2C model, for heterogeneous systems that utilize both CPU and GPU devices for providing massive parallelism. To validate the objectives of the current study, the proposed model has been implemented using bench‐marking applications including linear Dense Matrix Multiplication. Furthermore, we conducted a comparative analysis of the proposed model by existing state‐ofthe‐art models and libraries such as MOC, kBLAS, and cuBLAS. The suggested model outperforms existing models while achieving massive performance in HPC clusters and can be considered for emerging Exascale computing systems. Keywords: high performance computing, exascale computing, compute unified device architecture.
38. Ashraf, M. U., Jambi, K. M., Qayyum, R., Ejaz, H., & Ilyas, I. (2020). IDP: A privacy provisioning framework for TIP attributes in trusted third party‐based location‐based services systems. (IJACSA) International Journal of Advanced Computer Science and Applications, 11(7). 604‐617. (Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: Location‐Based Services (LBS) System is rapidly growing due to radio communication services with wireless mobile devices having a positioning component in it. LBS System offers location‐based services by knowing the actual user position. A mobile user uses LBS to access services relevant to their locations. In order to provide Point of Interest (POI), LBS confronts numerous privacy related challenges in three different formats including Non‐Trusted Third Party (NTTP), Trusted Third Party (TTP), and Mobile Peer‐to‐Peer (P2P). The current study emphasized the TTP based LBS system where the Location server does not provide full privacy to mobile users. In TTP based LBS system, a user’s privacy is concerned with personal identity, location information, and time information. In order to accomplish privacy under these concerns, state‐of‐the‐art existing mechanisms have been reviewed. Hence, the aim to provide a promising roadmap to research and development communities for the right selection of privacy approach has achieved by conducting a comparative survey of the TTP based approaches. Leading to these privacy attributes, the current study addressed the privacy challenge by proposing a new privacy protection model named “Improved Dummy Position” (IDP) that protects TIP (Time, Identity, and Position) attributes under TTP LBS System. In order to validate the privacy level, a comparative analysis has been conducted by implementing the proposed IDP model in the simulation tool, Riverbed Modeler academic edition. The different scenarios of changing query transferring rate evaluate the performance of the proposed model. Simulation results demonstrate that our IDP could be considered as a promising model to protect user’s TIP attributes in a TTP based LBS system due to better performance and improved privacy level. Further, the proposed model extensively compared with the existing work. Keywords: Location Based Services (LBS), Trusted Third Party (TTP), privacy protection goals, mobile user privacy, Improved Dummy Position (IDP), Sybil Query.
39. Tariq, S., Ahmad, N., Ashraf, M. U., Alghamdi, A. M., & Alfakeeh, A. S. (2020). Measuring the Impact of Scope Changes on Project Plan Using EVM. IEEE Access, 8, 154589‐154613. doi: 10.1109/ACCESS.2020.3018169. (Saman Tariq, Muhammad Usman Ashraf (Computer Science) (SKT Campus) Abstract: Earned Value Management (EVM) measures project performance against a baseline plan. It identifies deviations in budget and schedule, aids project managers in taking earlier corrective actions against cost and schedule overruns. Although the literature highlights the significance of scope by adopting it as a leading indicator to measure project success or failure. However, EVM does not include scope when evaluating the performance of any software project. While considering the importance of scope and its ever‐changing nature, it is imperative to measure the effect of changes in scope on the project plan. To analyse such effects, this study aims to enhance the traditional EVM by incorporating scope into it. The main objectives of this paper are: i) to extract the effects of project scope changes, ii) to map extracted effects of project scope changes with Software Project Scope Rating Research Outlook 2020 | 107
Index (SPSRI) elements, and iii) to quantify the extracted effects and integrate them with EVM. An extensive literature review is conducted to achieve the first objective, which results in the seventeen unique effects; that were used to map with SPSRI elements. To forecast the variations in scope for a given project budget, Monte Carlo simulations were run on the top eight scope elements, whereas, the results were incorporated with EVM to identify the deviations between actual and projected values of scope’s score and cost. Finally, the multivariate regression model was used to evaluate the influence of individual element on the overall estimated cost of the project. The correlation between the independent variables (SPSRI elements) and the dependent variable (overall cost) was calculated along with the valuation of each independent variable on the dependent variable. Moreover, the effects are statistically shown that independent variables have influenced the dependent variable. This technique could assist the project managers to forecast deviations in project scope earlier. Keywords: earned value management, project monitoring and controlling, software project scope rating index, monte carlo simulations.
40. Khalid, H., Hussain, M., Al Ghamdi, M. A., Khalid, T., Khalid, K., Fatima, K., Farooq, M. S., . . . Ahmed, A. (2020). A Comparative Systematic Literature Review on Knee Bone Reports from MRI, X‐rays and CT Scans Using Deep Learning and Machine Learning Methodologies. Diagnostics (Basel, Switzerland), 10(8). doi:10.3390/diagnostics10080518. (Hafsa Khalid, Muzammil Hussain, Kalsoom Fatima, Muhammad Shoaib Farooq(Computer Science/SST) Abstract: The purpose of this research was to provide a “systematic literature review” of knee bone reports that are obtained by MRI, CT scans, and X‐rays by using deep learning and machine learning techniques by comparing different approaches—to perform a comprehensive study on the deep learning and machine learning methodologies to diagnose knee bone diseases by detecting symptoms from X‐ray, CT scan, and MRI images. This study will help those researchers who want to conduct research in the knee bone field. A comparative systematic literature review was conducted for the accomplishment of our work. A total of 32 papers were reviewed in this research. Six papers consist of X‐rays of knee bone with deep learning methodologies, five papers cover the MRI of knee bone using deep learning approaches, and another five papers cover CT scans of knee bone with deep learning techniques. Another 16 papers cover the machine learning techniques for evaluating CT scans, X‐rays, and MRIs of knee bone. This research compares the deep learning methodologies for CT scan, MRI, and X‐ray reports on knee bone, comparing the accuracy of each technique, which can be used for future development. In the future, this research will be enhanced by comparing X‐ray, CT‐scan, and MRI reports of knee bone with information retrieval and big data techniques. The results show that deep learning techniques are best for X‐ray, MRI, and CT scan images of the knee bone to diagnose diseases. Keywords: magnetic resonance imaging (MRI), computed tomography (CT scan), electromagnetic radiation (X‐ ray), trabecular bone (TB).
41. Sheraz, N., Waqar, H., Khan, Y. D., & Nouman, R. (2020). NPalmitoylDeep‐PseAAC: A Predictor of N‐Palmitoylation sites in Proteins using Deep Representations of Proteins and PseAAC via Modified 5‐steps Rule. Current Bioinformatics, 15, 1‐12. doi: http://dx.doi.org/10.2174/1574893615999200605142828. (Sheraz Naseer, Yaser Daanial Khan (Computer Science/SST) Abstract: Background: Among all the major Post‐translational modification, lipid modifications possess special significance due to their widespread functional importance in eukaryotic cells. There exist multiple types of lipid modifications and Palmitoylation, among them, is one of the broader types of modification, having three different types. The N‐Palmitoylation is carried out by attachment of palmitic acid to an N‐terminal cysteine. Due to the association of N‐Palmitoylation with various biological functions and diseases such as Alzheimer’s and other neurodegenerative diseases, carrying out important processes in the life cycle of various pathogens, its identification is very important. Research Outlook 2020 | 108
Objective: The in vitro, ex vivo and in vivo identification of Palmitoylation is laborious, time‐taking and costly. There is a dire need of an efficient and accurate computational model to help researchers and biologists identifying these sites, in an easy manner. Herein, we propose a novel prediction model for identification of N‐ Palmitoylation sites in proteins. Method: Proposed prediction model is developed by combining the Chou’s Pseudo Amino Acid Composition (PseAAC) with deep neural networks. We used well‐known deep neural networks (DNNs) for both the tasks of learning a feature representation of peptide sequences and developing prediction model to perform classification. Results: Among different DNNs, Gated Recurrent Unit (GRU) based RNN model showed highest scores in terms of accuracy, and all other computed measures, and outperforms all the previously reported predictors. Conclusion: The proposed GRU based RNN model can help identifying N‐Palmitoylation in a very efficient and accurate manner which can help scientists understand the mechanism of this modification in proteins. Keywords: N‐Palmitoylation, DNNs, Deep features, 5‐steps rule, PseAAC.
42. Naseer, S., Hussain, W., Khan, Y. D., & Rasool, N. (2020). Sequence‐based Identification of Arginine Amidation Sites in Proteins Using Deep Representations of Proteins and PseAAC. Current Bioinformatics, 15, 1‐12. (Sheraz Naseer, Yaser Daanial Khan (Computer Science/SST) Abstract: Background: Among all the major Post‐translational modification, amidation seems to be a small change, where a peptide ends with an amide group (‐NH 2), not a carboxyl group (‐COOH). Thus, to study their physicochemical properties, identification of amidation mechanism is very important. However, the in vitro, ex vivo and in vivo identification can be laborious, time‐taking and costly. There is a dire need of an efficient and accurate computational model to help researchers and biologists identifying these sites, in an easy manner. Objectives: Herein, we propose a novel predictor for identification of arginine amide (R‐Amide) sites in proteins, by integrating the Chou’s Pseudo Amino Acid Composition (PseAAC) with deep features. Methods: We use well‐known DNNs for both the tasks of learning a feature representation of peptide sequences and performing classifications. Results: Among different DNNs, CNN showed the highest scores in terms of accuracy, and all other computed measures and outperforms all the previously reported predictors. Conclusions: Based on these results, it is concluded that the proposed model can help to identify arginine amidation in a very efficient and accurate manner which can help scientists understand the mechanism of this modification in proteins. Results: Among different DNNs, Gated Recurrent Unit (GRU) based RNN model showed highest scores in terms of accuracy, and all other computed measures, and outperforms all the previously reported predictors. Conclusion: The proposed GRU based RNN model can help identifying N‐Palmitoylation in a very efficient and accurate manner which can help scientists understand the mechanism of this modification in proteins. Keywords: Amidation, Arginine Amide, DNNs, Deep features, 5‐steps rule, PseAAC.
43. Abid, A., Abbas, A., Khelifi, A., Farooq, M. S., Iqbal, R., & Farooq, U. (2020). An architectural framework for information integration using machine learning approaches for smart city security profiling. International Journal of Distributed Sensor Networks, 16(10), 1550147720965473. doi: 10.1177/1550147720965473. (Adnan Abid, Ansar Abbas, Muhammad Shoaib Farooq, Uzma Farooq (Computer Science/SST) Abstract: In the past few decades, the whole world has been badly affected by terrorism and other law‐and‐ order situations. The newspapers have been covering terrorism and other law‐and‐order issues with relevant details. However, to the best of our knowledge, there is no existing information system that is capable of accumulating and analyzing these events to help in devising strategies to avoid and minimize such incidents in future. This research aims to provide a generic architectural framework to semi‐automatically accumulate law‐ Research Outlook 2020 | 109
and‐order‐related news through different news portals and classify them using machine learning approaches. The proposed architectural framework discusses all the important components that include data ingestion, preprocessor, reporting and visualization, and pattern recognition. The information extractor and news classifier have been implemented, whereby the classification sub‐component employs widely used text classifiers for a news data set comprising almost 5000 news manually compiled for this purpose. The results reveal that both support vector machine and multinomial Naı¨ve Bayes classifiers exhibit almost 90% accuracy. Finally, a generic method for calculating security profile of a city or a region has been developed, which is augmented by visualization and reporting components that maps this information onto maps using geographical information system. Keywords: human loss news, news classification, security profiling, machine learning, geo mapping.
44. Adnan, A., Muhammad Faraz, M., Muhammad Shoaib, F., Uzma, F., & Muzammil, H. (2020). Challenges and Issues of Resource Allocation Techniques in Cloud Computing. KSII Transactions on Internet and Information Systems (TIIS), 14(7), 2815‐2839. (Adnan Abid, Muhammad Faraz Manzoor, Muhammad Shoaib Farooq, Uzma Farooq, Muzammil Hussai (Computer Science/SST) Abstract: In a cloud computing paradigm, allocation of various virtualized ICT resources is a complex problem due to the presence of heterogeneous application (MapReduce, content delivery and networks web applications) workloads having contentious allocation requirements in terms of ICT resource capacities (resource utilization, execution time, response time, etc.). This task of resource allocation becomes more challenging due to finite available resources and increasing consumer demands. Therefore, many unique models and techniques have been proposed to allocate resources efficiently. However, there is no published research available in this domain that clearly address this research problem and provides research taxonomy for classification of resource allocation techniques including strategic, target resources, optimization, scheduling and power. Hence, the main aim of this paper is to identify open challenges faced by the cloud service provider related to allocation of resource such as servers, storage and networks in cloud computing. More than 70 articles, between year 2007 and 2020, related to resource allocation in cloud computing have been shortlisted through a structured mechanism and are reviewed under clearly defined objectives. Lastly, the evolution of research in resource allocation techniques has also been discussed along with salient future directions in this area. Keywords: cloud computing, resource allocation, resource scheduling, resource utilization.
45. Farooq, U., Rahim, M., Abid, A., & Khan, N. S. (2020). A Process to Develop Sign Language Corpus using Crowdsourcing. International Journal of Innovative Technology and Exploring Engineering (IJITEE), 9(5). doi: 10.35940/ijitee.E2975.039520. (Adnan Abid, Nabeel Sabir Khan (Computer Science/SST) Abstract: Humans use language in order to communicate between one another. There exist a number of languages which are either spoken or written. Among these languages, there exists a special type of language called Sign Language (SL). Sign language is a general term which includes any kind of gestural language that makes use of signs and gestures to convey message. Although the deaf community feels comfortable while using Sign Language as their mode of communication, but they face a lot of problems as well. Therefore, in order to help and assist the deaf community a repository of different sign languages are essential for each sign language. This work presents a process to develop a repository by collecting and validating sign language gestures of any language by involving the deaf community and language experts. A small data collection based on a proof‐of‐ concept application has also been presented in this work. Lastly, it highlights the benefits of such corpus by discussing possible applications that can be built to serve the deaf community of the world at large. Keywords: crowdsourcing, sign language, sign language corpus, sign language standardization.
Research Outlook 2020 | 110
46. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). A survey on internet of vehicles (IOV) with intelligent transport system using cloud services. Journal of Critical Reviews, 7 (9), 1660‐1672. doi:10.31838/jcr.07.09.303. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Cloud computing is a revolutionary in field of computer science or information technology. Its technology will be growing day by day and change the old or tradition system of the IT. Cloud computing plays important role in our technology sector. In this research main focus on the cloud computing, billions of things are interconnected to the internet and increases this industry next coming year. In recent years mostly, people facing the problem of traffic jams, security, and road incidents. Different types of technology used in internet of vehicles (IOV) and vehicular communications V2V, V2R, V2S and protocol to be used VANET’s. Basically, intelligent transport system used in vehicles. All the mobiles connect to the applications cloud connected, Millions of vehicles can move to the road and data sending to the cloud but burden of cloud can increase and server may me be down. we implantation of sensors in vehicles or traffic signals, sensor help to reduces the vehicles on which of road side heavy traffic not depend on time they can calculate the number of vehicles and passes through the signals. An algorithm can be applying in smart cellular vehicles to move on the road GPS navigation system help the intelligent transport system. Keywords: architecture, cloud services, iot devices, intelligent transport system, internet of vehicles, mobile devices, sensors, VANETs.
47. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). A role of networking technologies based iot with research challenges. Journal of Critical Reviews, 7 (9), 1673‐1679. doi:10.31838/jcr.07.09.304. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: This paper gives insight into how Internet of Things (IOT) networking is a unique combination of wireless personal area networks, like 6LowPAN, Zig‐ Bee, and the IEEE 802.15.4 protocol, which runs the Medium Access Control and the physical layer operations for 6LoW‐PAN and ZigBee connectivity. In addition, this paper discusses about wireless LAN Wi‐Fi technology, i.e. wireless local area network protocol and on a larger scale, mobile transmission technology, such as LTE, that is used to provide connectivity to the internet, the wide area network. This paper focuses on how these technologies need to work together to provide IOT connectivity. It showcases important research challenges in said area. Keywords: research challenges, IoT, networking technologies, 6LoWPAN, IEEE, standards.
48. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). Cloud based cryptography by using quantum key distribution. Journal of Critical Reviews, 7 (9), 1680‐1686. doi:10.31838/jcr.07.09.305. (Attique‐Ur‐ Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: In present days the technology of cloud computing is very useful. Cloud computing usage has been increased very fast in most of the organizations. Security is a very sensitive aspect in the environment of cloud computing because most sensitive data or information is saved in the cloud by the user. To maintain the information and applications it uses central remote servers or internet as well. Without any installation using the cloud communication the end users can use these applications. By using the cloud computing environments and is actual very flexible but many of the question arises that how can we gain an environment which is trusted or how our data or applications are safe and sound by the intruders and hackers. Problems in cloud are that, the data isn’t more secure in cloud and could be hacked by any third party. Moreover, other threats are such as data loss, user’s data theft or privacy issues. This paper surveys the new cryptographic area or environment which is safer or trusted using the quantum mechanism. Keywords: cloud encryption, cryptography, distribution of quantum key, cloud computing, security.
Research Outlook 2020 | 111
49. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). IOT based automated room temperature control system by using fuzzy logic. Journal of Critical Reviews, 7 (9), 1687‐1696. doi:10.31838/jcr.07.09.306. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Internet of thing of thing (IOT) conceptualizes the idea of connecting and monitoring the objects in real world by connecting to internet. It can make our houses smarter and save using the different sensors and the actuators and clouds. In paper we are going to automate the room temperature by using the fuzzy logics. A lot of energy lost every year. The IOT‐ARTC Expert System has three input variables. The input variables are Temperature (Celsius), Pressure (millibar) & Humidity (percentage) which determine the output variables Heater & Chiller. There are five membership functions of input variable Temperature i.e., Freeze, Cold, Moderate, Warm and Hot. where pressure also have five membership functions i.e., Fall, Low, Amicable, Elevated and High and Humidity have three membership functions i.e., Dry, Comfortable & Moisture. On the other hand, there are two membership function of output variable Heater i.e., Heat and Quick Heat, while output variable Chiller has three membership functions such as Chiller fan, Cool and Quick Cool. This paper includes the proposed Multi‐Layered Mamdani Fuzzy Inference System which provide the higher accuracy. MATLAB used to design this system. This paper presents an analysis of temperature, humidity and pressure of different areas of Pakistan. In this research paper we show the approximate 75 parameters. Keywords: automated room temperature, control system, fuzzy logic, IoT, cloud.
50. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). TRIED‐AND‐TRUE cloud architecture using multi cloud threading model as fundamental body. Journal of Critical Reviews, 7 (9), 1704‐1711. doi:10.31838/jcr.07.09.308. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: As we know that cloud is the major and hot domain of information technology to be relay‐on for data storage. So, more the data more will be the security issues to be resolve, if we rely on a single provider the data will be in great danger to be attacked or stolen by some ID, we may call stolen Id. This security threat is mainly occurring in the mobile data storage where cloud provider can’t handle the data to be more accurate and safer. If we see on the consumer point of view the major and crucial factor is to enhance the security and make their data to be more valuable and safer to use for them without any inconvenience. In this aspect the business and cloud organizations also moved in the way to have multi‐cloud on their side to have more users on their deck to have bigger income. So, in this work we propose the structure that is involved in the multi‐cloud architecture to secure the data and store the data. It is like the static to dynamic travel to have a multiple cloud rather than having only one provider. We provide a good architecture with standard up to the mark algorithm to have a multi‐cloud system to develop the structure to have customer trust to have data on cloud or any outsourced firm or organization to work and enhance their capabilities to store any type of secure and variable data, by using the surveys methods we use. Keywords: cloud, security and privacy, design architecture, vulnerability, threats, multi‐party configuration.
51. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). A survey on cloud computing security with cross platform. Journal of Critical Reviews, 7 (10), 1439‐1445. doi:10.31838/jcr.07.10.281. (Attique‐Ur‐ Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Cloud computing is the lately spread revolution. Every organization wants this type of technology for their programs’ interfaces. Surveys on particular cross cloud organization models and usable cloud profit models in the field of cloud computing are considered. According to industry style we notice that utilization of cross cloud which is use for solving industrial upcoming objection using a mix of both private and public cloud to an effective method to address the cloud status of your information does so that the office can get it. Storemost important Research Outlook 2020 | 112
information on private cloud and provide less basic information on public cloud where huge storing capacity of data. Cross cloud is particularly beneficial for effective or extremely flexible workload. This paper portrays the overview, service model, traits, supplier storage and issues of cloud computing. Keywords: cloud computing, cross platforms, cloud security, features, suppliers, technics.
52. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). A survey on the role of security and integrity issues in cloud. Journal of Critical Reviews, 7 (10), 1456‐1469. doi:10.31838/jcr.07.10.283. (Attique‐Ur‐ Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Cloud computing is actually the use of remote servers on the internet to store, manage and process the data rather than the local servers. In cloud computing we uses our demands as per utility instead of buying and maintaining our own servers. Cloud security comprises of the set of technologies, controls, procedures and policies to protect data, infrastructure and cloud based systems. These security values are built to protect customer’s privacy, their data and setting up rules of authentication and authorization for individual devices and users, also supports regulatory compliance. Normally cloud users neither exactly knows the actual location of their data stored on cloud nor the other sources of the data that are collectively stored with their data. Therefore many data integrity and security concerns have emerged, counting access control, data confidentiality and data availability, remote integrity check, proof of ownership in cloud and searchable encryption methods. Cloud service providers are using these security measures over server side. Keywords: security, integrity, cloud computing, rsa, encryption model.
53. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). ISP network function based performance analysis on virtualization using cloud computing. Journal of Critical Reviews, 7 (10), 1470‐1481. doi:10.31838/jcr.07.10.284. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: With advancement of technology, cloud computing gains vital importance in research. People and processes are moving over the cloud that cause to exponential increase in network, storage and computational resources. This exponential growth leads towards large and scalable clouds that costs high in terms of design, deployment and maintenance. The amount of data is increasing day by day due to large amount of cloud users. Resources or services are configured over cloud using virtualization technologies as per user demand. Various virtualization techniques are used for resource allocation. Network function virtualization (NFV) is function based well‐known technique to virtualize the functionalities of network while the resources of cloud network will be determined using capital expenditure (CAPEX). This research paper calculates the impact of network function virtualization on CAPEX for cloud‐oriented networks and performs comparative analysis between NFV and traditional technologies of virtualization. A prototype to implement NFV over cloud network is designed for experimentation and multiple test cases are executed for performance evaluation. Experimental results show that the overall cost for management and CAPEX is reduced in NFV based implementation of cloud networks. CPU also performing well in case of users or load increment. Keywords: NFV, virtualization, cloud, capital expenditure, restful services.
54. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). Analysis of cloud computing based blockchain issues and challenges. Journal of Critical Reviews, 7 (10), 1482‐1492. doi:10.31838/jcr.07.10.285. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Block chain is the technology that backs up cloud computing and internet of things in most cases such as cryptocurrency. It is often known as a public and decentralized ledger. The blockchain technology stores data in the form of blocks based on its type and data programming, these blocks are linked together, thus, named as blockchain. Some case studies where blockchain has been successfully used such as in the sectors of public Research Outlook 2020 | 113
health, public safety, smart cities, supply chains etc. but have revealed that blockchain remains at the heart of bitcoin. The compilation does not highlight the issues and challenges of blockchain despite its need. The data is retrieved with corresponding technology of IoT and Cloud Computing. This article discusses the ability of blockchain to facilitate various walks of life other than just banking and finance. The article builds strong foundation for blockchain by acknowledging its abilities and the phenomenal potentials that it holds. Keywords: blockchain, issues, challenges, cloud computing, application, architecture.
55. Vistro, D. M., Attique‐Ur‐Rehman, Abid, A., Farooq, M. F., Idrees, M. (2020). Cloud based architecture for smart educational system using modern technology. Journal of Critical Reviews, 7 (10), 1493‐1503. doi:10.31838/jcr.07.10.286. (Attique‐Ur‐Rehman, Adnan Abid, Muhammad Shoaib Farooq (Computer Science/SST) Abstract: Cloud computing is also a revolutionary in field of computer science or information technology. Its technology will be growing day by day and also change the old or tradition system of the IT. Cloud computing plays important role in our technology sector. People are using it in some way, our educational system is not in line with modern times. Now a day’s way of teaching method can be change. Students are moving towards modern technology. In our education institute to apologies our student or teachers to take knowledge about cloud computing and information technology. And also know about the data ho to save in cloud. It’s our country most of the backward areas do not about the awareness cloud challenging for us to implement to our system to cloud base. In this review paper cloud infrastructure will also change the education field in universities and many institutions so now a day’s website and portals are link to the cloud. At this time teaching method can be change technology will also be change as compared to the old system used in education. so, we change education sector without cloud infrastructure cannot be possible big challenge for the government to applying technology in our education structure. Keywords: cloud, architecture, benefits, issues, challenges, application.
56. Vistro, D. M., Farooq, M. S., Rashid, E., Attique‐Ur‐Rehman (2020). Water‐resistance smartphone technologies: opportunities and challenges. Journal of Critical Reviews, 7 (10), 1512‐1522. doi:10.31838/jcr.07.10.288. (Muhammad Shoaib Farooq, Ehtisham Rashid, Attique‐Ur‐Rehman (Computer Science/SST) Abstract: Smartphone Technologies are becoming popular among researchers and mobile phone companies in recent years. This increasing interest demands that people know about basics of smartphone technologies which will empower them to choose best smartphone for them. People has increasing demands to get smartphones with waterproof technology. The objective of this Systematic Literature Review is to identify and to present current research on water‐resistance smartphone technologies and to select important approaches and needs for future research. The testing standards for water‐resistance in terms of ingress protection codes for smartphones are also discussed. A systematic literature review was conducted for this purpose and a total of 1064 papers were selected among different libraries for this study. Problems with current techniques, used to make smartphones water‐resistant, were discussed and recommendations are given for future research. Keywords: IP code, smartphone, water protection, water‐resistance, ingress protection.
57. Shah, A. A., & Khan, Y. D. (2020). Identification of 4‐carboxyglutamate residue sites based on position based statistical feature and multiple classification. Scientific Reports, 10(1), 16913. doi: 10.1038/s41598‐020‐73107‐y. (Yaser Daanial Khan (Computer Science/SST) Abstract: Glutamic acid is an alpha‐amino acid used by all living beings in protein biosynthesis. One of the important glutamic acid modifications is post‐translationally modified 4‐carboxyglutamate. It has a significant role in blood coagulation. 4‐carboxyglumates are required for the binding of calcium ions. On the contrary, this
Research Outlook 2020 | 114
modification can also cause different diseases such as bone resorption, osteoporosis, papilloma, and plaque atherosclerosis. Considering its importance, it is necessary to predict the occurrence of glutamic acid carboxylation in amino acid stretches. As there is no computational based prediction model available to identify 4‐ carboxyglutamate modification, this study is, therefore, designed to predict 4‐carboxyglutamate sites with a less computational cost. A machine learning model is devised with a Multilayered Perceptron (MLP) classifier using Chou’s 5‐step rule. It may help in learning statistical moments and based on this learning, the prediction is to be made accurately either it is 4‐carboxyglutamate residue site or detected residue site having no 4‐ carboxyglutamate. Prediction accuracy of the proposed model is 94% using an independent set test, while obtained prediction accuracy is 99% by self‐consistency tests. Keywords: biotechnology, computational biology and bioinformatics, computer science.
58. Mustafa, H. T., Yang, J., Mustafa, H., & Zareapoor, M. (2020). Infrared and visible image fusion based on dilated residual attention network. Optik, 224, 165409. doi: https://doi.org/10.1016/j.ijleo.2020.165409. (Hamza Mustafa (Computer Science/SST) Abstract: In recent years, deep learning (DL)‐based techniques have achieved significant improvements over image fusion applications. Yet, current DL‐based approaches raise formidable feature extraction, computational and statistical challenges in image fusion models. To overcome these challenges, we proposed an end‐to‐end DL‐ based architecture for infrared (IR) and visible (VIS) image fusion. We introduce multi‐scale feature extraction and self‐attention‐based new feature fusion strategy to generate a high‐quality fused image having balance details of IR and VIS modalities. Specifically, instead of using normal convolutions, we introduce dilated convolutions in the encoders to extract multi‐scale features of IR and VIS images. Additionally, we introduce self‐attention mechanism to refine and adaptively fuse multi‐contextual features of IR and VIS images. Fused image is generated via decoder of the network. Extensive qualitative and quantitative evaluations on a benchmark dataset illustrate that our proposed method achieves reasonable performance over other state‐of‐the‐art and current CNN‐based image fusion methods. Keywords: Infrared imaging, Dilated convolutions, Feature extraction, Self‐attention, Image fusion.
59. Naseer, S., Faizan Ali, R., Dominic, P. D. D., & Saleem, Y. (2020). Learning Representations of Network Traffic Using Deep Neural Networks for Network Anomaly Detection: A Perspective towards Oil and Gas IT Infrastructures. Symmetry, 12(11), 1882. (Sheraz Naseer (Computer Science/SST) Abstract: Oil and Gas organizations are dependent on their IT infrastructure, which is a small part of their industrial automation infrastructure, to function effectively. The oil and gas (O&G) organizations industrial automation infrastructure landscape is complex. To perform focused and effective studies, Industrial systems infrastructure is divided into functional levels by The Instrumentation, Systems and Automation Society (ISA) Standard ANSI/ISA‐ 95:2005. This research focuses on the ISA‐95:2005 level‐4 IT infrastructure to address network anomaly detection problem for ensuring the security and reliability of Oil and Gas resource planning, process planning and operations management. Anomaly detectors try to recognize patterns of anomalous behaviors from network traffic and their performance is heavily dependent on extraction time and quality of network traffic features or representations used to train the detector. Creating efficient representations from large volumes of network traffic to develop anomaly detection models is a time and resource intensive task. In this study we propose, implement and evaluate use of Deep learning to learn effective Network data representations from raw network traffic to develop data driven anomaly detection systems. Proposed methodology provides an automated and cost effective replacement of feature extraction which is otherwise a time and resource intensive task for developing data driven anomaly detectors. The ISCX‐2012 dataset is used to represent ISA‐95 level‐4 network traffic because the O&G network traffic at this level is not much different than normal internet traffic. We trained four representation learning models using popular deep neural network architectures to extract deep representations from ISCX 2012 traffic Research Outlook 2020 | 115
flows. A total of sixty anomaly detectors were trained by authors using twelve conventional Machine Learning algorithms to compare the performance of aforementioned deep representations with that of a human‐ engineered handcrafted network data representation. The comparisons were performed using well known model evaluation parameters. Results showed that deep representations are a promising feature in engineering replacement to develop anomaly detection models for IT infrastructure security. In our future research, we intend to investigate the effectiveness of deep representations, extracted using ISA‐95:2005 Level 2‐3 traffic comprising of SCADA systems, for anomaly detection in critical O&G systems. Keywords: autoencoders, ANSI/ISO‐95, convolutional neural networks, IT infrastructures, data driven security, deep learning, information security, intrusion detection, network anomaly detection, oil and gas IT infrastructure, representation learning.
60. Siddiqui, N., Yousaf, F., Fiza, M., Ehatisham‐ul‐Haq, M., Ashraf, M. U., Alghamdi, A. M., & Alfakeeh, A. S. (2020). A highly nonlinear substitution‐box (S‐box) design using action of modular group on a projective line over a finite field. PLoS One, 15(11), 1‐16. doi: http://dx.doi.org/10.1371/journal.pone.0241890. (M. Usman Ashraf (Computer Science/SST) (SKT Campus) Abstract: Cryptography is commonly used to secure communication and data transmission over insecure networks through the use of cryptosystems. A cryptosystem is a set of cryptographic algorithms offering security facilities for maintaining more cover‐ups. A substitution‐box (Sbox) is the lone component in a cryptosystem that gives rise to a nonlinear mapping between inputs and outputs, thus providing confusion in data. An S‐box that possesses high nonlinearity and low linear and differential probability is considered cryptographically secure. In this study, a new technique is presented to construct cryptographically strong 8×8 S‐boxes by applying an adjacency matrix on the Galois field GF(28 ). The adjacency matrix is obtained corresponding to the coset diagram for the action of modular group PSLð2;ZÞ on a projective line PL(F7) over a finite field F7. The strength of the proposed S‐boxes is examined by common S‐box tests, which validate their cryptographic strength. Moreover, we use the majority logic criterion to establish an image encryption application for the proposed S‐boxes. The encryption results reveal the robustness and effectiveness of the proposed S‐box design in image encryption applications. Keywords: not available.
61. Hussain, A., Irfan, M., Baloch, N. K., Draz, U., Ali, T., Glowacz, A., . . . Antonino‐Daviu, J. (2020). Savior: A Reliable Fault Resilient Router Architecture for Network‐on‐Chip. Electronics, 9(11), 1783. (Ayaz Hussain (Computer Science) (SKT Campus) Abstract: The router plays an important role in communication among different processing cores in on‐chip networks. Technology scaling on one hand has enabled the designers to integrate multiple processing components on a single chip; on the other hand, it becomes the reason for faults. A generic router consists of the buffers and pipeline stages. A single fault may result in an undesirable situation of degraded performance or a whole chip may stop working. Therefore, it is necessary to provide permanent fault tolerance to all the components of the router. In this paper, we propose a mechanism that can tolerate permanent faults that occur in the router. We exploit the fault‐tolerant techniques of resource sharing and paring between components for the input port unit and routing computation (RC) unit, the resource borrowing for virtual channel allocator (VA) and multiple paths for switch allocator (SA) and crossbar (XB). The experimental results and analysis show that the proposed mechanism enhances the reliability of the router architecture towards permanent faults at the cost of 29% area overhead. The proposed router architecture achieves the highest Silicon Protection Factor (SPF) metric, which is 24.8 as compared to the state‐of‐the‐art fault‐tolerant architectures. It incurs an increase in latency for SPLASH2 and PARSEC benchmark traffics, which is minimal as compared to the baseline router. Keywords: reliability, reconfigurable architecture, fault tolerance, network‐on‐chip, permanent faults.
Research Outlook 2020 | 116
62. Nadeem, M. W., Goh, H. G., Ali, A., Hussain, M., Khan, M. A., & Ponnusamy, V. a. p. (2020). Bone Age Assessment Empowered with Deep Learning: A Survey, Open Research Challenges and Future Directions. Diagnostics, 10(10), 781. https://doi.org/10.3390/diagnostics10100781. (Muzammil Hussain (Computer Science/SST) Abstract: Deep learning is a quite useful and proliferating technique of machine learning. Various applications, such as medical images analysis, medical images processing, text understanding, and speech recognition, have been using deep learning, and it has been providing rather promising results. Both supervised and unsupervised approaches are being used to extract and learn features as well as for the multi‐level representation of pattern recognition and classification. Hence, the way of prediction, recognition, and diagnosis in various domains of healthcare including the abdomen, lung cancer, brain tumor, skeletal bone age assessment, and so on, have been transformed and improved significantly by deep learning. By considering a wide range of deep‐learning applications, the main aim of this paper is to present a detailed survey on emerging research of deep‐learning models for bone age assessment (e.g., segmentation, prediction, and classification). An enormous number of scientific research publications related to bone age assessment using deep learning are explored, studied, and presented in this survey. Furthermore, the emerging trends of this research domain have been analyzed and discussed. Finally, a critical discussion section on the limitations of deep‐learning models has been presented. Open research challenges and future directions in this promising area have been included as well. Keywords: bone age, deep learning, image processing, health care, survey, segmentation, magnetic resonance images (MRIs).
63. Khan, Y. D., Alzahrani, E., Alghamdi, W., & Ullah, M. Z. (2020). Sequence‐based Identification of Allergen Proteins Developed by Integration of PseAAC and Statistical Moments via 5‐Step Rule. Current Bioinformatics, 15(9), 1046‐ 1055. doi: 10.2174/1574893615999200424085947. (Yaser Daanial Khan, Najm Amin (Computer Science/SST) Abstract: Background: Allergens are antigens that can stimulate an atopic type I human hypersensitivity reaction by an immunoglobulin E (IgE) reaction. Some proteins are naturally allergenic than others. The challenge for toxicologists is to identify properties that allow proteins to cause allergic sensitization and allergic diseases. The identification of allergen proteins is a very critical and pivotal task. The experimental identification of protein functions is a hectic, laborious and costly task; therefore, computer scientists have proposed various methods in the field of computational biology and bioinformatics using various data science approaches. Objectives: Herein, we report a novel predictor for the identification of allergen proteins. Methods: For feature extraction, statistical moments and various position‐based features have been incorporated into Chou’s pseudo amino acid composition (PseAAC), and are used for training of a neural network. Results: The predictor is validated through 10‐fold cross‐validation and Jackknife testing, which gave 99.43% and 99.87% accurate results. Conclusion: Thus, the proposed predictor can help in predicting the Allergen proteins in an efficient and accurate way and can provide baseline data for the discovery of new drugs and biomarkers. Keywords: 5‐step rule, Allergen proteins, PseAAC, biomarkers, prediction, statistical moments.
64. Hussain, W., Rasool, N., & Khan, Y. D. (2020). A Sequence‐Based Predictor of Zika Virus Proteins Developed by Integration of PseAAC and Statistical Moments. Combinatorial Chemistry & High Throughput Screening, 23(8), 797‐ 804. doi: 10.2174/1386207323666200428115449. (Yaser Daanial Khan (Computer Science/SST) Abstract: Background: ZIKV has been a well‐known global threat, which hits almost all of the American countries and posed a serious threat to the entire globe in 2016. The first outbreak of ZIKV was reported in 2007 in the Pacific area, followed by another severe outbreak, which occurred in 2013/2014 and subsequently, ZIKV spread to all other Pacific islands. A broad spectrum of ZIKV associated neurological malformations in neonates and adults has driven this deadly virus into the limelight. Though tremendous efforts have been focused on understanding the molecular basis of ZIKV, the viral proteins of ZIKV have still not been studied extensively. Research Outlook 2020 | 117
Objectives: Herein, we report the first and the novel predictor for the identification of ZIKV proteins. Methods: We have employed Chou's pseudo amino acid composition (PseAAC), statistical moments and various position‐based features. Results: The predictor is validated through 10‐fold cross‐validation and Jackknife testing. In 10‐ fold cross‐ validation, 94.09% accuracy, 93.48% specificity, 94.20% sensitivity and 0.80 MCC were achieved while in Jackknife testing, 96.62% accuracy, 94.57% specificity, 97.00% sensitivity and 0.88 MCC were achieved. Conclusion: Thus, ZIKVPred‐PseAAC can help in predicting the ZIKV proteins efficiently and accurately and can provide baseline data for the discovery of new drugs and biomarkers against ZIKV. Keywords: 5‐step rule, PseAAC, ZIKV, jackknife testing, prediction, statistical momentsm.
65. Mahmood, M. K., Ehsan, A., Khan, Y. D., & Chou, K.‐C. (2020). iHyd‐LysSite (EPSV): Identifying Hydroxylysine Sites in Protein Using Statistical Formulation by Extracting Enhanced Position and Sequence Variant Feature Technique. Current Genomics, 21(7), 536‐545. doi: 10.2174/1389202921999200831142629. (Yaser Daanial Khan (Computer Science/SST) Abstract: Introduction: Hydroxylation is one of the most important post‐translational modifications (PTM) in cellular functions and is linked to various diseases. The addition of one of the hydroxyl groups (OH) to the lysine sites produces hydroxylysine when undergoes chemical modification. Methods: The method which is used in this study for identifying hydroxylysine sites based on powerful mathematical and statistical methodology incorporating the sequence‐order effect and composition of each object within protein sequences. This predictor is called "iHyd‐LysSite (EPSV)" (identifying hydroxylysine sites by extracting enhanced position and sequence variant technique). The prediction of hydroxylysine sites by experimental methods is difficult, laborious and highly expensive. In silico technique is an alternative approach to identify hydroxylysine sites in proteins. Results: The experimental results require that the predictive model should have high sensitivity and specificity values and must be more accurate. The self‐consistency, independent, 10‐fold crossvalidation and jackknife tests are performed for validation purposes. These tests are resulted by using three renowned classifiers, Neural Networks (NN), Random Forest (RF) and Support Vector Machine (SVM) with the demanding prediction rate. The overall predictive outcomes are extraordinarily superior to the results obtained by previous predictors. The proposed model contributed an excellent prediction rate in the system for NN, RF, and SVM classifiers. The sensitivity and specificity results using all these classifiers for jackknife test are 96.08%, 94.99%, 98.16% and 97.52%, 98.52%, 80.95%. Conclusion: The results obtained by the proposed tool show that this method may meet the future demand of hydroxylysine sites with a better prediction rate over the existing methods. Keywords: Hydroxylysine, PTMs, ANN, cross‐validation, predictive model, post‐translational modifications..
Conference Proceedings 1. Khan, A. H., Haroon, M., Altaf, O., Awan, S. M., & Asghar, A. (2020). Sentimental Content Analysis and Prediction of Text. Paper presented at the Second International Conference, INTAP 2019 Bahawalpur, Pakistan, November 6–8, 2019, Springer, Singapore. (Ali Haider Khan, Shahid Mehmood Awan (Computer Science/SST) Abstract: In the advancement of technology, the web era revolutionized mankind life; huge amounts of data are available on the internet in the form of articles and blogs. From this huge volume of data opinion mining is an important for extracting the raw data to become useful information. Sentiment analysis provides categorization in opinion mining as positive or negative class for content analysis. English language is considered as a universal language and used almost every part of the word, so classification of opinion is important to get the end meaning of the word phrase and comments. No literature is available for classification of sub opinion in the text mining. SAP of Text through Machine Learning algorithm (KNN) is a three‐step technique of opinion mining. In this study, Research Outlook 2020 | 118
authors have put articles at first removing stop‐words, tokenizing the sentence and revamping the tokens, it will calculate the polarity of the sentence, paragraph and text through contributing weighted words by keeping sentiment shifters and intensity clauses in consideration. Secondly, over polarization of sentence is adjusted. Finally, overall trend of the input text on the basis of tokenization and polarization of sentence is predicted with proposed algorithm and compared with KNN. Furthermore, domain specific analysis is a distinct feature of the proposed model where data can be updated according to the required domain to ensure the optimal level of efficiency. Keywords: machine learning, opinion mining, polarity, sentiment analysis and training data.
2. Samuel, O., Javaid, N., Shehzad, F., Iftikhar, M. S., Iftikhar, M. Z., Farooq, H., & Ramzan, M. (2020). Electric Vehicles Privacy Preserving Using Blockchain in Smart Community. Paper presented at the Broad‐Band Wireless Computing, Communication and Applications. BWCCA 2019. Lecture Notes in Networks and Systems, vol 97. Springer, Cham. https://doi.org/10.1007/978‐3‐030‐33506‐9_7. (Muhammad Ramzan (Computer Science/SST) Abstract: During the process of charging, electric vehicle’s location is usually revealed when making payment. This brings about the potential risk to privacy of electric vehicle. We observe that the trade information recorded on blockchain may raise privacy concern and therefore, we propose a blockchain oriented approach to resolve the privacy issue without restricting trading activities through (ϵ,δ)(ϵ,δ)‐differential privacy. The proposed scheme does not only preserve the electric vehicle’s location; however, prevents semantic, linking and data mining based attacks. Simulation results show that as the privacy level increases, the risk revealing decreases as well. Keywords: Blockchain, Demand side management, Electric vehicle, Energy trading and privacy preserving.
3. Riaz, S., Khan, A. H., Haroon, M., Latif, S., & Bhatti, S. (2020, 13‐14 Aug. 2020). Big Data Security and Privacy: Current Challenges and Future Research perspective in Cloud Environment. Paper presented at the 2020 International Conference on Information Management and Technology (ICIMTech). (Ali Haider Khan (Computer Science/SST) Abstract: Cloud computing is an Internet‐based technology that emerging rapidly in the last few years due to popular and demanded services required by various institutions, organizations, and individuals. structured, unstructured, semistructured data is transfer at a record pace on to the cloud server. These institutions, businesses, and organizations are shifting more and more increasing workloads on cloud server, due to high cost, space and maintenance issues from big data, cloud computing will become a potential choice for the storage of data. In Cloud Environment, It is obvious that data is not secure completely yet from inside and outside attacks and intrusions because cloud servers are under the control of a third party. The Security of data becomes an important aspect due to the storage of sensitive data in a cloud environment. In this paper, we give an overview of characteristics and state of art of big data and data security & privacy top threats, open issues and current challenges and their impact on business are discussed for future research perspective and review & analysis of previous and recent frameworks and architectures for data security that are continuously established against threats to enhance how to keep and store data in the cloud environment. Keywords: security threats, cloud computing, big data, data storage, data security challenges.
4. Ashraf, M. U., Hannan, A., Cheema, S. M., Ali, Z., Jambi, K. m., & Alofi, A. (2020, 12‐13 June 2020). Detection and Tracking Contagion using IoT‐Edge Technologies: Confronting COVID‐19 Pandemic. Paper presented at the 2020 International Conference on Electrical, Communication, and Computer Engineering (ICECCE). (Muhammad Usman Ashraf, Abdul Hannan, Sehrish Munawar Cheema, Zahra Ali (Computer Science) (SKT Campus) Abstract: The ongoing pandemic of Corona‐Virus (COVID‐19) induced by the coming forth category of SARS‐CoV‐ 2, has terrified the worldwide human health. Primarily, COVID‐19 challenges can be categorized into (a) way of Research Outlook 2020 | 119
epidemic prevention and blocking transmission, (b) live monitoring of infected / suspected persons (c) FDA approved vaccine. Leading to said COVID‐19 (a), (b) challenges, digit technologies such Artificial Intelligence, Big data analytics and Internet of Things (IoT), can play a vital role in epidemic prevention and blocking COVID‐19 transmission. In this study, we have proposed a smart edge surveillance system that is effective in remote monitoring, advance warning and detection of a person's fever, heart beat rate, cardiac conditions and some of the radiological features to detect the infected (suspicious) person using wearable smart gadgets. The proposed framework provides a continually updated map/pattern of communication chain of COVID‐19 infected persons that may span around in our national community. The health and societal impact of suggested research is to help public health authorities, researchers and clinicians contain and manage this disease through smart edge surveillance systems. The proposed model will help to detect and track the contagious person. Moreover, it will also keep the patient's data record for analysis and decision making using edge computing. Keywords: COVID‐19, IoT, Edge Computing, Cloud Computing, Ubiquitous Computing, graph transfusion, recommendations. Department of Software Engineering Research Articles 1. Mehmood, E., & Anees, T. (2020). Challenges and Solutions for Processing Real‐Time Big Data Stream: A Systematic Literature Review. IEEE Access, 8, 119123‐119143. doi: 10.1109/ACCESS.2020.3005268. (Erum Mehmood, Tayyaba Anees (Software Engineering/SST) Abstract: Contribution: Recently, real‐time data warehousing (DWH) and big data streaming have become ubiquitous due to the fact that a number of business organizations are gearing up to gain competitive advantage. The capability of organizing big data in efficient manner to reach a business decision empowers data warehousing in terms of real‐time stream processing. A systematic literature review for real‐time stream processing systems is presented in this paper which rigorously look at the recent developments and challenges of real‐time stream processing systems and can serve as a guide for the implementation of real‐time stream processing framework for all shapes of data streams. Background: Published surveys and reviews either cover papers focusing on stream analysis in applications other than real‐time DWH or focusing on extraction, transformation, loading (ETL) challenges for traditional DWH. This systematic review attempts to answer four specific research questions. Research Questions: 1)Which are the relevant publication channels for real‐time stream processing research? 2) Which challenges have been faced during implementation of real‐time stream processing? 3) Which approaches/tools have been reported to address challenges introduced at ETL stage while processing real‐time stream for real‐time DWH? 4) What evidence have been reported while addressing different challenges for processing real‐time stream? Methodology: A systematic literature was conducted to compile studies related to publication channels targeting real‐time stream processing/joins challenges and developments. Following a formal protocol, semi‐automatic and manual searches were performed for work from 2011 to 2020 excluding research in traditional data warehousing. Of 679,547 papers selected for data extraction, 74 were retained after quality assessment. Findings: This systematic literature highlights implementation challenges along with developed approaches for real‐time DWH and big data stream processing systems and provides their comparisons. This study found that there exists various algorithms for implementing real‐time join processing at ETL stage for structured data whereas less work for un‐structured data is found in this subject matter. Keywords: Real‐time stream processing, big data streaming, structured/un‐structured data, ETL, systematic literature review.
2. Shoukat, A., Hassan, M. T., & Asim, H. (2020). Automatic generation of teachers’ course preferences using document clustering. Journal of Applied Research and Multidisciplinary Studies, 1(1), 01–16. (Amna Shoukat,
Research Outlook 2020 | 120
Malik Tahir Hassan, Hira Asim (Software Engineering/SST) UMT JOURNAL Abstract: The current study examined the automated course preferences of teachers using document clustering. Data regarding teachers’ course preferences and course outlines were collected and preprocessed for further analysis. Two separate clustering solutions were generated for teachers and courses datasets. The clustering solution for teachers contained clusters of similar faculty members grouped together on the basis of their course preferences and courses taught by theminpreviousyears.Theclusteringsolutiongeneratedforcoursescontainedthe list of course outlines of assigned courses. Good quality clusters for both teachers and courses were generated using K‐means clustering method in CLUTOsoftware package.Thegeneratedclusteringsolutionsweremappedforautomatedgeneration of course preferences for each teacher in the dataset. Precision, Recall and F‐measure values were also reported and they indicated promisingresults. Keywords: course allocation, data mining, document clustering, higher education, teaching quality, teaching management. Conference Proceedings 1. Adil, M., Khan, R., & Ghani, M. A. N. U. (2020, 17‐19 Feb. 2020). Preventive Techniques of Phishing Attacks in Networks. Paper presented at the 2020 3rd International Conference on Advancements in Computational Sciences (ICACS). (M. Ahmad Nawaz Ul Ghani (Software Engineering/SST) Abstract: —Internet is the most widely used technology in the current era of information technology and it is embedded in daily life activities. Due to its extensive use in everyday life, it has many applications such as social media (Face book, WhatsApp, messenger etc.,) and other online applications such as online businesses, e‐ counseling, advertisement on websites, e‐banking, e‐hunting websites, e‐doctor appointment and e‐doctor opinion. The above mentioned applications of internet technology makes things very easy and accessible for human being in limited time, however, this technology is vulnerable to various security threats. A vital and severe threat associated with this technology or a particular application is “Phishing attack” which is used by attacker to usurp the network security. Phishing attacks includes fake E‐mails, fake websites, fake applications which are used to steal their credentials or usurp their security. In this paper, a detailed overview of various phishing attacks, specifically their background knowledge, and solutions proposed in literature to address these issues using various techniques such as antiphishing, honey pots and firewalls etc . Moreover, installation of intrusion detection systems (IDS) and intrusion detection and prevention system (IPS) in the networks to allow the authentic traffic in an operational network. In this work, we have conducted end use awareness campaign to educate and train the employs in order to minimize the occurrence probability of these attacks. The result analysis observed for this survey was quite excellent by means of its effectiveness to address the aforementioned issues. Keywords: network security, information security, malware, phishing, spam, social engineering, and machine learning, anti‐phishing.
2. Shaheen, M., Anees, T., Anjum, M. J., & Anum, A. (2020). Usability Engineering Process for Medical Devices. Paper presented at the Proceedings of the Future Technologies Conference (FTC) 2020, Volume 3, Cham. (Tayyaba Anees (Software Engineering/SST) Abstract: When designing the innovative technologies for point‐of‐care medical devices, use errors must be significantly considered, as use‐related errors can be very harmful for the patients. Reports stated that about one third of medical device incidents, reported in US Food and Drug Administration, occurred due to use error. The engineers must study usability engineering deeply, to make medical devices effective, for the native use environments and user populations related to medical device. This research uses process methodology, which describes the refining of usability engineering process. Data is gathered in both qualitative and quantitative
Research Outlook 2020 | 121
manner. Literature and used conventions are refined in this process to find an optimized way to perform usability engineering. This modified process employs the usability testing in parallel with the refined process. This increment in the standards of usability engineering will lessen the risk of human errors in medical devices. Keywords: usability engineering process cycle, medical devices, device design, usability testing, human factor engineering, ergonomics.
3. Abbas, T., Ali, S. F., Khan, A. Z., & Kareem, I. (2020, 5‐7 Nov. 2020). optNet‐50: An Optimized Residual Neural Network Architecture of Deep Learning for Driver's Distraction. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (Tahir Abbas, Syed Farooq Ali, Aadil Zia Khan, Irfan Kareem (Software Engineering/SST) Abstract: Over the last few decades, human facial recognition has gained significant popularity in areas ranging from surveillance, tracking, and access control to more recent developments in advertising, disease diagnosis, assistance to people requiring special needs and drivers' distraction detection. This study proposes a modified deep learning neural network architecture using Openpose library for a two‐category problem of distraction detection. Openpose library, detects the human face and draws 43 points on face skeleton, which is given to the deep network along with the input images. The proposed approach attains an accuracy of 98% on publicly available `State Farm Distracted Driver Detection' dataset and outperforms existing state‐of‐the‐art deep Residual Network architectures including ResNet‐50 and ResNet‐101. Keywords: Computer architecture, Deep learning, Vehicles, Residual neural networks, Libraries, Transforms, Skeleton.
4. Haq, I. U., Ali, G., Ghani, M. A. N. U., & Nadeem, A. (2020, 5‐7 Nov. 2020). Towards Gait Analysis and Rehabilitation of Parkinson's Disease Patients. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (M.Ahmad Nawaz Ul Ghani (Software Engineering/SST) Abstract: This paper aims at designing an efficient real‐time gait analysis algorithm to detect a possible fall. Four‐ meter Go and Back (4G) scale has been designed for taking measurements of experiments. Two wireless accelerometers are put on waist positions of 17 subjects suffering from Parkinson's disease. Based on information captured, a real‐time gait analysis algorithm is implemented to detect an ambulatory deviation. Furthermore, the proposed method is flexible to adjust to respond to the gait‐related movements. Other researchers can use this algorithm in their gait‐related studies. In this paper, different gait‐related parameters are also discussed and represented through a 4GB scale. Keywords: Parkinson's disease (PD), Gait Analysis, Algorithm, Rehabilitation, 4GB Scale.
5. Kareem, I., Ali, S. F., & Sheharyar, A. (2020, 5‐7 Nov. 2020). Using Skeleton based Optimized Residual Neural Network Architecture of Deep Learning for Human Fall Detection. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (Irfan Kareem, Syed Farooq Ali (Software Engineering/SST) Abstract: For the last few decades, human posture recognition has gained mammoth popularity specifically in elderly fall detection. This study proposes a modified deep learning neural network architecture using OpenPose library for two category problem of human fall detection. OpenPose library computes and draws 18 points skeleton on frames. The proposed approach achieves an accuracy of 97.46% on publicly available, standard Multi Camera Fall dataset and outperforms existing state‐of‐the‐art deep learning image classification Residual Network architectures ResNet‐50 and ResNet‐101 which have an accuracy of 94.63% and 70.18% respectively. Keywords: Human Posture, Residual Network, MCF dataset, Deep Architectures, ResNet‐50, ResNet‐101, OpenPose.
6. Yaqoob, M. K., Ali, S. F., Kareem, I., & Fraz, M. M. (2020, 5‐7 Nov. 2020). Feature‐based optimized deep residual Research Outlook 2020 | 122
network architecture for diabetic retinopathy detection. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (M Kashif Yaqoob, Syed Farooq Ali, Irfan Kareem (Software Engineering/SST) Abstract: For the last few decades, the detection of diseases using deep learning architecture has gained huge popularity specifically for diabetic retinopathy. This disease progresses at different levels so early detection is crucial. The study proposes feature‐based optimized deep learning neural network architecture for the detection of diabetic retinopathy. The features include a canny edge detector and histogram of oriented gradients. The proposed approach achieves an accuracy of 97.01% and 97.88% on publicly available, standard Messidor‐2 and EyePACS datasets of Diabetic Retinopathy and outperforms existing state‐of‐the‐art deep learning image classification Residual Network architectures of ResNet‐50 and Inception‐v3. Keywords: Deep Learning, Residual Network, Diabetic Retinopathy, Messidor‐2, EyePACS.
7. Amin, M. A., Jia, Y., Muhammad, F., H. Aaqib, M., Ahmad, A., & Rustam, M. A. (2020, 5‐7 Nov. 2020). Weak Grid Reactive Power Improvement and Voltage Control of MT‐HVDC Grid using APF. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (M. Aaqib H. (Software Engineering/SST) Abstract: In the present era, attention towards renewable energy resources has been growing due to the ever‐ growing energy demand and dwindling of fossil fuel reserves. In order to overcome these challenges, offshore energy resources and oil or gas resources integrated with AC power grid is getting popularity and multi‐terminal HVDC would be the more feasible solution for long‐distance electricity transmission. In this paper, a three‐ terminal grid‐connected MT‐HVDC grid is proposed in PSCAD/EMTDC software‐based simulation using conventional PQ control and its improved strategy using harmonic elimination while considering weak and stiff grids. By using this technique, the dynamic stability of the grid will be achieved. MT‐HVDC is connected through the radial configuration of DC cable. During DC side contingencies, the control structure of voltage source converter (VSC) shows a remarkable part to shape the fault current of MTDC. These results will contribute to addressing future challenges regarding MT‐HVDC smart grid. Keywords: MT‐HVDC (Multi‐terminal HVDC) grid, Voltage Source Converter (VSC), dq control structure, PLL synchronization.
8. Muhammad, F., Lei, W., Amin, M. A., Feng, W. D., H. Aaqib, M., & Faiz, M. T. (2020, 5‐7 Nov. 2020). Parameter Designing Method of Active Damping LCL Filter For Grid‐Connected Inverter. Paper presented at the 2020 IEEE 23rd International Multitopic Conference (INMIC). (M. Aaqib H. (Software Engineering/SST) Abstract: In the present era, attention towards renewable energy resources has been growing due to the ever‐ growing energy demand and dwindling of fossil fuel reserves. In order to overcome these challenges, offshore energy resources and oil or gas resources integrated with AC power grid is getting popularity and multi‐terminal HVDC would be the more feasible solution for long‐distance electricity transmission. In this paper, a three‐ terminal grid‐connected MT‐HVDC grid is proposed in PSCAD/EMTDC software‐based simulation using conventional PQ control and its improved strategy using harmonic elimination while considering weak and stiff grids. By using this technique, the dynamic stability of the grid will be achieved. MT‐HVDC is connected through the radial configuration of DC cable. During DC side contingencies, the control structure of voltage source converter (VSC) shows a remarkable part to shape the fault current of MTDC. These results will contribute to addressing future challenges regarding MT‐HVDC smart grid. Keywords: LCL filter, Active & Passive Damping, Gird Connected Inverter, Harmonics, Resonance Frequency, APF. Department of Informatics and Systems Research Articles 1. Mustahsan, M., Younas, H. M., Iqbal, S., Rathore, S., Nisar, K. S., & Singh, J. (2020). An Efficient Analytical
Research Outlook 2020 | 123
Technique for Time‐Fractional Parabolic Partial Differential Equations. Frontiers in Physics, 8(131). doi: 10.3389/fphy.2020.00131. (Shaukat Iqbal (INFS/SST) Abstract: In this work, we examine time‐fractional fourth‐order parabolic partial differential equations with the aid of the optimal homotopy asymptotic method (OHAM). The 2nd order approximate results obtained by using the suggested scheme are compared with the exact solution. It has been noted that the results achieved via OHAM have a large convergence rate for the problems. The solutions are graphically analyzed, and the relative errors are presented in tabular form. Keywords: approximate solutions, fractional calculus, TFPPDE, OHAM, convergence.
2. Naz, T., Akhtar, M., Shahzad, S. K., Fasli, M., Iqbal, M. W., & Naqvi, M. R. (2020). Ontology‐driven advanced drug‐drug interaction. Computers & Electrical Engineering, 86, 106695. doi: https://doi.org/10.1016/j.compeleceng.2020.106695. (Syed Khuram Shahzad(INFS/SST) Abstract: The rapid growth of data in the pharmaceutical area has created new challenges for large‐scale data mining like Drug‐Drug Interaction (DDI) analysis. To meet these challenges, various types of data related to DDI must be integrated with true semantics. However, the existing tools do not provide automated DDI analysis. Interaction details are not machine readable and pharmacists need to do further processing for its extraction. This research paper proposed an ontology‐driven Advanced Drug‐Drug Interaction (ADDI) system to assists the physicians and pharmacists to identify the DDI effects. ADDI provides ontological definitions and semantic relations among diseases, drugs, ingredients, action mechanism, physiologic effect, dosage formation, administration methods, DDI mechanism, DDI types (Antagonism, Synergism, Potentiation, and Interaction with metabolism), DDI reactions, their frequency and duration. It can be used as Semantic Information Layer (SIL) to resolve the heterogeneity problem and can play a significant role to remove the barriers for semantic interoperability. Keywords: drug‐drug interaction, pharmacy semantics, drug ontologies, pharmaceutical informatics.
3. Ahmad, A., Jin, Y., Zhu, C., Javed, I., Waqar Akram, M., & Buttar, N. A. (2020). Support vector machine based prediction of photovoltaic module and power station parameters. International Journal of Green Energy, 17(3), 219‐232. doi: 10.1080/15435075.2020.1722131. (Iqra Javed (INFS/SST) Abstract: The uncertainty in the output power of the photovoltaic (PV) power generation station due to variation in meteorological parameters is of serious concern. An accurate output power prediction of a PV system helps in better design and planning. The present study is carried out for the prediction of output power of PV generating station by using Support Vector Machines. Two cases are considered in the present study for prediction. Case‐I deals with the prediction of PV module parameters such as V oc ,I sh ,R s ,R sh ,I max ,V max ,P max , and case‐II deals with the prediction of power generation parameters such as P DC, P AC , and system efficiency. Historical data of PV power station with an installed capacity of 10 MW and weather information are used as input to develop four different seasons‐based SVM models for all parameters. The performance results of the models are presented in terms of Mean Relative Error (MRE) and Root Mean Square Error (RMSE). Additionally, the performance results obtained with polynomial and Radial Based Function kernel are also compared to show that which kernel has better prediction accuracy, and practicability. The result shows that the minimum average RMSE and MRE for case‐I with Radial Based Function kernel are 0.034%, 0.055%, 0.002%, 1.726%, 0.044%, 0.047%, 2.342%, and 0.005%, 0.014%, 0.079%, 0.885%, 0.005%, 0.007%, 0.013%, and for case‐II with poly kernel are 0.014%, 0.016%, 0.149% and 0.011%, 0.0175, 1.03%, respectively. The present study will be helpful to provide technical guidance to the prediction of the PV power System. Keywords: photovoltaic system, power prediction, seasonal classification, support vector machine, support vector regression.
Research Outlook 2020 | 124
4. Ahmad, A., Jin, Y., Zhu, C., Javed, I., & Waqar Akram, M. (2020). Investigating tension in overhead high voltage power transmission line using finite element method. International Journal of Electrical Power & Energy Systems, 114, 105418. doi: https://doi.org/10.1016/j.ijepes.2019.105418. (Iqra Javed (INFS/SST) Abstract: Transmission line failure is a serious problem in developing countries. The major cause of high voltage overhead transmission line failure in power system is prolonged excessive current. The determination of line segments where high tension is generated due to prolonged excessive current under the different arrangements of line spacing and current carrying conditions can lead us to analyze high tension zones for efficient design of transmission lines. In this context, the mechanical tension on an overhead high voltage electrical power transmission line resulting from excessive or normal currents was computed using Finite Element Method. Multiple segments of a long transmission line with symmetrical and unsymmetrical spacing under accidental and normal line current are examined. Therein, the line segments with high tension are determined. Maximum integrated tension is found in middle segments of both symmetrical and unsymmetrical spaced transmission line. While, maximum per unit tension is found in initial and bottom segments. However, variation in magnitude is found for symmetrical and unsymmetrical spacing. The present study may provide technical guidance to the transmission line design engineers and technicians regarding the risk and solutions related to electrical power transmission line systems. Keywords: finite element method, power transmission linetension, symmetrical spacing, unsymmetrical spacing, accidental current.
5. Zahid, A. H., Al‐Solami, E., & Ahmad, M. (2020). A Novel Modular Approach Based Substitution‐Box Design for Image Encryption. IEEE Access, 8, 150326‐150340. doi: 10.1109/ACCESS.2020.3016401. (Amjad Hussain Zahid (INFS/SST) Abstract: In modern‐day block ciphers, the role of substitution‐boxes is to transform the plaintext data nonlinearly to generate ciphertext data with sufficient confusion. It has been well‐confirmed that the robustness and security of such block ciphers heavily based on the cryptographic strength of the underlying substitution‐ boxes. Reason being, they are the only components that are held responsible to bring required nonlinearity and complexity into the security system which can frustrate the attackers. Accordingly, a number of different concepts have been explored to construct strong S‐boxes. To move forward with the same aim, a novel simple modular approach, the very first time, is investigated to construct nonlinear S‐box in this paper. The proposed new modular approach consists of three operations such as new transformation, modular inverses, and permutation. A number of highly nonlinear S‐boxes can be easily constructed with slight changes in the novel transformation parameters. An example S‐box is presented whose critical performance assessment against some benchmarking criterions such as high nonlinearity, absence of fixed points, fulfillment of SAC and BIC properties, low differential uniformity and linear approximation probability and comparison with recent S‐boxes demonstrate its upright cryptographic potentiality. In addition, an image encryption algorithm is also proposed wherein the generated S‐box is applied to perform the pixels shuffling and substitution for strong statistical and differential encryption performance. Keywords: Substitution‐box, modular approach,linear transformation,image encryption,block cipher.
6. Gul, M., Kalam, M. A., Mujtaba, M. A., Alam, S., Bashir, M. N., Javed, I., . . . Iqbal, S. (2020). Multi‐objective‐ optimization of process parameters of industrial‐gas‐turbine fueled with natural gas by using Grey‐Taguchi and ANN methods for better performance. Energy Reports, 6, 2394‐2402. doi: https://doi.org/10.1016/j.egyr.2020.08.002. (Iqra Javed (INFS/SST) Abstract: Gas‐turbines are widely utilized in the power generation sectors as these require low operational cost, have very good efficiencies among other turbines, and produce less pollution but required to improve their performances further. This study used efficient and simple optimization methods of grey Taguchi and ANN to Research Outlook 2020 | 125
enhance gas turbine performance. The objective was to increase ηth, horsepower, and to decrease SFC and heat release of the industrial gas turbine (model # T‐4502) by optimizing different levels of input process parameters by gyey‐Taguchi method. Finally, air inlet temperature of 28.8 °C,14400 rpm and cartridge filter were found as optimal input parameters at which gas turbine’s performance improved with less consumption of natural gas. Moreover, ANOVA analysis revealed that ‘air‐inlet‐temperature’ is the dominant and ‘type of air‐inlet‐filter’ is the least effective process parameter with 71.17% and 1.40% impacts on the output parameters of the gas turbine. Confirmatory test was carried out experimentally and by ANN at suggested optimal level of input parameters, satisfactory results obtained which validates the effectiveness of the grey‐Taguchi‐method. Keywords: gas turbine, grey taguchi optimization, grey relational analysis, anova analysis, artificial neural networking.
7. Manzoor, T., Zafar, M., Iqbal, S., Nazar, K., Muddassir, A., Saleem, M., . . . Woo Young, K. (2020). Theoretical Analysis of Roll‐Over‐Web Surface Thin Layer Coating. Coatings, 10(7), 691. doi: http://dx.doi.org/10.3390/coatings10070691. (Shaukat Iqbal (INFS/SST) Abstract: This study presents the theoretical investigation of a roll‐over thin layer formation under the lubrication approximation theory. The set of differential equations derived by lubrication approximation is solved by the optimal homotopy asymptotic method (OHAM) to obtain precise expressions for pressure and velocity gradients. Critical quantities such as velocity, pressure gradient, and coating layer depth are numerically estimated. The impact of parameters affecting the coating and layer formation is revealed in detail. Results indicate that the transport properties of the higher‐grade fluid play an essential role in regulating velocity, pressure, and the final coated region. Moreover, couple stress effects on the properties of fluid particles to be coated on roller‐surface have also been studied. Keywords: roll‐over‐web coating, couple stress fluid, lubrication approximation theory, optimal homotopy asymptotic method (OHAM).
8. Sarwar, S., Sirhindi, R., Aslam, L., Mustafa, G., Yousaf, M. M., & Jaffry, S. W. U. Q. (2020). Reinforcement Learning Based Adaptive Duty Cycling in LR‐WPANs. IEEE Access, 8, 161157‐161174. doi: 10.1109/ACCESS.2020.3021016. (Ghulam Mustafa (INFS/SST) Abstract: For conserving energy, duty cycle is defined by setting up the active and sleep periods of network nodes. In beacon enabled networks, to provide support for duty cycle, the IEEE 802.15.4 standard uses optional super‐frame structure. This duty cycle is usually fixed and does not consider the topology changes that often occur in dynamic sensor networks. In this paper, existing energy conserving duty cycling approaches for 802.15.4 networks especially the adaptive duty cycling techniques for wireless sensor networks are summed up. Also, this paper highlights the shortcomings of the proposals in the literature, such as induced additional latency, so that they may not support the practical scenarios of Internet of Things (IoT). Further, this study highlights a gross shortcoming that relative performance comparison of RL‐based proposals cannot be performed without using a benchmarking framework and real test‐bed environment. In this paper, we have presented the future research directions that would lay the foundation for successful development of energy efficient RL‐based duty‐cycling techniques. Keywords: duty cycling, reinforcement learning, super frame parameters.
9. Sattar, M. U., Palaniappan, S., Lokman, A., Shah, N., Khalid, U., & Hasan, R. (2020). Motivating Medical Students Using Virtual Reality Based Education. International Journal of Emerging Technologies in Learning (iJET), 15(2), 160‐174. (Mian Usman Sattar (INFS/SST) Abstract: An exploratory study to compare the effects of immersive virtual reality based training on the learning motivation of final year medical students as compared to video and text‐based learning. Different modes of Research Outlook 2020 | 126
delivery of a training simulation of laparoscopy operation were presented to students and learning motivation corresponding to which were evaluated using the Intrinsic Motivation Inventory. The study was conducted from September 2018 to May 2019. Undergraduate medical students from 8 medical colleges and universities across Punjab, Pakistan participated in this study. A total of 87 students with a mean age of 22.5 ± 4 years were recruited for the study. Of these, 57.4% (n = 50) were males and 42.6% (n = 37) were females. Paired sampled t‐test was chosen for the statistical investigation for the study. The tests were conducted by comparing means of text, video, and virtual reality learning methodologies in medical students. All executed statistical models are having significance value P=.000. Therefore, results are generalizable and can be implemented across the population. Medical student motivation was observed to be the greatest in Virtual Reality settings as compared to video‐ based and text‐based learning settings. Both theoretical and practical studies have importance in medical studies, whereas practical hand‐on‐practice can enhance medical students’ professional proficiency. Virtual reality was at the top in User experience, perceived competence, usefulness, and motivation for final year medical students. It can play a signficant role in contemporary teaching and learning methodology with medical educationist and students can get benefit from this technology. Keywords: Virtual Reality (VR), Learning Motivation, Medical Simulations, Intrinsic Motivation Inventory (IMI).
10. Tanveer, M., Zahid, A. H., Ahmad, M., Baz, A., & Alhakami, H. (2020). LAKE‐IoD: Lightweight Authenticated Key Exchange Protocol for the Internet of Drone Environment. IEEE Access, 8, 155645‐155659. doi: 10.1109/ACCESS.2020.3019367. (Amjad Hussain Zahid (INFS/SST) Abstract: A drone is an unmanned aerial vehicle, which is deployed in a particular Fly Zone (FZ), and used to collect crucial information from its surrounding environment to be transmitted to the server for further processing. Generally, a Mobile User (MU) is required to access the real‐time information collected by the drone stationed in a specific FZ securely. Therefore, to ensure secure and reliable communications an Authenticated Key Exchange (AKE) protocol is imperative to the Internet of Drone (IoD) environment. An AKE scheme ensures only authentic MU to access IoD network resources. Upon successful authentication, MU and drone can set up a secret session key for secure communication in the future. This paper presents a novel Lightweight AKE Protocol for IoD Environment (LAKE‐IoD), which first ensures the authenticity of MU and also renders session key establishment mechanism between MU and drone with the help of a server. LAKE‐IoD is an AKE protocol, which is based on an authenticated encryption scheme AEGIS, hash function, and bit‐wise XOR operation. Meticulous formal security verification by employing a software tool known as Scyther and informal security analysis demonstrates that LAKE‐IoD is protected against different well‐known active and passive security attacks. Additionally, Burrows‐Abadi‐Needham logic is applied to verify the logical completeness of LAKE‐IoD. Furthermore, a comparison of LAKE‐IoD with the related schemes shows that LAKE‐IoD incurs less communication, computational and storage overhead. Keywords: internet of drone, authenticated key exchange, lightweight cryptography, unmanned aerial vehicles, security and privacy. 11. Ahmad, A., Jin, Y., Zhu, C., Javed, I., Maqsood, A., & Akram, M. W. (2020). Photovoltaic cell defect classification using convolutional neural network and support vector machine. IET Renewable Power Generation, 14(14), 2693‐2702. https://digital‐library.theiet.org/content/journals/10.1049/iet‐ rpg.2019.1342. (Iqra Javed (INFS/SST) Abstract: Automatic defect classification in photovoltaic (PV) modules is gaining significant attention due to the limited application of manual/visual inspection. However, the automatic classification of defects in crystalline silicon solar cells is a challenging task due to the inhomogeneous intensity of cell cracks and complex background. The present study is carried out for automatic defects classification of PV cells in electroluminescence images. Two machine learning approaches, features extraction‐based support vector machine (SVM) and convolutional neural network (CNN) are used for the solar cell defect classifications. Suitable hyperparameters, algorithm Research Outlook 2020 | 127
optimisers, and loss functions are used to achieve the best performance. Solar cell defects are divided into seven classes such as one non‐defective and six defective classes. Feature extraction algorithms such as histograms of oriented gradients (HOG), KAZE, Scale‐Invariant Feature Transform (SIFT) and speeded‐up‐robust features (SURF) are used to train the SVM classifier. Finally, the performance results are compared. It is concluded that CNN's accuracy for solar cell defect classification is 91.58% which outperforms the state‐of‐the‐art methods. With features extraction‐based SVM, accuracies of 69.95, 71.04, 68.90, and 72.74% are obtained for HOG, KAZE, SIFT, and SURF, respectively. The present study may contribute to making a PV system more efficient for classifying defects to improve the power system efficiency. Keywords: silicon, inspection, solar cells, neural nets, feature extraction, pattern classification, image classification, support vector machines, learning (artificial intelligence). Conference Proceedings 1. Hasan, R., Palaniappan, S., Mahmood, S., Naidu, V. R., Agarwal, A., Singh, B., . . . Sattar, M. U. (2020, 2020//). A Review: Emerging Trends of Big Data in Higher Educational Institutions. Paper presented at the Micro‐Electronics and Telecommunication Engineering, Singapore. (Mian Usman Sattar (INFS/SST) Abstract: Universities/higher educational institutions are finding ways to increase the student‐faculty interactions beyond the traditional classroom, helping institutions to gather the information to enhance the student learning experiences with the help of learning analytics. These interactions are captured using the virtual learning environment through which institutions learn from the student interactions and behavioral patterns within those systems. This helps the institutions for better retention rate, prediction of the results and focus on weak students. Many institutions have placed an early detection system for management and faculty to engage with the students and figure out the problems faced by the students and provide a remedy to improvise for the faculty members. Most of the institutions rely mainly on one system such as the learning management system to capture the student interactions thus creating a gap. The Internet gives an edge to its users for practicing, learning, by doing, this leads to the emergence of video‐based learning technologies that are practiced and used in several ways, such as flipped classrooms. Student faces a doubt often in their phase of learning, to clear their doubts they refer to multiple sources to get the information and knowledge. These videos provide complete skill sets, students due to lack of skill set they use these sources for their specific problems. This paper discusses literature and background studies on the big data used in institutions of higher education. It establishes a framework based on the latest trends in this area that can help stakeholders to predict their business needs. Keywords: learning analytics, big data, virtual learning environment, learning management system, education data mining, prediction.
2. Tahir, M. U., Naqvi, M. R., Shahzad, S. K., & Iqbal, M. W. (2020, 22‐23 Feb. 2020). Resolving Data De‐ Duplication issues on Cloud. Paper presented at the 2020 International Conference on Engineering and Emerging Technologies (ICEET). (Syed Khuram Shahzad(INFS/SST) Abstract: Data de‐duplication refers to provide the cloud providers a way to manage the uncontrollable data and the challenges of cloud storage. The success of IOT and social media led us to face big data challenges. Big data is interesting but also becomes a critical challenge for cloud service providers. Data storage and management become also the topic of discussion where big data generate opportunity for business as well as come with big issues for the cloud providers. In this paper, we discussed the issues of redundant data and techniques to prevent the data redundancy on the cloud. Version control system for data de‐duplication is also discussed for the solution of this problem. Keywords: de‐duplication on the cloud, big data management, cloud computing, data management.
3. Naqvi, M. R., Jaffar, M. A., Aslam, M., Shahzad, S. K., Iqbal, M. W., & Farooq, A. (2020, 26‐28 June 2020).
Research Outlook 2020 | 128
Importance of Big Data in Precision and Personalized Medicine. Paper presented at the 2020 International Congress on Human‐Computer Interaction, Optimization and Robotic Applications (HORA). (Syed Khuram Shahzad(INFS/SST) Abstract: The rapidly increasing adaptation of Big data technologies in biomedicine, has introduced a revolution in and medical research practice. Trending high‐throughput data analysis techniques, have converted the appearance of the biological system to acquire idolization methods for complicated diseases. Majority of the acquired Big‐data models govern the materialization of illustrating medicine. This transformation aims at quantification of the period of P4 medicine that will then progressively be more predictive, personalized, pre‐ emptive, and participatory. It layouts a track to modernize antiseptic methods for the patient’s concern center. P4 medicine besides being a scientific face of systems medicine has two highlighted purposes first of which is to evaluate wellness, while the other is, to identify and expose disease. Patients are major operators in the cognizance of P4 medicine as they directly get engaged with a medically familiar network that helps them boost their health. This article will discuss the maturity in big data planning and correlated challenges in biomedicine. Keywords: big data analytics, medical records, genomics data, P4, P5 medicine.
4. Naqvi, M. R., Aslam, M., Iqbal, M. W., Shahzad, S. K., Malik, M., & Tahir, M. U. (2020, 26‐28 June 2020). Study of Block Chain and its Impact on Internet of Health Things (IoHT):Challenges and Opportunities. Paper presented at the 2020 International Congress on Human‐Computer Interaction, Optimization and Robotic Applications (HORA). (Syed Khuram Shahzad(INFS/SST) Abstract: Blockchain has been making some vital progress in these days because of its secure and amiable structure. It is a distributed and decentralized database that deals with transactions. The blockchain is also emerging in the healthcare sector rapidly. Healthcare has now become a prestigious part of our life as it is making life‐changing innovations day by day whether it is about artificial intelligence influence in the diagnostic system, expert system, patient’s data storage, retrieval, security, and any other healthcare smart services. Smart health data is the most important ingredient to help us in solving our healthcare needs. Many researchers are now emerging blockchain in smart health because of its secure, flexible, and reliable architecture. In this paper, the major progress made in implementing the blockchain and its vulnerabilities are discussed in the area of smart health. The major focus is on the issues of patient’s electronic health record, retrieval, security, and interoperability in Internet of Health Things (IoHT). Keywords: Blockchain, data analysis, data retrieval, EHR systems, IoHT, immutability, Smart health.
5. Naqvi, M. R., Shahzad, S. K., Iqbal, M. W., Ahmed, M., Tahir, M. U., & Khan, B. A. (2020, 22‐24 Oct. 2020). Need for Computational and Psycho‐linguistics Models in Natural Language Processing for Web Documents. Paper presented at the 2020 4th International Symposium on Multidisciplinary Studies and Innovative Technologies (ISMSIT). (Syed Khuram Shahzad(INFS/SST) Abstract: Natural Language Processing (NLP) is an argument that provokes territory of figural manner for motorized scrutiny and depiction of humane language. Research in it unfolded from the term of punch cards till the age of intelligent examination engines which takes less than a second to Figure out millions of web pages and digital documents. In the web, pieces of evidence and end‐users produced content to have formerly stimulated text. The obligation of advantageous and astute content driving is decisive forthwith. Consequently, the web is being treated as a foremost source of evidence brought about the extensive extent of a probe to perceive the compass of the machine. Considering the democratization of online content formulation, it has skeptically influenced the information resurgence and eradication. This paper pulls contemporary developments in the NLP probe to perceive the scope of machine learning in a modern era to avoid ramification of adverse instructions. Keywords: Natural language processing, Computational and psycholinguistics models, Web documents, Cortana, Siri, Google Assistant ALO. Research Outlook 2020 | 129
6. Rashid, U., Iqbal, M. W., Skiandar, M. A., Raiz, M. Q., Naqvi, M. R., & Shahzad, S. K. (2020, 22‐24 Oct. 2020). Emotion Detection of Contextual Text using Deep learning. Paper presented at the 2020 4th International Symposium on Multidisciplinary Studies and Innovative Technologies (ISMSIT). (Syed Khuram Shahzad(INFS/SST) Abstract: In recent years, the data in the form of text is created in very huge amount in day to day conversation on social media. We need a naive approach to analyzed and summarized data to extract meaningful information. Textual dialogue is given in contextual emotion detection. We have to recognize user emotions either it is happy, sad, angry or others. This paper describes Aimens system which detect emotions from textual dialogues. This system used the Long short term memory (LSTM) model based on deep learning to detect the emotions like happy, sad and angry in contextual conversation. The main input to the system is a combination of word2vec and doc2vec embeddings. The output results are shown substantial changes in f‐scores over the model baseline where Aimens system score is 0.7185. Keywords: Contextual Conversation, Emotion Detection , Happy, LSTM, Machine Learning. School of Engineering (SEN) Department of Mechanical Engineering Research Articles 1. Al Rashid, A., Imran, R., & Khalid, M. Y. (2020). Determination of opening stresses for railway steel under low cycle fatigue using digital image correlation. Theoretical and Applied Fracture Mechanics, 108, 102601. doi: https://doi.org/10.1016/j.tafmec.2020.102601. (Muhammad Yasir Khalid (Mechanical Engineering/SEN) (SKT Campus) Abstract: Crack closure phenomenon is important to study as it provides an estimation to fatigue life of the components. It becomes even more complex under low cycle fatigue (LCF), since under LCF high amount of plasticity is induced within the material near notches or defects, as a result the assumptions used by linear elastic fracture mechanics (LEFM) approach become invalid. Evaluation of opening stresses for mechanical components undergoing LCF phenomenon requires a robust methodology to correctly predict the fatigue life. In this study, an experimental campaign was carried out for determination of opening stresses of railway steels (25CrMo4 and 30NiCrMoV12) subjected to LCF using digital image correlation (DIC) technique. The concept of crack opening displacement (COD) was used for the analysis. Two different methodologies were introduced to analyze experimental data for the identification of opening levels. Experimental results were then compared with crack closure prediction model, Newman model. Results from Newman model agreed well with the experimental
analysis. Newman model provided very good prediction for strain ratio Rε = −1, however, for the materials
undergoing strain ratio Rε = 0, stress ratio must be considered rather than strain ratio, because Newman model can’t predict stress relaxation behaviour. Keywords: crack closure, crack propagation, digital image correlation, low cycle fatigue, non‐contact testing, opening stresses.
2. Rashid, A. A., Khalid, M. Y., Imran, R., Ali, U., & Koc, M. (2020). Utilization of Banana Fiber‐Reinforced Hybrid Composites in the Sports Industry. Materials, 13(14), 3167. doi: http://dx.doi.org/10.3390/ma13143167. (Muhammad Yasir Khalid, Ramsha Imran, Umair Ali (Mechanical Engineering/SEN) Abstract: The sports industry is an ever‐growing sector worldwide. With technological advancements in information technologies, the sports industry has merged with the entertainment industry, reaching and influencing billions of people globally. However, to ensure and advance the safety, security, and sustainability of the sports industry, technological innovations are always needed in several manufacturing and materials processes to achieve cost‐effectiveness, efficiency, durability, reusability, and recyclability of products used in Research Outlook 2020 | 130
this industry. For example, 90% of the field hockey equipment produced in the world comes from Sialkot, Pakistan. Most export quality field hockey equipment is currently produced via reinforcement of glass/carbon fibers in epoxy resin. The current study aimed to introduce new materials for field hockey equipment to reduce manufacturing costs and the environmental impact of synthetic materials, without comprising the quality of the final product. Our literature review on natural fibers revealed that they offer excellent and compatible mechanical properties. Based on extensive experimental studies, we concluded that banana fiber reinforced hybrid composites could be an alternative to pure glass fiber reinforced composites, with comparable and even higher load withstanding capabilities. Using banana fiber reinforced hybrid composites for the fabrication of hockey products would cut costs and lower the environmental impact stemming from the uses of biodegradable organic materials. It will also lead to the development of a domestic economy based on domestic resources. Keywords: hockey, banana fiber‐reinforced composites, hybrid composites, finite element analysis.
3. Azeem, M. A., Arif, Z. U., Shah, M., Ehtsham‐ur‐Rehman, & Tariq, A. (2020). Influence of liquid nitrogen on residual circumferential distortion, weld penetration and delta‐ferrite distribution in clamped tungsten inert gas welded butt joint of 316 stainless steel. SN Applied Sciences, 2(10), 1640. doi: 10.1007/s42452‐020‐03446‐y. (Zia Ullah Arif, Ehtsham ur Rehman (Mechanical Engineering/SEN) (SKT Campus) Abstract: AISI 316 stainless steel (SS316) is an attractive material for industrial applications. Welding of this alloy can lead to severe distortion that often results in dimensional inaccuracies. With the help of specially designed fxture and clamping mandrels, tungsten inert gas (TIG) welding on SS316 pipes is employed to investigate the efect of liquid nitrogen on the circumferential distortion, weld penetration and delta‐ferrite distribution in diferent welding zones. The experimental results reveal that the presence of trailing heat sink in TIG welded butt joint has almost zero distortion at a distance of 30 mm from the weld centerline and 64% decrement in residual circumferential distortion at the center of the weld bead. A metallurgical microscope is used to fnd the weld penetration, (fusion zone) FZ and (heat afected zone) HAZ. The results illustrate that increase in current and the presence of intensive cooling media yield deeper penetration in TIG welding. Liquid nitrogen (LN2) also constricts the FZ and HAZ. Instead of evaluating delta‐ferrite contents using the ferrite number technique, a MATLAB® code for image processing is developed to evaluate the delta‐ferrite distribution in the diferent regions of a single‐pass weldment. Delta‐ferrite contents are maximum in the presence of intensive cooling media near HAZ and increase with an increase in the current value. Hence, TIG welding with LN2 as trailing heat sink is the most suitable scheme to weld industrial pipes owing to its higher weld penetration, higher delta‐ferrite contents and minimum circumferential distortion. Keywords: TIG welding, Trailing heat sink, Liquid nitrogen, Circumferential distortion, Weld penetration, Delta‐ ferrite contents. Department of Electrical Engineering Research Articles 1. Ullah, I. (2020). Fiber‐based daylighting system using trough collector for uniform illumination. Solar Energy, 196, 484‐493. doi: https://doi.org/10.1016/j.solener.2019.12.052. (Irfan Ullah (Electrical Engineering/SEN) Abstract: A lot of research attention has been given to collect sunlight through solar concentrators for indoor illumination. Traditional, parabolic trough as a line focus with single array of fibers had mechanical design and installation issues. Here, a novel daylighting system is proposed to transmit maximum light into the optical fibers using parabolic trough as the primary collector and nonimaging reflector as the secondary reflector. The proposed system increases light levels, improves installations difficulties, and maintains long‐term reliability. All modules are designed and verified through raytracing simulation for calculating the efficiency and achieving the required light‐levels. The proposed trough‐based design inserts maximum light into the fiber bundle, which is
Research Outlook 2020 | 131
placed at the center of the trough. Further, the fiber‐coupled bi‐layer prismatic optical diffuser provides relatively high uniform illuminance distribution. Simulation results have shown that the light concentration of 285, an optical efficiency of 42%, and an acceptance angle of ± 1.1° are achieved that are better than that of previous troughbased daylighting system. Keywords: parabolic trough, optical fiber, daylighting, indoor illumination.
2. Asim, M., Saleem, S., Imran, M., Leung, M. K. H., Hussain, S. A., Miró, L. S., & Rodríguez, I. (2020). Thermo‐economic and environmental analysis of integrating renewable energy sources in a district heating and cooling network. Energy Efficiency, 13(1), 79‐100. doi: 10.1007/s12053‐019‐09832‐9. (Muhammad Asim (Electrical Engineering/SEN) Abstract: This paper presents the technical, environmental, and economic evaluation of integrating various combinations of renewable energy sources‐based systems in the expansion of a district heating and cooling network of a Technology Park near Barcelona in Spain. At present, a combined heat and power plant running on fossil fuels serves the heating, cooling, and electricity demand of the Park. However, this energy demand is expected to increase substantially in the coming years. EnergyPRO software was used to model the energy demand growth till 2030. Validation of the software application was done by making a base model using real plant data from the year 2014. The software was then used to project the energy supply based on three 15‐year scenarios, having different combinations of renewable energy technologies, from 2016 until 2030. Primary
energy consumption, CO2 emissions, and the net present value obtained in each scenario were used to decide the best combinations of renewable energy sources. The results of the study showed that presently, biomass boilers combined with absorption chillers and supported with solar thermal cooling are the most competitive technologies in comparison to ground source heat pumps for large DHC networks. This is mainly because of the lower primary energy consumption (624,380 MWh/year in 2030 vs. 665,367 MWh/year), higher net present
value (NPV) (222 million € vs. 178 million €), and lower CO2 emissions (107,753 tons/year in 2030 vs. 111,166 tons/year) obtained as a result of the simulations. Keywords: district heating and cooling, renewable energy integration, energy efficiency, feasibility study, techno‐ economic evaluation.
3. Ayub, M., Atiq, S., Ali, Q., Hussain, A., & Kwon, B. (2020). Dual‐Mode Wound Rotor Synchronous Machine for Variable Speed Applications. IEEE Access, 8, 115812‐115822. doi: 10.1109/ACCESS.2020.2999609. (Asif Hussain (Electrical Engineering/SEN) Abstract: This paper presents a novel dual‐mode wound rotor synchronous machine (DWRSM) for variable speed applications. The proposed machine combines the advantages of both the conventional wound rotor synchronous machine (CWRSM) and the brushless wound rotor synchronous machine (BWRSM). Unlike the existing BWRSM, through the dual‐mode operation of the proposed machine, constant torque is achieved in the constant torque region by operating the machine in mode‐I, i.e., as a CWRSM, and constant power is achieved in the field weakening region by operating the machine in mode‐II, i.e., as a BWRSM. The mode change is performed through an additional thyristor drive circuit. The airgap magnetomotive force (MMF) in both modes is derived analytically. To verify this principle, finite element analysis (FEA) and an experiment on a 1‐ horsepower prototype machine was performed, and key influential factors were verified. The transients in the stator currents and torque during the mode change was analyzed. The test results validated the correctness of the theory and the FEA results. Keywords: brushless, dual‐mode, harmonic winding, sub‐harmonic, wound rotor synchronous machine.
Research Outlook 2020 | 132
4. Ayub, M., Hussain, A., Sirewal, G. J., & Kwon, B.‐i. (2020). Wye‐delta winding configuration for brushless operation of a wound field synchronous machine. International Journal of Applied Electromagnetics and Mechanics, 64, (1‐4), 1165‐1172. doi: 10.3233/JAE‐209433. (Asif Hussain (Electrical Engineering/SEN) Abstract: This manuscript proposes a wye‐delta winding configuration for brushless operation of a wound field synchronous machine (BL‐WFSM). In existing third harmonically excited BL‐WFSM topologies, the additional third harmonic component of the stator magnetomotive force (MMF) was produced by an extra thyristor drive circuit or by utilizing an additional inverter. In the proposed single inverter topology, the stator winding is divided into two coil sets: the wye coil and delta coil. Triplen harmonic currents are produced owing to the delta coils set and start to circulate in the delta coils. This triplen harmonic circulating currents produce a triplen harmonic pulsating MMF in the airgap. The additional triplen harmonic pulsating MMF induces voltage in the rotor harmonic winding. This induced voltage in the harmonic winding is used to excite the rotor field. A 2D finite element analysis is performed, and the simulation results confirmed the operation principle of the proposed brushless topology. Keywords: brushless, delta coils, MMF, triplen harmonic, wye coils, WFSM.
5. Saleem, M. S., Abas, N., Kalair, A. R., Rauf, S., Haider, A., Tahir, M. S., & Sagir, M. (2020). Design and optimization of hybrid solar‐hydrogen generation system using TRNSYS. International Journal of Hydrogen Energy, 45(32), 15814‐15830. doi: https://doi.org/10.1016/j.ijhydene.2019.05.188. (Muhammad Shoaib Saleem, Aun Haider (Electrical Engineering/SEN) (SKT Campus) Abstract: Solar thermal systems are an efficient utilization of solar energy for hot water and space heating at domestic level. A Solar Water Heater (SWH) incorporating an Evacuated Glass Tube Collector (EGTC) is simulated using TRNSYS software. Efficiency parameters are pointed, and a parametric optimization method is adopted to design the system with maximum conceivable efficiency. In the first part, the selection of refrigerant for heat transportation in SWH loop is presented. A set of 15 working fluids are chosen, and their chemical properties are computed using NIST standard software (REFPROP). The selected working fluids are tested in the system under
study and plots for energy gain and temperature are plotted using TRNSYS. Results showed that ammonia (NH3) having specific heat 4.6kJ/kg‐K and fluid thermal conductivity 2.12 kJ/hr‐m supplies peak energy gain of 7500 kJ/h in winter and 8900 kJ/h in summer season along 120 °C temperature rise. On the other hand, R‐123 having specific heat 0.65kJ/kg‐K and fluid thermal conductivity 0.0293kJ/hr‐m showed inferior performance during the simulation. A solar‐hydrogen co‐generation system is also designed and simulated under low solar insolation and warm climate regions to study annual hydrogen produced by the hybrid system. System comprises main components: a PV array, an electrolyzer, a fuel cell, a battery, a hydrogen storage unit and a controller in the complete loop. Results of Hydrogen cogeneration system provide 7.8% efficiency in the cold climate of Fargo North Dakota state due to lower solar insolation. While hot climate condition of Lahore weather provides efficiency of 11.8% which satisfy the statistics found in literature. Keywords: TRNSYS, solar water heater, evacuated glass tube collector, hydrogen energy.
6. Rehman, B., Liu, C., Wei, W., Fu, C., & Li, H. (2020). Applications of eigenvalues in installation of multi‐infeed HVDC system for voltage stability. International Transactions on Electrical Energy Systems. 30(12). e12645. doi: https://doi.org/10.1002/2050‐7038.12645. (Bilawal Rehman (Electrical Engineering/SEN) (SKT Campus) Abstract: This research work provides a practical approach to install High Voltage Direct Current (HVDC) link in close vicinity of an existing HVDC system. The work establishes eigenvalue‐based approach using modal analysis to give voltage stability conditions for multi‐infeed scenario. A detailed analysis of steady state and transient behavior of multi‐infeed HVDC system is provided to understand the influence of network impedances. Minimum eigenvalue of AC‐DC Jacobian matrix is taken as index to determine stability using a realistic multi‐infeed HVDC model. Newton Raphson technique is applied to calculate bus angle and voltage for accurate stability analysis. Research Outlook 2020 | 133
The inter‐converter interaction of multi‐infeed HVDC severely affects the performance of AC/DC network. So, it is of great importance to study multi‐infeed phenomena with a systematic way to minimize the risk of adverse results. Practical applications of proposed scheme are provided. It has been examined that the behavior of positive eigenvalue largely depends on coupling impedance while impedance between AC busbar and inverters show less control on region of stability. With increase in coupling impedance, multi‐infeed interaction factor reduces which reflects less transient over voltage, commutation failure, and stability like problems. Various case studies are provided regarding network impedances to make system voltage stable. The results show that eigenvalues are greatly influenced by associated network impedances. The simulations are performed in MATLAB and PSCAD/EMTDC to verify the analytical results. Keywords: eigenvalues, HVDC installation, multi‐infeed HVDC, voltage stability. Conference Proceedings 1. Basit, A., Ullah, Z., Khan, I., Ullah, K., Sarwar, M. A., Ali, S. M., . . . Mehmood, C. A. (2020, 29‐30 Jan. 2020). Electric Vehicles Interactions for Efficient Energy Performance within Smart Grid. Paper presented at the 2020 3rd International Conference on Computing, Mathematics and Engineering Technologies (iCoMET). (Zahid Ullah, Irfan Ullah (Electrical Engineering/SEN) (SKT Campus) Abstract: Electric Vehicles (EVs) evolution brought a revolutionary change in the domain of electric transformation. The development of EVs is growing day‐by‐day. The rapid growth in EV technology is diverting consumers from normal cars to electric vehicles. EV has become the need of the modern era. Fossil fuel reserves are depleting which results in inflation of fuel prices. The solution to this problem is to develop new technologies that are independent of fossil fuels. EVs are the answer to the massive increase in oil prices. Therefore, this paper presents two interactive modes of EVs, namely: (a) Grid‐ to‐Vehicle (G2V) and (b) Vehicle‐to‐Grid (V2G) operational modes. Moreover, interactions of V2G and G2V are discussed with respect to SG dynamics and control. Finally, a case study of EVs operating in Wide Area Smart Grid System (WASGS) is presented in the context of (a) wide area system stability, (b) voltage control, and (c) active and reactive power management. The computer‐based simulation of EVs is evaluated in three areas of the WASGS with distributed parking stations. Keywords: smart grid, electric vehicles, energy flows, vehicle‐to‐grid, grid‐to‐vehicle, wide area smart grid system, energy efficiency.
2. Uddin, W., Ishfaq, M., Zeb, K., Islam, S. u., Kim, H. J., Ullah, Z., . . . Sarwar, M. A. (2020, 29‐30 Jan. 2020). Super twisting sliding mode control for inner current suppression of Modular Multilevel Converter. Paper presented at the 2020 3rd International Conference on Computing, Mathematics and Engineering Technologies (iCoMET). (Zahid Ullah (Electrical Engineering/SEN) (SKT Campus) Abstract: Modular Multilevel Converter (MMC) is very popular due to its flexibility, use of low rating devices, low harmonic distortion, and high efficiency. Despite these advantages, MMC faces challenges of controlling its parameters especially inner current and capacitor voltages. This paper presents the control of the inner current of MMC using Sliding Mode Controller (SMC). The switching function of SMC is based on 2 nd order super twisting algorithm. The Proposed super twisting algorithm is proved to be efficient in controlling the inner current. The 2 nd order harmonic is effectively suppressed, and the inner current is fully converged to its reference value. Moreover, the continuous nature of the super twisting algorithm solves the chattering issue. The implementation of MMC and its control is carried out in MATLAB/Simulink. Keywords: modular multilevel converter, inner current, sliding mode control, harmonic supression, inner current.
3. Abideen, Z. U., Tariq, H., Hafeez, M. A., & Subhani, Z. M. (2020, 11‐13 Oct. 2020). An Improved Implementation of Shift Displacement Method on Hardware – Comprehensive Evaluation of Emerging Bi‐pedal Techniques. Paper
Research Outlook 2020 | 134
presented at the 2020 4th International Conference on Automation, Control and Robots (ICACR). (Hassan Tariq, M. Asfanad Hafeez, Zahid Mehmood Subhani (Electrical Engineering/SEN) Abstract: Bipedal walking approaches are one of the main technical hurdles in the robotics due to its high dimensionality, natural instability, nonlinearity, and high Cost of Travelling (CoT). The major challenge is to achieve a stable walk with inexpensive infrastructure without using complex algorithms. Researchers are trying to achieve a large angle of freedom but there is a tradeoff between power, stability, and angle of freedom. This paper presents simulation, implementation of a bipedal walking robot, and analysis of various research techniques for a simple but reliable bipedal walking method. We have implemented a shift displacement walking technique through that bipedal robot attains CoP (Centre of Point) while walking and keeping the CoG (Center of Gravity) projection to the ground within its foot area to maintain dynamic stability, achieved high angle of freedom, and efficiency due to efficient cycle time. We have simulated three different bi‐pedal walking techniques, and it shows the Shift Displacement Method achieved 14 degrees of angle of freedom with a cycle time of 0.605 seconds. We achieved less power consumption, cost of traveling (CoT), and angle of freedom of 14 degrees as compared to state of the art. The experimental prototype is based on the KHR‐I and has 10 DOF (Degrees of Freedom), weighted as 1.5 kg, and stands 38 cm. Keywords: bipedal, humanoid, dynamic walking, shift displacement, zero moment point, stability, angle of freedom, walking robots.
4. Perkins, G., McGlinn, C., Rizwan, M., & Whitaker, B. M. (2020, 13‐16 Sept. 2020). Detecting Cardiac Abnormalities From 12‐lead ECG Signals Using Feature Selection, Feature Extraction, and Machine Learning Classification. Paper presented at the 2020 Computing in Cardiology. (Muhammad Rizwan (Electrical Engineering/SEN) Abstract: This work represents an entry to the 2020 PhysioNET Computing in Cardiology Challenge for the team named “Whitaker's Lab.” The algorithm we developed can be divided into three main components: feature extraction, dimensionality reduction, and classification. In the feature extraction stage, we process the provided 12‐lead ECG signals to determine various features. We consider 12 time‐domain statistical features per lead, as well as sparse coding features obtained from frequency information that is extracted from each ECG lead. After computing the features, we reduce the dimensionality of the statistical features using principal component analysis in an attempt to ease the computational requirements of the classifier. After feature extraction and dimensionality reduction, we classify each 12‐lead ECG signal using a random forest classifier. The classifier is trained using a cross‐validated grid search algorithm to help select hyperparameters. In an attempt to avoid overfitting, the classifier and unsupervised feature extraction algorithms are trained on disjoint subsets of the Challenge data. We were unable to rank and score in the test set, but using a holdout portion of the training set we achieved a validation score of − 0.744. This result is likely to be over‐optimistic. Keywords: training, dimensionality reduction, electrocardiography, feature extraction, encoding, classification algorithms, cardiology.
5. Khan, T. A., Kalimullah, Hafeez, G., Khan, I., Ullah, S., Waseem, A., & Ullah, Z. (2020, 12‐13 June 2020). Energy Demand Control Under Dynamic Price‐based Demand Response Program in Smart Grid. Paper presented at the 2020 International Conference on Electrical, Communication, and Computer Engineering (ICECCE). (Taimoor Ahmad Khan, Kalimullah, Ghulam Hafeez, Imran Khan (Electrical Engineering/SEN) (SKT Campus) Abstract: Dynamic pricing can be considered a key method for the smart grid which maintains a balance supply and demand with the help of a closed‐loop super twisting sliding mode controller (STSMC). Demand‐side load management (DSLM) consists of agents that control, change, shift and modify the load usage pattern according to dynamic pricing offered by the smart grid. The DSLM agents under price‐based DR programs perform load shifting, peak clipping and valley filling to maintain the balance between demand and supply. A control theoretic approach is introduced in this work for persistent demand control by dynamic price‐based closed‐loop STSMC. A Research Outlook 2020 | 135
renewable energy integrated micro grid platform is discussed to show that the demand of consumers can be controlled through STSMC which regulates the electricity price to the DSLM agents installed in smart meters at the demand side. The overall demand elasticity of the current study is represented by a first order dynamic price generation model having a piece‐wise linear DR program and uncertainty of 1MWh is added in overall demand response of the system to make simulations more realistic. The simulations validate that STSMC is a useful technique to control closed loop elastic demand and preserve a balance between demand and generation in renewable energy integrated micro grid. Keywords: Demand response, dynamic energy pricing, elastic demand control, smart grid, super twisting sliding mode controller.
6. Nawaz, A., Hafeez, G., Khan, I., Usman, M., Jan, K. U., Ullah, Z., & Diallo, D. (2020, 12‐13 June 2020). Demand‐side Management of Residential Service Area Under Price‐based Demand Response Program in Smart Grid. Paper presented at the 2020 International Conference on Electrical, Communication, and Computer Engineering (ICECCE). (Zahid Ullah (Electrical Engineering/SEN) (SKT Campus) Abstract: Grid extension and construction of additional power plants based on conventional fuels are becoming a challenge to meet ramping‐up load demand. This becomes more pressing especially in cost and time constraints. In order to alleviate these issues and bridge the gap of demand with supply, demand‐side management (DSM) in the smart grid (SG) is considered as an effective solution. In this paper, DSM is performed through residential load‐scheduling with the help of an energy management controller (EMC). The EMC introduced for residential load‐scheduling is based on heuristic algorithms like; binary particle swarm optimization (BPSO), genetic algorithm (GA), and hybrid genetic BPSO (HGBPSO). The proposed heuristic‐based EMC performs DSM by scheduling residential load under day‐ahead price‐based demand response (DR) program. The proposed scheme optimally performs DSM and results in an acceptable reduction of electricity cost, peak to average ratio (PAR), CO2 emission, and user‐discomfort all at once. Simulation results validate that HGBPSO‐ based EMC outperforms BPSO and GA‐based EMC in the matter of management. The proposed scheme is highly suitable for real‐life management of residential service in SG. Keywords: Energy management controller, smart grid, heuristic algorithm, carbon reduction, residential load scheduling. Conference Papers 1. Ahmad, J., Aslam, M. A., Tahir, M., & Mazumder, S. K. (2020, 11‐15 Oct. 2020). Distributed Control and Dynamic Optimization of a Microgrid. Paper presented at the 2020 IEEE Energy Conversion Congress and Exposition (ECCE). (Jameel Ahmad (Electrical Engineering/SEN) Abstract: In this paper dynamics of a power system consisting of distributed generators in a microgrid is modeled as a nonlinear system. The specific objectives are to optimize non‐liner economic‐emission dispatch and control the dynamics of power sharing of distributed generators in a microgrid. For efficient coordination of distributed generators, a multi‐agent system with shared communication framework employing self‐triggered data sampler is proposed. The system is tested for load as well as source side transients. The performance evaluation results show that distributed optimized control with proposed self‐triggered strategy significantly reduces the bandwidth requirement. Numerical results show that approximately thirty‐six times less data transmission is required during steady state while data transmission requirement during transients reduces twenty times, leading to significant reduction in the demanded communication bandwidth. Keywords: Microgrid, distributed generation, multi‐agent system, self‐trigger control.
Research Outlook 2020 | 136
2. Arsalan, A., Ahmad, J., Tahir, M., & Mazumder, S. K. (2020, 11‐15 Oct. 2020). Distributed Control and Power Management of Islanded DC Nanogrids with Applications to Rural Electrification. Paper presented at the 2020 IEEE Energy Conversion Congress and Exposition (ECCE). (Jameel Ahmad (Electrical Engineering/SEN) Abstract: DC Nanogrids (NGs) with integrated distributed generation are becoming more and more popular for electrification of remote/rural communities. Stable as well as interactive operation of these NGs face many challenges such as optimal resource sharing among NGs. distribution losses and load/generation side transient control. etc. There are multiple communication‐less control techniques that are insufficient to address these challenges. In this paper. we present a multi‐agent communication based distributed control strategy that provides optimal resource sharing among NGs with minimized distribution losses and an improved transient control by employing augmented Lagrangian based optimized controller. The efficiency of proposed model is validated for various case study scenarios. Keywords: DC Nanogrid, distributed generation, multiagent system, power sharing. Department of Industrial Engineering Research Articles 1. Arslan, M., Farooq, M., Naqvi, M., Sultan, U., Tahir, Z.‐u.‐R., Ahmad, I. C., . . . Anukam, A. (2020). Impact of Varying Load Conditions and Cooling Energy Comparison of a Double‐Inlet Pulse Tube Refrigerator. Processes, 8(3). doi: 10.3390/pr8030352. (Ijaz Ahmad Chaudhry (Industrial Engineering/SEN) Abstract: Modeling and optimization of a double‐inlet pulse tube refrigerator (DIPTR) is very difficult due to its geometry and nature. The objective of this paper was to optimize‐DIPTR through experiments with the cold heat exchanger (CHX) along the comparison of cooling load with experimental data using different boundary conditions. To predict its performance, a detailed two‐dimensional DIPTR model was developed. A double‐drop pulse pipe cooler was used for solving continuity, dynamic and power calculations. External conditions for applicable boundaries include sinusoidal pressure from an end of the tube from a user‐defined function and constant temperature or limitations of thermal flux within the outer walls of exchanger walls under colder conditions. The results of the system’s cooling behavior were reported, along with the connection between the mass flow rates, heat distribution along pulse tube and cold‐end pressure, the cooler load’s wall temp profile and cooler loads with varied boundary conditions i.e. opening of 20% double‐inlet and 40‐60% orifice valves, respectively. Different loading conditions of 1 and 5 W were applied on the CHX. At 150 K temperature of the cold‐end heat exchanger, a maximum load of 3.7 W was achieved. The results also reveal a strong correlation between computational fluid dynamics modeling results and experimental results of the DIPTR. Keywords: boundary conditions, two‐dimensional simulation, fluent, pressure user define function, regenerator.
2. Uddin, G. M., Niazi, S. G., Arafat, S. M., Kamran, M. S., Farooq, M., Hayat, N., . . . Chaudhry, I. A. (2020). Neural networks assisted computational aero‐acoustic analysis of an isolated tire. Proceedings of the Institution of Mechanical Engineers, Part D: Journal of Automobile Engineering, 234(10‐11), 2561‐2577. doi: 10.1177/0954407020915104. (Ijaz Ahmad Chaudhry (Industrial Engineering/SEN) Abstract: The computational aero‐acoustic study of an isolated passenger car tire is carried out to understand the effect of dimensions of longitudinal tire grooves and operational parameters (velocity and temperature) on tire noise. The computational fluid dynamics and acoustic models are used to obtain aero‐acoustic tire noise at near‐field and far‐field receivers around the tire and artificial neural networks‐based regression are used to study the highly non‐linear and interactive causal relationships in the system. Unsteady Reynolds‐Averaged Navier‐ Stokes based realizable k‐epsilon model is used to solve the flow field in the computational domain. The Ffowcs Williams and Hawkings model is used to obtain aero‐acoustic tire noise at far‐field positions. Spectral analysis is used to convert the output time domain to frequency domain and to obtain A‐weighted sound pressure level.
Research Outlook 2020 | 137
Artificial neural network–based response surface regression is conducted to understand casual relationships between A‐weighted sound pressure level and control variables (Groove depth, Groove width, Temperature and velocity). Maximum A‐weighted sound pressure level is observed in the wake region of the tire model. The interaction study indicates that ∼10% reduction in the aero‐acoustic emissions is possible by selecting appropriate combinations of groove width and groove depth. The interaction of velocity with width is found to be most significant with respect to A‐weighted sound pressure level at all receivers surrounding the tire. The interaction of operational parameters, that is, velocity and temperature are found to be significant with respect to A‐weighted sound pressure level at wake and front receivers. Therefore, the regional speed limits and seasonal temperatures need to be considered while designing the tire to achieve minimum aero‐acoustic emissions. Keywords: aero‐acoustic, artificial intelligence, isolated tire, computational aero‐acoustics, computer simulated experimentation, response surface methodology.
3. Uddin, G. M., Arafat, S. M., Ashraf, W. M., Asim, M., Bhutta, M. M. A., Jatoi, Chaudhry, I. A., . . . Zeid, I. (2020). Artificial Intelligence‐Based Emission Reduction Strategy for Limestone Forced Oxidation Flue Gas Desulfurization System. Journal of Energy Resources Technology, 142(9). doi: 10.1115/1.4046468. (Ijaz Ahmad Chaudhry (Industrial Engineering/SEN) Abstract: The emissions from coal power plants have serious implication on the environment protection, and there is an increasing effort around the globe to control these emissions by the flue gas cleaning technologies. This research was carried out on the limestone forced oxidation (LSFO) flue gas desulfurization (FGD) system installed at the 2*660 MW supercritical coal‐fired power plant. Nine input variables of the FGD system: pH, inlet
sulfur dioxide (SO2), inlet temperature, inlet nitrogen oxide (NOx), inlet O2, oxidation air, absorber slurry density, inlet humidity, and inlet dust were used for the development of effective neural network process models for a
comprehensive emission analysis constituting outlet SO2, outlet Hg, outlet NOx, and outlet dust emissions from the LSFO FGD system. Monte Carlo experiments were conducted on the artificial neural network process models to investigate the relationships between the input control variables and output variables. Accordingly, optimum operating ranges of all input control variables were recommended. Operating the LSFO FGD system under
optimum conditions, nearly 35% and 24% reduction in SO2 emissions are possible at inlet SO2 values of 1500 mg/m3 and 1800 mg/m3, respectively, as compared to general operating conditions. Similarly, nearly 42% and 3 3 28% reduction in Hg emissions are possible at inlet SO2 values of 1500 mg/m and 1800 mg/m , respectively, as compared to general operating conditions. The findings are useful for minimizing the emissions from coal power plants and the development of optimum operating strategies for the LSFO FGD system. Keywords: artificial intelligence, process industry, neural networks, emission control, environment, LSFO FGD system, SO2 emissions, NOx emissions, Hg emissions, dust emissions, coal power plant, air emissions from fossil fuel combustion, fuel combustion.
4. Ikhlaq, A., Javed, F., Akram, A., Rehman, A., Qi, F., Javed, M., . . . Aziz, H. A. (2020). Synergic catalytic ozonation and electroflocculation process for the treatment of veterinary pharmaceutical wastewater in a hybrid reactor. Journal of Water Process Engineering, 38, 101597. doi: https://doi.org/10.1016/j.jwpe.2020.101597. (Asia Akram) Abstract: The research investigates the treatment of real veterinary pharmaceutical wastewater by synergic catalytic ozonation with iron‐loaded zeolite A (Fe‐Z) catalyst and electroflocculation process in a hybrid reactor. The wastewater was characterized by high organic content (COD =1220 mg/L) and turbidity 247 NTU. The experiments were conducted in a batch laboratory scale hybrid reactor with ozone spargers, metal electrodes, and suspended buckets loaded with (Fe‐Z) catalyst. The effect of operational parameters of voltage (5−15 V), pH (5–9), ozone dose (0.2−0.4 mg/min), and catalyst dose (1−2 g/L) on COD and turbidity removal was studied with the mechanism explored. The obtained results showed the COD removal efficiency was 85.12 % and the turbidity of pharmaceutical wastewater reduced to 78 NTU at optimal conditions of voltage 5 V, pH 7, ozone dose Research Outlook 2020 | 138
0.4 mg/min, and catalyst dose 1.5 g/L. The pharmaceutical removals achieved were 100 % for enrofloxacin and 90 % for amoxicillin. It is therefore concluded that the synergic process was found highly suitable for the effective treatment of veterinary pharmaceutical wastewater in the hybrid reactor as an effective option. Keywords: catalytic ozonation, chemical oxygen demand, electroflocculation, pharmaceutical wastewater.
5. Ashraf, W. M., Uddin, G. M., Arafat, S. M., Afghan, S., Kamal, A. H., Chaudhry, I. A., . . . Krzywanski, J. (2020). Optimization of a 660 M[W.sub.e] Supercritical Power Plant Performance‐‐A Case of Industry 4.0 in the Data‐ Driven Operational Management Part 1. Thermal Efficiency. Energies, 13,(21). 1‐34. (Ijaz Ahmad Chaudhry (Industrial Engineering/SEN) Abstract: This paper presents a comprehensive step‐wise methodology for implementing industry 4.0 in a functional coal power plant. The overall efficiency of a 660 MWe supercritical coal‐fired plant using real operational data is considered in the study. Conventional and advanced AI‐based techniques are used to present comprehensive data visualization. Monte‐Carlo experimentation on artificial neural network (ANN) and least square support vector machine (LSSVM) process models and interval adjoint significance analysis (IASA) are performed to eliminate insignificant control variables. Effective and validated ANN and LSSVM process models are developed and comprehensively compared. The ANN process model proved to be significantly more effective; especially, in terms of the capacity to be deployed as a robust and reliable AI model for industrial data analysis and decision making. A detailed investigation of efficient power generation is Energies 2020, 13, 5592 2 of 34 presented under 50%, 75%, and 100% power plant unit load. Up to 7.20%, 6.85%, and 8.60% savings in heat input values are identified at 50%, 75%, and 100% unit load, respectively, without compromising the power plant’s overall thermal efficiency. Keywords: combustion, supercritical power plant, industry 4.0 for the power sector, artificial intelligence, thermal efficiency. Department of Civil Engineering Research Articles 1. Tanveer, M., Kashmiri, F. A., Naeem, H., Yan, H., Qi, X., Rizvi, S. M. A., . . . Lu, H. (2020). An Assessment of Age and Gender Characteristics of Mixed Traffic with Autonomous and Manual Vehicles: A Cellular Automata Approach. Sustainability, 12(7), 2922.(Faizan Ahmad Kashmiri (Civil Engineering/SEN) Abstract: Traffic congestion has become increasingly prevalent in many urban areas, and researchers are continuously looking into new ways to resolve this pertinent issue. Autonomous vehicles are one of the technologies expected to revolutionize transportation systems. To this very day, there are limited studies focused on the impact of autonomous vehicles in heterogeneous traffic flow in terms of different driving modes (manual and self‐driving). Autonomous vehicles in the near future will be running parallel with manual vehicles, and drivers will have different characteristics and attributes. Previous studies that have focused on the impact of autonomous vehicles in these conditions are scarce. This paper proposes a new cellular automata model to address this issue, where different autonomous vehicles (cars and buses) and manual vehicles (cars and buses) are compared in terms of fundamental traffic parameters. Manual cars are further divided into subcategories on the basis of age groups and gender. Each category has its own distinct attributes, which make it different from the others. This is done in order to obtain a simulation as close as possible to a real‐world scenario. Furthermore, different lane‐changing behavior patterns have been modeled for autonomous and manual vehicles. Subsequently, different scenarios with different compositions are simulated to investigate the impact of autonomous vehicles on traffic flow in heterogeneous conditions. The results suggest that autonomous vehicles can raise the flow rate of any network considerably despite the running heterogeneous traffic flow.
Research Outlook 2020 | 139
Keywords: autonomous vehicle, age, gender, manual vehicle, cellular automata.
2. Ali, N., & Piantanakulchai, M. (2020). Self‐reported inclination of heavy‐duty vehicle drivers to adopt eco‐ driving in different motivation contexts. Songklanakarin Journal of Science and Technology (SJST), 42 (3), 496‐503.(Nazam Ali (Civil Engineering/SEN) Abstract: Eco‐driving is an emerging field of research. Due to its positive dimensions on fuel‐economy and environmental emissions, it is becoming a well‐known concept in transportation industry. Behavioral responses of drivers’ readiness to adopt eco‐driving are studied. Questionnaires are collected from 87 truck drivers working for a logistics firm in Thailand. Eco‐driving was introduced using three different strategies; changing driving behavior, competition with fellow drivers, and reward or penalty systems. A five‐point Likert scaling system is adopted to record their self‐evaluation scoring to practice eco‐driving in given contextual motivations. Results are reported in the form of eco‐driving scores and Statistical evaluations to check if the difference in behavioral response is statistically significant. Statistically significantly different results showed that in‐relationship (score 3.75) and high school drivers (score 4.38) manifested strong motivations in penalty or reward systems while high school drivers exhibited great inclinations in changing their driving behavior (score 3.89). Keywords: co‐driving, Thai drivers, co‐driving score, behavioral response, motivation contexts.
3. Dias, C., Iryo‐Asano, M., Abdullah, M., Oguchi, T., & Alhajyaseen, W. (2020). Modeling Trajectories and Trajectory Variation of Turning Vehicles at Signalized Intersections. IEEE Access, 8, 109821‐109834. doi: 10.1109/ACCESS.2020.3002020. (Muhammad Abdullah (Civil Engineering/SEN) Abstract: Information on the trajectories of turning vehicles at signalized intersections can be used in numerous applications, such as movement planning of autonomous vehicles, realistic representation of surrounding vehicle movements in driving simulator and virtual reality applications, and in microscopic simulation tools. However, no proper framework is currently available to realistically model and estimate trajectories of turning vehicles reflecting the intersection geometries, which is critical for the reliability of simulation models. This study explores the applicability of the minimum‐jerk principle, which has been initially applied in neuroscience and robotics domains, to model and simulate free‐flow trajectories of turning vehicles. The modeling method is validated by comparing model outputs with empirical trajectories collected at several signalized intersections in Nagoya, Japan. The capability of the model in realistically capturing the variations in turning trajectories based on intersection geometry (e.g., intersection angle and turning radius) is also explained. Further, the applicability of the modeling framework at intersections with different geometric features under different speeds and accelerations are also discussed. Keywords: autonomous vehicles, motion planning, numerical simulation, path planning, predictive models, traffic control, trajectory optimization.
4. Muley, D., Shahin, M., Dias, C., & Abdullah, M. (2020). Role of Transport during Outbreak of Infectious Diseases: Evidence from the Past. Sustainability, 12(18), 7367. doi: http://dx.doi.org/10.3390/su12187367. (Muhammad Abdullah (Civil Engineering/SEN) Abstract: The outbreak of infectious diseases affects people’s lifestyles significantly, as they undertake fewer outdoor activities as a protective measure and to follow government orders of restricted movements. This paper reviewed the scientific literature related to transport and infectious diseases to gain insights into managing such circumstances. The outcomes indicate that the transport sector has a two‐ fold role during the outbreak of infectious diseases: controlling the spread of infection and assessing the impact of reduced outdoor activities on the transport sector. It was found that local and international travel restrictions, if applied at the initial stages, are effective in controlling the spread of infectious disease; at a Research Outlook 2020 | 140
later stage, behavioral changes become prominent in limiting the spread. Further, the outbreaks resulted in a significant reduction in mobility, altering traffic patterns with lower peaks and improving traffic safety. The public transport mode share reduced considerably and people preferred cars and active modes. These changes also showed positive impacts on air pollution and water pollution. Further, the air transport and tourism sector were noted to be the hardest hit and will recover slowly. The outcomes from the review will be useful for planners and administrators in managing future emergency conditions better. Keywords: infectious disease, pandemic, epidemic, transport effects, health emergencies, spread of diseases, traffic impacts.
5. Joyklad, P., Hussain, Q., & Ali, N. (2020). Mechanical Properties of Cement‐Clay Interlocking (CCI) Hollow Bricks. Engineering Journal, 24(3), 89‐106, doi: https://doi.org/10.4186/ej.2020.24.3.89. (Nazam Ali (Civil Engineering/SEN) Abstract: In this paper, an investigative study on mechanical properties of CCI hollow bricks, for example, compressive strength, modulus of rupture, splitting tensile strength, water absorption capacity and heat transfer is conducted. The experimental program is divided into two parts. In the 1st part, bricks from three different regions (A, B and C having different soil stratum) of Thailand were collected and their mechanical properties were investigated. The mechanical properties of CCI hollow bricks of region A were observed relatively very low as compared to other regions. The compressive strength values of region A bricks were found even below the standard values required by Thai Community Product Standards (TCPS). Then, in the 2nd part, change in three mix design ratios followed by sand, cement and fly ash for region A have been exercised to observe their effects on mechanical properties of bricks from said region. Results showed significant improvements as compared with previous results obtained in first part of the experimental program. Also, a cost‐benefit analysis was performed to observe the effect of the manufacturing cost on the mechanical properties of CCI hollow bricks in Thailand. It has been investigated that the brick samples with more cement content (from region C, Mix – 2 & Mix – 3) are relatively expensive as compared with other brick samples with less cement content (from region A, region B & Mix – 1). Keywords: cement, clay, interlocking bricks, compressive strength, water absorption capacity, fly ash.
6. Raja, M. N. A., & Shukla, S. K. (2020). Ultimate bearing capacity of strip footing resting on soil bed strengthened by wraparound geosynthetic reinforcement technique. Geotextiles and Geomembranes. 48(6). 867‐874. doi: https://doi.org/10.1016/j.geotexmem.2020.06.005. (Muhammad Nouman Amjad Raja (Civil Engineering/SEN) Technical note Abstract: In the recent past, the wraparound geosynthetic reinforcement technique has been recommended for constructing the geosynthetic‐reinforced soil foundations. This paper presents the development of an analytical expression for estimating the ultimate bearing capacity of strip footing resting on soil bed reinforced with geosynthetic reinforcement having the wraparound ends. The wraparound ends of the geosynthetic reinforcement are considered to provide the shearing resistance at the soil‐ geosynthetic interface as well as the passive resistance due to confinement of soil by the geosynthetic reinforcement. The values of ultimate load‐bearing capacity determined by using the developed analytical expression agree well with the model footing load test values as reported in the literature. Keywords: geosynthetic reinforcement, strip footing, ultimate bearing capacity, wraparound technique.
7. Abdullah, M., Dias, C., Muley, D., & Shahin, M. (2020). Exploring the impacts of COVID‐19 on travel behavior and mode preferences. Transportation Research Interdisciplinary Perspectives, 8, 100255. doi: https://doi.org/10.1016/j.trip.2020.100255. (Muhammad Abdullah (Civil Engineering/SEN)
Research Outlook 2020 | 141
Abstract: Various measures were recommended or imposed by the governments to control the spread of COVID‐19. Travel behaviors are significantly influenced due to such measures. However, people have various travel needs ranging from grocery shopping to work. This study examines the changes that occurred in travel behavior due to the COVID‐19 pandemic. Data were collected through an online questionnaire survey that included questions on trip purpose, mode choice, distance traveled, and frequency of trips before and during COVID‐19. 1203 responses were collected from various countries around the world. Results explained that trip purpose, mode choice, distance traveled, and frequency of trips for the primary travel were significantly different before and during the pandemic. Further, the majority of trips were made for shopping during the pandemic. There was a significant shift from public transport to private transport and non‐motorized modes. People placed a higher priority on the pandemic related concerns while choosing a mode during the pandemic as compared to the general concerns. Gender, car ownership, employment status, travel distance, the primary purpose of traveling, and pandemic‐related underlying factors during COVID‐19 were found to be significant predictors of mode choice during the pandemic. Outcomes of this study could be useful in transport planning and policymaking during pandemics based on the travel needs of people. In particular, government authorities could utilize such knowledge for planning smart and partial lockdowns. Service providers, e.g., taxi companies and retailers, could use such information to better plan their services and operations. Keywords: COVId‐19, travel behavior, modal shift, travel patterns, mode choice.
8. Asad, M., Djavanroodi, F., Ijaz, H., Khan, M. A. A., Rashid, M. U., & Mabrouki, T. (2020). Numerical Modeling the Effects of Chamfer and Hone Cutting Edge Geometries on Burr Formation. WSEAS Transactions on Applied and Theoretical Mechanics, 15(17), 151‐156. doi: 10.37394/232011.2020.15.17. (Muhammad Usman Rashid (Civil Engineering/SEN) Abstract: A finite element based numerical model to simulate orthogonal machining process and associated burr formation process has been developed in the presented work. To incorporate simultaneous effects of mechanical and thermal loadings in high speed machining processes, Johnson and Cook`s thermo‐visco‐plastic flow stress model has been adopted in the conceived numerical model. A coupled damage‐fracture energy approach has been used to observe damage evolution in workpiece and to serve as chip separation criterion. Simulation results concerning chip morphology, nodal temperatures, cutting forces and end (exit) burr have been recorded. Model has been validated by comparing chip morphology and cutting force results with experimental findings in the published literature. Effects of cutting edge geometries [Hone and Chamfer (T‐land)] on burr formation have been investigated thoroughly and discussed in length. To propose optimum tool edge geometries for reduced burr formation in machining of an aerospace grade aluminum alloy AA2024, numerical analyses considering multiple combinations of cutting speed (two variations), feed (two variations) and tool edge geometries [Hone edge (two variations), Chamfer edge (four variations)] have been performed. For chamfer cutting edge, the “chamfer length” has been identified as the most influential macro geometrical parameter in enhancing the burr formation. Conversely, “chamfer angle” variation has been found least effecting the burr generation phenomenon. Keywords: finite element analysis, machining simulation, cutting edge geometry, burr.
9. Ali, N., Javid, M. A., & Rahim, A. (2020). Predicting Transit Mode Choice Behavior from Parents ï¿ ½ Perspectives: A Case Study in Lahore, Pakistan. Jordan Journal of Civil Engineering, 14(4), 476‐489. (Nazam Ali (Civil Engineering/SEN) Abstract: In the recent decade, an emerging trend is escalating in developing countries named as ‘Ridesharing Services’ or ‘Transportation Network Companies (TNCs)’ and in Pakistan, TNCs are recently introduced. In this study, an online questionnaire survey included a stated preference experiment for three Research Outlook 2020 | 142
different transport alternatives: own vehicle, TNCs (i.e., Uber and Careem) and public transport. A total of 317 parents (149 females and 168 males) reported their preferences to use given alternatives based on their personal and trip characteristics. A multinomial logit model was used to describe the mode choice mechanism. The impacts of travel cost, privacy and safety concerns and travel time were identified based on household income, gender and type of profession. Results manifested that parents with middle‐income and employees prefer TNCs, while high‐income, female and business parents prefer personal vehicles considering trip characteristics. The extracted findings would provide a clear understanding of mode choice factors for the selected travel alternatives. Keywords: Mode choice, Transportation network companies, Stated preference, Travel behavior, Public transport, Parents’ perspectives.
10. Khalid, M., Sardar, A., & Jaffar, S. (2020). Influence of Footing Shapes and GWT on Bearing Capacity and Settlement of Cohesive Soil Beneath Shallow Foundations. The Nucleus, 57(2), 39‐48. (M. Khalid, A. Sardar, Syed Taseer Abbas Jaffar (Civil Engineering/SEN) Abstract: Footing shapes and ground water table (GWT) greatly affect the bearing capacity and settlement of cohesive soil. A series of laboratory experiments and simulation techniques are performed to investigate the effect of footing shapes and GWT on bearing capacity and settlement in cohesive soils. Results showed that by increasing the depth of footing, bearing capacity of cohesive soil increases while settlement and stress influence zone decreases. In case of square footing when depth of footing is increased from 1m to 2.2m bearing capacity also increased from 26.45kPa to 27.90kPa; while settlement and stress influence zone decreased from 0.30mm to 0.20mm and 1.2m to 0.60m, respectively. In case of rectangular footing when depth of footing is increased from 1m to 2.2m bearing capacity increased from 26.25kPa to 27.60kPa; while settlement and stress influence zone decreased from 0.60mm to 0.49mm and 1.53m to 1.15m, respectively. On the basis of high stress influence zone, critical footings are further selected to study the effect of GWT. It is observed that GWT does not affect the bearing capacity when its level is below the footing bottom, while settlement keeps on decreasing with the depth. A Soil Structure Interaction (SSI) model is proposed by comparing different built‐in Finite Element Method (FEM) based models in Geo‐5 software. Among the studied SSI models, Modified Elastic Model and Modified Mohr Coulomb Model proved to be more realistic models in terms of settlement, shear stress and effective stress. Keywords: bearing capacity, ground water table, cohesive soil, foundation, soil structure interaction model.
11. Abid, M. M., Ayaz, A., Nawaz, N., Iqbal, M., Yang, H., Tehseen, A. S., & Jafar, S. T. A. (2020). Attraction of Bus Rapid Transit (BRT) for Car and Bike Owners. Romanian Journal of Transport Infrastructure, 9, 1 ‐ 21. (Syed Taseer Abbas Jaffar (Civil Engineering/SEN) Abstract: This study aims to find the potential of Bus Rapid Transit (BRT) to attract the vehicle owners from their personal vehicles i.e., motorcars and motorcycles. Stated preference survey (questionnaires) and interviews were conducted at BRT (Metro Bus) Stations for the prediction of the individuals shifting from their private vehicles to BRT. Questions were designed critically as per the requirements of the research related to numerous aspects of BRT use i.e., vehicle ownership of the travelers, driving license holder, demographic characteristics, choice to use BRT if the fare increases, trip purpose and their prior mode of transportation for the same trip. A total of 374 responses, as per the population of the study area (Islamabad‐Rawalpindi, Pakistan), were collected. The Multinomial Logistic Regression (MNL) model has been employed for four categories of vehicle ownerships i.e., “Car owners using BRT”, “Bike owners using BRT”, “Both Car and Bike owners using BRT” and the last one which has been taken as reference category is “BRT users with no vehicle ownership”. The analysis indicated that BRT has attracted considerably private Research Outlook 2020 | 143
vehicle users specially the bike owners. Some socio‐economic factors like income and residence location (accessibility) additionally have a major effect on the selection of BRT. In addition, it has been observed that fare increase can alter the mode choice of the BRT users and they will again prefer their own vehicles. The Travel choice model developed in the study can be very useful for policy makers and transport planners to enhance the BRT service and attraction, to mitigate traffic congestion and car ownership. Keywords: bus rapid transit, metro bus service, mode shift, multinomial logistic, regression model (MNL), Stated Preference.
12. Ali, N., Zia, H., Sarwar, H. B., Baig, Z., & Abdullah, M. (2020). Implementation of Different Traffic Management Strategies on Major Roads for the Improvement of Traffic Flow in Lahore City. Scientific Inquiry and Review, 4(4), 1‐14. https://doi.org/10.32350/sir/2020/44/689. (Nazam Ali, Hashir Zia, Hamza Bin Sarwar, Muhammad Nadeem, Zafar Baig, Muhammad Abdullah (Civil Engineering/SEN) UMT JOURNAL Abstract: Traffic congestion causes many socio‐economic problems in developing nations. One of the main causes of traffic congestion can be attributed to poor design practices. In the last few years, Lahore city has expanded haphazardly where the allocation of resources was done based on political will instead of feasible design practices. This haphazard growth coupled with a poor design resulted in traffic congestion on the main roads of the city. In this study, simulations using different traffic management design strategies were carried out on major roads to check if traffic delays and Level of Service (LOS) can be improved. The most feasible designs based on the simulated results were proposed for the improvement of the existing infrastructure designs. These findings suggested that Akbar Chowk and Jinnah Hospital Intersection have greatly reduced the traffic delay time by 92.97% and 92.67%, respectively. Policymakers can utilize these simulated results for future design guidelines to accommodate the future growth of traffic on these arterial roads. Keywords: Lahore city, traffic congestions, traffic management strategies, traffic simulation. Conference Proceedings 1. Ali, N., Javid, M. A., Hussain, S. A., & Abdullah, M. (2020). Key Performance Indicators for Sustainable Freight Transport and Scenario‐based Impediments in Pakistan Freight Industry. IPTEK Journal of Proceedings Series(5), 1‐8. (Muhammad Abdullah (Civil Engineering/SEN) Abstract: Freight transport enables economic growth, market connectivity, and access to the global supply chain systems which contribute to the societal progress and inclusive development of a country. However, it may undermine the sustainable operations by incurring external costs, inefficiency, and economic losses due to non‐ reliability, poor services, and information systems. In this research study, the Key Performance Indicators (KPIs) for Sustainable Freight Transport Systems (SFTS) are discussed based on available literature review and standards of sustainability measurement in freight transport. Then, based on KPIs some of the scenario‐based impediments are highlighted which hinder the performance of the freight transport in Pakistan for achieving sustainable development goals. The core impediments included are Strategic Determinants (SD), Information Systems (IS), Infrastructure Management Systems (IMS) and City Logistics (CL). The negative direct impacts of the key identified factors are also highlighted and linked with each scenario‐based impediment. This research study would provide an opportunity for the stakeholders to get tangible idea for policy making and upgradation of the freight transport industry in the country. The highlighted implications will also be validated via expert surveys and Delphi‐analysis in the future study. Keywords: freight transport, sustainable transport, key performance indicators, scenario‐based impediments, Pakistan freight industry.
Research Outlook 2020 | 144
School of Business and Economics (SBE) Department of Management Research Articles 1. Raja, U., Haq, I. U., De Clercq, D., & Azeem, M. U. (2020). When ethics create misfit: Combined effects of despotic leadership and Islamic work ethic on job performance, job satisfaction, and psychological well‐being. International Journal of Psychology, 55(3), 332‐341. doi: 10.1002/ijop.12606. (Muhammad Umer Azeem (Management/SBE) Abstract: This study applies social exchange and person–environment fit theories to predict that despotic leaders tend to hinder employee job performance, job satisfaction, and psychological well‐being, whereas employees' own Islamic work ethic (IWE) enhances these outcomes. Also, IWE moderates the relationship of despotic leadership with the three outcomes, such that it heightens the negative impacts, because employees with a strong IWE find despotic leadership particularly troubling. A multi‐source, two‐wave, time‐lagged study design, with a sample (303 paired responses) of employees working in various organisations, largely supports these predictions. Despotic leadership and IWE relate significantly to job performance, job satisfaction and psychological well‐being in the predicted directions, except that there is no significant relationship between IWE and job satisfaction. A test of moderation shows that the negative relationships of despotic leadership with job outcomes are stronger when IWE is high. These findings have pertinent implications for theory, as well as for organisational practice. Keywords: despotic leadership, Islamic work ethic, social exchange theory, person–environment fit.
2. De Clercq, D., Haq, I. U., & Azeem, M. U. (2020). When does job dissatisfaction lead to deviant behaviour? The critical roles of abusive supervision and adaptive humour. Australian Journal of Management, 45(2), 294‐ 316. doi: 10.1177/0312896219877679. (Muhammad Umer Azeem (Management/SBE) Abstract: With a basis in conservation of resources theory, this study investigates the relationship between employees’ sense of job dissatisfaction and their engagement in deviant behaviour, as well as the moderating roles that their exposure to abusive leadership and possession of adaptive humour skills can play in this process. Based on two‐way survey data collected from employees in Pakistan, the findings show that employees’ unhappy feelings about their job situations enhance the likelihood that they undertake negative behaviours that can harm their organization, especially when they suffer from abusive leadership or lack adaptive humour skills. The buffering effect of their adaptive humour on the positive relationship between job dissatisfaction and deviant behaviour is also particularly salient in the presence of abusive leadership. Keywords: abusive supervision, adaptive humour, conservation of resources theory, deviant behaviour, job dissatisfaction.
3. De Clercq, D., Azeem, M. U., Haq, I. U., & Bouckenooghe, D. (2020). The stress‐reducing effect of coworker support on turnover intentions: Moderation by political ineptness and despotic leadership. Journal of Business Research, 111, 12‐24. doi: https://doi.org/10.1016/j.jbusres.2020.01.064. (Muhammad Umer Azeem (Management/SBE) Abstract: Grounded in conservation of resources theory, this study investigates the mediating role of job stress in the relationship between coworker support and employees’ turnover intentions, as well as the moderating roles of political ineptness and despotic leadership in this process. Time‐lagged data collected from employees in Pakistan reveal that an important reason coworker support diminishes turnover intentions is the lower stress that employees experience while undertaking their job tasks. This influence of stress reduction is particularly salient to the extent that employees are equipped with less political skill and, contrary to expectations, are less exposed to despotic leadership. For organizations, this study accordingly pinpoints a key mechanism by which Research Outlook 2020 | 145
coworker support can diminish the tendency to leave the organization (stress containment), and it reveals that this mechanism varies according to both personal and leadership factors. Keywords: coworker support, turnover intentions, job stress, political ineptness, despotic leadership, conservation of resources theory.
4. Ying, M., Faraz, N. A., Ahmed, F., & Raza, A. (2020). How Does Servant Leadership Foster Employees' Voluntary Green Behavior? A Sequential Mediation Model. International journal of environmental research and public health, 17(5). (Ali Raza (KUBEAC) (SKT Campus) Abstract: Employees’ voluntary green behavior (EVGB) is indispensable in realizing organizations’ environmental sustainability objectives. Leaders can act as catalysts to shape the behavior of their employees. On EVGB, noticeably the missing link is investigating the influence of servant leadership and the mechanism through which it operates. Building upon self‐determination and psychological empowerment theories, this research examined the impact of servant leadership on EVGB through the simple and sequential mediation of psychological empowerment and autonomous motivation for the environment (AME). Through systematic sampling, dyadic data were collected from 315 pairs of subordinates and supervisors working in the power sector organizations of Pakistan. Results were obtained by employing the partial least squares structural modeling (PLS‐SEM) technique with Smart‐PLS 3.2.8 software. Findings revealed that psychological empowerment and AME simply and sequentially mediate the influence of servant leadership on EVGB. Implications for theory and organizational practitioners are offered, accompanied by suggestions for future research. Keywords: servant leadership, employees’ voluntary green behavior, psychological empowerment, autonomous motivation for the environment, sequential mediation.
5. Raza, A., Saeed, A., Iqbal, M. K., Saeed, U., Sadiq, I., & Faraz, N. A. (2020). Linking Corporate Social Responsibility to Customer Loyalty through Co‐Creation and Customer Company Identification: Exploring Sequential Mediation Mechanism. Sustainability, 12(6), 1‐19. (Ali Raza, Muhammad Khalid Iqbal (KUBEAC) Amer Saeed (Operations and Supply Chain/SBE) Imran Sadiq (Marketing/SBE) (SKT Campus) Abstract: Promoting corporate social responsibility (CSR) and co‐creation has become a crucial relationship marketing strategy for the banks. This research empirically investigates how banks’ CSR activities generate positive customer responses in the form of co‐creation, customer–company identification (CCI), and loyalty. This research sheds light on the influence of CSR on customer behavior by analyzing the underlying psychological processes through the sequential mediation of co‐creation and CCI. Working with a sample of 280 banking customers in Pakistan, partial least square based structural equation modeling (PLS‐SEM) is employed to test the conceptual model. CSR is a multidimensional formative construct that affects customer loyalty both directly and indirectly. Sequential partial mediations of co‐creation and CCI are found between CSR activities and customer loyalty. Lastly, CCI has a direct and significant impact on co‐creation and customer loyalty. Banks must include CSR in their long‐term marketing plans to improve overall customer behavior because banks’ CSR activities result in customer identification and co‐creation. Similarly, banks should welcome the customers’ participation in service design and use their knowledge and skills to improve overall service culture. Keywords: corporate social responsibility, co‐creation, customer‐company identification, customer loyalty, customer behavior, developing country, sustainability.
6. De Clercq, D., Haq, I. U., & Azeem, M. U. (2020). The relationship between workplace incivility and depersonalization towards co‐workers: Roles of job‐related anxiety, gender, and education. Journal of Management & Organization, 26(2), 219‐240. doi: 10.1017/jmo.2019.76. (Muhammad Umer Azeem (Management/SBE) Abstract: This study contributes to management scholarship by unpacking the relationship between employees' Research Outlook 2020 | 146
exposure to workplace incivility and their exhibition of depersonalization towards co‐workers, according to the mediating effect of job‐related anxiety and the moderating effects of gender and education. Time‐lagged data from employees in Pakistani organizations show that an important reason workplace incivility enhances depersonalization towards co‐workers is that employees feel anxious about their jobs. This mediating role of job‐ related anxiety is particularly salient among male and higher‐educated employees, possibly because they suffer from resource losses in the form of dignity threats when they are treated with disrespect. For organizations, this study accordingly pinpoints a key mechanism by which disrespectful workplace treatment can escalate into depersonalization towards co‐workers (enhanced job‐related feelings of anxiety), as well as how the strength of this mechanism might depend on individual factors. Keywords: workplace incivility, depersonalization, job‐related anxiety, gender, education level, conservation of resources theory.
7. Raja, U., Azeem, M. U., Haq, I. U., & Naseer, S. (2020). Perceived threat of terrorism and employee outcomes: The moderating role of negative affectivity and psychological capital. Journal of Business Research, 110, 316‐326. doi: https://doi.org/10.1016/j.jbusres.2020.01.026. (Muhammad Umer Azeem (Management/SBE) Abstract: Using the conservation of resources theory and the terror management theory, we proposed that the perceived threat of terrorism would hurt employees' well‐being, performance and individually directed citizenship behaviors (OCBI) and increase employee stress and emotional exhaustion. We tested our hypotheses in two studies using time‐lagged data with independent measures for behaviors. In study 1, two‐wave data comprised of 160 peer‐employee dyads supported the proposed relationships of fear of terrorism with well‐ being and performance and the moderating role of negative affectivity. In study 2, two‐wave data from 350 employee‐supervisor dyads supported the proposed relationships of perceived threat of terrorism with stress, emotional exhaustion, performance, and OCBI. Results supported a moderating role of psychological capital in these relationships. We believe that our research adds meaningfully to the limited research on the effects of terrorism on employees’ well‐being and behaviors. We discuss the implications of our findings for managers and the future research. Keywords: fear of terrorism, perceived threat of terrorism, cor theory, terror management theory, performance, ocbis, tress, emotional exhaustion, psychological capital, negative affectivity.
8. Azeem, M. U., Bajwa Sami, U., Shahzad, K., & Aslam, H. (2020). Psychological contract violation and turnover intention: the role of job dissatisfaction and work disengagement. Employee Relations: The International Journal, 42(6), 1291‐1308. doi: 10.1108/ER‐09‐2019‐0372. (Muhammad Umer Azeem, Sami Ullah Bajwa, Khuram Shahzad (Management/SBE) (Haris Aslam (Operation and Supply Chain/SBE) Abstract: Purpose – This paper investigates the role of psychological contract violation (PCV) as the antecedent of employee turnover intention. It also explores the role of job dissatisfaction and work disengagement as the sequential underlying mechanism of a positive effect of PCV on employee turnover intention. Design/methodology/approach – Drawing on social exchange theory (SET), the authors postulate that PCV triggers negative reciprocity behaviour in employees, which leads to job dissatisfaction and work disengagement, which in turn develop into turnover intentions. The authors tested the research model on timelagged data from 200 managers working in the banking sector of Pakistan. Findings – The findings confirmed the hypothesis that employees experiencing PCV raise their turnover intentions because of a feeling of organisational betrayal which makes them dissatisfied and detached from their work. Originality/value – This research advances the body of knowledge in the area of psychological contracts by identifying the mechanisms through which PCVs translate into employee turnover intentions. Keywords: psychological contract violation, job dissatisfaction, work disengagement, turnover intention.
Research Outlook 2020 | 147
9. Raza, A., Rather Raouf, A., Iqbal Muhammad, K., & Bhutta Umair, S. (2020). An assessment of corporate social responsibility on customer company identification and loyalty in banking industry: a PLS‐SEM analysis. Management Research Review. 43(11). 1337‐1370. doi: 10.1108/mrr‐08‐2019‐0341. (Ali Raza, Muhammad Khalid Iqbal (KUBEAC) (SKT Campus) Abstract: Purpose: This paper aims to address the need for a more in‐depth empirical investigation of exploring the link between the adoption of corporate social responsibility (CSR) practices and different aspects of customer behavior in a developing country. This paper develops a research framework and assesses the mediating role of trust, customer‐company identification (CCI) and electronic‐service quality (E‐SQ) between customer perceptions of CSR and customer loyalty. Design/methodology/approach: Working with a sample of 280 banking customers in Pakistan, partial least square based structural equation modeling is used to test the conceptual model. Findings: Surprisingly, results suggest that CSR is not directly related to customer loyalty, which is contradictory to previously established findings conducted in developed countries. Thus, confirming a full mediation of CCI, E‐ SQ and trust in enhancing the effect of CSR on customer loyalty. The study also confirms that CSR is positively related to E‐SQ, and E‐SQ also directly affects CCI. Practical implications: Banks should adhere to honest CSR practices and effectively communicate and advertise these practices to increase awareness and knowledge among the customers. Similarly, banks should advance in technological expertise to generate customer identification, which then leads to their loyalty. Originality/value: Previous studies conferred short‐term customer’s reactions, such as purchase intention and brand image. Still, this research discusses the long‐term effect of CSR on customer behavior, such as the loyalty of the customers. Moreover, this is the pioneer study that investigates how CSR actions influence customer perceptions about E‐SQ and how electronic services affect customer identification with a bank. Keywords: corporate socialre sponsibility, electronic‐servicequality, trust, customer firmidentification, customerloyalty, Pakistan.
10. Zeesahn, M., Qureshi, T. W., Bashir, S., & Ahmed, U. (2020). Transformational Leadership and Corporate Reputation: Mediation Effects of Employer Branding. Journal of Management and Research, 7(1), 184‐211. Retrieved from https://ojs.umt.edu.pk/index.php/jmr/article/view/466. (Tariq Waheed Qureshi (Management/SBE) Abstract: The purpose of this paper is to examine the impact of transformational leadership and corporate reputation on employer branding by testing a hypothesized model. This study employed a quantitative online survey technique. The researcher distributed 350 questionnaires through purposive sampling out of which 132 questionnaires received back for data analysis. Regression analysis was selected to analyze the collected data to test the hypothesis developed from past literature. Results validate that transformational leadership has an impact on employer branding and employer branding has a direct impact on corporate reputation but correlation amid transformational leadership and business reputation goes insignificant when added employer branding showing full mediation of this variable. The present study backs the writings of business reputation that can be developed through transformational leadership and employer branding. The findings would be helpful for organizational leaders in developing strategies to create a corporate reputation. Keywords: Transformational leadership, employer branding, corporate reputation, management.
11. Ghaffar, A. (2020). The Impact of the Financial Cost of Caring for Greying on Emotional Exhaustion in the Workplace: The Mediating Role of Stress. Is Ahlakı Dergisi, Turkish Journal of Business Ethics, 13(1), 31‐51. (Abdul Ghaffar (Management/SBE) Abstract: The workforce around the globe is facing multiple challenges due to ever‐increasing greying (ageing) of the world’s population. One of the major challenges is caring for this greying population i.e. eldercare. A family Research Outlook 2020 | 148
member is usually the one who provides care for an elder and resultantly faces a lot of issues including financial hardships. A caregiver may face financial challenges and the impact may spill over the workplace. This financial burden may produce stress that later on results in emotional exhaustion at work. Therefore, the objective of this study is to investigate the impact of this financial burden on the employee’s emotional exhaustion at the workplace. A total of 143 respondents from education, banking and health sector were included in this study. The results indicate that the impact of financial burden spills over the workplace and initially it generates stress at work that eventually results in emotional exhaustion. Furthermore, the study suggests that employers should also focus on eldercare demands carried by the employees as the burden of these demands are regarded as a “silent productivity killer”. Keywords: financial burden, emotional exhaustion, job stress, caregiving.
12. Khan, W., Ali, A., Khan, S., Yazdani, N. (2020). Islamic perspective regarding the promotion of health and participation in sports activities. Journal of Islamic Thought and Civilization (JITC), 10(1). 365‐374. https://journals.umt.edu.pk/index.php/JITC/article/view/731. (Naveed Yazdani (Management/SBE) Abstract: Sound health is considered a prerequisite for performing any action, whether it iparticipation in sports or performing any other activity of life. From the perspective oIslam, health and fitness are imperative for the appropriate performance of various religiouobligations. Sports and other physical activities are considered very effective means to achieve good health. In this paper, the researchers analyzed diverse Islamic standards and rules with reference to participation in games. Moreover, researchers also analyzed the preservation and maintenance of health in the light of the teachings of Islam. After a briediscussion, it was concluded that the Islamic approach is very clear and Islam endorses the upkeep and maintenance of health, fitness and physical power. It was also concluded thasports and other physical activities of today are variations of such activities performed in the past. The study also claims that Islam promotes involvement in leisure sports and othephysical activities carried out to strengthen the body and to retain fitness, while observing Islamic teachings, formulated rules and regulations. It can be inferred that the Holy Prophet (SAW) not only took part in different games but also convinced and encouraged his disciples to take part in sporting activities Keywords: health, Islamic perspective, participation, promotion, sports activities.
13. Farrukh, M., Meng, F., Raza, A., & Tahir, M. S. (2020). Twenty‐seven years of Sustainable Development Journal: A bibliometric analysis. Sustainable Development, 28, 1725– 1737. https://doi.org/10.1002/sd.2120. (Ali Raza (KUBEAC) (SKT Campus) Abstract: This study aims to analyse 27 years' bibliometric data of the Sustainable Development Journal (SD). The analysis of 874 publications exhibits multi‐folded growth, rising from 22 articles in 1993 to 121 articles by 2019. Moreover, the analysis of publication structure, as well as the mapping of bibliographic data based on co‐citation, bibliographic coupling (BC), and co‐occurrence (CC), showed the intellectual structure and the connection among the contributing universities, countries, and authors. As the first retrospection of the Journal, this study not only educates and enriches SD's global readers and aspiring contributors but also may be useful to its editorial board, as it provides several inputs to navigate for future research. Keywords: bibliographic coupling, bibliometrics, co‐citation, co‐occurrence, scimago, scopus, vos viewer.
14. Ur Rehman, Z., Ahmed, D., Ali, Ahmad, S., Khattak, A., & Sameer, I. (2020). Entrepreneurial Factors Affecting Perceived Socioeconomic Success in One Belt One Road Initiative–A Study of China‐Pakistan Economic Corridor. International Journal of Management (IJM), 11(9). (Syed Ahmad Ali, Izba Sameer (Management/SBE) Abstract: Using the Multi Attribute Decision Making (MADM) approach and the Social Exchange theory, this study is amongst the first few studies to investigate the perceived socioeconomic success of the China‐Pakistan
Research Outlook 2020 | 149
Economic Corridor (CPEC) along with its antecedents i.e. entrepreneurial trust (in Government, media, enterprises and experts), entrepreneurial intention to invest in CPEC projects, and entrepreneurial information (information transparency and information acquisition). The data was collected through a cross‐sectional design survey by 327 entrepreneurs in Pakistan. The results indicate that entrepreneurs’ trust and their intention to invest in CPEC positively impact the perceived socioeconomic success of CPEC in Pakistan. Information transparency and information acquisition both significantly moderate the relationships at low and medium level. However, in the study, information transparency and information acquisition became insignificant at high levels. This paper aims to fill gap in the current literature on entrepreneurial development by investigating the antecedents that potentially influence the perceived socioeconomic success of CPEC in Pakistan. Keywords: CPEC, Entrepreneurs ‘Intentions, Perceived Socioeconomic Success, Entrepreneurs’ Trust, Information Transparency, OBOR.
15. Ahmed, M., & Ali, S. A. (2020). Muslim Consumers’perception About Diverse Marketing Advertisement Channels: A Qualitative Study in Malaysia. Epistemology, 7(1), 47‐66. (Syed Ahmad Ali (Management/SBE) Abstract: Marketers today bombard messages on consumers through diverse advertisement channels without recognizing what consumers actually perceive about them. The selection of advertisement channels depends primarily upon the needs, preferences, lifestyle, and culture of the target market. Considering religion an important aspect of culture, this qualitative research uses interviewing technique and ascertains perception of nine Malaysian Muslim consumers about various advertising channels. Using convenience sampling, it further probes reasons for liking and disliking a particular advertisement channel. Findings indicate that TV has been liked the most among majority respondents. Contrarily, random advertisement emails are found the most disliked advertisement channel. Furthermore likes and dislikes pertaining to eight advertisement channels (TV, FM radio, Magazine, Newspaper, Pamphlet, Web site banners and popups,Emails and Billboards) have been highlighted individually. This study will help marketers determine both effective and ineffective advertisement channels in order to attract and retain Muslim consumers. Comparison of diversified channels will help managers discern the channel that Muslim consumers liked and disliked the most which will subsequently help in decision making. Keywords: Consumer, Advertisement, Channels, Decision Making.
16. Shafaqat, S., Kausar, A. R., & Ali, S. A. (2020). Conceptualization of Higher Education Institutions (HEI) as a Service System Using SD Logic Lens. NICE Research Journal, 13(1). 47‐99. (Sara Shafaqat, Abdul Rashid Kausar, Syed Ahmad Ali (Management/SBE) Abstract: This qualitative study provides a tentative theory of university as service system using S‐D logic lens.Presently, the universities are working under G‐D logic, where thenetworks & entitiesare performing under the different agendas to contributeto the whole ecologywiththe approach of unilateral transfer of services/resources.However,the organizational effectiveness highly depends on actively interacting with its internal and external networks to seek valuable resources to ensure its functioning through a shared worldview. Therefore, universitiesneed to develop an architecture of participation where actors connect and collaborate through a shared vision. The resultsof G‐D logic‐based university systemrevealedthe dominant factors;“the behaviourof people” which is opportunistic,and “dealings” have been done in self‐interest,asthe system is complex and based on indirect interactions.This study presents a solution by the conceptualization of universities as service system; the propositions reveala mechanism of resource integration through which entities and networks linkresources through forming the value proposition for mutual benefits. Thereby, this mechanism may be use as “transparent check of governance” in whichall the public and private universitysystem’s constraints maybe mitigated by application of S‐D logic. Keywords: Entities, Resources, Networks, Management, G‐D logic, S‐D logic and Servicesystem. Research Outlook 2020 | 150
17. Azeem, M. U., De Clercq, D., & Haq, I. U. (2020). If the organization is a mess, do employees explain or exploit the situation? Personnel Review, 50(2), 610‐629. doi: 10.1108/PR‐11‐2019‐0600. (Muhammad Umer Azeem (Management/SBE) Abstract: Purpose – This study investigates the connection between employees’ dissatisfaction with the organizational status quo and their job performance, with a particular focus on the mediating role of their problem‐focused voice behavior – through which they pinpoint possible causes of organizational problem situations – and the moderating role of their Machiavellianism. Design/methodology/approach – Three‐wave survey data were collected from employees and their supervisors in Pakistani organizations. Findings – An important reason that employees’ beliefs about organizational underperformance spur their own performance, as rated by supervisors, is that they spend significant energy expressing their concerns about shortcomings. The mediating role of such constructive voice behaviors is mitigated though, to the extent that employees have stronger Machiavellian tendencies. Practical implications – For human resource managers, the findings reveal problem‐focused voice as a key mechanism by which employees’ negative perceptions about how well their organization fares can be channeled into higher job performance. They also elucidate how this process is less likely among employees who are self‐centered and less concerned about their organization’ well‐being, such that they hold back pertinent information about organizational failures from others. Originality/value – The study pinpoints problem‐focused voice as an unexplored behavioral response by which employees’ beliefs about organizational underperformance can enhance their job performance. It also details how the tendency of Machiavellian employees to stay away from such voice activities may backfire in the form of lower performance evaluations. whichall the public and private universitysystem’s constraints maybe mitigated by application of S‐D logic. Keywords: dissatisfaction with the organizational status quo, problem‐focused voice behavior, job performance, machiavellianism, conservation of resources theory.
18. Azeem, M. U., De Clercq, D., & Haq, I. U. (2020). But they promised! How psychological contracts influence the impact of felt violations on job‐related anxiety and performance. Personnel Review, 50(2), 648‐666. doi: 10.1108/PR‐07‐2019‐0388. (Muhammad Umer Azeem (Management/SBE) Abstract: Purpose –This study unpacks the relationship between violations of organizational promises, as perceived by employees and their job performance, considering the mediating effects of job‐related anxiety and moderating effects of psychological contract type. Design/methodology/approach – Multi‐source, multi‐wave data were collected from employees and their supervisors in Pakistan. Findings – Feelings of organizational betrayal may reduce job performance due to the higher anxiety that employees experience in their daily work. This mediating role of enhanced job‐related anxiety in turn is stronger to the extent that employees believe that their psychological contract contains relational obligations but weaker when it contains transactional obligations. Practical implications – The study gives organizational decision makers pertinent insights into how they can mitigate the risk that employees who are angry about broken organizational promises stay away from performance‐enhancing work activities, namely, by managing the expectations that come along with psychological contracts. In so doing, they can avoid imposing dual harms on employees, from both a sense that they have been betrayed and the risk of lower performance ratings. Originality/value – This study offers expanded insights into the process that underpins the translation of psychological contract violations into diminished job performance, by pinpointing the simultaneous roles of experienced job‐related anxiety and beliefs about employer obligations. Keywords: felt violation, job‐related anxiety, job performance, psychological contract type, conservation of Resources theory.
Research Outlook 2020 | 151
Conference Proceedings 1. Umar, M., Ali, S. A., & Sial, M. H. (2020). Effect of Empowering Leadership on Organizational Learning and knowledge sharing behavior: Mediation of OCB, Moderation of Knowledge Culture. Paper presented at the BAM Conference USA 2020, (IN Cloud) Renaissance Schaumburg Convention Center Hotel, Schaumburg, Illinois, United States. Oct 2‐4. 2020. (Muhammad Umar, Syed Ahmad Ali (Management/SBE) Maqbool Hussain Sial (Economics\SBE) Abstract: The study in hand examine, describe and explain the relationship among empowering leadership, knowledge sharing behavior and organizational learning with the mediation of OCB and moderation of knowledge sharing culture among higher education institutions of Pakistan. The study follows positivist paradigm, it is quantitative and cross‐sectional survey‐based research. Thus, current research is deductive, explanatory and descriptive. It used mixed method sampling technique consisting of stratified random sampling and multi‐stage cluster sampling. An adapted questionnaire used to collect data from sample population. The collected data interpreted using inferential statistics i.e. structure equation modelling technique with the help of Statistica software to achieve research objectives. The proposed hypotheses undergo empirical verification for statistical acceptance. The study intends to transpire positive association among empowering leadership, knowledge sharing and organizational learning with intervention of OCB and moderation of knowledge sharing culture respectively. Subsequently, it paves way for more empirical evidence for better generalization of the hypothesized framework. Keywords: Empowering leadership, Organizational learning, Knowledge sharing, OCB, Knowledge sharing culture.
2. Sultana, K., Ali, S. A., Aslam, H., & Afzal, S. (2020). Spiritual Leadership, Ethical, and Philanthropic Citizenship, Mediated by Professional Moral Courage. Academy of Management Proceedings, 2020(1), 20047. doi: 10.5465/AMBPP.2020.20047abstract. (Khawar Sultana, Syed Ahmad Ali, Haris Aslam and Sana Afzal (Management/SBE) Abstract: In recent years, organizations have witnessed a formidable shift in employees’ behaviors deeply rooted in a negatively charged work environment. This initiates a need for spiritual leadership to address organizational vice and challenges associated to employees’ behavior. These behaviors subsequently reflect in employees’ work outcomes and conform a penultimate connection of personal, environmental and behavioral factors. With this premise, our study encompasses an integrated framework of social cognitive theory and spiritual leadership theory to test the impact of spiritual leadership on employees’ ethical and philanthropic citizenship behaviors through a mediating channel of professional moral courage. Data for this study is collected from four higher educational institutes (N = 320) with scales which are found reliable and valid for this context. Findings show that observed data fits the hypothesized model and conforms to criteria of model fit indices. The significance and effect size of the results indicate distinctive incremental variance in the dependent variables of ethical and philanthropic citizenship of behavior and proved the intervening effect of professional moral courage. The theoretical and practical implications along with future research directions are discussed subsequently." Keywords: not available.
3. Ghaffar, A., & Azeem, M. U. (2020). Socially Burdened? The Impact of Social Burden on Employee Burnout: Roles of Stress and PsyCap. Paper presented at the British Academy of Management Conference 2020 Proceedings in the Cloud. (Abdul Ghaffar, Muhammad Umer Azeem (Management/SBE) Abstract: The continuous increase in ageing of the population has offered huges challenges to the contemporary workforce including caring for these elders. Demands associated with eldercare burden caregivers in multiple ways including financial, emotional, physical and social issues which may spill over to caregivers’ workplace. The
Research Outlook 2020 | 152
social burden may lead to social isolation as the social network becomes limited to only close family and as a result produces multiple issues including stress and burnout. An individual may cope with these negative consequences of eldercare using personal psychological resources also called psychological capital or PsyCap. The current study aims to investigate the impact of social burden on job burnout through the lense of stress and PsyCap using as mediator and moderator respectively. Data were collected from a total of 333 respondents from banks and hospitals. The results show a positive relationship between social burden, stress and job burnout. The moderating role of PsyCap was reported limited to only job stress to job burnout and revelaed no significant impact between social burden and job stress. The later findings offer new lines for future researchers. Keywords: eldercare, social burden, stress, psycap, burnout. Conference Papers 1. Kamran H., Arshed N., & Munir M. (2020). Forces of Dynamic Capability and Incidence of Entrepreneurship: a machine‐learning based country classification. Paper presented at 7th Global Conference on Business Management and Social Sciences (Online). 8th‐9th August 2020. (Kamran Hameed (Management\SBE) Noman Arshed, Mubbasher Munir (Economics/SBE) Abstract: Not available. Keywords: not available. Department of Operations & Supply Chain Research Articles 1. Aslam, H., Blome, C., Roscoe, S., & Azhar, T. M., (2020). Determining the antecedents of dynamic supply chain capabilities. Supply Chain Management: An International Journal, 25(4), 427‐442. doi: 10.1108/SCM‐02‐2019‐ 0074. (Haris Aslam, Tashfeen Mahmood Azhar (Operation and Supply Chain/SBE) Abstract: Purpose – The purpose of this paper is to determine the antecedents of dynamic supply chain capabilities (DSCCs). The authors test entrepreneurial orientation (EO) and supply chain learning orientation (SCLO) as two antecedents of DSCCs. Design/methodology/approach – The paper uses structural equation modelling to test a hypothetical model. Data are gathered from a survey of 275 operations managers in Pakistan’s turbulent manufacturing industry. Findings – The findings suggest that the weaker direct effects of EO, in comparison to the indirect effects, indicate that an SCLO mediates the relationship between EO and DSCCs. Research limitations/implications – It is widely accepted that firms do not compete with each other, instead, it is end‐to‐end supply chains that fight for market dominance. Many scholars use the dynamic capabilities view to understand supply chain level competition. However, the dynamic capabilities view is firm‐centric in its examination of how companies transform internal resources to compete in the external environment. The theoretical contribution of this paper is a roadmap of how to build dynamic, supply‐chain level and capabilities by determining the key antecedents. This paper explains that DSCCs emerge when buyers and suppliers share strategic orientations. Firms with an EO and the ability to learn with supply chain partners are well‐positioned to develop DSCCs. This provides a new angle to theory testing by indicating that dynamic capabilities are enabled by an EO and an ability to learn with supply chain partners. Practical implications – Managers are given the building blocks of DSCCs, starting with fostering an entrepreneurially‐oriented mindset in the company and then learning with supply chain partners. Entrepreneurially‐oriented managers are encouraged to take risks and co‐ develop innovative ideas with suppliers during the supply chain learning process. Originality/value – This study is one of the earliest efforts to determine the strategic orientations that antecede the emergence of DSCCs. Keywords: entrepreneurial orientation, supply‐chain management, structural equation model, supply chain agility, dynamic supply chain capabilities, supply chain learning orientation, market sensing, supply chain adaptability.
Research Outlook 2020 | 153
2. Usama, M., & Ramish, A. (2020). Towards a sustainable Reverse Logistics framework/typologies based on Radio Frequency Identification (RFID). Operations and Supply Chain Management: An International Journal, 13(3), 222‐ 232. (Muhammad Usama, Asher Ramish (Operation and Supply Chain/SBE) Abstract: In the past, closed loop supply chains (CLSCs) were not considered as value creating chains due to complexities and uncertainties in the product returns until the introduction of radio frequency identification (RFID) in the domain of supply chain (SC), which has made the product visibility possible in the CLSCs and has overcome the issues of uncertainties in product returns. There is a lack of research to configure RFID in closed loop supply chains or reverse logistics (CLSCs/RL). The objective of this paper is to develop the typology and propose the framework for configuring RFID in the CLSC/RL by categorizing the products based on RFID tagging and correspondingly finding the place of tagging RFID to the products in the CLSC/RL on the basis of product category in order to attain sustainability in an efficient and effective manner. Two typologies (pre‐tagging and post‐tagging) regarding deployment of RFID in sustainable and CLSC/RL are developed along with categorization of products as single‐piece and multi‐piece products followed by a proposed conceptual framework for RFID configuration in Reverse Logistics domain. Empirical study is required to validate the proposed conceptual framework. The outcomes include: improvement in product visibility, forecasting accuracy, customer satisfaction, profit and market share and reduction in inventory cost and pollution. Keywords: sustainability, radio frequency identification (RFID), closed‐loop supply chain (CLSC), reverse logistics (RL), framework, typology, typologies.
3. Mukhtar, U., & Azhar, T. M., (2020). Inter‐functional Coordination to Co‐create Value Within Integrated Value Chains for Competitive Supply Chain. Operations and Supply Chain Management: An International Journal, 13(1), 11‐22. (Umer Mukhtar, Tashfeen Mahmood Azhar (Operation and Supply Chain/SBE) Abstract: This paper aims to develop a conceptual model that can assist managers in the development of competitive value chain using value co‐creation and integration to make the whole supply chain competitive. The model is based on theoretical and conceptual underpinnings of value co‐creation, network theory, value chain, and customer value theory. The model focuses on the idea that integrated value chains with high value co‐ creation abilities within them would make the whole supply chain competitive. That means that if the individual firms along the supply chain work on improving their value co‐creation abilities, and they are well‐integrated, it will increase the whole supply chain competitiveness. It is a conceptual model that needs to be operationalized and empirically tested in the future. The model suggests high value co‐creation abilities in the individual value chains with a well‐integrated supply chain as a basis for supply chain competitiveness. The model includes several theoretical and conceptual views related to value co‐creation. However, it may be possible to add some additional perspectives in the future research. Keywords: value chain, value co‐creation, integration, supply chain competitiveness, supply chain performance.
4. Aslam, H., Khan Abdul, Q., Rashid, K., & Rehman, S.‐u. (2020). Achieving supply chain resilience: the role of supply chain ambidexterity and supply chain agility. Journal of Manufacturing Technology Management. 31(6). 1185‐1204. doi: https://doi.org/10.1108/JMTM‐07‐2019‐0263. (Haris Aslam, Abdul Qadeer Khan, Kamran Rashid and Saif‐ur Rehman (Operation and Supply Chain/SBE) Abstract: Purpose – This study analyzes the role of supply chain ambidexterity (SC‐Ambidexterity) in developing supply chain resilience (SC‐Resilience). We describe SC‐Ambidexterity as a simultaneous application of supply chain adaptability (SC‐Adaptability) and supply chain alignment (SC‐Alignment) capabilities. We also consider the role of supply chain agility (SC‐Agility) in the relationship between SC‐Ambidexterity and SC‐Resilience. We further suggest that the relationship between SC‐Ambidexterity and SC‐Resilience may be stronger in case of higher market uncertainty. Design/methodology/approach – Based on the dynamic capabilities view (DCV) of the firm, we develop a set of hypotheses that are tested through a survey of manufacturing firms in Pakistan. The Research Outlook 2020 | 154
hypothesized model is tested through structural equation modeling (SEM). Findings – The results of this study show a positive effect of SC‐Ambidexterity on SC‐Resilience. SC‐Agility positively mediates the relationship between SC‐Ambidexterity and SC‐Resilience. However, our results show that this relationship does not vary at different levels of environmental uncertainty. Originality/value – This study provides the seminal operationalization of SC‐Ambidexterity in the supply chain context. It further shows the importance of SC‐ Ambidexterity and SC‐Agility in contributing toward SCResilience. Keywords: dynamic capabilities, supply chain ambidexterity, supply chain adaptability, supply chain alignment, supply chain agility, supply chain resilience.
5. Yusuf, I., & Azhar, T. (2020). Development of a Dynamic Model of Quality Control Circles: A Case of ABC Packaging Company. Journal of Management and Research, 7(2), 288‐323. https://doi.org/10.29145/jmr/72/0702010. (Ijaz Yusuf, Tashfeen Mahmood Azhar (Operation and Supply Chain/SBE) Abstract: Quality control circles are considered an effective tool in the organization to best utilize the potential of the workforce. The objective behind using quality control circles is to use employees’ brains to generate savings and create an impact on the bottom‐line of the company. The framework of the quality control circles shown in Table 2 proposed the structured seven steps strategy to use the workforce's potential for continuous improvement in the organization. Companies confront multi‐faceted issues and challenges in the operational processes and corporate excellence thus mainly depends upon the effective and efficient quality controls to overcome the product, process, machine, and material related issues that hamper the production efficiency, quality of the product, and overall productivity of the company. This paper attempts to develop the system dynamics model of quality control circles based on normalized data of the case company. Participation in quality control circles is voluntary in nature and passion to learn and improve is the intrinsic motivation for employees and organizations to join these circles. Employee involvement to participate and produce creative ideas in these circles is the key to the success of these quality‐enhancing programs (Jerman et al. 2019) and model outcome depicts the same story. The quality control circle model indicates that a set of inter‐related and interdependent skills and behaviors are a necessary condition to increase participation in the quality control circles and productivity of projects under consideration. The computer‐based software STELLA is used for programming the model of quality control circles using the generic structures of the company under study. Underlying feedback structures and interactions among various variables makes the model closer to the real‐life setting. Keywords: quality control circles, systems dynamics, computer simulation, employee involvement, project savings. Department of Information Systems Research Articles 1. Wajid, B., Iqbal, H., Jamil, M., Rafique, H., & Anwar, F. (2020). MetumpX—a metabolomics support package for untargeted mass spectrometry. Bioinformatics, 36(5), 1647‐1648. doi: 10.1093/bioinformatics/btz765. (Bilal Wajid (Information Systems/SBE) Abstract: Motivation: Metabolomics is a data analysis and interpretation field aiming to study functions of small molecules within the organism. Consequently Metabolomics requires researchers in life sciences to be comfortable in downloading, installing and scripting of software that are mostly not user friendly and lack basic GUIs. As the researchers struggle with these skills, there is a dire need to develop software packages that can automatically install software pipelines truly speeding up the learning curve to build software workstations. Therefore, this paper aims to provide MetumpX, a software package that eases in the installation of 103 software by automatically resolving their individual dependencies and also allowing the users to choose which software works best for them.
Research Outlook 2020 | 155
Results: MetumpX is a Ubuntu‐based software package that facilitate easy download and installation of 103 tools spread across the standard metabolomics pipeline. As far as the authors know MetumpX is the only solution of its kind where the focus lies on automating development of software workstations.. Keywords: not available.
2. Yu, X., Yan, J.D., Zhang, F., Hammad, M., Zhang, Q. (2020). Sustainable development of sci‐tech service intermediaries based on triple helix model of innovation. International Journal of Sustainable Development and Planning, 15(4), 513‐519. https://doi.org/10.18280/ijsdp.150411. (Hammad Mushtaq (Information Systems/SBE) Abstract: Innovation is an important driver of sci‐tech progress. In the innovation network, there are multiple challenges for the cooperation based on sci‐tech resources, talents, and sharing mode. To cope with these challenges, it is imperative to promote the sustainable development of sci‐tech service intermediaries, the external institutions that support innovation activities. Based on the triple helix model of innovation, this paper looks for the sustainable development path of sci‐tech service intermediaries in the context of openness and innovation. Firstly, neural network analysis was performed to clarify the driving factors and their correlations in innovation activities. Next, the authors established an evolutionary game model of the sustainable development for the sci‐tech service intermediary, and used the model to analyze the factors affecting the intermediary’s cooperation strategies in innovation activities. After that, the influencing factors of the intermediary’s sustainable development were identified through Matlab simulation. The results show that the sustainability of sci‐tech service intermediaries depends on the information technology level, resource allocation capability, and operation and management level of its platform. Keywords: triple helix model of innovation, sci‐tech service intermediaries, sustainable development, evolutionary game.
3. Ashraf, M., Geng, G., Wang, X., Ahmad, F., & Abid, F. (2020). A Globally Regularized Joint Neural Architecture for Music Classification. IEEE Access, 8, 220980‐220989. doi: 10.1109/ACCESS.2020.3043142. (Fazeel Abid (Information Systems/SBE) Abstract: Music classification is an essential application of Music Information Retrieval (MIR) in organizing extensive collections of music. The tasks to classify different music with reliable accuracy observed to be challenging. Most of these tasks employ handcrafted feature engineering to build a classifier, yet unable to identify the original characteristics of music. Several combinations of neural networks using convolutional neural networks (CNNs) and recurrent neural networks (RNNs) have been in consideration of many researchers. However, it has been noticed that the joint architecture of CNN and RNN suffers some problems due to batch normalization, which causes low accuracy and more training time. To handle these issues, the Global Layer Regularization (GLR) technique is proposed on the hybrid model of CNN and RNN using Mel‐spectrograms for the evaluation of training and accuracy. Our experiments, with few hyper‐parameters, improve performance on GTZAN and Free Music Achieve (FMA) datasets by achieving modest accuracy of 87.79% and 68.87% respectively. Empirically, our proposed model takes the advantages of spatiotemporal domain features and the global layer regularization technique to accomplish reliable accuracy as compared to the other state of art works. Keywords: Information retrieval, information systems,convolutional neural networks (CNNs),recurrent neural networks (RNNs),global layer regularization (GLR),music classification,spatiotemporal domain.
Research Outlook 2020 | 156
Department of Marketing Research Articles 1. Waheed, A., Zhang, Q., Rashid, Y., & Zaman Khan, S. (2020). The impact of corporate social responsibility on buying tendencies from the perspective of stakeholder theory and practices. Corporate Social Responsibility and Environmental Management, 27(3), 1307‐1315. doi: 10.1002/csr.1885. (Yasir Rashid (Marketing/SBE) Abstract: This paper investigates the impact of corporate social responsibility (CSR) on buying behavior tendencies (BBTs), adopting two sub‐tendencies of BBTs—exploratory acquisition of buying tendencies (EAPTs) and exploratory information seeking tendencies (EISTs)—based on the stakeholder theory and practices. Data were collected and examined using confirmatory factor analysis and structural equation modeling. The study revealed a positive relationship between CSR practices and BBTs, and a significant correlation of CSR on both EISTs and EAPTs. Additionally, it verified a positive linkage between CSR and BBTs through the mediation of EAPTs and EISTs. These results provide insights for managements, especially those in CSR‐oriented firms, on how incorporation of CSR activities may influence the BBTs of consumers. Finally, the paper discusses several implications for strategic management along with avenues for future research. Keywords: buying behavior tendencies, corporate social responsibility, information seeking tendencies, product acquisition tendencies, stakeholder theory, structural equation modeling.
2. Rashid, Y., Tanveer, A., Shaukat, Z. and Sadiq, I. (2020), Value co‐creation features: an empirical case study of B2B collaboration and interactions in New Zealand. Digital Library Perspectives, 36(3), 219‐229. https://doi.org/10.1108/DLP‐02‐2020‐0006. (Yasir Rashid, Anisha Tanveer, Zeeshan Shaukat, Imran Sadiq (Marketing/SBE) Abstract: Purpose – This paper aims to highlight four features of value co‐creation among actors in a business‐ tobusiness environment. Service‐dominant (S‐D) logic of marketing is used as a theoretical lens to view at the process of value co‐creation. Design/methodology/approach – Using an interpretive methodological approach, the authors collected empirical material from a single case based in New Zealand. The case was based on the collaboration, interaction and relationship between vendor and client during an information and communication technology (ICT) systems integration project. The unit of analysis was “points of value creation.” Empirical material came from observation, in‐depth interviews and documents such as meeting notes and email logs. Interpretation highlighted four features of the value co‐creation process: motivators, outcomes, disadvantages and management. Moreover, personal and network aspects of value co‐creation process emerged. Findings – The findings of this study capture benefits, as well as conflicts and frustrations, in a value co‐creation process. Furthermore, it provides future research motivations for researchers currently working to develop S‐D logic of marketing. Originality/value – It is suggested that there is relatively little direction on how value co‐creation process should be undertaken in different contexts such as retail, education, health care and ICT. There is a need to understand the dynamics and specification of value co‐creation process, as the literature is scarce in this field. Keywords: resource integration, b2b collaboration, service‐dominant logic of marketing, empirical materials marketing, qualitative methodology co‐creation, value co‐creation.
3. Sabir Sana, S. (2020). Does product design stimulate customer satisfaction? Mediating role of affect. Asia Pacific Journal of Marketing and Logistics. 32(6). 1255‐1268. doi: https://doi.org/10.1108/APJML‐03‐2019‐0216. (Sana Sameen Sabir (Marketing/SBE) Abstract: Purpose – Product design is a dynamic factor that triggers customers’ experiential value which eventually escalates their satisfaction. Therefore, the purpose of this paper is to examine the impact of product design dimensions on customer satisfaction with the mediating role of affect. Design/methodology/approach –
Research Outlook 2020 | 157
A survey on 225 smartphone users has been conducted to test the conceptualization empirically. Confirmatory factor analysis and structural equation modeling were performed using SPSS Amos‐22.0 to confirm the hypotheses. Findings – The results indicate that affect fully mediates the relationship between symbolic dimension and satisfaction. Whereas, partial mediation of affect is observed in the relation between functional dimension and satisfaction. Practical implications – The framework of this research contributes towards the practice by facilitating managers in evaluating the impact of experiential value which product design dimensions create to influence customer satisfaction. Originality/value – This study is first of its kind to analyze how design dimensions create experiential value to influence customer satisfaction. It contributes to the literature by giving empirical evidence that affective responses like pleasure and arousal play an important role in assessing product design dimensions that influence customer satisfaction. Keywords: satisfaction, aesthetics, affect, symbolism, functionality.
4. Basharat, T. (2020). Applying ISPAR Model of Service Dominant Logic on Mentoring a Part of Training and Development Function of HRM Functions. International Journal of Service Science, Management, Engineering, and Technology (IJSSMET), 11(1), 46‐54. (Taimoor Basharat (Marketing/SBE) Abstract: This is a conceptual article written to apply I‐S‐P‐A‐R model which was presented in 2009 by research scholars Maglio, Vargo, Caswel and Spohrer on the Mentoring in Service Dominant Logic (SDL) perspective. The author has taken a deep insight of mentoring which is a part of training and development: a function of the Human Resource Management in Good Dominant Logic (GDL) perspective. For this research, a wide range of literatures is reviewed and many disciplines have been explored which include mentoring roles, need, responsibilities, and context. Here, it is worthy to mention that mentoring and supervision are two different terms and both have different roles, too. Roles of supervisors are: boss, teacher, evaluator, expert and counselor; whereas mentoring consisted of assisting, befriending, guiding, advising and counseling. In service science, all the service systems do not fulfill the requirement to be a service system. There is also presented I‐S‐P‐A‐R which stands for Interact‐Serve‐Propose‐Agree‐Realize model of service system interactions episodes. This model is applied on mentoring in SDL perspective. At the end of this article, a conclusion is drawn and areas for further research have been mentioned. Keywords: not available.
5. Zameer, H., Yasmeen, H., Zafar, M. W., Waheed, A., & Sinha, A. (2020). Analyzing the association between innovation, economic growth, and environment: divulging the importance of FDI and trade openness in India. Environmental Science and Pollution Research, 27(23). 29539–29553. (Abdul Waheed (Marketing/SBE) Abstract: The objective of this paper is to explore the nexus of innovation–environment and economic growth in the context of the Indian economy. To achieve the study objective, we explored the role of technological innovation, FDI, trade openness, energy use, and economic growth toward carbon emissions. Using the data of 1985–2017, the study employed ARDL bound testing and vector error correction model (VECM) methods to capture the effects of technological innovation, trade openness, FDI, energy use, and economic growth on CO2 emissions. Empirical estimation has confirmed the existence of long‐run cointegration. Similarly, in the long run, it is found that trade openness, energy use, and economic growth positively reinforce CO2 emissions. In contrast, technological innovation and FDI negatively reinforce CO2 emissions in the long run. Furthermore, VECM indicates that the relationship among innovation, trade openness, and energy use is bidirectional in the long run. Whereas, unidirectional relation has been found that is coming from GDP to carbon emissions, FDI, innovation, trade, and energy use. In the short run, unidirectional link found which is coming from FDI, innovation, and energy use to carbon emission. However, the association between emissions and trade openness is bidirectional. The conclusions put forward policy implications that innovation is a way to reduce environmental degradation. Keywords: innovation, trade, CO2 emissions, growth, environment. Research Outlook 2020 | 158
6. Waheed, A., Zhang, Q., Rashid, Y., Tahir, M. S., & Zafar, M. W. (2020). Impact of green manufacturing on consumer ecological behavior: Stakeholder engagement through green production and innovation. Sustainable Development, 28. 1395– 1403. doi: 10.1002/sd.2093. (Yasir Rashid (Marketing/SBE) Abstract: To pursuit sustainability in all business operations is a notable challenge for firms to survive in today's competitive environment. Customers are the important stakeholders who are becoming mindful regarding the environment‐friendly actions of the organizations. This study investigates the impact of green manufacturing practices (GMP) within two streams—pollution prevention practices (PPP) and product stewardship practices (PSP)—on ecological conscious consumer behavior (ECCB) along with the mediation influence of green product innovation (GPI). Data were gathered from Chinese consumers from those who prefer environment‐friendly products. The findings affirmed the positive nexus between GMP and ECCB. Second, a positive mediation influence of GPI was observed between GMP and ECCB. The multidimensional analysis revealed the positive relationships of PPP and PSP on ECCB, respectively. The findings furnish implications for green production on how organizations can accomplish stakeholder engagement incorporating green practices—GMP, PPP, PSP, and GPI— in their manufacturing operations. This study further suggests future avenues for academicians and practitioners. Keywords: ecological conscious consumer behavior, green manufacturing, stakeholder engagement, stakeholder theory, sustainable innovation.
7. Tariq, A., Rashid, Y., & Waseem, A. (2020). Value Co‐Creation in Travel Industry: Examining the Impact of Operand and Operant Resources on Actor Experience. Journal of Management Sciences, 7(1), 31‐46. (Amna Tariq, Yasir Rashid (Marketing/SBE) Ansar Waseem (Management/SBE) Abstract: The notion of value creation has now transformed into customer‐centric approach. Its focus has been shifted towards the free will of customers and they are being engaged into value co‐creation by means of different platforms. However, within this research, experiential innovation and human experiences have received little attention and very few studies have empirically investigated resource integration. This study explains the value of co‐creation process within the travel industry by examining the impact of operand and operant resources on customers’ experiences. Data was collected from 215 customers who had previously used the services of travel agents. The results indicate that both operand and operant resources are important in managing customers’ experience. This study establishes the importance of human experience in creating value and guides modern firms to adopt service dominant logic instead of good dominant logic. Keywords: Value co‐creation, resource integration, operant and operand resources, travel industry.
8. Guo, C., Guo, J., Yu, C., Li, Z., Gong, C., & Waheed, A. (2020). A Safe and Reliable Routing Mechanism of LEO Satellite Based on SDN. Computers, Materials & Continua, 64(1), 439‐‐454. (Abdul Waheed (Marketing/SBE) Abstract: Satellite networks have high requirements for security and data processing speed. In order to improve the reliability of the network, software‐defined network (SDN) technology is introduced and a central controller is set in the network. Due to the characteristics of global perspective, control data separation, and centralized control of SDN, the idea of SDN is introduced to the design of the satellite network model. As a result, satellite nodes are only responsible for data transmission, while the maintenance of the links and the calculation of routes are implemented by the controller. For the massive LEO satellite network based on SDN, a state evaluation decision routing mechanism is proposed. The designed mechanism monitors the status of the entire network effectively and reduces the on‐board load on the satellite network. The best routing decision is made under the comprehensive consideration of the current and historical status of each intersatellite link between Low Earth Orbit (LEO) satellite network nodes. The calculation and storage requirements are controlled within a reasonable range. Based on the curve parameter transmission fuzzy encryption algorithm, a safe and reliable condition Research Outlook 2020 | 159
assessment decision routing mechanism (CADRM) is designed. It ensures that the personal information of the LEO satellite network can be transmitted safely and effectively. The experimental simulation results show the improvement of network throughput, the reduction of packet loss rate and the enhancing of network reliability. Keywords: Route, LEO satellite, SDN, state assessment, inter‐satellite link.
9. Bashir, S., Khwaja, M. G., Rashid, Y., Turi, J. A., & Waheed, T. (2020). Green Brand Benefits and Brand Outcomes: The Mediating Role of Green Brand Image. SAGE Open, 10(3), 2158244020953156. doi: 10.1177/2158244020953156. (Yasir Rashid, Tariq Waheed (Marketing/SBE) Abstract: This study develops a test model that can conceptually contribute to the formation of a green brand image for the hospitality market. A conceptual model highlighting the mediating role of green brand image based on two antecedent constructs (consumer’s perceived functional and emotional benefits of green hotels) and four outcome constructs (green brand preferences, trust, loyalty, and corporate image) was tested using 347 Malaysian lodging consumers. The findings indicate that the increase in consumer’s perceived functional and emotional benefits will initially increase their green brand image, and eventually increase their green brand preferences, trust, loyalty, and corporate image. Moreover, the role of green brand image as a mediator exists between consumers’ perceived benefits and their green brand preferences, trust, loyalty, and corporate image. Based on these findings, the managers can devise green branding strategies for their hotels, and show how green campaigns can highlight ecological concerns among green hotel consumers. Keywords: green brand image, green brand benefits, green brand outcomes, hospitality market.
10. Zhao, F., Ahmed, F., Iqbal, M. K., Mughal, M. F., Qin, Y. J., Faraz, N. A., & Hunt, V. J. (2020). Shaping Behaviors Through Institutional Support in British Higher Educational Institutions: Focusing on Employees for Sustainable Technological Change. Frontiers in psychology, 11, 584857‐584857. doi: 10.3389/fpsyg.2020.584857. (Khalid Iqbal (KUBEAC) (SKT Campus) Abstract: Technology permeates all walks of life. It has emerged as a global facilitator to improve learning and training, alleviating the temporal and spatial limitations of traditional learning systems. It is imperative to identify enablers or inhibitors of technology adoption by employees for sustainable change in education management systems. Using the theoretical lens of organizational support theory, this paper studies effect of institutional support on education management information systems (EMIS) use along with two individual traits of self‐ efficacy and innovative behavior of academic employees in British higher educational institutions. Data for this cross‐sectional study were collected through a questionnaire completed by 591 academic employees of 23 universities from 10 cities in the United Kingdom. Partial Least Square structural equation modeling was used to analyze data with smartPLS 3.2.9 software. Results indicate that institutional support promotes self‐efficacy and innovative behavior that help develop positive employee perceptions. The model explains a 52.9% variance in intention to use. Post‐hoc mediation analysis shows that innovativeness and self‐efficacy mediate between institutional support and employee technology adoption behavior. As opposed to student samples in past studies on educational technology, this study adds to the literature by focusing on academic employees. Keywords: intention to use, education management information systems, self‐efficacy, institutional support, personal innovativeness, organizational support theory. Conference Proceedings 1. Zakir, F., Wang, D., Rehman, A., Waheed, A., Iffat, Z., & Wang, L. (2020, 29‐30 Jan. 2020). LNG supply chain: Challenges, Opportunities and Future Prospects. Paper presented at the 2020 3rd International Conference on Computing, Mathematics and Engineering Technologies (iCoMET). (Abdul Waheed (Marketing/SBE) Abstract: In the current energy challenges, natural gas (NG) has been emerged as eco‐friendly source of energy with abundance of offshore and onshore reserves. Due to economic infeasibility of NG transportation via
Research Outlook 2020 | 160
pipelines to far‐off destinations, liquefied natural gas (LNG) has become one of the most promising candidates to transport natural NG around the globe. However, multiform distribution of NG reservoirs and geographical constraints among LNG exporters and importers emerged the cost‐intensive challenges regarding LNG supply chains. In this research work, nature of current challenges like remote locations, cost escalations, LNG storage, scheduling and price convergence were identified. On the basis of identified issues, energy saving opportunities have been established in LNG supply chain. Design optimization of LNG process contributes to extract the energy saving opportunities and usage of jettyles LNG transfer concept is utilized for cost savings. Moreover, a way forward has been paved for possible improvements in the distinct contents of LNG supply chain. Keywords: liquefied natural gas, supply chain, cost savings, energy consumption.
2. Akbar, K., Jin, Y., Mahsud, M., Akbar, M., Waheed, A., & Amin, R. (2020). Role of Big Five Personality Traits in Sustainable Consumption Behavior. Paper presented at the Proceedings of the 2020 3rd International Conference on Big Data Technologies, Qingdao, China. https://doi.org/10.1145/3422713.3422750. (Abdul Waheed (Marketing/SBE) Abstract: This body of knowledge analyzed the relationship between the big five personality traits (BfT) and sustainable consumption behavior (SCB) in social networking sites. This study contributes to the available literature on sustainable consumption behavior by using date from social networking sites users from Pakistan. The sample size was (n = 394). To analyze the data, causal modeling technique (SEM) was used. The study results reveal that there is a positive association of BfTwith SCB. The results contribute to increasing the understanding of SCB and marketing managers can develop strategies using these findings to gain a competitive advantage. Keywords: big five personality traits, sustainable consumption behavior, empirical findings, structure equation modeling. Department of Economics Research Articles 1. Anser, M. K., Hanif, I., Vo, X. V., & Alharthi, M. (2020). The long‐run and short‐run influence of environmental pollution, energy consumption, and economic activities on health quality in emerging countries. Environmental Science and Pollution Research, 27, 32518–32532. doi: https://doi.org/10.1007/s11356‐020‐09348‐1. (Imran Hanif (Economics/SBE) Abstract: This study investigates the effect of energy utilization, greenhouses gasses emissions, and economic activities on health risks such as mortality rate and incidence of respiratory diseases in emerging Asian economies. The study analyzes a panel data from 1995 to 2018 to examine the long‐run and short‐run influence of environmental pollution on health issues. The empirical findings highlight that greenhouse gasses emissions, fossil fuel consumption, and natural resources depletion in the region are key factors to increasing health risks in the long‐run period, while the use of clean energy and improvement in per capita economic growth is helping to improve the health status of the households. In a short period, greenhouse gasses emission is the only significant factor responsible for the high mortality rate and occurrence of respiratory diseases in the emerging economies of Asia. According to the results, there is a need for government intervention programs to rescue the region from the negative effects of environmental pollution and the utilization of nonrenewable energy. In emerging Asian countries, the combustion of fossil fuels, environmental pollution, and limited access to clean energy are such factors responsible for high mortality rate and stimulating incidence of respiratory diseases in the individuals. The study suggests that alternative green energy can prove helpful to control greenhouse gasses emissions and to control health issues by improving environmental quality. The study further suggests that the use of clean energy from water, wind, and sunlight may prove helpful to meet the energy requirement at the domestic level
Research Outlook 2020 | 161
and improve the health status of the individuals by reducing the incidence of respiratory diseases in emerging countries of Asia. Keywords: energy consumption, emerging economies, greenhouse gasses, mortality rate, respiratory diseases.
2. Arshed, N., Hassan, M. S., & Aziz, O. (2020). Does income inequality lead to education inequality? A cross sectional study of Pakistan. UMT Education Review, 3(1), 45–68. (Noman Arshed, Muhammad Shahid Hassan (Economics/SBE) UMT JOURNAL Abstract: When firms do not know which labor is capable of efficient work, then paying all employees their average product as wage seems a feasible option. This simplest of waysdiscourages good workers and makes bad workers costly. Spence proposed to use educational attainment as the indicator of the labor force's capability to solve this problem. Since workers are randomly distributed in terms of their ability, Akerlof would lead us to believe that the level of educational attainment should be proportional to the individual's ability, which is not valid, practically. This study strives to find the determinants of educational inequality, where income inequality of the household is the prime suspect, and other indicators include gender, household size, and age. GMM instrumental variable approach was used to study the effect of income inequality on educational inequality. The results showed that it is income inequality, which restricts people from attaining higher education. Keywords: access to education, income inequality, GMM model, labor force survey.
3. Suleman, S., Sial, M. H., & Siddique, H. N. (2020). Nexus between Child labor, Sector‐specific Growth and International Trade in Pakistan. Journal of Business and Tourism, 6(1), 313‐326. (Maqbool H. Sial (Economics/SBE) Abstract: This study focused on analyzing the impacts of different sectors’ growth and globalization on child labor in Pakistan. The order of integration variables was found mix as some were I(0) and some were I(1). That’s why, the long run and short run dynamics were evaluated through ARDL mechanism using data from 1980‐2014. The long run and short run inferences revealed that growth reduced child labor significantly in all sectors except services. The urban population growth significantly lessened the child labor as compared to rural population. The FDI significantly decreased the child labor growth while trade openness did opposite. Results suggest that trade policy and labor laws of ILO should be implemented. Keywords: child labor, ARDL, FDI, ILO.
4. Ayaz, M., Jamal, K. F., Shaheen, S., & Arshed, N. (2020). Sources and Uses of Charity Fund Accounts: A Comparative Analysis of Islamic Banks in Pakistan. COMSATS Journal of Islamic Finance, 5(1), 14‐40. (Mohammad Ayaz, Sadaf Shaheen, Noman Arshed (Economics/SBE) Abstract: Charity Fund Account (CFA) is a unique account of Islamic banks (IBs) where all Shari‘ah non‐ compliant earnings of the banks are transferred. However, unfortunately, this has got the least attention in the academic literature so far. This case study explored the sources and uses of charity funds accounts of four Islamic banks in Pakistan. It also analyzed the disclosure level of information regarding these sources and uses of funds. The study applied content analysis technique on disclosures of charity fund composition. The study uses five‐year secondary data (2014‐2018) of four Islamic banks (Meezan Bank, Dubai Islamic Bank, Bank Al Barakah and Bank Islami) collected from their financial statements. The findings of the study were that there is no uniformity in the disclosure of sources and uses of charity accounts funds of the selected banks. The Meezan Bank’s disclosure level was higher than the rest of the three banks. Further, among these four banks, the Dubai Islamic banks’ late payment charges showed more decreasing trend over time. It means that Dubai Islamic banks performed better in controls and monitoring. The SBP as a regulator should make a detailed policy regarding disclosure of charity funds account to ensure uniformity and ultimately the comparability of these accounts. Research Outlook 2020 | 162
Keywords: sources, uses, charity fund accounts, Islamic banks.
5. Arshed, N., & Kalim, R. (2020). Modelling demand and supply of Islamic banking deposits. International Journal of Finance & Economics, 1‐19. doi: 10.1002/ijfe.1936. (Noman Arshed, Rukhsana Kalim (Economics/SBE) Abstract: The purpose of the study is to assess the market of Islamic banking deposits. As banking intermediation ensures efficient allocation of excess capital, but stable availability of deposit resource helps banks to manage long‐term capital structure portfolio. Unlike conventional banks, Islamic banks also have to meet the Shari'ah requirements. This study works under the domain of Islamic economics and intends to explore the demand and supply model of deposits of Islamic banks using data from financial statements, World Development Indicators and Thomson Reuters. The results using panel feasible generalized least squares model with two‐way fixed effect showed that deposits are supply‐elastic and demand‐elastic with respect to returns to deposits. While other factors like inflation, money market rate and knowledge significantly affect supply of deposit and banking profitability and Islamic financial development significantly affect demand for deposits. This study concludes that the global Islamic banking deposit market is stable and converging hence, banks must ensure their relationship with price while devising a strategy to attract deposits. Keywords: convergence, deposit market equilibrium, Islamic banks, panel FGLS, price elasticity.
6. Tara, N., Arshed, N., Aziz, O., & Yamin, M. (2020). Can Financial Assistance Mediate the Training and Human Capital Relationship for Pakistani Women Micro Entrepreneurs? International Journal of Economics and Financial Issues, 10(4), 80‐87. (Noman Arshed (Economics/SBE) Abstract: Women participation in the economy can help accumulate capital formation and ideation which helps them in becoming a tool for socio‐economic uplift for poor people working in the informal sector of the economy. The current research has examined the impact of financial assistance programs provided to micro and small women entrepreneurs, on the economic capital formation. Assistance programs include training and financial assistance. This research also aimed to investigate the mediating role of financial assistance between training assistance and economic capital. The methodology included empirical study, collection of data from 350 women micro‐entrepreneurs from Southern Punjab in Pakistan, and analysis is conducted with the help of SPSS. Findings revealed that training assistance program has a significant impact on capital formation. While the mediation test confirmed the mediation of financial assistance between the training and economic capital. Keywords: economic capital, financial assistance, informal economy, vocational training, women micro entrepreneurs.
7. Abduqayumov, S., Arshed, N., & Bukhari, S. (2020). Economic Impact of Institutional Quality on Environmental Performance in Post‐Soviet Countries. Journal Transition Studies Review, 27(2), 13‐24. (Noman Arshed, Samra Bukhari (Economics/SBE) Abstract: Maintaining the balance between economic growth and environmental performance is a new trend of challenges for developing countries. The economic impact of institutional quality on environmental performance is analyzed from 2001 to 2017 using multinational panel data for 15 Post Soviet‐Countries. The indicators of institutional quality are government effectiveness and regulatory quality and this research is first of its kind utilizing a comprehensive Environmental Performance Index as an empirical paper for post‐Soviet‐Countries. This study has utilized an instrumental variable method in Generalized Method of Moments, in order to introduce dynamics and then check for endogeneity. Other controlling factors include GDP per capita, industrial manufacturing, energy efficiency, urbanization, and secondary education. The results indicate that institutional quality have a significant positive impact on environmental performance. It is suggested that the post‐Soviet‐ Countries must ensure better institutions in order to sustain an environment for future generations. Research Outlook 2020 | 163
Keywords: Panel GMM, Industrialization, Urbanization.
8. Hassan, M. S., Meo, M. S., Abd Karim, M. Z., & Arshed, N. (2020). Prospects of Environmental Kuznets Curve and Green Growth: The Role of Globalization in Developed and Developing Economies. Studies of Applied Economics/ESTUDIOS DE ECONOMIA APLICADA, 38(3). (Muhammad Shahid Hassan, Noman Arshed (Economics/SBE) Abstract: The study empirically investigated the determinants of carbon dioxide (CO2) emissions by using energy utilization intensity, and globalization. The investigation to determine linear, inverted U shaped or N shaped relationship between CO2 emission and GDP is conducted using a panel ARDL approach. 64 countries are selected for making two panel data models of developed economies and developing economies for the time period 1970‐ 2015. The outcomes showed that in long run increase in the energy use intensity and the global integration lead to increase in the CO2 emissions. In the case of GDP, study has confirmed inverted U shape relationship proposing prospects of green growth. Hence, results of the study found that there is a significant evidence of global environmental Kuznets curve for both economies. In comparison, developing economies pollute more with increase in GDP but they are also expected to revert faster towards green growth as compared to developed economies. Keywords: CO2 emissions, environmental kuznets curve, green growth.
9. Khallid, S., Asghar, N., & Hafeez‐ur‐Rehman. (2020). A Comparative Analysis of MPI Through Socio Economic Indicators in Punjab and Sindh Provinces of Pakistan. Journal of the Research Society of Pakistan, 57(1), 261‐270. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: This study analyzes multidimensional deprivations and vulnerability in two major provinces of Pakistan using the data of Pakistan Social and Living Standard Measurement (PSLM) 2014. It compiles a Multidimensional Poverty Index (MPI) for provincial and regional levels on the basis of identification and equal weight approach as conceptual framework. The study proposes a comprehensive operationalization of a Multidimensional Poverty Index for developing countries like Pakistan, including a justification for several social and economic dimensions. This study may be helpful for structuring new policy metrics, and may provide useful information to human development experts and statisticians for assessing and using poverty indices M0 , M1 and M2 . Keywords: MPI, social dimensions, vulnerability, poverty indices.
10. Shahid, M. G., Nadeem, M., Gulzar, A., Saleem, M., Hafeez‐ur‐Rehman, Ghafoor, G. Z., . . . Nelofer, R. (2020). Novel Ergot Alkaloids Production from Penicillium citrinum Employing Response Surface Methodology Technique. Toxins, 12(7), 427. doi: 10.3390/toxins12070427. (Ahmed Gulzar, Hafeez‐ur‐ Rehman (Economics/SBE) Abstract: Ergot alkaloids are novel pharmaceutical and therapeutic agents synthesized in this study using fungal species Penicillium citrinum. To get the maximum yield of ergot alkaloids a statistical process of response surface methodology was employed using surface culture fermentation technique. Initially, the strain of Penicillium was improved using physical (ultraviolet (UV) and chemical (ethyl methane sulfonate (EMS) treatments to get the maximum yield of ergot alkaloids through surface culture fermentation technique. After improving the strain, survival rate of colonies of Penicillium citrinum treated with UV and EMS was observed. Only 2.04% living colonies were observed after 150 min of exposure of Penicillium citrinum in UV light and 3.2% living colonies were observed after 20 min of the exposure in EMS. The mutated strains of Penicillium citrinum were screened for their production of ergot alkaloids and after fermentation experiments, maximum yield was obtained from PCUV‐ 4 and PCEMS‐1 strains. After strain improvement, Plackett‐Burman design (PBD) and Box‐Behnken design (BBD) of RSM were employed and 10‐fold yield enhancement (35.60 mg/100 mL) of ergot alkaloids was achieved. This enhancement in yield of ergot alkaloids proved the positive impacts of RSM and UV on the yield of ergot alkaloids. Research Outlook 2020 | 164
The study provides a cost effective, economical and sustainable process to produce medically important ergot alkaloids which can be used in various pharmaceutical formulations to treat human diseases. Keywords: BBD, EMS, PBD, Penicillium citrinum, UV, ergot alkaloids, response surface methodology, strain improvement.
11. Batool, H., Hafeez‐ur‐Rehman, Ashagar, N. (2020). Key Dimensions and Determinants of women’s Empowerment in Pakistan: Empirical Evidence from Southern Punjab. Journal of the Research Society of Pakistan, 57(1), 149‐169. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: Women empowerment is indispensable for attaining sustainable development goals (SDGs) 2030. This study empirically identified the key dimensions and determinants of women empowerment in Southern Punjab using primary data taken through multi stage cluster sampling technique. Considering the multidimensional nature and context a comprehensive cumulative women empowerment index is constructed through polychoric principle component analysis with six dimensions of women empowerment. The empirical results revealed that women empowerment is positively influenced by age and job of women, advertency of legal rights, access to medical facilities, participation in social gatherings, safe and clean environment, communication behavior, participation in politics and negatively by area of residence, unpaid domestic care work and fear of violence. Keywords: women empowerment, determinant factors, polychoric principle, component analysis, cumulative women empowerment index.
12. Asghar, N., Batool, M., Farooq, F., & Hafeez‐ur‐Rehman. (2020). Covid‐19 Pandemic and Pakistan Economy: A Preliminary Survey. Review of Economics and Development Studies, 6(2), 447‐459. https://doi.org/10.47067/reads.v6i2.222. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: The impact of pandemic Covid‐19 appears to be quite uncertain across globe. The nations are trying to overcome its impact on their economies. It has affected the production, distribution and life style. Coronavirus pandemic has taken more than 5 lacs lives globally and paralysed the global economy. The developing countries like Pakistan expect to face substantial economic set back from this situation. This study analyses the impact of Covid‐19 pandemic on Pakistan economy through observing the relationship between incidence of cases and number of tests conducted. Furthermore, it examines the impact of the demand‐side and supply‐side shocks due to Covid‐19 pandemic on Pakistan economy. On supply side, this pandemic has halted the domestic and international supply chain, causing a shortage of inputs and necessities. On demand‐side, decreased domestic and international demand have resulted in massive layoffs and poverty scares. Government and State Bank of Pakistan have announced different relief packages for controlling the situation but due to poor health infrastructure and lack of social protection, the people remain vulnerable to medical and financial misery. These unprecedented circumstances call for immediate policy changes for saving millions of people from virus and poverty. Keywords: COVID‐19, Pandemic, Pakistan, Economy.
13. Shahid, M., & Kalim, R. (2020). Decentralized Tax Revenue, Institutional Complementarity and Economic Growth: A Time Series Analysis of Pakistan. International Journal of Economics and Financial Issues, 10(4), 25‐33. (Rukhsana Kalim (Economics/SBE) Abstract: Fiscal decentralization is one of the major policy variables to attain economic efficiency. The present study examines the impact of decentralized taxes on the economic growth of Pakistan from 1976 to 2018. For examining the stationarity of variables, Kwiatkowski‐Phillips‐Schmidt‐Shin (KPSS) and Ng‐Perron unit root Tests are used. Autoregressive Distributed Lag Approach (ARDL) is used for co‐integration among the variables of the model. The results suggest that decentralized tax revenue i.e. income tax decentralization and sales tax revenue with political institutions have growth promoting impact on the economy of Pakistan. With strong institutions, Research Outlook 2020 | 165
provincial governments can give better results while transferring responsibility of collecting income tax from federal to provincial level. Keywords: Stationarity, Income tax and sales tax, decentralization, political institutions, economic growth.
14. Arshed, N., Meo, M. S., & Farooq, F. (2020). Empirical assessment of government policies and flattening of the COVID19 curve. Journal of Public Affairs, 20, e2333. doi: 10.1002/pa.2333. (Noman Arshed (Economics/SBE) Abstract: The objective of the study is 2‐fold. First, it estimates the 2019 new coronavirus disease (COVID19) flattening curve using Panel Random Coefficient Model. This allows each country to have its trajectory while allowing for random error effects to transfer across countries. Second, it calculates the expected number of days to reach the flattening point of COVID19 curve and estimate the empirical effectiveness of government policies around the world using Poisson regression. This study avails global COVID19 incidence data for 190 countries between January 22, 2020 and May 11, 2020. In the absence of a vaccine or of more appropriate treatment options, non‐pharmaceutical approaches must be used to control the spread of the COVID19. This study proposed that the contact tracing, stay at home restrictions and international movement restrictions are most effective in controlling the spread and flattening the COIVD19 curve. At the same time, habits that hurt the immune system like smoking have a negative effect on the flattening of the curve. The government should integrate these policies in their lockdown plan to make it smart lockdown. Keywords: not available.
15. Anser, M., Hanif, I., Alharthi, M., & Chaudhry, I. (2020). Impact of fossil fuels, renewable energy consumption and industrial growth on carbon emissions in Latin American and Caribbean economies. Atmósfera, 33(3), 201‐213. doi:https://doi.org/10.20937/ATM.52732. (Imran Hanif (Economics/SBE) Abstract: This study examines the impact of fossil fuels consumption, renewable energy use and industrial growth on carbon emissions in the developing economies of Latin America and the Caribbean. An industrial growth index is developed using competitive industrial indicators, and a two‐step system generalized method of moments robust estimator is employed, involving a panel of 16 middle‐ and lower‐middle‐income economies for the period 1990 to 2015. The empirical results show an Inverted‐U shaped relationship between economic growth and carbon emissions and confirm the existence of the environmental Kuznets curve for the region. The results indicate that industrial growth and consumption of fossil fuels are significantly contributing to carbon emissions in the region. The results highlight that, based on competitiveness in manufacturing and the transition from simple to sophisticated technologies, advance technology‐based industrial growth increases the potential to produce goods competitively with lower carbon emissions. The findings suggest that such advanced industrial growth is unavoidable to attain sustainable economic growth. Thus, technological advancement and consumption of renewable energies have the potential to both meet the rising demand for goods and energy and to control carbon emissions in the developing countries of Latin America and the Caribbean. Keywords: carbon emissions, fossil fuels, economic growth, industrial growth, renewable energy.
16. Rafiq, M. Y., Azad, Mueen Ud‐Din, Rafique, A., Chang, Lu S. (2020). Development of a Model for Retention of MS/MPhil Students at Virtual University (VU) of Pakistan. International Journal of Distance Education Technologies (IJDET), 18(2), 01‐18. doi: 10.4018/IJDET.2020040101. (Mueen Ud‐Din Azad (Economics/SBE) Abstract: Due to the of use of ICTs and ODL, Virtual University (VU) has become one of leading distance learning university in Pakistan. However, the retention rate among online learners found considerably low. The primary objective of this research was to dig out determinants of retention of MS/MPhil students at VU and modeling Research Outlook 2020 | 166
their retention by considering important influences. For sampling purpose, three departments with the most students were considered and complete enumeration was done. There were 4,608 students from three departments; Computer Science & Technology, Management Sciences and Education have been included in this study. To dig out the important retention factors, this research has used a Chi‐Square test, optimal scaling, a decision tree using CHAID analysis, and then developed a suitable model for student retention. Binary logistic regression techniques were applied. Results have revealed that gender, scholarship, province, location, and division are significant factors and contributing in predicting students' retention at VU. Detailed outputs are shown in respective tables and figures. At the end, different recommendations and suggestions are proposed. Keywords: binary logistic regression, distance education, icts, Pakistan, retention, VU.
17. He, W., Abbas, Q., Alharthi, M., Mohsin, M., Hanif, I., Vinh Vo, X., & Taghizadeh‐Hesary, F. (2020). Integration of renewable hydrogen in light‐duty vehicle: Nexus between energy security and low carbon emission resources. International Journal of Hydrogen Energy, 45(51), 27958‐27968. doi: https://doi.org/10.1016/j.ijhydene.2020.06.177. (Imran Hanif (Economics/SBE) Abstract: Climate change challenges associated with global warming are an increasing concern for developing countries. Pakistan is experiencing severe energy crises, and global warming effects have considerably changed its climate, especially the temperature, which has risen significantly. Renewable energy is uninterrupted, clean, and strengthens energy security. This study employed a linear programming model to assess the potential of renewable hydrogen power and its impact on electricity prices, measured the possible demand of wind‐ generated renewable hydrogen for light‐duty vehicles. The findings demonstrate that Pakistan has sufficient wind‐generated renewable power potential, and its light‐duty vehicles could shift to renewable energy. The findings of this research recommend a policy shift to light‐duty hydrogen‐based vehicles to eliminate fossil fuel imports and ensure green supplies. With a shift to hydrogen‐based vehicles, the government could ensure maximum revenue and green supplies. The study provides valuable guidelines for decision‐makers. Keywords: energy crises, energy security, renewable hydrogen, economic viability, energy policy.
18. Huang, Y., Raza, S. M. F., Hanif, I., Alharthi, M., Abbas, Q., & Zain‐ul‐Abidin, S. (2020). The role of forest resources, mineral resources, and oil extraction in economic progress of developing Asian economies. Resources Policy, 69, 101878. doi: https://doi.org/10.1016/j.resourpol.2020.101878. (Imran Hanif (Economics/SBE) Abstract: This study determines the role of natural resources’ utilization, foreign direct investment (FDI), and fossil fuel consumption in economic growth by utilizing panel data of 25 developing Asian countries from the period 1996 to 2016. Pool Mean Group (PMG) regression is used for this purpose, and the results show that the rent received from forests has a sizeable share in the economic growth of developing Asian Countries. The study shows that an increase in FDI is stimulating economic growth in developing countries. However, although the utilization of natural resources has a positive impact on economic growth, the results show a statistically insignificant role of natural resources in improving economic growth. Finally, the results show that the rent obtained from forest resources, mineral resources, and oil extraction makes a significant contribution to economic growth. The findings highlight that FDI and the rent received from the pool of natural resources are significant contributors to economic growth, as they are both helping to develop industrialization in the nations concerned and improve the level of per capita income. However, the findings also suggest that there is a need to consider the limited availability of natural resources and to deal with this situation by (a) developing policies that can ensure the efficient use of such rent received from the natural resources by importing advanced technologies from developed nations and (b) using the rents from natural resources to promote the business environment and attract FDI in developing countries. Keywords: forest resources, mineral resources, fossil fuels, economic growth, natural resources. Research Outlook 2020 | 167
19. Mehmood, Q., Sial, M. H., Sharif, S., Hussain, A., Riaz, M., & Shaheen, N. (2020). Forecasting the Fisheries Production in Pakistan for the Year 2017‐2026, using Box‐Jenkin's Methodology. Pakistan Journal of Agricultural Research, 33(1). 140‐145. (Maqbool Hussain Sial, Saira Sharif (Economics/SBE) Abstract: Fisheries play a key role for national income and a source of food in Pakistan. Therefore, forecasting the production of fish is important for better production and for planning of fish export. Objective of this research is to propose suitable Autoregressive Integrated Moving Average (ARIMA) model for forecasting the production of fisheries, using Box‐Jenkins’s (1976) methodology. Secondary data, “50 years of Pakistan: volume‐iii (1947‐ 1997)” published by Pakistan Bureau of Statistics (PBS) and World Development Indicators World Bank (2016) from the year 1947‐ 2016 was used. After comparing all possible ARIMA model diagnostically, ARIMA (2, 1, 3) is the most parsimonious model with less forecast error. Forecast values for the fisheries production from 633.974 to 720.196 tons for the year 2017‐2026 shows a significant increase in the fisheries production. The proposed ARIMA (2,1,3) model for forecasting is helpful for fish producers, researchers, business men, and planning their resources as well as decision making regarding the export and production of fisheries in Pakistan. Keywords: autoregressive integrated moving average, model, error, production, forecast.
20. Javed, M. M., Ayaz, M., & Kalim, R. (2020). Revisiting the Index to Measure Maqasˉid al‐Sharˉı‘ah Oriented Performance of Islamic Banks: Evidence from Pakistan. Journal of Islamic Business and Management, 10(1), 12‐27. https://doi.org/10.26501/jibm/2020.1001‐002. (Rukhsana Kalim (Economics/SBE) Abstract: In the context of fulfillment of maqˉas. id al‐Sharˉı‘ah, Islamic banks’ performance has been measured by some researchers by adding many dimensions and elements to the five objectives of Sharˉı‘ah, and resultantly many indices have been developed. However, these dimensions and elements are either not comprehensive, or not relevant. The objective of the present study is to provide an improved maqˉas. id al‐Sharˉı‘ah oriented performance index that includes all the five objectives of Ghazali’s theory of maqˉas. id al‐Sharˉı‘ah, namely protection of faith, life, intellect, family and wealth. Additionally, the present study proposed more reflective measures to assess maqˉas. id oriented performance including share of financing based on non‐controversial modes and percentage of value added that is distributed to various stakeholders. The study applied Sekaran’s behavior science method and applied social accounting concept of value added statement and service profit chain as a logic to develop maqˉas. id index which is later on validated through experts’ interviews. In addition, the study has also applied the proposed index using eight years data (2010‐2017) from full‐fledged Islamic banks of Pakistan to assess their maqˉas. id oriented performance. The findings reveal that only protection of intellect oriented performance of Islamic banks is improving whereas other maqˉas. id oriented performances are deteriorating. Keywords: Maqasid ˉal‐Sharˉı‘ah, social performance, index development.
21. Hafeez‐ur‐Rehman, Chaudhry, I. S., Arshed, N., & Sardar, M. S. (2020). The Nonlinear Relationship between Trade Balance and Income for Selected Asian Economies. Review of Applied Management & Social Science, 3(2), 177‐192. (Hafeez‐ur‐Rehman, Noman Arshed, Muhammad Shahzad Sardar (Economics/SBE) Abstract: This research study is an attempt to explore the nonlinear relationship between domestic and foreign income and deficit in the trade balance for a sample of 13 high deficit Asian countries from 1990 to 2019. Furthermore, the study also moderates the role of financial development and carbon emissions with trade balance. The study results validated the existence of a nonlinear relationship between trade balance and domestic and foreign income. For this purpose, three different types of model are formulated. The first model was of the benchmark type, which contains only the domestic and foreign income effect, while in the other two models, the role of financial development and carbon emissions is also included. The estimated results evinced the existence of U shape relationship for domestic income and inverted U shape curve for World income. The results revealed that it would be very suitable for selected countries to boost up domestic income. Because of it, Research Outlook 2020 | 168
the deficit in trade balance will start to decline. The financial development and carbon emissions are found to be a significant contributor to reduce the deficit in the trade balance. Keywords: Income – Trade Kuznets curve, J Curve Phenomenon, World Demand.
22. Aziz, O., Grant, K. A., & Arshed, N. (2020). Does Entrepreneurial Activity Assist in the Alleviation of Poverty? The Journal of Applied Business and Economics, 22(7), 114‐132. (Noman Arshed (Economics/SBE) Abstract: Poverty is a major issue across the world with governments and organizations such as the World Bank and the IMF increasingly looking for ways to reduce its impact. Despite this, almost 2.5 billion people still live in poverty. Entrepreneurial Activity can reduce poverty and can be boosted through the help of Entrepreneurship Facilitators such as Government, Incubators, and Financial Institutions. This study examines the relationship between Entrepreneurial Activity and poverty alleviation using Feasible Generalized Least Square (FGLS). The study found a positive and significant relationship between Entrepreneurial Activity and poverty alleviation as measured by the changes in Human Development Index (HDI) in all 104 countries studied over a 12 year period, and that the presence of good Entrepreneurial Facilitators improves the capacity of Entrepreneurial Activity. It suggests that governments need better business related regulations to motivate entrepreneurs and create ease of doing business. Keywords: ease of doing business, entrepreneurial activity, poverty, moderator model, panel FGLS model. 23. Maqbool, M. S., Atiq‐ur‐Rehman, M., Hafeez‐ur‐Rehman, & Shafiq‐ur‐Rehman. (2020). The Economic Analysis of Comparative Advantage and Competitiveness in the Textile Export Industry in Pakistan. Pakistan Journal of Social Sciences (PJSS), 40(3), 1409‐1416. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: The present study aims at measuring the export competitiveness of the textile sector of Pakistan in the global market by employing several indices of Revealed Comparative Advantage. The data on textile exports of Pakistan have been taken from the international trade center (ITC) UN‐Comtrade statistics from 2003‐2018. The findings of the analysis exemplify that Pakistan’s textile exports had a comparative and competitive advantage. Pakistan is the net exporter of textile products and it has also a comparative advantage in the imports. Besides, the results of the Revealed Trade Advantage index demonstrate that Pakistan had a net comparative advantage in the concerned sector. The study suggests that Pakistan should emphasize on the diversification of the products, improving its supply chain, searching new markets for selling products and use of modern technology to increase the trade volume of textile products. Keywords: comparative advantage, comparative cost, gains from trade.
24. Gulzar, A., Ditta, A., Hafeez‐ur‐Rehman, & Ghafoor, N. (2020). Testing the Validity of Keynesian Military Model of Fiscal Side in Case of Pakistan. Review of Economics and Development Studies, 6(3), 675‐686. (Ahmed Gulzar, Hafeez‐ur‐Rehman (Economics/SBE) Abstract: The objective of the study was to determine the impact of national security expenditures (military expenditures) on economic growth. Time series data from 1981 to 2018 on annual frequency on GDP growth rate, military expenditures as percentage of GDP, imports as percentage of GDP, unemployment rate, FDI as percentage of GDP and percentage of population living in agglomeration cities taken from online World Development Indicators. Johansen Co‐integration and VECM methodology are applied to check the long run relationship and to get the long run and short run coefficient values. The major findings of this study explain that there is found the positive and significant relationship between military expenditures and economic growth of Pakistan both in long run and in short run. It explains that military expenditures are the key driver of economic growth both in short run and in the long run. The impact of imports on GDP growth was also found to be positive and significant both in long run and in short run. The impact of FDI is found positive and significant both in the long run and in the short run. The impact of migration of population to agglomeration cities have huge impact on growth were observed. The impact of unemployment was found to be negative on economic growth in short Research Outlook 2020 | 169
run. Keywords: military expenditure, imports, unemployment, FDI, population, Pakistan’s Economy.
25. Ali, M., Khan, K., & Hafeez‐ur‐Rehman. (2020). Violent Conflict and Informal Justice System: Evidence from a Conflict Zone in Pakistan. Review of Education, Administration & LAW, 3(2), 215‐236. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: Conflicts have a variety of economic, social, and institutional consequences. This study considers the conflict episode of district Swat of Khyber Pakhtunkhwa (KP), Pakistan, and examines its impact on the individuals’ preferences with regard to justice structure in a society. To search the underlying causal impact, this study identify district Buner – a neighboring district, as a control group. This study collects data from a randomly selected 400 households in each district and applies the Ordinary Least Square (OLS) and Spatial Regression Discontinuity Design (SRDD) estimation techniques. The OLS findings suggest that the occurrence of violent shock strengthens informal justice system. Whereas, the fall in trust on ordered institutions is observed a potential channel that enhances the efficacy of informal justice system. Additionally, the SRDD estimates confirm that the intensity of change in the structure of informal justice system varies across the location of the individuals. Alternatively, the informal justice system relatively more strengthens in the regions that remain highly exposed to the conflict as compared to the moderately and least affected areas. Keywords: violent conflict, informal justice system, trust on ordered institutions.
26. Akhtar, M. J., Ashraf, M. W., & Hafeez‐ur‐Rehman. (2020). The environmental Kuznets curve: segregating the economic growth into production inputs in G‐7 countries: An econometric analysis. International Review of Social Sciences (IRSS), 8(11), 9‐23. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: The COVID‐19 pandemic is greatest evidence to explore the link between production inputs and environmental quality. The lockdown in most countries limited the labor/capital participation in industries. The pattern of economic growth affected very badly but the quality of environment gets much better condition in COVID‐19 pandemic periods. This study segregating economic‐growth into production inputs like Labor and capital, and examining impact of Labor, capital and electricity‐production by fossil fuels on environmental degradations in G‐7 countries” using panel data from 1996 to 2019. The study verifies an environmental Kuznets curve model. The unit root test shows mix order of integration and study use the ARDL (Auto Regressive Distributive Lag) Model and ECM to estimate the results. The result shows that in the short run and as well as long run, Labor and capital have significant impact on carbon‐dioxide‐emissions and capital square proves EKC. In short run as well as in longrun, Energy consumption has significant but positive impact on carbon dioxide emissions. The study suggest the prescription of environmental degradation, the carbon dioxide can be minimized by increasing the better economic growth with optimal combination of labor and capital and Energy consumption by renewable sources to achievement of better conditions. Keywords: Economic, Growth, G‐7 Countries & Production.
27. Afzal, H. M., Hafeez‐ur‐Rehman, Asim, H., & Akhtar, M. J. (2020). Dynamic Impact of Development and Energy Consumption Pattern on Environmental Quality: A Case Study of Selected Populous Asian Countries. International Review of Social Sciences (IRSS), 8(11), 113‐128. doi: 10.21203/rs.3.rs‐77348/v1. (Hafiz Mohammad Afzal, Hafeez‐ur‐Rehman, Hafiz Asim, Muhammad Javed Akhtar (Economics/SBE) Abstract: The present study aims to examine the long‐run and short‐run effects of economic development, energy consumption pattern, trade openness and urbanization on environmental quality in ten Asian most populous economies. The analysis examines panel data from 1988 to 2018 by employing an Autoregressive Distributed Lag (ARDL) approach. The results indicate that the struggles to raise development are increasing the CO 2 emissions in these emerging populous countries. Moreover, the utilization of non‐renewable energy sources Research Outlook 2020 | 170
(gas, coal, oil) is associated with high carbon emissions affecting environmental quality adversely and worsening the atmosphere at the zonal level too. Furthermore, the empirical findings highlight that urbanization and trade openness partake to the reduction of CO 2 emission and hence are considered environmental friendly. Finally, the government should formulate the strategies which help to reduce the use of non‐renewable energy sources and promote the consumption of efficient gas energy source to raise development and better environmental quality in populous countries of Asia and hence the strategies will be helpful for the comfort and happiness of this part of the emerging region. Keywords: Environmental quality, Economic development, energy consumption pattern, ASIAN Populous countries, panel data.
28. Kausar, A., Hafeez‐ur‐Rehman, Mureed, H., & Raza, N. (2020). The Analysis of Production Emission (Industrial EKC) and consumption emission: An Empirical investigation of STIRPAT model In Case of Pakistan. Academic Journal of Social Sciences (AJSS), 4(3), 632‐654. (Amna Kausar, Hafeez‐ur‐Rehman, Haseena Mureed (Economics/SBE) Abstract: This study investigates a long‐term and short‐term association among climatic change due to industrialization in Pakistan by using ARDL technique for the time span of 1990 to 2019. The Present study uses Industrial value added in its place of economic growth for EKC in case of Pakistan as the industrial sector is considered the key cause of carbon dioxide (CO2) emission. Besides that, study used Population density, Nuclear energy, Households Final consumption expenditure and trade openness as independent variables. Empirical findings come out with U shaped EKC instead of Inverted U shape EKC in incident of Pakistan in short and in long run. This is because of consumption of modern technology and Nuclear energy consumption in Industrialization, i.e evident with negative association of Nuclear energy with carbon emission in short and in long run in Pakistan. Household’s Final consumption expenditure also shows significant and negative association, as income increases people use more advanced home appliances so carbon emission decreased. Being the most densely populated country of the world Population density is the significant contributor of carbon emission in case of Pakistan. Policy Implication for Pakistan is to control Population Pressure and to use of Nuclear power in Industrialization may reduce carbon emission. Keywords: CO2 Emission, The Value Added of Industrial Sectors, Environmental Kuznets Curve, Households Final Consumption Expenditure.
29. Ditta, A., Asim, H., & Hafeez‐ur‐Rehman. (2020). An Econometric Analysis of Exigent Determinants of Trade Balance in Finland: An Autoregressive Distributed Lag (ARDL) Approach. Review of Applied Management & Social Science, 3(3), 347‐360. (Hafeez‐ur‐Rehman (Economics/SBE) Abstract: A number of research papers analyzed the factors that may have impacts on the balance of trade for the effective macroeconomic policies but the results of these studies have created ambiguity which implies that further research is needed as the worsening trade balance can limit the economic growth of any country. Hence the current paper is an effort to study the short‐run and long‐run relationships among trade balance, real effective exchange rate, GDP per capita, urbanization, unemployment and inflation rate for the Finnish economy. Autoregressive Distributed Lag (ARDL) bound testing methodology to co‐integration along with error correction mechanism is applied by using time series data from 1990 to 2019 for checking the existence of long‐run equilibrium between explained variable and its various determinants. Empirical findings of ARDL show that the long‐run relationship among the factors of the estimated model holds. The results indicate that real effective exchange rate, urbanization and inflation are having a significant but negative impact on Finland’s trade balance for both the short‐run and long‐run while the impacts of GDP per capita and unemployment are significant and positive on the Finish balance of trade. In addition to above, the structural stability of mean and variance of the error term for the estimated ARDL model is verified with the help of CUSUM and CUSUM square graphs. Research Outlook 2020 | 171
Therefore, a reliable policy measure to improve the balance of trade by encouraging the domestic production and curtailing the imports is suggested in Finland. Keywords: Trade Balance, Co‐Integration, Error Correction Mechanism, Significant, Structural Stability, CUSUM.
30. Anwar, M. A., Arshed, N., & Saeed, M. I. (2020). Domestic Terrorism, Investment and Economic Growth: Evidence from Developing Countries. International Review of Management and Business Research, 9(4), 223‐244. (Noman Arshed (Economics/SBE) Muhammad Ibrahim Saeed (ORIC) Abstract: The main objective of the study is to empirically examine the relationship between domestic terrorism, investment and economic growth. The study finds the implication of domestic terrorism on investment and growth among 26 Muslim and 14 Christian developing countries. Data regarding the incidence of terrorism are obtained from Global Terrorism Database (2015). While, economic data are obtained from World Development Indicators (WDI, 2015). The data on external and internal conflict have been extracted from Global Conflict Risk Index (GCRI, 2015) for the time period 1990‐2015. Ordinary least square (OLS), feasible generalized least squares (FGLS) and system generalized method of moment (SGMM) approaches were applied to ensure robust results with different specification of models by using dummy variable. The value of Dummy variable is 1, if country is Muslim otherwise 0. For all specifications, it is confirmed that increase in domestic terrorism will decrease the level of investment directly, but the percentage decrease in investment due to terrorism is high among Muslim as compared to Christian developing economies. The results indicate the public policy efforts to mitigate the loss of private investment which can be done initially by public investments to ensure public safety. Keywords: OLS, FGLS, SGMM, Domestic Terrorism, Muslim and Christian Developing Countries.
31. Arshed, N., Yasmin, S., & Gulzar, M. (2020). Islamic Financing Portfolio and its Comparative Growth Potential. Islamic Banking and Finance Review, 7. https://doi.org/10.32350/ibfr/2020/0700/440. (Noman Arshed, Sadia Yasmin (Economics/SBE) Muhammad Gulzar (SCA) Abstract: Background – Growth has a strong association with financial sector development. As both micro and macro projects significantly count institutionalized financing contented to the access of finance and help to reduce the cost. Islamic finance development incorporates several benefits such as the transformation of the economy towards the Shari’ah compliancy, higher degree of risk‐sharing, and integration of returns with the risk/performance associated with the investment venture thus ultimately leading to social prosperity.Objectives ‐ This study envisages the exploration of the contribution of different type of Islamic banking financing which Islamic Banks are utilizing in their capital structure, on the economic growth. This assessment may help in empirically identifying the financing which has been fruitful to promote growth. This is because each of these Islamic financing products has their essence in the path of growth.Design/methodology/approach ‐ Gross Domestic Product (GDP) is taken as the dependent variable. And the Solow model based controlling variables includes Labor Resource (L), and Physical Capital (K) while the base variable are the financing modes. The quarterly data is collected for 9 countries which are available between 2014Q1 and 2017Q4. Findings – The results indicate that other than Istisna financing, all other financings have a positive effect on economic growth, whereas Salam financing has highest growth potency. Originality/value – Previous studies lack in providing a country‐level comparison of growth effect of country‐level Islamic capital structure. While, considering financing as an input of economic growth within a panel data setup. This study is finding growth based weights on the popular Islamic financing options, which policymakers can use to find a particular financing which needs promoting in order to boost economic growth. Keywords: not available.
32. Ayaz, M., Arshed, N., & Haq, I. (2020). Characteristics of Shari’ah Governance and Incidence of Charity: A Case of Pakistan. COMSATS Journal of Islamic Finance, 5(2), 77‐91. doi:10.26652.cjif.5202015. (Muhammad Ayaz, Research Outlook 2020 | 172
Noman Arshed (Economics/SBE) Abstract: There are several studies which have evidenced the role of Shari’ah governance on the profitability of Islamic banks for different countries in different data setup. The main purpose of Shari’ah governance is derived from the concept of corporate governance to avoid any non‐compliant transactions and book charity against any non‐ compliant income. There are two kinds of Shari’ah supervisory boards. First is the proactive type that follows the rule of ‘Hisba’ which restricts any non‐compliant transaction before it happens. The second type is reactive which detects and reacts to the non‐compliant transactions following the Islamic legal system when they happen. The first type would conclude to a reduction in the incidence of charity transactions. In contrast, the second type would conclude to increase in the incidence of charity transaction. The objective of this study is to explore whether the Shari’ah governance of Islamic banks of Pakistan is jointly proactive or reactive. This study is deductive and uses quantitative methods. This study builds an unbalanced panel data of full‐fledged Islamic banks of Pakistan using the available data from financial statements. This study is one of its kinds to see the nature of Shari’ah governance based on empirical patterns using Panel FGLS model. The results show that board size, board expertise, and reputation are the reactive factors while the others are proactive factors. Keywords: Shari’ah Supervisory Board, Panel Data Analysis, Shari’ah Disclosure, Shari’ah Controls.
33. Bukhari, S. M. H., Ayaz, M., Kalim, R. (2020). Shari’ah Scholars’ Insight on Shari’ah Governance Framework for Islamic Banking Institutions in Pakistan. COMSATS Journal of Islamic Finance, 5(2), 29‐47. doi:10.26652.cjif.5202012. (Syed Muhammad Hassan Bukhari, Mohammad Ayaz, Rukhsana Kalim (Economics/SBE) Abstract: One of the major reasons behind the financial crises generally and the 2008 crises especially, was the poor corporate governance in financial institutions. For ensuring good Islamic corporate governance as well as Shari’ah compliant environment in Islamic banking institutions (IBIs), Shari’ah governance framework (SGF) was developed in many countries including Pakistan. This study is conducted to evaluate the SGF, its implementation level, and the challenges facing the IBIs in the implementation of the SGF in Pakistan. For this purpose, the insight of the Shari’ah scholars is taken on SGF by following the qualitative research approach with semi‐structured interviews of the scholars. The respondents included Shari’ah Board’s (SB) members and Incharges of Shari’ah Compliance Department (SCD) in various IBIs in Pakistan. The researchers used Nvivo12 software for the analysis of the interviews data. The study discovered some important issues faced by Islamic banks in the implementation of SGF. It is evident from the research that there are shortcomings and weaknesses in the implementation of Shari’ah governance framework which requires improvements such as interpretation and quantification of the provisions of the SGF, approval from Shari’ah Board (SB) for all minute requirements, reporting line issues, and communication gap between the board of directors (BODs) and the members of SB. This research work suggests that the State Bank of Pakistan (SBP) should revisit the SGF in the light of the present study and further improve its provisions as well ensure the implementation of SGF in true letter and spirit. Keywords: Shari’ah governance framework, Shari’ah scholars, Implementation, Islamic banking institutions.
34. Ashraf, M. W., Hafeez‐ur‐Rehman, Chaudhry, I. S. (2020). The Impact of Economic Growth, Foreign Direct Investment, Urbanization, Fossils Fuel Consumption on Environmental Degradation in Emerging Asian Economies. Journal of Business and Social Review in Emerging Economies. 6(4). 1479‐1495. (Muhammad Waqas Ashraf, Hafeez‐ur‐Rehman (Economics/SBE) Abstract: The current examination ascertains the impact of foreign direct investment, urbanization, economic growth, fossil fuel consumption on carbon emissions in eleven rising Asian economies. Panel data has been scrutinized from 1990 to 2018, and (ARDL)/PMG model is executed. The outcomes of the model exemplify that in these growing Asian economies, the triumph to cuitivate economic growth, foreign direct investment, urbanization and fossil fuels are bestowing CO2 emissions and deteriorating the environmental circumstances at Research Outlook 2020 | 173
the regional level. Moreover, the conclusions emphasis that foreign direct investment is a source of environmental humiliation and increases carbon emissions at the regional level. Furthermore, outcomes of the investigate also confirmes the existence of (EKC) in these eleven emerging Asian economies. The study also suggest that by lessening the consumption of fossil fuel energy and encouragement of an environmental responsive economic growth policy will be suitable for the affluence in these emerging developing Asian economies and also the rest of world. Keywords: environmental kuznut curve (EKC), carbon dioxide emissions, fossil fuel, urbanization, environmental degradation.
35. Arshed, N., Rehman, F., & Aziz, O. (2020). An investigation into entrepreneurship determining factors ‐ the case of Asian economies. Organization Theory Review, 3(1). (Noman Arshed (Economics/SBE) UMT JOURNAL Abstract: The number of new business registered through entrepreneurship is vital for the rejuvenation of the economy. It fills the gap of all businesses which left the economy, creates ideation process, enforcing then to operate at an efficient level. This quantitative research study examines the role of several macroeconomic factors on entrepreneurship. It selects Asian countries using Feasible Generalized Least Square model with particular reference to unemployment. The secondary data is collected between 2004 and 2016 for 29 Asian countries. The results show that entrepreneurship is negatively affected by terrorism, cost of procedures and openness and positively affected by human capital, regulatory quality, and banking sector development. While unemployment has an inverted U shape relationship with entrepreneurship. This study sheds light on some economic determinants of entrepreneurship for the case of Asia. Keywords: not available.
36. Sial, M. H., Sarwar, G., & Najum‐ul‐Hassan. (2020). Regional Disparities in Demand for Education: A Microeconometric Analysis for Pakistan. Journal of Education & Social Sciences, 8(1), 121‐132. doi: DOI: 10.20547/jess0812008108. (Maqbool H. Sial (Economics/SBE) Abstract: This study identifies the determinants of household expenditures on education in four provinces of Pakistan. The household survey data are used to identify the factors that affect household’s decision to spend on education. Lognormal hurdle model is employed which suggests that household income, gender and age of household head, awareness about education, school going children and rural urban residence affect household expenditures on education. Household expenditures on education are income inelastic implying that households consider education as an importance and necessary budget item. This elasticity is different in magnitude for Punjab, Sindh, KPK and Balochistan. The concavity of relationship between household expenditures and age of household head is evident. Female heads spend more on education than their male counterpart. Rural households invest less than urban households in education. Moreover, educational awareness, number of school going children also have positive effect on household expenditures on education. Keywords: Households, educational expenditures, double hurdle model, regional disparity.
37. Humera, Hafeez‐ur‐Rehman, Shahid, A., & Khalid, L. (2020). The Interest Rate Targeting; A Way Out to Curb Price Instability in Pakistan. Academic Journal of Social Sciences (AJSS). 4(4), 999‐1012. (Humera, Hafeez‐ ur‐Rehman (Economics/SBE) Abstract: To attain sustainable economic growth stability in prices is considered as the key instrument. The SBPisconsidering interest rate targeting as most suitable strategy to control price instabilityin Pakistan.Presentresearch will make analysisofinterest rate targetingin the country. The study empirically investigates long and short runimpact of interest rate targeting on inflation. Estimated outcomes of present research indicate the significance of interest rate targeting for the country. Inflation rate is considered as Research Outlook 2020 | 174
dependent variable. Mainproposed variableto influenceinflation is interestrate. The controlled variable of present research is real GDP growth. Annual data covering the period from 1980‐2018 has been used. Thetechniques of Autoregressive Distributed Lag Model and pair wise causality approach to assess the nature of causation among variables have been used.The results of the study propose that interest rate is best instrumentto achieve target of less volatility inprices in economy. Keywords: monetary policy, central bank, inflation targeting.
38. Alharthi, M., & Hanif, I. (2020). Impact of blue economy factors on economic growth in the SAARC countries. Maritime Business Review, 5(3), 253‐269. doi: 10.1108/MABR‐01‐2020‐0006. (Imran Hanif (Economics/SBE) Abstract: Purpose – This study aims to examine the influence of the blue economy factors on the economic growth of the South Asian Association for Regional Cooperation (SAARC) countries. Design/methodology/approach – Secondary data from 1995 to 2018 have been used for the analysis of eight countries. The contributing factors that measure the fishing production are total aquaculture production, total fisheries production and agriculture, forestry and fishing. Trade and the rate of inflation are used as control variables. Using the feasible generalized least square technique. Findings – It was found that the blue economy factors play a statistically significant role in the economic growth of SAARC countries and contribute to the achievement of Goal 14 of the United Nations’ sustainable development goals: to conserve and sustainably use the oceans, seas and marine resources for sustainable development. Originality/value – This study highlights the fact that proper management and utilization of water resources may assist the stimulation of economic growth and meet the challenges of food insecurity by improving the supply of seafood in developing South Asian countries. The study proposes that the sustainable management of water resources requires an alliance across nation states. The alliance will be useful in understanding the concept of the blue economy and the role it plays in ensuring economic growth in developing nations throughout the world. Keywords: Aquaculture and fishing, Blue economy, Economic growth, Fishing production, Gross domestic product. Book/Book Chapters 1. Kalim, R. (2020). Sukuk as an Alternative Source of Public Debt Handbook of Research on Theory and Practice of Global Islamic Finance (pp. 788‐802): IGI Global. (Rukhsana Kalim (Economics/SBE) Abstract: Public debt is a prime source of government revenue to finance budget deficit. Developing countries have been relying on public debt to cater the needs of fiscal expenditure. With the emergence of Islamic banking and finance across the globe, Muslim governments have introduced Sukuk (Islamic Bonds) to generate funds by the governments to meet their expenditure. The present study aims to discuss the possibilities of introducing Sukuk as an alternative way of financing public expenditure in Pakistan by replacing other conventional modes of financing in the future. The study will discuss the viable options available to the Government of Pakistan to offer Sukuk instead of bonds as a means of raising funds from abroad. Keywords: not available.
2. Arshed, N. (2020). Applied Cross‐Sectional Econometrics: KSP Books. (Noman Arshed (Economics/SBE) Abstract: The project to write a book on applied Econometrics when I was granted with the Econometrics II course to teach to MPhil Economics, the contents of this book were developed from the lecture material which is competitive to course contents of The University of Edinburgh UK, a university where I did MSc in Economics, exploring other books, personal experience and the critical discussion by the students. The variety of contents which this book covers meet no competition with other universities in the city.
Research Outlook 2020 | 175
This book is an attempt to provide straight forward application based illustration of popular econometric models which are popular and available in the literature. I started this work with the idea that a research practitioner who is not versed with the basics of mathematics and statistics. He might not be able to understand the complex econometric model. This book provides firstly with some background to the model regarding what are the conditions which lead to this model selection. Secondly, basic mathematical derivations which are necessary for the concept. Lastly, STATA software‐based example and its interpretation. The approach this book uses it that it delivers the concepts of the econometric models as well as it provides guidelines to use the STATA software using coding. This book is especially designed for the MPhil / PhD students of all social science disciplines. And researchers who want to avail the skills of latest econometric models to be used in subjects like Sociology, Psychology, Finance and Banking. This book uses a unique way to categorize the econometric models, which makes it different from other Econometrics books available in the market. In the first chapter, it provides an example of the simple regression model, and explains what information it provides and what information it lacks, the information which is lacking is called post regression issues in Econometrics. Unlike other econometric text books, it advocates the regression issues as missing information which model needs to incorporate rather than presenting them as a disease in a model. Then this book practically explains what each issue means and then categorizes the advanced model based on its incorporation (solution) to the regression issue. This book constitutes of chapter 1, which provides brief and necessary background knowledge of Econometrics and regression analysis. The second part includes chapters 2–5, which are provided illustrations for the cross‐ sectional based models. Keywords: not available.
3. Sohail, H., & Arshed, N. (2020). Cost‐Efficiency Analysis of Mudarabah Companies. In A. Rafay (Ed.), Handbook of Research on Theory and Practice of Global Islamic Finance (pp. 25): IGI Global. (Hadia Sohail, Noman Arshed (Economics/SBE) Abstract: The economic system recognizes the role of the financial system as an important cog in its machinery. Several theoretical and empirical studies have evidenced its contributing role to the economy. Within the overall financial system, the Islamic financial system ensures the increase in productivity of capital as well as in the synchronization between the incomes of the rich and the poor. Mudarabah companies stay at the forefront of the Islamic financial system. Their knowledge‐intensive approach helps the allocation of resources in long‐term ventures and, because of their participation‐based setup, they can theoretically cause a trickle‐down effect via their redistribution process from the borrower to the lender. Practically, though, this requires the financial institutes such as Mudarabah to be cost‐efficient. This chapter explores specifically how efficient Mudarabah companies of Pakistan are in terms of cost minimization, and investigates whether different dimensions of intellectual capital can improve cost efficiency. Keywords: not available. Conference Paper 1. Arshed, N. (2020). Sensitivity Assessment of Pakistan KMI Index to COVID‐19. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Noman Arshed (Economics/SBE) Abstract: Not available. Keywords: not available.
2. Kakar A. R., Arshed N., Munir M., & Hafeez‐ur‐Rehman. (2020). Do globalization and economic growth widen income disparity : A Case of Pakistan. Paper presented at the 7th International Conference on Business
Research Outlook 2020 | 176
Management (ICoBM) 2020, Online. (Abdul Rehman Kakar, Noman Arshed, Mubbasher Munir, Hafeez‐ur‐ Rehman (Economics/SBE) Abstract: Not available. Keywords: not available.
3. Arshed, N. (2020). On Exploration of Equilibrium Level of Musharaka Financing in Full‐Fledged Islamic Banks. Paper presented at 5th Global Forum on Islamic Economics, Finance and Banking, University of Management and Technology Lahore, Pakistan. 11‐12 March 2020. (Noman Arshed (Economics/SBE) Abstract: Not available. Keywords: not available.
4. Arshed, N. (2020). Proactive vs. Reactive Shari’ah Governance: A Case of Pakistan. Paper presented at 5th Global Forum on Islamic Economics, Finance and Banking, University of Management and Technology Lahore, Pakistan. 11‐12 March 2020. (Noman Arshed (Economics/SBE) Abstract: Not available. Keywords: not available.
5. Arshed, N. (2020). Islamic Financing Portfolio and its Growth Potential. Paper presented at 5th Global Forum on Islamic Economics, Finance and Banking, University of Management and Technology Lahore, Pakistan. 11‐12 March 2020. (Noman Arshed (Economics/SBE) Abstract: Not available. Keywords: not available.
6. Munir, M., Arshed, N., Alhajj, R. (2020). Effects of Covid19 and Global Clusters – A Machine Learning Case Study. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Mubbasher Munir, Noman Arshed (Economics/SBE) Abstract: Not available. Keywords: not available.
7. Arshed, N., Hameed, K., Munir, M., Yazdani, Y., Baig, A. A. (2020). Prevailing Psychological Stress and COVID19 Incidence: A Time to revisit our Economic Priorities. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Noman Arshed, Kamran Hameed, Mubbasher Munir, Naveed Yazdani (Economics/SBE) Abstract: Not available. Keywords: not available.
8. Arshed, N., Hussain, T., Sohail, A. B. (2020). Sensitivity Assessment of Pakistani Shari'ah and non Shari'ah Index due to COVID 19?. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Noman Arshed, Talat Hussain (Economics/SBE) Abstract: Not available. Keywords: not available.
Research Outlook 2020 | 177
Department of Quantitative Methods Research Articles 1. Iqbal, K., Moeen, M., Ali, A., & Iqbal, A. (2020). Mixture regression cum ratio estimators of population mean under stratified random sampling. Journal of Statistical Computation and Simulation, 90(5), 854‐868. doi: 10.1080/00949655.2019.1710149.(Kanwal Iqbal, Muhammad Moeen, Asad Ali (Quantitative Methods/SBE) Abstract: In this paper, single‐phase mixture regression cum ratio estimators are presented by utilizing auxiliary variables and auxiliary attributes simultaneously under stratified random sampling. Special cases of these estimators are discussed and further mean square errors are extracted mathematically. Also, to observe the properties of proposed estimators, simulation technique is used which shows that the distribution of the proposed estimators is approximately normal. To differentiate the performance of the proposed estimators, an empirical study has been conducted by incorporating quantitative and qualitative characteristics in the form of auxiliary attributes and variables simultaneously. Comparisons are made with single‐phase mixture regression cum ratio estimators under simple random sampling. It has been found that the mixture regression cum ratio estimators employing multiple auxiliary variables and attributes, simultaneously, under stratified random sampling are more efficient than mixture regression cum ratio estimator under simple random sampling. Keywords: auxiliary information, mean square error, stratified random sampling, study variate, attribute.
2. Ali, S., Altaf, N., Shah, I., Wang, L., & Raza, S. M. M. (2020). On the Effect of Estimation Error for the Risk‐Adjusted Charts. Complexity, 2020, 6258010. doi: 10.1155/2020/6258010. (Syed Muhammad Muslim Raza (Quantitative Methods/SBE) Abstract: Control charts are a popular statistical process control (SPC) technique for monitoring to detect the unusual variations in different processes. Contrary to the classical charts, control charts have also been modified to include covariates using regression approaches. This study assesses the performance of risk‐adjusted control charts under the complexity of estimation error by considering logistic and negative binomial regression models. To be more precise, risk‐adjusted Cumulative Sum (CUSUM) and Exponentially Weighted Moving Average (EWMA) charts are used to evaluate the impact of the estimation error. To compute the average run length (ARL), Markov Chain Monte Carlo simulations are conducted. Furthermore, a bootstrap method is also used to compute the ARL assuming different Phase‐I data sets to minimize the effect of estimation error on risk‐adjusted control charts. The results for cardiac surgery and respiratory disease data sets show that the modified control charts improve the performance in detecting small shifts. Keywords: not available.
3. Raza, S. M. M., Ali, S., Shah, I., Wang, L., & Yue, Z. (2020). On Efficient Monitoring of Weibull Lifetimes Using Censored Median Hybrid DEWMA Chart. Complexity, 2020, 9232506. doi: 10.1155/2020/9232506. (Syed Muhammad Muslim Raza (Quantitative Methods/SBE) Abstract: A control chart named as the hybrid double exponentially weighted moving average (HDEWMA) to monitor the mean of Weibull distribution in the presence of type‐I censored data is proposed in this study. In particular, the focus of this study is to use the conditional median (CM) for the imputation of censored observations. The control chart performance is assessed by the average run length (ARL). A comparison between CM‐DEWMA control chart and CM‐based HDEWMA control chart is also presented in this article. Assuming different shift sizes and censoring rates, it is observed that the proposed control chart outperforms the CM‐ DEWMA chart. The effect of estimation, particularly the scale parameter estimation, on ARL is also a part of this study. Finally, a practical example is provided to understand the application and to investigate the performance of the proposal in practical scenarios. Keywords: not available.
Research Outlook 2020 | 178
4. Mehmood, Q., Naeem, S., Sharif, S., & Shaheen, N. (2020). Statistical analysis of heavy metals in Catlacatla, Wallago attu and Tilapia nilotica fish at head Sulemanki in Satlujriver. Pure and Applied Biology (PAB), 9(1), 1216‐ 1222. Retrieved from https://thepab.org/index.php/journal/article/view/1256 (Qaisar Mehmood, Saira Sharif (Quantitative Methods/SBE) Abstract: The present study was aimed to evaluate the concentration of heavy metals in various organs of three edible fish species (Catlacatla, Wallagoattu and Tilapia nilotica) sampled from contaminated water of River Setluj at head Sulemanki (Okara), Pakistan. The concentration of selected heavy metals iron (Fe), nickel (Ni), Chromium (Cr), Cadmium (Cd) and lead (Pb) are compared in skin muscles, heart, liver, kidney and gills of same fish and also made comparison among three type of fishes. Overall absorption of heavy metals in three type of fishes is as follow Fe >Pb> Ni > Cr > Cd. The concentration of heavy metals in all three species of fishes is compared as Tilapia nilotica ˃ Catlacatla ˃ Wallagoa u, while the existence of heavy metals in the organs of fish is also compared, kidney ˃ liver ˃ gills ˃ skin muscles ˃ heart. In analysis of variance accumula on of heavy metals in three species is significantly present, as p˗value is less than 0.05 for all heavy metals. Measured elevated levels of metal concentrations in fish organs is pointed out to be risks for potential health of fish, other aquatic organisms and human health. Keywords: catlacatla, heavy metal, organs, tilapia nilotica and wallagoattu. Department of Finance Research Articles 1. Rafay, A., Farid, S., Yasser, F., & Safdar, S. (2020). Social Collateral and Repayment Performance: Evidence from Islamic Micro Finance. Iranian Economic Review (IER), 24(1), 41‐74. (Abdul Rafay, Saqib Farid (Finance/SBE) Farah Yasser (SCA) Abstract: In this study we designed to test the remarkable repayment performance of Akhuwat in Pakistan; the most successful Islamic Microfinance Institution (IMFI), which offers interest‐free loans in order to improve the quality of life and alleviate poverty. The model of Akhuwat is based on Muakhaat (brotherhood) and Qard‐e‐ Hasan (offering financial assistance to somebody in need without interest). The primary objective of this study was to investigate the determinants of microfinance repayment performance. The study examined the borrowers’ characteristics, loan attributes, lender/institutional characteristics and the social collateral characteristics related to the Akhuwat and the data of 387 borrowers is obtained from microfinance programs carried out on a continuous basis by Akhuwat. The findings depicted that among the socio‐demographic factors like gender, marital status, number of dependents and numbers of previous loans are significantly and positively associated with loan repayment performance. However, previous loan default and religion are significantly and inversely associated with the loan repayment performance. The findings of the study supported the role of social ties in improving repayment performance and hold key insights and directions about microfinance policymaking in Pakistan. Keywords: Islamic microfinance, repayments, Pakistan, social collateral.
2. Anwer, Z., Khan, S., & Abu Bakar, M. (2020). Sharīʿah‐compliant central banking practices: lessons from Muslim countries’ experience. ISRA International Journal of Islamic Finance, 12(1), 7‐26. doi: 10.1108/IJIF‐01‐2019‐0007. (Zaheer Anwer (Finance/SBE) Farah Yasser (SCA) Abstract: Purpose – The purpose of this study is to document how a central bank can perform its primary and secondary functions in a Sharīʿah‐compliant manner. It also seeks to investigate the outcomes of the experiments of Muslim‐majority countries in this regard. Design/methodology/approach – As a first step, a detailed review of existing literature is conducted, which discusses the views of scholars and practitioners on the central banking
Research Outlook 2020 | 179
mechanism in a fully Sharīʿahcompliant financial system. Moving further, the case studies of Iran, Sudan and Pakistan are presented to highlight experiences of regulators from three Muslim‐majority countries, which aimed to achieve full compliance with Sharīʿah (Islamic law) principles related to Islamic finance. To evaluate their models, an assessment of their practices is performed in the light of Sharīʿah rules and principles based on existing literature. Finally, the issues involved in establishing a Sharīʿah‐compliant central bank (SCCB) are discussed and improvements are suggested. Findings – It is found that Iran played an effective role in pursuing broader objectives of monetary policy by setting priorities for credit allocation and assisting the government in reducing expenses; however, with respect to instruments, its experience is limited to the rebranding of conventional products. Sudan has not only used monetary policy to effectively curb inflation but also it has introduced various indirect instruments to perform monetary operations. Pakistan succeeded in formulating a theoretical roadmap to establish a SCCB but the desired objectives could not be achieved because of multiple factors. Practical implications – This study has important policy implications for regulators and policymakers from Muslim countries, who can use the findings in shaping effective Sharīʿah‐compliant central banking practices in their respective countries. Originality/value – This study discusses the salient features of an important Islamic financial institution, the central bank and evaluates the experiments of three Muslim‐majority countries in implementing Sharīʿah‐ compliant central banking practices. To the best of the knowledge, this evaluation has not been performed in the existing literature and the present study fills in this gap. Keywords: Pakistan, Sudan, Islamic finance, monetary policy, iran, Sharīʿah‐compliant central bank.
3. Ajmal, M. M., Rafay, A., & Ajmal, M. M. (2020). Managing International Communication: Ji Trading Company. Asian Journal of Management Cases, 17(1), 52‐60. doi: 10.1177/0972820119892704. (Muhammad Mobeen Ajmal, Abdul Rafay (Finance/SBE) Abstract: On 16 January 2015, Zohaib Akhtar, the company secretary and PA to the CEO of Ji Trading Company was analysing what went wrong during the day. Ji Trading Company imported heavy machinery from China for its clients in Pakistan. This year the company tried to attract more investment from their existing Chinese partners and raise new capital from local investors. Zohaib and his associate, Sheng, had been working on this deal for more than a year. They worked on understanding the Chinese culture as well as understanding the inherent differences between the Chinese and Pakistanis. Yet, on the first day, the Chinese partners came to the firm and it was a fiasco. Now he had to think about ways to stop further problems during the next month the Chinese partners were in Pakistan. Keywords: Investment, partnership, China, trading, Pakistan.
4. Khan, T. M., Nosheen, S., & ul Haq, N. (2020). Corporate governance mechanism and comparative analysis of one‐tier and two‐tier board structures: evidence from ASEAN countries. International Journal of Disclosure and Governance. 17, 61–72 . doi: 10.1057/s41310‐020‐00075‐0. (Tahseen Mohsan Khan, Safia Nosheen (Finance/SBE) Naveed ul Haq (ORIC) Abstract: The study investigates and compares the determinants of disclosure quality of one‐tier and two‐tier board structures in selected ASEAN countries. We measure the significance of different corporate governance mechanism of top 50 companies from Malaysia, Indonesia, Thailand, and Singapore from 2011 to 2015. The results of independent sample t test prove that the variances of the disclosure quality scores of one‐tier and two‐ tier board structures are different. In order to avoid problems of omitted variable bias, unobserved heterogeneity and endogeneity, we use the Tobit regression model with random effects. The results confirm that the disclosure quality has a dependence on board size, board expertise, board meetings, board diversity, the timeline for both one‐tier and two‐tier board structures. The female board members and free cash flows have sole dependence on the one‐tier board, whereas board power and block holders have sole dependence on two‐tier boards. The study also establishes the relationship between board independence with disclosure quality of board structures.
Research Outlook 2020 | 180
Keywords: disclosure quality, board structures, asean countries, tobit regression.
5. Sadiq, R., Nosheen, S., & Akhtar, W. (2020). The Influence of Governance on Intellectual Capital in Textile Industry. International Journal of Business and Society, 21 (1), 1‐24. (Ramla Sadiq, Safia Nosheen Naveed (Finance/SBE) Abstract: This study is aimed to evaluate the impact of corporate governance index on intellectual capital performance by developing the index from five sub‐indices and incorporating the value‐added intellectual coefficient (VAIC) methodology for intellectual capital performance. Fixed and Random Effect Regression techniques have been used to analyze the data of the textile sector in Pakistan from 2010 to 2014. The findings suggest a negatively significant impact of corporate governance index on intellectual capital performance while subindices give mixed results. The study also investigates the relationship of individual variables in each subindex with performance and results show a significant relationship for five variables namely independent director, independent audit committee, foreign shareholders ownership, gratuity, and remuneration committee. This study contributed empirical work in the literature of corporate governance and intellectual capital performance. The outcomes of this study can be used by policymakers as an attempt to boost the performance of the textile sector. A modified value‐added intellectual coefficient (M‐VAIC) methodology can be used in future research. Keywords: corporate governance, intellectual capital performance, related party transactions, textile industry, value added intellectual coefficient.
6. Ramzan, M., Ahmed, I., & Rafay, A. (2020). Is auditor independence influenced by non‐audit services? A stakeholders viewpoint. Pakistan Journal of Commerce and Social Sciences (PJCSS), 14(1), 388‐408. (Abdul Rafay (Finance/SBE) Abstract: The auditor may provide numerous services to their clients covering audit and non‐audit services (NAS). These services have been considered as a combination of services offering varying results for client firms. The mixed results reported by past studies in measuring the relation between NAS and auditor independence had generated the need of further investigation. Moreover, the dearth of literary evidence from a developing country like Pakistan also created a need for such a study. Considering the gaps left unaddressed in past studies, the current study aims at investigating the possible relationship between NAS and auditor independence. Data of the study was collected from three stakeholders of audit (i.e. accountants, finance managers, and internal auditors). Data collected through the questionnaire proved that various respondent groups have different opinions about the said relationship. It was observed that NAS were believed to have positive, negative and no effects on auditor independence. Moreover, occupational level, experience and educational level of the respondents was also observed to have significant bearing on the opinion about NAS and auditor independence relationship. The changing dynamics of the audit profession with abridged trust in its services, caused by NAS, have created the need for investigation focusing on views of various stakeholders of such services. This study attempts to provide empirical evidence on the varied perspectives. Keywords: auditor independence, internal auditors, non‐audit services, Pakistan.
7. Nosheen, S., Naveed‐ul‐Haq, & Khan, T. M. (2020). ASEAN countries CG disclosure practices: a comparative analysis of one‐tier and two‐tier board structures. International Journal of Business Governance and Ethics, 14(3), 317‐335. (Safia Nosheen, Naveed‐ul‐Haq,Tahseen Mohsan Khan (Finance/SBE) Abstract: Study focal point is to access the influence of CEO characteristics and audit quality on disclosure quality in the comparison between one‐tier and two‐tier board structures. Tobit regression model with the random effect is used to access influence on disclosure quality by using the sample of 200 non‐financial firms of Indonesia, Malaysia, Thailand, and Singapore for the period from FY 2011 to FY 2015. The study empirically analyses the various characteristics of one and two‐tier board structures. Findings of the study observe CEO dual role inversely
Research Outlook 2020 | 181
and audit committee expertise directly impact disclosure quality for both structures. Further, observed audit committee size and firm size directly impact disclosure quality for one‐tier structure and CEO age and leverage inversely impact two‐tier structure. Finally, CEO tenure, audit quality and audit committee independence having no impact on disclosure quality for both board structure. Keywords: disclosure quality, CEO characteristics; one‐tier boards, two‐tier boards, audit quality characteristics, non‐financial firms.
8. Nosheen, S., Khan, T. M., & Fazal‐Ur‐Rehman. (2020). SMEs Exports are Influenced by Different Risk Factors: Empirical Study of Emerging Economy. Journal of Accounting and Finance in Emerging Economies, 6(1), 201‐218. (Safia Nosheen, Tahseen Mohsan Khan, Fazal‐Ur‐Rehman (Finance/SBE) Abstract: Study intent to identify the direct (indirect) risk factors that can influence the export of medical instruments from SMEs sector of Pakistan by using the time series monthly data sample for a period of fifteen years that is from FY 2003 to FY 2017. Empirically a strong long term relation between the export of medical instruments with operational risk, market risk, export refinance schemes and steel prices are proven by Johansen co‐integration. Study also establishes a direct positive relation of operational risk and market risk with the export of medical instruments as a result of Vector Error Correction Model. Keywords: medical instruments, market risk, operational risk, export refinance, smes.
9. Naeem, M. A., Farid, S., Faruk, B., & Shahzad, S. J. H. (2020). Can happiness predict future volatility in stock markets? Research in International Business and Finance, 54, 101298. doi: https://doi.org/10.1016/j.ribaf.2020.101298. (Saqib Farid (Finance/SBE) Abstract: In this paper, we use the Twitter based happiness index as a proxy for investor sentiment in order to examine whether happiness influences future market volatility of country VIX indexes. Our sample includes the major stock markets of the USA, Canada, UK, Germany, France, Netherlands, Switzerland, Japan, China, Hong Kong, India, Brazil, South Korea, and South Africa. Using linear and nonlinear causality tests, we find that Twitter happiness significantly causes the future volatility of the sample countries. The robustness checks show no divergence from our primary findings and provide strong evidence of a nonlinear relationship between investor sentiment and future stock market volatility. Keywords: G12, G14.
10. Liu, C., Muhammad Abubakr, N., Mobeen Ur, R., Farid, S., & Syed Jawad Hussain, S. (2020). Oil as Hedge, Safe‐ Haven, and Diversifier for Conventional Currencies. Energies, 13(17), 4354. doi: http://dx.doi.org/10.3390/en13174354. (Saqib Farid (Finance/SBE) Abstract: The research investigates the safe‐haven, hedging, and diversification function of crude oil for conventional currencies, among which five are major oil exporters, and six are major oil importers. In order to model time‐varying dynamic correlations between crude oil and currencies, the study uses the Asymmetric‐DCC model. The findings highlight low or negative correlations, especially during the crisis period. Next, we employ a quantile based regression framework and conclude distinct safe‐haven and hedge functions of oil for major currencies. We provide additional evidence on the safe‐haven, hedging, and diversification function of crude oil using the cross‐quantilogram framework. The findings of out of sample analysis illustrate that the hedging effectiveness of oil is greater for oil‐exporting countries. In addition, the conditional diversification benefit of oil is higher in the lower quantiles, i.e., when both foreign exchange and oil markets are in a bearish state. Finally, implications for investors, portfolio managers, and policymakers are further discussed. Keywords: hedge, safe haven, crude oil, currency.
11. Anwer, Z. (2020). Salam for import operations: mitigating commodity macro risk. Journal of Islamic Accounting Research Outlook 2020 | 182
and Business Research, 11(8), 1497‐1514. doi: 10.1108/JIABR‐09‐2018‐0142. (Zaheer Anwer (Finance/SBE) Abstract: Purpose: This paper aims to present the idea of using classic Islamic finance instrument Salam to conduct import transactions. It documents the complete framework of the proposed model. At present, this mode is not used by Islamic Financial Services Industry although it is capable of becoming a viable risk‐sharing instrument. Design/methodology/approach: First, the features of existing import financing products are explored and compared with various contractual features of Salam. Second, a discussion on why banks are reluctant in practicing Salam is included. Third, the pricing techniques, accounting treatment and collateral arrangements related to proposed product are discussed. Finally, the feasibility of this product in present industry environment is assessed. Findings: The proposed model carries certain features that make it a true risk‐sharing product. For example, it suggests changing bank’s role from intermediary to entrepreneur and favours better alignment of risk between the related parties. This work has also proposed using market‐based returns, instead of the existing interest‐ based benchmarks, for pricing the contract. To practice this product, a dedicated effort of all the stakeholders is required. The product features can contribute to the goal of practicing responsible financing, engrained in true economic reality. Research limitations/implications: The present work is a technical paper, and the product features may be improved in the light of feedback from the industry and academia. Practical implications: The proposed model views Islamic bank as a trader instead of a lender, who will assume the effective ownership of imported goods before selling them to the customers. The pricing structure will also be unique, as the margins will be decided upon the basis of market‐driven returns of the underlying assets. Indeed, by entering into such contract, Islamic Banks will be exposed to market‐related risks. They will be required to design their risk management frameworks accordingly. Originality/value: It is widely argued that many Islamic finance products are similar to their conventional counterparts in substance. There is a need for the instruments that carry risk sharing attributes. This paper aims to bridge this gap by investigating the potential of classical Islamic finance product Salam for conducting foreign trade transactions. Keywords: Islamic banking, Islamic finance, Salam, Foreign trade.
Book/Book Chapters 1. Rafay, A. (2020). Growth and Emerging Prospects of International Islamic Banking. IGI Global. http://doi:10.4018/978‐1‐7998‐1611‐9. (Abdul Rafay (Finance/SBE) Abstract: As an ever‐growing international business, Islamic banking has changed the face of economics in recent years. As more and more industries embrace Islamic principles, the industry will unquestionably influence modern economic practices and techniques across the globe. Growth and Emerging Prospects of International Islamic Banking is a collection of innovative research on the methods and applications of Islamic banking interests on a global economic scale. While highlighting topics including asset diversification, profit sharing, and financial reporting, this book is ideally designed for bankers, banking analysts, international business managers, financiers, industry professionals, economists, government officials, academicians, students, and researchers seeking current research on Islamic banking perspectives and approaches to finances. Keywords: asset diversification, banking governance, financial reporting, global business, islamic law, limited purpose banking, ownership risk, profit sharing, return rate, risk management.
Research Outlook 2020 | 183
Department of Banking and Finance Research Articles 1. Qureshi, M. H., & Hussain, T. (2020). Green Banking Products: Challenges and Issues in Islamic and Traditional Banks of Pakistan. Journal of Accounting and Finance in Emerging Economies, 6(3), 703‐712. https://doi.org/10.26710/jafee.v6i3.1177. (Talat Hussain (IBF/SBE) Abstract: Purpose: The issuance of green banking guidelines in 2017 has opened the door of a new banking horizon for Islamic banks because the objective of Islamic banks, objective of Shariah, objective of Islamic economic system and objective of green banking are linked. Banking, especially Islamic banking based on products and one of the main components of green banking guidelines is the development of green banking products. Since green banking is in the infancy stage, therefore, the objective of the study is to explore the issues and challenges in green banking products in Islamic and traditional banks of Pakistan. Methodology: Semi‐Structured interview technique is utilized for data collection. The green operation managers and Shariah scholars of sample banks selected as interviewees. Interviews are conducted through telephonic recorded calls and email‐interviewing. Total of 26 interviews are conducted. Findings: The results indicate that lack of skills, knowledge, identification of the target market with the appropriate mode of financing and convincing the people are some main obstacles in green banking product formulation and implementation. Implications: At one‐point, green banking is an opportunity for Islamic banks to achieve Maqasid‐e‐Shariah on the other side, it may become an obstacle because it further limits the financing areas for Islamic banks. The situation needs serious attention from policymakers to act at earliest. Keywords: green products, Pakistan, Islamic banks, traditional banks.
2. Qureshi, M. H., & Hussain, T. (2020). Trend Analysis of Islamic Financing: A Case of Islamic Banks in Malaysia. Journal of Islamic Business and Management, 10(1), 79‐95. (Muhammad Hussain Qureshi, Talat Hussain (IBF/SBE) Abstract: The objective of this study is to identify and analyze the trend of different modes of financing offered by standalone Islamic banks and Islamic subsidiaries of conventional banks of Malaysia. At present, there are 5 standalone Islamic banks and 11 Islamic subsidiaries of conventional banks operating in Malaysia. All banks are selected for analysis. Annual audited financial statements of standalone Islamic banks and Islamic subsidiaries of conventional banks have been utilized for obtaining data. The study period is from year 2010 to 2016. Vertical and horizontal analysis techniques are applied for analyzing the data. The results indicate that Islamic subsidiaries of conventional banks are more efficient in providing different modes of financing out of 6 popular modes; Islamic subsidiaries of conventional banks are capturing 4 modes which are in double figure as percentage of the total portfolio; while in standalone Islamic banks, 3 modes are in double figure. In sales base products standalone Islamic banks are more efficient, while Islamic subsidiaries of conventional banks are more efficient in providing rental base products. In products like Murabaha and Ijarah, Islamic subsidiaries of conventional banks are more efficient, while standalone Islamic banks are more efficiently managing the controversial products such as Bai Bithaman Ajil and Tawarruq. While three products are showing upward trends, the other three are showing downward trend. The study concluded that despite being exalted in Islamic banking and finance, still the Islamic financing base of Malaysian banks comprises the debt creating modes. Keywords: Islamic Banking, Financing Modes, Financing Portfolio, Malaysia.
3. Hussain, T., Arshed, N., & Kalim, R. (2020). An Appraisal of the Role of Islamic Banking Development and Economic Growth. Journal of Applied Economics and Business Studies (JAEBS), 4(4), 215‐236. doi: https://doi.org/10.34260/jaebs.4410. (Talat Hussain (IBF/SBE) Noman Arshed, Rukhsana Kalim(Economics
Research Outlook 2020 | 184
/SBE) Abstract: Literature is well‐versed with the contribution of financial inclusion from the deposit and financing size and its role in economic growth. These contributions include a boost in economic transactions and efficient resource mobilization. Islamic financial system is different from conventional banking as it distributes the risk equitably and promotes fairness in dealings. It helps in the integration of business gains as a borrower of Islamic capital with the earnings of savers as depositors. This study has proposed two channels via which Islamic financial development may incur growth. First is bank financing penetration, and second is depositor financial inclusion. Based on the data of 41 full‐fledged Islamic banks between 2012 and 2017, the results show that both increases in bank and depositor returns have a growth‐promoting effect. This prompts the policymakers with new insights. Policymakers should increase Islamic banking penetration to different sectors and regulate for increased extraction of the depositor contribution from the banking financing activity. Keywords: capital structure, financing penetration, financial inclusion, income integration.
4. Saeed, M. (2020). Mediation effect of psychological contract between personality dimensions and turnover intention. Journal of Economics, Finance and Administrative Science, 25(50), 205‐219. doi: 10.1108/JEFAS‐06‐ 2019‐0101. (Maryam Saeed (IBF/SBE) Abstract: Purpose – This study aims to test the mediating role of psychological contract (PC) in a relationship between personality dimensions and turnover intention. Design/methodology/approach – The current study is analytical in nature. The data for the purpose of the analysis is collected from 300 software engineers working in Lahore, Punjab. Purposive sampling technique is used for the collection of this data. The response rate was 87.33 per cent. Different data analysis techniques such as correlation, regression analysis, are used to test the 10 hypotheses of the study. Moreover, the study adopted a cross‐sectional survey design. Findings – According to regression analysis, extroversion, conscientiousness and agreeableness personality dimensions brought positive but insignificant increments in turnover intention. However, emotionally stable personality dimensions brought positive and significant increments in turnover intention. Open to experience personality dimension brought negative but insignificant decrement in turnover intention. Results showed extroversion personality dimension brought a very less but insignificant increment in variations of PC, which have higher contributions in variations of turnover intention. Emotional stable, conscientiousness and agreeableness personality dimensions brought also very less but a significant increment in PC. Open to experience personality dimension have negative but insignificant decrement in PC. Results showed the mediation impact of PC among emotional stability, conscientiousness and agreeableness personality dimensions and turnover intention. However, PC does not mediate among extroversion, open to experience personality dimensions and turnover intention. The paper concludes with recommendations for further research. Originality/value – This study will help the organization in reducing the turnover rate and can enhance the motivation level of their employees. Keywords: Extroversion personality dimension (EPD), Consciousness personality dimension (CPD), Agreeabl personality dimension (APD), Openness to experience personality dimension (OEPD), Psychological contract (PC).
5. Yasmeen, S., & Sohail, H. (2020). Economics of COVID‐19: A case of Punjab, Pakistan. Empirical Economic Review, 3(2), 10‐30. Retrieved from https://ojs.umt.edu.pk/index.php/eer/article/view/464. (Sadia Yasmeen, Hadia Sohail (IBF/SBE) Abstract: Desperate timescall for desperate measures. This study explores thoseassessment tools which may enlightenthe current pandemic situation. Itassesses the link between the COVID‐19 incidence and its effectson the length of the expected recessionary period in the region. Being a developingeconomy, the Prime Minister of Pakistan feared that the severity of recession because ofa strict lockdown may not be tolerable. This study
Research Outlook 2020 | 185
developed a theoretical model to explain the possible parameters and tradeoffs which can help in the decision to ease the lockdown. Previously, social and print media focusedon the reporting of COVID‐19 cases and consequently, its mortalityrate. This study used the relative forms of recovery and mortality ratesto assess theirquadratic/nonlinearpatternwith respect to time. It is proposed here that the government should use more complicated plots to assess how COVID‐19 is evolving and should also prepare a factfinding team to assess the situation foreasing the lockdown. Keywords: COVID incidence curve, economic recession, smart lockdown.
School of Social Science & Humanities (SSSH) Department of Political Science and International Relations (DPSIR) Research Articles 1. Mehmood, U., & Tariq, S. (2020). Globalization and CO2 emissions nexus: evidence from the EKC hypothesis in South Asian countries. Environmental Science and Pollution Research. 27, 37044–37056. doi: 10.1007/s11356‐020‐09774‐1.(Usman Mehmood (DPSIR/SSSH) Abstract: In the last few decades, developing countries continued to increase their manufacturing industries’ phenomenal growth rate. Due to the emergence of globalization, these developing countries are getting economic growth at the cost of environmental pollution. In this context, the extent of linkages between globalization and carbon dioxide (CO2) emissions has been investigated over the time period of 1972–2013 in South Asian countries. The econometric and graphical analyses are found U‐shape association between globalization and CO2 emissions in Nepal, Afghanistan, Bangladesh, and Sri Lanka, and an inverted U‐shape relationship is observed in Pakistan and Bhutan. Moreover, results have shown that there exists a bi‐directional causality between globalization and CO2 emissions in Pakistan, Bangladesh, and Nepal. This indicates that globalization is increasing CO2 emissions and CO2 emissions impact globalization by economic growth. However, after some threshold level, globalization is responsible for decreasing CO2 emissions in Pakistan and Bhutan. For the first time, globalization is incorporated in the economic analysis, showing the U‐shape and inverted U‐shape associations between globalization and CO2 emissions. This study suggests some strong policy recommendations to consider globalization as cost‐effective tool to achieve sustainable economic growth in South Asian countries. Keywords: Globalization, CO2 emissions, South Asia, EKC.
2. Shehvaar, D. e., Idris, W., & Ahmed, M. (2020). Climate Change and the Surge for Pandemics. Journal of Sustainable Development, 13(3). doi: DOI:10.5539/jsd.v13n3p138. (Durr e Shehvaar, Wardah Idris Mubashira Ahmed (DPSIR/SSSH) Abstract: The pandemic of the century has caused great concern about the global environmental crisis. The article outlines the various aspects of the surge of pandemic its link to climate change along with the prospects for the nation‐states and how they have seen it as a challenge as it is being seen as taking thousands of lives. In the literature review, the research problem that has been tailored is if the pandemic can create a common awareness about the global climate crisis that has destructive projections for the globe itself. A causal link between the surge of pandemics and climate change that helps spread the viruses has been created. In addition to this, we further argue that the nation‐states and their exploitative corporate goals that are manipulating the environment should be curbed through decisive steps. Keywords: climate change, environmental crisis, nation‐states, pandemic.
3. Sajjad, F. W., & Ahmad, S. (2020). The Policy and Practice of'Enlightened Moderation': Representations in International Print Media. Pakistan Horizon, 73(1) 101‐110. (Fatima Waqi Sajjad, Sara Ahmad (DPSIR/SSSH)
Research Outlook 2020 | 186
Abstract: This study discusses President Pervez Musharraf's policy of Enlightened Moderation (EM) which he formulated after the incident of 9/11, for the Muslim world as well as for the western world. Elaborating on his policy of EM, president Musharraf appealed to the world to eradicate global violence by putting an end to political disputes in the Muslim world. He also suggested that in order to promote peace, the West should help the Muslim world for their socio‐economic betterment. This study analyses the representations in the international print media on the policy of Enlightened Moderation which pointed out that Musharraf's policy of EM was self‐ contradictory because he did not implement his idea in his own country. It also disclosed that, contrary to popular perception, Musharraf's policy of EM was mostly criticized in the media, despite his support for the internationally sanctioned Global War on Terror. Keywords: not available.
4. Qureshi, A. (2020). Countering Extremism and Radicalization: The Role of Muslim Women Activists in informing Ethno‐Religious Minority Policies in the UK (2001‐2016). Pakistan Horizon, 73(1), 79‐100. (Abeeda Qureshi (DPSIR/SSSH) Abstract: This article examines the role of Muslim women in informing ethnoreligious minority policies in the UK (2001‐2016). Using Muslim women activists as a case study, it explores how this relationship works in practice and whether the role played by Muslim women is symbolic or substantive. Specifying the 'decentred' theory of policymaking, I employ a 'hybrid' approach and take further insight from Saward's 'representation' theory to answer the aforementioned questions. Using evidence from the documentary analysis of public records and in‐ depth elite interviews of Muslim women activists, community leaders and government officials, this article highlights the presence of a systematic and institutionalized nature of the engagement between the government and Muslim women activists. It concludes by highlighting the positive role of non‐elected Muslim women in the promotion of dialogue between the wider Muslim population and a variety of government departments. Keywords: multiculturalism, integration, preventing violent extremism, radicalization, muslim women activists, policy debates. terrorism.
5. Shabbir, M. O., Shabbir, M. F., Rizvi, S. Z., & Asghar, Z. (2020). Rise of Xenophobia in West: Indian exploitation and its implication on Pakistani Diaspora. Journal of Indian Studies, 6(1), 47– 56. (Muhammad Omer Shabbir (DPSIR/SSSH) Syeda Zahida Rizvi, Zainab Asghar (ILA) Abstract: The world is witnessing the rise of xenophobia in the Western society and culture that is massively deteriorating the social fabric of the western society and creating a gulf between the natives of different countries and the locals. A considerable number of Political Scientists including the famous Noam Chomsky are of the view that it is nothing but a planned manipulation of minds of the local people by the ruling elite for getting their electoral gains and portray Muslims as a monster that are serious threat for the stability and security of the Western society. The paper intends to unfold the xenophobic trends and the Indian role in fueling the xenophobia against the Pakistani Diaspora. The theoretical lens that will magnify the literature would be the Social Constructivism. The paper will highlight the exploitation of minds by the Western political parties that ultimately help them to get the desired results in the electoral process with primary focus on the Pakistani Diaspora. The paper will also illuminate the fears of the Western society about the decaying trends in their culture and linguistics. Keywords: xenophobia, West, Indian role, Pakistani diaspora.
6. Owais, M. (2020). Indian Ocean and Indo‐China Rivalry: Challenges for Pakistan. Journal of Indian Studies, 6(1), 91‐100. (Muhammad Owais (DPSIR/SSSH) Abstract: Indian Ocean is the third largest Ocean of the world providing sea route for almost half of the global trade. It has also become a reason of conflict for regional powers such as China and India, as well as for external
Research Outlook 2020 | 187
powers. Both countries are trying to secure their interests at every cost challenging the peace and security. This paper gives an analytical review on the interest of world powers specially the interests and ambitions of China and India. Based on their interest and geo‐political rivalry, this paper aimed at discussing the challenges associated for Pakistan. This paper concluded that the role played by the rival and regional powers is endangering the existence of many states including Pakistan in this region. Keywords: Indian Ocean, China, India, Pakistan.
7. Tariq, A., & Owais, M. (2020). A Case Study of Operation Gibraltar and Indo‐Pak War of 1965: An Application of Decision‐Making Models. Journal of Indian Studies, 6(1), 131‐138. (Azeem Tariq, Muhammad Owais (DPSIR/SSSH) Abstract: This paper focused on the real reasons and objectives behind the launch of Operation Gibraltar and Grand Slam. It also throws light on the trigger points of Indo‐Pak war of 1965. The primary objective of this paper is to apply the various decision‐making models on the case study of Operation Gibraltar and 1965 war. What were the real issues that forced Pakistan to choose the alternative of secret mission to infiltrate into Indian Occupied Kashmir? In this article, the authors tried to give different explanations of Operation Gibraltar. These explanations include: rational choice explanation, cybernetic explanation, prospect theory explanation, poliheuristic explanation, bureaucratic explanation, and organizational explanation from the best alternatives for conducting Operation Gibraltar. Keywords: Indian Occupied Kashmir, Operation Gibraltar, Rann of Kutch, Akhnur.
8. Farrukh, A., & Owais, M. (2020). Brexit implosion: will UK survive the unity of kingdom? Journal of European Studies, 36(1), 93‐112. (Muhammad Owais (DPSIR/SSSH) Abstract: The UK decided to leave European Union. In fact, it had triggered the Article 50 in 2017, which acts as the exit button for any EU member if it wants to leave the Union. So far, it has been an unprecedented move by the UK as no country has ever left the EU. The study is focused on the phenomenon of Brexit and the aftershocks it is likely to cause in times to come. The purpose of this research is to analyse the future scenario that could take shape in the aftermath of the British referendum of 2016, both for the EU and the likely future of the UK itself. Brexit is an ongoing phenomenon. I shall use an empirical method while using the data collected from the various sources such as newspapers, the magazines, journals and the research articles. Besides, the online sources including the government sources will also be used. The method of this research is qualitative. Although I have written this research in the light of the reference used and the nature of this work is predictive. With the lens of realist perspective, this article concludes that the future of the EU is bleak if Brexit happens, even bleaker for the UK itself regarding the integration of the country. Keywords: not available.
9. Sajjad, F. W. (2020). Lagging Behind Others? An Exploration of Muslims' Educational Outlook in Modern Times. Social Transformations: Journal of the Global South, 8(2), 157‐183. (Fatima Waqi Sajjad (DPSIR/SSSH) Abstract: In this paper I explore how modern Muslims' educational outlook has been affected by colonial disruptions of the past and coloniality of the present. Focusing on the case of colonial India and modern‐day Pakistan, I explore how the colonial intrusion in India dichotomized local Muslim education into two separate, divergent domains: religious and secular, a division that remains intact to date. When a contemporary Pakistani Muslim contemplates the purpose of education, he/she confronts two dominant discourses: 1) secular education discourses that advocate economic growth and catching up with the West as the ultimate purpose of education, and 2) dominant religious discourses that advocate salvation in the hereafter as the ultimate goal of education. Through semi‐structured interviews of university students in Pakistan, I explored how students make sense of these divergent discourses. I found that students (with a mainstream secular educational background) tend to Research Outlook 2020 | 188
make a distinction between the purpose of life (which they associate with religion) and the purpose of education (which they associate with worldly pursuits). I argue that this outlook of a difference between the purpose of life and that of education undermines the cultivation of the self that can make a meaningful contribution to knowledge and society. Furthermore, I explore contemporary ideas and practices of knowledge contribution and question the rampant epistemic hegemony of the West in the academic publication enterprise. I point out that the prevailing coloniality of knowledge amplifies the disorientation of Muslims' educational outlook and hence injury to the modern Muslim self. Keywords: coloniality of knowledge, decolonizing higher education, epistemic hegemony, Muslim education, religious/secular divide.
10. Askari, M. U., & Tahir, M. (2020). Sino‐US Rivalry in the South China Sea: A Hegemonic Stability Theory Perspective. Journal of Politics and International Studies, 6(2), 115–127. (Muhammad Usman Askari (DPSIR/SSSH) Abstract: This article is written in the background of the growing Sino‐US rivalry in the SCS dispute. It discusses the political, military, and economic initiatives of these countries to save their interests in the region. The South China Sea has become the center of Asia Pacific politics in specific and global politics in general. Its geostrategic importance and huge resources have attracted the attention of world powers in this region. China, the regional hegemon, claims the SCS region as its core interest and provides the basis to its claims based on historical usage and a part of the ancient Chinese dynasties. Though the US is a non‐resident state in this dispute its defense relations with other claimant states, its long‐term interests in this region, and increasing political and military rivalry with emerging superpower China, all these factors have forced the US to play a significant role in this dispute. This research tries to find out the answer to the research puzzle about the factors behind the growing rivalry between the US and China in the SCS. The research has employed qualitative methodology within the post‐positivist paradigm. The study is conducted under the lens of Hegemonic Stability Theory. This study concludes that the prevailing situation in the SCS would further get hot if either side behaves assertively to secure interests in the region. The conclusion suggests that peace could only be achieved if both countries show patience and solve this issue through multilateral negotiations. Keywords: politics, hegemon, South China Sea, geo‐politics, spratly, paracel.
11. Askari, M. U., Tahir, M., & Shaheen, N. (2020). Blue Economy of Pakistan: Challenges and Prospects. Journal of the Punjab University Historical Society, 33(2), 1‐14. (Muhammad Usman Askari, Nafisa Shaheen (DPSIR/SSSH) Abstract: The Blue or maritime economy promotes sustainable economic growth and development. In Pakistan, governments have not paid adequate attention in the growth of ocean economy. Under the flagship project of CPEC, the Sino‐Pak blue partnership is expected to promote the growth of maritime economy in Pakistan. This paper explores opportunities attached with blue economy and highlights the barriers which could impede the growth of this sector in Pakistan. A 1050 km long coastline and the EEZ with 290000 sq. km of sea zone promise Pakistan with invaluable untapped and unexplored hydrocarbon reserves, minerals, fish stocks and other marine resources. Pakistan’s maritime sector has huge potential of growth but needs favorable policies and substantial investment to materialize the dream of sustainable growth into reality. The geo‐strategic location provides Pakistan a pivotal position in the changing dynamics of the India Ocean and if this potential is utilized to its maximum, Pakistan can covert it vast sea zone into an epicenter of blue economy in the region. The paper concludes with the argument that future of Pakistan is attached with the development of blue economy. An all‐ encompassing strategy on maritime sector by government can pave the road to prosperity in Pakistan. Keywords: blue economy, opportunities, challenges, maritime sector, prosperity, ocean.
12. Shaheen, N., & Askari, M. U. (2020). The US Asia‐Pacific Policy and Regional Response. Pakistan Vision, 21(2),
Research Outlook 2020 | 189
132‐148. (Muhammad Usman Askari (DPSIR/SSSH) Abstract: China’s economic growth and military modernization have forced the US to shift its focus from the Middle‐East to the Asia‐Pacific region. The US Pivot to Asia Pacific policy aims to maintain the US hegemony by containing China in this region. This article is an attempt to gauge the responses of those regional countries which are having close economic and political relations with China and the US. It also tries to highlight the factors which increased the US military and diplomatic involvement in the region. This article tries to find the answer of research question that why the US has introduced Asia‐Pacific policy and how the regional countries have responded to it. As per the nature of the research, secondary sources have been used to complete this research. Three qualitative approaches such as historical, descriptive and exploratory within the broader framework of post positivist paradigm have been used to find the answer of the research question. This study is conducted under the lens of Hegemonic Stability Theory. This study concludes with the argument that regional countries have shown mixed reactions to the US policy and geo‐political competition is likely to grow between the US and China in future. Keywords: Asia‐Pacific, pivot, the rebalancing, the US, hegemonic stability theory.
13. Owais, M. (2020). India and Pakistan Strategic Influence in Afghanistan: Pros and Cons of Rivalry. Journal of Political Studies, 27(2), 167‐180. (Muhammad Owais (DPSIR/SSSH) Abstract: The geo‐strategic location of Afghanistan is one of the important factors in its destabilization in post‐ 9/11 era as it was in the late 1970s. The society of Afghanistan is composed of distinct ethnic groups supported by neighbouring states exacerbating instability to promote their interests. The regional powers always tried to influence this state to achieve their strategic objectives. India and Pakistan are involved in different activities to promote their divergent goals in this country for many decades. They supported contrasting regimes in Afghanistan to strengthen their influence and counter their historical rivalry like in other conflicts and institutions. So, far the strategies of both the countries are successful but their goals are counterproductive in bringing normalcy to Afghanistan. This research paper aimed to highlight the strategic battle between India and Pakistan in Afghanistan. The theory applied in this research is balance and power with formation of alliances. Afghanistan formed alliance with India in post‐9/11 era to outwit the influence of Pakistan. The results concluded from this study primarily entails that the directions of policies of these two rivals could be more productive if reconciliation is embraced instead of conflict. Keywords: Afghanistan, strategies, rivalry, alliances, interests.
14. Khalid, A., & Owais, M. (2020). Sino‐Indian Counter‐Balancing Strategies in the Indian Ocean: An Analysis. Journal of Indian Studies, 6(2), 249‐262. (Ayesha Khalid, Muhammad Owais (DPSIR/SSSH) Abstract: This research paper is an attempt to offer a detailed analysis of the growing Sino‐Indian strategic rivalry in the Indian Ocean. Indian Ocean is at the center of major geo‐political events unfolding in Asia due to its historical, political, security and economic significance. Various actors have converging and overlapping strategic interests in the IOR that generates competition among them. India wants to achieve the status of a regional hegemon. Likewise, China is focusing on enhancing its economic and military capabilities to become a world power. These competing powers are indulged in counter balancing against each other to consolidate their strategic hold in the region. In response to Chinese BRI, India has initiated “Act East Policy” along with increasing cooperation with its neighbors. This research has been conducted by employing qualitative research method. Secondary sources of data have taken from existing literature, journals and research articles. Main finding of this research is that both states are seemed to be indulged in a never‐ending competition which can be intensified in future. Therefore, they should increase coo peration in economic and maritime spheres to reduce the chances of clash between them. Keywords: Sino‐Indian Strategic Rivalry, Indian Ocean, BRI, Counter Balancing. Research Outlook 2020 | 190
15. Nadeem, S., Askari, M. U. (2020). Strategic Maritime Environment in Indian Ocean: Challenges and Opportunities for Pakistan. Journal of Politics and International Studies, 6(2), 203‐215. (Sheeza Nadeem, Muhammad Usman Askari (DPSIR/SSSH) Abstract: Pakistan naval forces are well organized and strong enough to maintain its defense and border security against any kind of naval aggression. The purpose of this essay is to describe all the possible challenges and opportunities faced by Pakistan in Indian Ocean. Moreover, there is a tripolar interest of US, China and India in the Ocean. The major interest of these states in Indian Ocean is due to its huge significance, immense natural assets, trade and world connectivity. Pakistan with the help of China, is going towards the stairs of success through Gwadar port, which can provide a gateway to Asian states and other world. No doubt, Pakistan’s navy is performing well and trying their best to deal with the situation in the Indian Ocean. Furthermore, chances of success and opportunities never have an ending point for anyone. So Pakistan should always further search these opportunities and utilize them in an appropriate manner. Keywords: Indian Ocean, Maritime, Pakistan, India, China, challenges, opportunities. Conference Paper 1. Qureshi, A. (2020). ‘Countering Extremism and Radicalization: The Role of Muslim Women Activists in Informing Ethno‐Religious Minority Policies in the UK'(2001‐2016). Paper presented at the 1st International Conference 2020 Advances and Challenges in Basic & Social Sciences in Contemporary Research under Higher Education Commission of Pakistan at Government Islamiyah College, Coper road, Lahore. February 12– 13, 2020. (Abeeda Qureshi (DPSIR/SSSH) Abstract: This article examines the role of Muslim women in the implementation of ethno‐religious minority policies in the UK from 2001‐2014. Using Muslim women as a case study, I aim to understand how this relationship works in practiceand whether the role played by Muslim women is symbolic or substantive.Also, I attempt to explore whether the engagement between the government and Muslim women has increased since 2010, with the change in the government from New Labour to the Coalition.Last but not least, the representative claims of the women involved in the policy process is examined to determine the legitimacy of the whole process. Specifying the ‘decentred’ theory of policy making, I employ a ‘hybrid’ approach to policy implementation and take further insight from ‘Saward’s (2006; 2009) ‘representation’ theory to answer the aforementioned questions.The theoretical framework helps meto justify thethree level analysis, e.g. national, local and individual case studies. Using evidence from the documentary analysis and in‐depth elite interviews, I highlight the positive role of non‐elected Muslim women in the implementation of policies towards the Muslim community. The particular importance of the thesis lies in the way I apply the ‘decentred’ government’ approach and the ‘hybrid’ model of policy implementation to appreciate how Muslim women and local actors can ‘twist’ national policy to suit local needs. The empirical findings on how women approached engagement through Prevent, and how local actors negotiated a ‘grey space’ to pursue more locally appropriate approaches, are both significant interventions in the wider debate on Prevent and its implications for Muslim women’s and state‐ Muslim engagement. Keywords: multiculturalism, integration, preventing violent extremism, radicalization, muslim women activists, policy debates. terrorism.
2. Sajjad, F. W. (2020). Lagging behind Others: Exploring Transformation of Muslims’ Educational Outlook in Modern Times. Paper presented at the Phiso2020 Exploratory Workshop: “Decolonizing Global Studies: Charting Trends, Mapping Trajectories”, 11‐ 12 September 2020. via Zoom. (Fatima Waqi Sajjad (DPSIR/SSSH) Abstract: In this paper, I explore how modern day Muslims’ educational outlook has been affected by colonial disruptions of the past and Coloniality of the present. Focusing on the case of colonial India and modern Pakistan, I explore how colonial intrusion of India dichotomized local Muslim education into two separate, divergent Research Outlook 2020 | 191
domains; religious and secular, a division that remains intact till date. When a contemporary Pakistani Muslim contemplates the purpose of education , he/she confronts two dominant discourses – secular education that advocates economic growth and catching up with the West as the ultimate purpose of education, and dominant religious discourses that advocate salvation in the hereafter as the ultimate goal of education. Through semi‐ structured interviews of university students in Pakistan (N ‐236) , I explore how students make sense of these divergent discourses. I find that students (from mainstream secular education background) tend to make a distinction between the purpose of life (which they associate with religion) and the purpose of education (which they associate with worldly pursuits). I argue that the outlook that sees a difference between the purpose of life and that of education undermines cultivation of self that can make a meaningful contribution to knowledge and/or society. Furthermore, I explore contemporary ideas and practices of knowledge contribution and question rampant epistemic hegemony of the West in the academic publication enterprise. I point out that the prevailing Coloniality of knowledge amplifies the disorientation of Muslims’ educational outlook and hence injury to modern Muslim self. Keywords: not available.
3. Sajjad, F. W. (2020). Colonial Disruptions and Educational Dilemmas of Modern Muslims: An Exploration of Educational Outlook of University Students in Pakistan. Paper presented at the 2020 Philippine Sociological Society Annual National Conference, 2‐9 October 2020. via Zoom. (Fatima Waqi Sajjad (DPSIR/SSSH) Abstract: not available. Keywords: not available.
4. Sajjad, F. W. (2020). Exploring White Ignorance and (In) Security through Subaltern Lens: The Case of Preventing Violent Extremism through Education. Paper presented at the 2020 Philippine Sociological Society Annual National Conference, 2‐9 October 2020. via Zoom. (Fatima Waqi Sajjad (DPSIR/SSSH) Abstract: not available. Keywords: not available.
5. Sajjad, F. W. (2020). Colonial Disruptions and Educational Dilemmas of Modern Muslims: An Exploration of the Educational Outlook of University Students in Pakistan. Paper presented at the Online International Conference Mapping South‐South Connections: Networks, Alliances and New Actors on the International Scene during the Decolonization Process and Cold War in Latin America, Asia and Africa (1810–1990), organized by Allameh Tabataba’i University (Iran) & Universidad Autónoma de Madrid (Spain) Tehran (Iran), 21–22 November 2020. (Fatima Waqi Sajjad (DPSIR/SSSH) Abstract: not available. Keywords: not available. Department of Sociology Research Articles 1. Malik, B., Lyndon, N., & Yew, V. W. (2020). Understanding the Relationship between Refugees and the Host Community Through Afghan Refugees' Lived Experiences in Pakistan. Asia‐Pacific Social Science Review, 20(1). (Beenish Malik (Sociology/SSSH) Abstract: With massive forced displacement, hosting refugees has become one of the leading concerns for developing countries like Pakistan. In the given context, this article is an attempt to unfold the nature of the relationship between the Afghan refugees and their Punjabi host community. To understand, describe, and interpret the essence of the refugees’ lived experiences, 31 adult Afghan refugee scavengers were involved in
Research Outlook 2020 | 192
this qualitative study through semi‐structured in‐depth interviews. The collected data revealed that while being in exile, the Afghans had formed new relationships with their hosts. These relationships were generally positive and reciprocal in nature. The Afghans confirmed the absence of discrimination and harassment from the hosts and highlighted both the monetary and nonmonetary help that they receive from the native residents at times. However, despite being in good terms, Afghan refugees reported restricted movements with the host community. The reasons were predominantly grounded in Afghan traditions of protecting the honor of the women and the privacy of the household by limiting the contact with native residents. It emphasizes the need to further enhance the interaction among refugees and hosts. Keywords: Afghan refugee, scavenger, lived experience, host community.
2. Jamil, M. F., & Sohail, T. (2020). Role of Socialization Patterns towards Adopting Rigid Sectarian Identities. Journal of Islamic Thought and Civilization (JITC), 10(1). Retrieved from https://journals.umt.edu.pk/index.php/JITC/article/view/651. (Muhammad Faizan Jamil, Tayyaba Sohail (Sociology/SSSH) Abstract: Religion is an essential part of individuals’ daily routine practices in the Pakistani society. People rigorously own and defend their particular religious beliefs in the extremely diversified population of the country. The induction of sectarian ideologies in the mindset of children begins with their early socialization. This process further develops with the passage of time and the mindset of children becomes extremely rigid. Sectarian rigidity advances the elements of disrespect and intolerance among the believers of adverse sectarian groups. This study was aimed to explain the role of socialization patterns (religious ideological orientation, cultural socialization and peer group pressure) in enhancing sectarian rigidity in the society. Survey research was conducted in two high ranking universities of Lahore (one government university and one private university). It was based on the responses collected from 250 participants who were selected through the application of simple ransom sampling technique. Two hypotheses were tested to evaluate the relationship and the predictive role of socialization patterns in enhancing the element of sectarian rigidity in individuals. The results of the current study revealed that there was a significant positive relationship between socialization patterns and sectarian rigidity after the application of Pearson product‐moment correlation test. Furthermore, the results computed through multilinear regression analysis showed a significant and positive predictive role of socialization patterns in enhancing sectarian rigidity. Thus, religious ideological orientation, cultural socialization and peer group pressure influenced the behavior of individuals that generate rigid sectarian identities in the society. Keywords: not available.
3. Hussain, B., Sheikh, A., Timmons, S., Stickley, T., & Repper, J. (2020). Workforce diversity, diversity training and ethnic minorities: The case of the UK National Health Service. International Journal of Cross Cultural Management, 20(2), 201‐221. doi: 10.1177/1470595820938412. (Basharat Hussain (Sociology/SSSH) Abstract: This research studied an NHS organization as a case to explore how it is responding to cross‐cultural issues against a backdrop of policy expectations about equitable and good quality mental health service provision to service users of a minority ethno‐cultural group in the UK. Data were collected by conducting semi‐structured interviews with 20 participants from three hierarchical levels of the organization. The research found that the concepts of culture and ethnicity are used in a fixed way in the interventions (staff diversity training and ethnic matching) taken by the case organization. It is argued that this fixed understanding of cultural concepts and related interventions may not be helpful in meeting the needs of service users, especially in the context of United Kingdom, which is characterized as a super‐diverse society. It appears that the interventions are developed and implemented on the conceptualization of cultural identity as generic and fixed. Organizations working in a multicultural society, or where they have service users from a variety of ethnic and cultural backgrounds, need to develop and implement interventions based on individualized and fluid understanding of such concepts. The Research Outlook 2020 | 193
findings of this study contribute to cross‐cultural management scholarship by taking a critical stance on the concept of culture, as it is operationalized by a large organization. We show how, even when required by national policy, this one‐dimensional model of culture causes human resource management interventions, intended to address cultural diversity, to be perceived as ineffective. Keywords: cross‐cultural issues, cultural identity, cultural diversity training, ethnic‐matching, mental healthcare, NHS. Department of Special Needs Education Research Articles 1. Thakur, I., Azeem, A., & Gilani, N.(2020). Internet Addiction, Shyness,and Self‐Esteem of Pakistani Youth. Sir Syed Journal of Education & Social Research, 3(3), 83‐89. (Asma Azeem (SNE/SSSH) Abstract: Internet addiction is the most rising tool of the present era.Undoubtedly, it has left a strong influenceon the mindsof youth. Like other parts of the world use of the internet is quite common in Pakistan. The present study aimedto investigate the relationship between internet addiction,shyness,and self‐esteem of Pakistani youth. 120 young students; male (n=60) females (n=60) wereselected through purposive sampling.The researchersexplored how excessive use of the internet brings problems and how all these problems reflect in their behavior.It highlighted how at this point, emerges the significance of self‐esteem and shyness. Internet Addiction Test (IAT) developed by Dr. Kimberly Young (1998),the collective self‐esteem scale (CSES) developed byRiia Luhtanen and Jennifer Crooker, 1992 and 1994,andShyness scale developed by Cheek & Melichor (1985) were used in the present study to measure internet addiction self‐esteem and shyness of Pakistani youth. The results of the study indicated that all study variables have a significant positive correlation with each other. It is found that female students have significantly higher scores on shyness as compared to male students and students of private institutes have significantly higher scores on internet addiction thanstudents of public institutes.Oneof the reasons may be that students of private institutes have more easy accessto the internet as compared to public students. The present study indicated that master’s level students have significantly higher scores on private collective self‐esteem and shyness as compared to bachelor’s students. Keywords: internet addiction, self‐esteem, shyness, Pakistani youth.
2. Waqar, Y. W., Faiz, Z., Nouman, A. (2020). Satisfaction Level of Secondary School Teachers for Religious Education. Journal of Research in Psychology (JRP). 2(1). 10‐13. https://doi.org/10.31580/jrp.v2i1.1172. (Zikra Faiz, Asmaa Nouman (SNE/SSSH) Abstract: Religious education is the term given to the kind of education which is concerned with spiritual mindedness and religious conscience. This study aimed to investigate the level of satisfaction of teachers about religious education at secondary level. The study shows that the foundation of education in Islam is guided by the principles of Quran and Hadith (the saying and deeds of Prophet Muhammad) (PBUH). Thepresent study was descriptive in nature; cross‐sectional survey method was used to collect data from participants through questionnaire. The sample comprised of three hundred teachers from secondary schools selected through non‐ proportionate stratified random sampling technique. Questionnaire was developed by the researchers. Validity of the tool was assured from the experts and the Cronbach’s alpha was 0.87. For the purpose of analysis descriptive and inferential statistical techniques were applied. It was found that teachers were satisfied from the curriculum of religious education. According to the respondents curriculum of religious education is old and same topics with similar description are repeating every year. There is not interesting and innovative style to teach. It is depicted that there was no significant difference between male and female secondary school teachers’ level of satisfaction regarding religious education at secondary level. It is suggested that curriculum should be revised and more information about religion should be added in the textbooks issued by Punjab Textbook Board.
Research Outlook 2020 | 194
Keywords: secondary schools, religious education, satisfaction, teacher’s perception, curriculum. Department of Education Research Articles 1. Arif, S., Asghar, Z., & Mukhtar, S.(2020). Interactive effect of school principals’ leadership styles and teacher characteristics on curriculum implementation at public secondary schools of Punjab. UMT Education Review, 3(1), 95–119. (Seema Arif (Education/SSSH) UMT JOURNAL Abstract: The research was conducted in the positivist paradigm to determine the interactive effect of school principals' leadership style and the teaching characteristics (traditional Vs. Progressive) of school teachers on curriculum implementation. The research further explores how teaching characteristics mediate between school principals' leadership style and curriculum implementation. Higher secondary school teachers' perceptions were collected from 600 teachers teaching at secondary schools in six districts of Punjab. Multistage sampling was used to draw a sample from a large and diverse population. Descriptive and inferential statistics were used to determine the relationship among various constructs leadership styles, teacher characteristics, and strategies used for the curriculum implementation at secondary schools of Punjab. Path analysis using Structure Equation Modeling with AMOS yielded unique relationships among leadership styles of school principals and teacher characteristics for curriculum implementation. Democratic style of school principals was found to exert maximum direct influence on curriculum implementation with no teacher characteristics mediation. However, it is found that both teacher characteristics play a significant mediating role in curriculum implementation; the visionary style was best mediated through progressive characteristics, and 2) commanding style was mediated through traditional characteristics. The research draws attention to existing gaps in developing teacher expertise for curriculum implementation, which need to be addressed to prepare future teacher leadership in Pakistan. Keywords: curriculum implementation, progressive teaching, secondary school principals, traditional teaching.
2. Khokhar, A. J., & Muhammad, Y. (2020). Islamic Habitus in English Language Textbooks Produced by Boards in Pakistan. Journal of Islamic Thought and Civilization (JITC), 10(1). Retrieved from https://journals.umt.edu.pk/index.php/JITC/article/view/653. (Ashar Johnson Khokhar, Yaar Muhammad (Education/SSSH) Abstract: The textbook is an important and powerful tool used by the state to reproduce the social and cultural habits of a group, most often, of the majority group’s social and cultural imaginations. The habitus produces and instills the world‐view about society, the social and cultural values that a state valorized and would like pupils to internalize and make it part of their world‐view. This study analyzes the English textbook published by the state textbook boards (Punjab, Khyber Pakhtunkhwa, and Sindh) for the academic year 2018‐2019 for pupils of classes four to eight. The textbook content was analyzed using the Qualitative Content Analysis method. The content of 15 textbooks was digitized (scanned and made readable) to electronically categorized the text into categories using Nvivo 12 Plus software. The analysis revealed that the content is focused on developing and promoting Islamic habitus through stories weaved around family, making it a core component of a Muslim country. The family members practiced Islamic values, social and cultural, not only through their everyday lives at home, in school, and at other public places but also within their community through the celebration of cultural and religious festivals. The textbooks presented the Prophet Muhammad (PBUH) and his family’s life as an ideal life to be lead by all, whether Muslims or non‐Muslims. The textbook highlighted the ‘good,’ the ‘bad,’ valorizing the former and stigmatizing the latter to encourage pupils to develop an Islamic world‐view. The textbooks fail to look into the micro‐level national habitus, that is, portraying the habitus of its minorities, ethnic and religious, as the content did not integrate their habitus into the national habitus of Pakistan, making it the habitus of the
Research Outlook 2020 | 195
majority. The current fast globalizing world needed to be presented to pupils a world‐view, and this required, broadening the scope of textbook content to make it reflective of true Pakistani habitus aligned and rooted in the humane global world‐view. Keywords: not available.
3. Nadeem, M., Arif, S., & Naeem, M. (2020). The Role of Principals and Administrators in Performance Appraisal of School Teachers in Punjab. Sir Syed journal of Education and Social Research (sjesr), 3(2), 132‐ 142. doi: https://doi.org/10.36902/sjesr‐vol3‐iss2‐2020(132‐142). (Muhammad Nadeem, Seema Arif (Education/SSSH) Abstract: Qualitative research was conducted in the interpretive paradigm using phenomenology as an approach to check the execution of the performance appraisal system (PAS) at higher secondary schools in Punjab. The population of the study consisted of key stakeholders of appraisal, higher secondary school principals, teachers, and district administration. 6 out of 36 districts were selected from school district rankings, each falling in poor, good, and average criterion. Participants of one district served as a pilot and the rest for the main study. A total of 35 participants were selected from five districts purposively; a selection criterion was used to select a set of one administrator, one principal and five teachers from each of the five districts. After obtaining consent from the participants, structured interviews were conducted with the school principals and district administrators, while the focus group was held with the teachers of each district using self‐constructed interview protocols. Thematic analysis was performed on data obtained from different sources. Seven themes emerged during analysis reflected that the principals and teachers have enough knowledge and experience to conduct the PAS. It is a positive activity that must be continued; however, the procedure needs improvement. PAS should be planned and conducted with the consultation of teachers, motivating them for further improvement. Keywords: performance appraisal, stakeholders, satisfaction, dissatisfaction, professional development.
4. Latif, M. Z., Hussain, I., Khan, R. A., Mehboob, U., Nizami, R., & Ali, S. (2020). Use of social media for medical education; perspective of medical faculty from Sialkot, Pakistan. Journal Of Medical Sciences, 28(2), 171‐ 175. (Rahila Nizami (Education/SSSH) Abstract: Objective: To study the perspective of faculty members about the use of social media in medical education. Material and Methods: Across sectional descriptive study was conducted among the faculty of three medical colleges from Sialkot. After ethical approval and informed consent, a structured, pretested questionnaire was used for data collection. Data was entered in IBM SPSS version 23 and analyzed by the use of statistical tools. Results: Out of the total of 123 participants of this study, 65 (52.8%) were males and 58 (47.2%) were females. Mean age of the males was 41.43±10.91years and females were of 32.84±7.83years.Faculty members’ use of Social Media in teaching was more in private colleges than public college (P‐value 0.018). Benefits score was higher in private institution (p‐value 0.300). Barriers score was higher in public institutions but difference was not statistically significant (p‐value 0.638).Use of social media score was higher in females but the difference was not statistically significant (p‐value 0.965). Conclusion: Majority of the medical faculty in private sector use social media for education whereas the public‐sector faculty is also engaged in the process of education through social media tools. Keywords: social media, medical, faculty, education, smart phones, students.
5. Shakir, M., Nadeem, T., Gul, F., & Khan, M. M. A. (2020). Evaluation of Secondary School Teachers’ Pedagogical Practices Associated with National Professional Standards for Teachers (NPSTs). Al‐Qalam, 25(1), 649‐656. (Fariha Gul (Education/SSSH) Abstract: The major purpose of conducting this research study was to gauge secondary school teachers' pedagogical practices according to the rubrics and competencies defined in the National Professional Standards
Research Outlook 2020 | 196
for Teachers (NPSTs) document. The main objectives of the study were (a) to study the current status of teachers' pedagogical practices in Punjab (b) to gauge secondary school teachers’ pedagogical practices through rubrics associated with NPSTs and (c) to recommend certain measure for the betterment of teacher pedagogical practices in the classroom. This observational study was descriptive type research which was conducted in a real setting. 453 secondary school teachers from the province of Punjab were selected through multi‐stage sampling techniques. An observation checklist with defined rubrics was developed. Based on the analysis of data, it was observed that very few of the secondary school teachers had attained the level the competence in using different pedagogies while different subjects. Most of the secondary school teachers were teaching subjects with the same teaching methods and were fall under the category of emerging teachers. Keywords: pedagogical practices, professional standards, teaching quality and assessment.
6. Gul, F., Yousaf, A., Masood, S. (2020). Information skill teaching through experiential learning: a requisite for praxis oriented self‐regulated learning. Hamdard Islamicus, 43(2), 1622‐1629. (Fariha Gul, Amna Yousaf, Sajid Masood (Education/SSSH) Abstract: The information skill is considered important for prospective teachers as it influence on current learning process as well as future job prospects. Though many research studies are conducted to explore level of information skills of students, however, there is dearth of empirical evidences on skill level of prospective teachers. This study aims to examine the level of information skill of prospective teachers and influence of level of study and difference in level of information skill on the basis of gender. The data was collected from four hundredstudents of six universities(publicand private) through Information literacy skills continuum. The value of Cronbachalpha was .79. The results gained through descriptive level indicate moderate level of information skill among postgraduate students, while there was no difference on the basis of level of study or gender on score of information skill’s score. The results are in consistent with previous results and lead towards future research with wider sample and diverse socio‐biographic variables including previous training. Keywords: Information literacy, prospective teachers.
7. Abid, N., & Akhtar, M. (2020). Relationship between Academic Engagement and Academic Achievement: An Empirical Evidence of Secondary School Students. Journal of Educational Research, 23(1), 48‐61. (Mumtaz Akhtar (Education/SSSH) Abstract: The quantitative correlational study was designed to examine relationship of academic engagement and achievement of students. 800 students of 10th grade participated in this study that were randomly chosen from 20 high schools of district Lahore. Students’ academic engagement was measured by administrating Academic Engagement Scale (AES) whereas academic achievement was their scores that they achieved in final exams of 9th grade. Multiple statistical data analysis techniques i.e. mean, standard deviation, independent sample t‐test, ANOVA, and Pearson r were applied. Results exhibited that learners have competent level in engagement while difference in students’ perception regarding academic engagement of girls and boys is significant. Students’ father qualification has significant influence while mother qualification has no significant influence on their perceptions about academic engagement. Results also demonstrated that there is a weak as well as negative correlation in students’ academic engagement and their achievement as r = ‐.088 (p>0.01). Thus, academic engagements have indirect influence on students’ achievement. It is recommended that policy makers, teachers, and the researchers pay attention to individual learner’s academic engagement because it influences on their achievement. Keywords: academic engagement, academic involvement, academic commitment, academic achievement.
Research Outlook 2020 | 197
8. Shoaib, A., & Akhtar, M. (2020). Teachers’ Epistemological Beliefs and Instructional Practices: A Panorama of Mathematics Classroom. International Review of Social Sciences (IRSS), 8(11), 317‐334. (Mumtaz Akhtar (Education/SSSH) Abstract: The purpose of the study was to explore the teachers’ epistemological beliefs regarding the Mathematics curriculum and their reflection in classroom practices. The explanatory sequential design of the mixed‐method approach was adopted. The sample was selected from public sector secondary schools of Lahore District by using a multi‐level sequential mixed sampling design. For the quantitative phase, the sample was selected at two levels. At the first level, 50 secondary schools were selected through a proportionate stratified cluster random sampling technique. Subsequently, 250 teachers were selected through a simple random sampling technique from the selected school. While in the qualitative phase, the researchers observed 35 secondary school teachers’ epistemological beliefs about the Mathematics curriculum that reflect through their classroom practices. Two research instruments (i.e. questionnaire for teachers’ epistemological beliefs and observation protocol) were used to explore the teachers’ epistemological beliefs regarding the Mathematics curriculum and their classroom practices. The quantitative data were analyzed through descriptive and inferential statistics. However, the qualitative data were analyzed through the qualitative descriptive analysis technique. The researchers found that teachers have sophisticated (strong) beliefs in the dimension of the certainty of knowledge as compare to other dimensions of epistemological beliefs. Moreover, teachers played as an omniscient authority as the source of Mathematical knowledge which was reflected in their classroom practices. Keywords: epistemological beliefs, mathematics curriculum, classroom practices.
9. Bibi, S., & Akhter, M. (2020). A Study to Assess Critical Thinking Skills among Prospective Teachers. Pakistan Social Sciences Review, 4(IV), 134‐143. (Mumtaz Akhtar (Education/SSSH) Abstract: The presents study was designed to assess the development of critical thinking skills among prospective teachers. Prospective teachers of three universities of Lahore offering teacher training program constituted the population of the study. The subjects of the study were only those students who were nearly to complete their Master’s degree. A sample of 160 students (University 1= 100 students, University 2= 40 students and University 3=20 students) was selected through stratified random sampling technique. A standardized test, “Watson‐Glaser Critical Thinking Test” specially designed to examine critical thinking of graduate students, was administered as achievement test. The test is further categorized into 5 sub‐sets. The analysis of results indicated that majority of the students (75%) scored less than 50 % marks in the test. Further the students performed worst in the sub‐ skills; inference, assumption, deduction, and analyzing arguments. Participants performed comparatively better in the sub‐skill “interpreting information”. The present situation, in the light of the results of this study, is alarming for teacher education programs. It was concluded that teacher education program, under study, was not performing effectively for the critical thinking development. It is recommended to the teacher educators and curriculum developers to take practical actions to improve the existing situation. Keywords: critical thinking skills, prospective teachers.
10. Kouser, T., & Akhter, M. (2020). Opinion of the Graduates Teaching in Pre‐Schools about Effectiveness of MA Early Childhood Education Program. Bulletin of Education and Research, 42(2), 1‐14. (Mumtaz Akhtar (Education/SSSH) Abstract: This paper draws on a larger study conducted to examine the Effectiveness of the MA ECE program at the Institute of Education and Research, University of the Punjab. Various aspects of the teacher education program were examined regarding their effectiveness as a preparation for teaching. Three sessions of focus group discussions were conducted with program graduates who had embarked on teaching careers. Twelve graduates of the program were identified for participation in the focus groups by snowball sampling. It was the
Research Outlook 2020 | 198
experience of the focus group participants that the program was focused more on theory and provided fewer opportunities for putting this into practice. Pre‐school education is mostly provided by the private sector. Consequently, job opportunities for ECE teachers are mainly in the private sector. At the time of the study, IER did not collaborate with the private sector to prepare teachers according to private sector demands. It was suggested that a four year, concurrent program for professional training would better equip prospective teachers with the knowledge, skills and attitude they require to teach at ECE level rather than a two year, consecutive program, as the current MA is. The concurrent program would prepare effective teachers by providing them practice opportunities for their theoretical knowledge and by developing a strong relationship with ECE settings, including private sector ones. Further research to assess the knowledge and skills requirements of prospective ECE teachers is required. Keywords: early childhood education, student experience, concurrent or consecutive provision.
11. Shoaib, A., & Akhter, M. (2020). Diagnosing High School Students’ Mathematics Misconceptions. International Review of Social Sciences (IRSS), 8(12), 339‐385. (Mumtaz Akhtar (Education/SSSH) Abstract: The study was designed to diagnose high school students‟ Mathematics misconceptions through a descriptive survey. The 1500 students from 50 high schools of Lahore were selected by using a two‐stage cluster random sampling technique. The misconceptions two‐tiered test was developed after reviewing the literature and textbooks which cover various topics of Mathematics i.e. real and complex numbers, linear equations and inequalities, algebraic expressions and formula (surds), quadratic equations, algebraic manipulation, variation (ratio), sets and functions. The data were analyzed through item wise content analysis technique. It is concluded from the results that high school students have numerous misconceptions in the content of Mathematics. Students were memorized properties and shortcuts to work with Mathematics problems. Correspondingly, they were unable to write the reasons. It is recommended from the results that textbook of Mathematics at the secondary level may be revised by experts keeping in mind that the content like LCM, HCF, sets and functions, inequality, radicals (surds), factorizations and complex numbers, etc. given in textbooks should help students to remove their misconception instead of leading to misconception. Keywords: complex numbers, HCF, LCM, mathematics misconceptions, high school students.
12. Gul, F., Yousaf, A., & Masood, S., Naheed, F. (2020). Perceived Satisfaction of Teachers about Practices of Leaders of Religious Institutes to Promote Peace Education. Journal of Islamic Thought and Civilization, 10(2) 268‐289. (Fariha Gul, Amna Yousaf, Sajid Masood, Fauzia Naheed (Education/SSSH) Abstract: Practices of the leaders of religious institutes are fundamental in promoting peace education as their practices leave an immense impact not only on the perceptions and practices of teachers but also of the students regarding peace education. The beliefs, interests, inclinations, moral values, and competency of institutional leaders are reflected in policies they make and are presented in the practices of teachers. Owing to the importance of their practices aimed to promote peace education, there is a need to identify the extent of these practices as they are perceived by direct stakeholders, that is, teachers, which makes the aim of the current study. This research is a quantitative survey‐based research. The population of this research includes the teachers of religious education institutes of Lahore. Cluster sampling method was used for the selection of sample. Data was collected from the teachers teaching to final year students and a total of 292 teachers participated in the study. A self‐developed instrument was used to collect data. The instrument was based on the factors of peace education and practices used to promote them from the literature. The instrument was pilot tested and the validity and reliability of the instrument was established that was 0.87. The data was analyzed using descriptive and inferential statistics. The results indicated that teachers were satisfied with the practices of the leaders of religious institutes aimed to promote peace education. This study may help the academicians, practitioners, and policymakers to promote peace education in all schools of Pakistan. Research Outlook 2020 | 199
Keywords: peace education, perceived satisfaction, religious institutes.
13. Arif, S., Nadeem, M., & Khaliq, F. (2020). Factors Affecting the Satisfaction of School Teachers with Performance Appraisal System in Punjab. Research Journal of Social Sciences & Economics Review, 1(3), 1‐ 11. (Seema Arif (Education/SSSH) Abstract: Performance Appraisal System (PAS) is the tool the education department of Pakistan uses to evaluate the performance of teachers. Survey research was conducted to determine the satisfaction level of public‐school teachers with conduction and outcomes of PAS. The correlational research design was planned to determine the perceptions of the teachers about their competencies in areas evaluated by PAS and its outcomes. A multistage random sampling technique was used to access the target sample of 900 higher secondary school teachers from 12 out of 36 districts of Punjab. Since it was a pioneer study, a self‐constructed questionnaire was used for the survey piloted on two out of 12 selected districts. The questionnaire was distributed among 1200 teachers; 960 were retrieved, and 900 were tabulated and recorded on SPSS 21 for the final analysis. Both descriptive and inferential statistics were applied. After ensuring reliability, the items were factorized using the exploratory factor analysis technique yielding six factors. Pearson Correlation was conducted to determine the strength of the relationship among the variables, while multiple linear regressions using the stepwise method were conducted to get informed with the critical risk factors associated with the satisfaction of teachers with the conduction of PAS. The results reveal a highly complex situation faced by school teachers; though teachers have displayed complete knowledge about the conduction of the PAS process and its consequences, yet, not only the teachers seem deficient in the needed skills; they also lack motivation for self‐development. Keywords: correlational research, performance appraisal system, secondary school teachers, satisfaction.
14. Omar, M. I., & Arif, S. (2020). From Epistemological Pedagogical Access to Student Success: New Framework for Studying Access to Higher Education. Research Journal of Social Sciences & Economics Review, 1(3), 45‐55. (Seema Arif (Education/SSSH) Abstract: Research related to access to higher education is often criticized for lacking a strong theoretical ground, arguing it is limited to seek information regarding the quality of infrastructure or teaching and learning. This study, however, seeks to draw a model for meaningful access to higher education regarding epistemic quality. For this purpose, the relationship between factors influencing pedagogical access (Teacher Pedagogic Quality, Teaching Learning Environment, and Teacherstudent Relationship) and factors leading to student success (student satisfaction and student engagement) is assessed. The researchers assume that meaningful and purposeful access is created for a diverse population entering higher education only by providing 'epistemological‐pedagogical access,' ensuring student success. The study was quantitative, and correlational research design was used following the positivist paradigm. The researcher used a multi‐stage sampling technique, to approach the target sample of 400 students studying in universities of Lahore (one public and one private). a close‐ended questionnaire was self‐constructed for the data collection, and advanced statistical techniques Pearson Correlations, and multiple regressions were applied using SPSS. The study concludes a model of epistemological‐pedagogical access leading to success for the university students of Pakistan. Furthermore, this pilot study results also share the predictive value of pedagogical access to ensure student success., yet, not only the teachers seem deficient in the needed skills; they also lack motivation for self‐development. Keywords: epistemological ‐ pedagogical access, student success, student ‐ teacher relationships, teacher pedagogic quality, teaching, and learning environment.
15. Nadeem, M., Arif, S., & Asghar, M. Z. (2020). Development and Validation of Performance Appraisal Scale (PAS‐HSSTs) for Higher Secondary School Teachers. Sir Syed Journal of Education & Social Research, 3(3), 105‐116. (Seema Arif, Muhammad Zaheer Asghar (Education/SSSH) Research Outlook 2020 | 200
Abstract: A study was conducted to develop the research instrument for evaluating the Performance Appraisal System (PAS) at public higher secondary schools in Punjab. Data werecollected from the three divisions total (N=900) male and female teachers of public schoolsusing a multi‐stage sampling technique. The questionnaire was founded onthe factors elaborated inthe Performance Evaluation Report (PER), National Professional Standards (NPS) for teachers. This scale is extended to evaluate the satisfaction of the teachers with the performance appraisal process. The factors taken from PER areclassroom management, quality of teaching, motivation, teamwork,and punctuality, whereas Awareness, Satisfaction with PAS, Dissatisfaction with PAS, and Need for Improvement were added by the researchers to evaluate the PAS process. Performance Appraisal Scale for higher secondary school teachers (PAS‐HSSTs) contained 57 items. The experts'opinion was sought to check for content validity, and apilot study was performed with 300 teachers from public higher secondary schools. The reliability coefficient (Cronbach alpha) of the instrument was.866 for the pilot and .883for final data. Structure Equation Modelling(SEM) was used for the validation of the instrument (PAS‐ HSSTs)using Confirmatory Factor Analysis (CFA). Thefactor loadingsof all items used in the scale were well above the threshold value 0.35. The SEM resultsindicated that Fit indices for PAS resulted inan acceptable model fit. Keywords: Performance Appraisal, SEM Analysis, Awareness, Satisfaction with PAS, Dissatisfaction with PAS, Improvement Needs of PAS.
16. Shoaib, A., Akhtar, M., & Naheed, F. (2020). Epistemological Beliefs Regarding Mathematics Curriculum and Students’ Academic Achievement. Journal of Educational Sciences & Research, 7(2), 196‐226. (Mumtaz Akhtar, Fauzia Naheed (Education/SSSH) Abstract: Epistemological beliefs about Mathematics are associated with students’ cognitive performances and effective responses. This study aims to investigate the epistemological beliefs of students about the Mathematics curriculum and their relationship with academic achievement. In this study, a quantitative research approach through the correlational method was used. 600 students from 20 public secondary schools of the Lahore District were selected through two‐stage random sampling. Conceptions of Mathematics Inventory were adapted after ensuring its validity and reliability in our local context. The reliability of the inventory was α = 0.917. It was found that secondary school students had sophisticated epistemological beliefs about Mathematics curriculum beliefs about formulas; which are significant in Mathematics as they represent useful ideas and are based on the certainty of knowledge. Moreover, students’ epistemological beliefs were positively correlated with their Mathematics academic achievements. It is recommended that teachers may try to recognize the Mathematics epistemological beliefs of students as they commence a new session of classes and take care of appropriate instructions that enhance students’ Mathematics epistemological beliefs. Keywords: Academic Achievements, Epistemological Beliefs, Mathematics, Secondary School Students.
17. Ali, M. J., & Hameed, A. (2020). Development of Students’ Learning Outcomes Based Standardized Achievement Test of Mathematics. Pakistan Social Sciences Review. 4(1). 389‐402. (Muhammad Jafar Ali, Abdul Hameed (Education/SSSH) Abstract: The present study was undertaken to promote a research on standardization of tests items for testing learning outcome in the subject of Mathematics at secondary level. An item bank consisting of 140 dichotomous items was developed using modern test theory‐Item Response Theory (IRT). Each item was aligned, on the basis of Blooms’ taxonomy, with a unique students’ learning outcome SLO of National Curriculum for 9th Grade Mathematics. Three Item’s booklets were piloted over 960 students from four strata male, Female, rural and urban. Pilot data was analyzed using Classical Test Theory (CTT) and Item Response Theory (IRT) based software and sixty items were selected for final test based on item difficulty and discrimination indexes. Total 320 students were participated from 09 districts of the Punjab and four strata—male, Female, rural and urban. Data was Research Outlook 2020 | 201
analyzed by using SPSS, Conquest, and Multilog software. IRT based person item map showed the test item covered ‐3 to +3 range of abilities. Test characteristics and item characteristics curves and factor analysis supported the reliability and validity of the test. It explored that Math achievement test is appropriately constructed. One may replicate this study by using 2PLM and 3PLM of Item Response Theory (IRT) models. Keywords: Standardized, Mathematics, Achievement test, Learning Outcomes, Classical Test Theory (CTT), Item Response Theory (IRT), Rash Model.
18. Hameed, A., Manzoor, A., & Minhas, K. (2020). Discerns of Special Education Teachers about Access and Equity in Schools. Journal of Educational Research. 23(2). 73‐82. (Abdul Hameed (Education/SSSH) Abstract: Majority of children with disabilities are enrolled in special schools under a segregated learning environment. This marginalization hampers the learning process in two ways: first; providing substandard curricular learning activities and second; standardized and uniform instructional approach does not leave room to address the diversified needs of the students with disabilities. As a result, the students remain deprived from a pedagogy that can rightly trigger their learning process. The compromised assessment system further down plays the student achievements. The main objectives of this study were to identify special education teachers’ perceptions about inequitable learning opportunities in special education schools, explore the most salient factors affecting the equitable opportunities on student’s learning and to propose measures to reduce learning inequities. Quantitative study method was used to collect data from 67 special education teachers working in government special schools in four districts i.e. Lahore, Sheikhupura, Kasur and Nankanasahib through convenient sampling procedure. An instrument was designed on 4 dimensions of equitable learning reported by classroom teachers. Teachers in special education were found sensitive enough to recognize the inequitable learning experiences in schools. Findings of the study revealed that inequity reported by teachers existed in all areas i.e. policy, infrastructure, curriculum & instruction and transition, however, analysis of variance shows that teachers of three disabilities; hearing impairment, visual impairment and physical impairment feel more inequities in education. Keywords: Inequalities, inclusion, children with disabilities, equitable learning.
19. Hameed, A., Qurrat‐ul‐Ain. (2020). Challenges Faced by Higher Education Institutions in Including Students with Hearing Impairment. Journal of Inclusive Education. 4(1). 13‐28. (Abdul Hameed, Qurrat‐ul‐Ain (Education/SSSH) Abstract: Inclusion at higher education is a recent initiative of Higher Education Commission, Pakistan. Students with hearing impairment and students with visual impairment are welcomed by several HEIs in Punjab. However, the case of students with hearing impairment emerged as very challenging because of limited communication between teacher and taught and ill preparedness of HEIs to accommodate these students. Several studies indicated that students with hearing impairment face multiple problems such as getting admission support, diversified learning, social adjustment and modified assessment procedures. Similarly, there are very few opportunities available for higher education to students with hearing impairment in limited number of institutes. This study was conducted to identify the various types of problems faced by students with hearing impairment in HEIs. For this purpose, survey method was used to collect data from 48 teachers and 246 students with hearing impairment studying in 10 different higher education institutes of Punjab. All teachers and students were included in the sample. Findings of study indicate that students with hearing impairment enrolled in various programs i.e. B.A, B.S, M.A and M.Phil. are facing problem in academics such as reading, writing, availability of interpreter, lack of adaptive study material, and inappropriate assessment system. Keywords: higher education, quality education, academic problems, students with hearing impairment.
Research Outlook 2020 | 202
20. Jamil, M., Muhammad, Y., Masood, S., & Habib, Z. (2020). Critical Thinking: A Qualitative Content Analysis of Education Policy and Secondary School Science Curriculum Documents. Journal of Research and Reflections in Education. 14 (2). 249‐258. (Muhammad Jamil, Yaar Muhammad, Sajid Masood (Education/SSSH) Abstract: Critical thinking is one of the twenty‐first‐century skills and an essential aspect of formal education. The current study aimed to analyze the education policy documents to get an understanding of policy recommendations for developing critical thinking in secondary school students. The education policy document—National Education Policy and National Curriculum documents for Physics, Chemistry, and Biology, Grades IX‐X were analyzed. These documents were analyzed through qualitative content analysis with the facilitation of NVivo 11. Findings suggested that the focus of these documents was to develop critical thinking through student‐centered techniques and assessment system. The National Education Policy document aimed to produce critical thinkers, and for this purpose, much significance was given to curriculum and assessment processes. The National Curriculum for Physics, Chemistry, and Biology emphasized activity‐based, conceptual, and critical thinking pedagogy. Students’ engagement, problem‐solving, questioning, discussions, debates, group work, cooperative learning strategies were recommended to produce critical thinkers for the twenty‐first century. The documents also accentuated that the assessment system should also be focused on developing critical thinking by assessing higher‐order abilities among secondary school students. The findings of the current study have strong implications for science teachers in their teaching at the secondary level. Keywords: critical thinking, science education, pedagogy, policy documents, secondary level.
21. Saleem, A., Muhammad, Y., & Masood, S. (2020). Classroom Management Challenges and Administrative Support in Elementary Schools: Experiences of Novice Public‐School Teachers. UMT Education Review, 3(2), 29‐46. (Yaar Muhammad, Sajid Masood (Education/SSSH) UMT JOURNAL Abstract: The purpose of this study was to explore classroom management challenges that novice teachers experienced in their early years of profession. Moreover, this study explored the administrative support novice teachers received from school administration concerning classroom management. We drew on interview data to explore novice teachers' experiences who had less than three years of experience during their first job in public elementary schools. The data were collected through semi‐structured interviews with a purposive sample of ten novice teachers. Thematic analysis was used to analyze the experiences of novice teachers. The analysis came up with four themes: Responsive administration, helping hands, struggling with workload, and supportive principal.The study's findings revealed that most of the teachers faced over‐crowded classes and a high workload in their initial time. Most of the teachers had received support from the administration; however, the administration was helpless regarding many challenges that the novice teachers faced in their early years. Many administrators did not help the novice teachers’ deal with over‐crowded classrooms, the extra workload in the form of periods per week, and the management of students' behaviors. Keywords: administrative support, classroom management challenges, elementary public‐ schools, novice teachers.
22. Naseer, H., Muhammad, Y., & Masood, S. (2020). Developing Reflective Practices of Elementary School Teachers: A Collaborative Action Research Study. Research Journal of Social Sciences and Economics Review (RJSSER), 1(4), 22‐33. (Hadiya Naseer, Yaar Muhammad, Sajid Masood (Education/SSSH) Abstract: The purpose of this study was to investigate the development of reflective practices of elementary school teachers through interactive workshops. This study used a collaborative action research design, and five‐day interactive workshop sessions related to reflective practices conducted to introducethe participants to reflective practices. Most specifically, these workshops focused on building their cognition, affection, and behavior about reflective practices. The Purposive sampling technique was used to select 20 elementary school teachers with at least 1.5 years’ experience in elementary school. After the workshop,
Research Outlook 2020 | 203
participants spend two months of reflective teaching practices. Then, interviews with the participants were conducted, and data were collected until saturation occurred. The analysis of the data revealed that the teachers developed positive beliefs and feelings towards reflective practices, but they lacked in some areas of practice because of the school environment. Implications of the findings are also discussed. Keywords: Reflective Practice, Positive Attitude, Cognition, Affect, Behavior, Classroom Practice, Interactive Workshop.
23. Naseer, H., Muhammad, Y., & Masood, S. (2020). Critical Thinking Skills in a Secondary School Pakistan Studies Textbook: A Qualitative Content Analysis. Sir Syed Journal of Education & Social Research. 3(4), 84‐95. (Hamna Naseer, Yaar Muhammad, Sajid Masood (Education/SSSH) Abstract: The purpose of this study was to examine the critical thinking skills incorporated in text‐based questions and tasks in the Pakistan Studies textbooks of secondarylevel. The Pakistan Studies textbook produced by the Punjab Textbook Board for ninth wasanalyzedusingqualitative content analysis based on cognitive domains derived from six levels of revised Bloom's taxonomy. Moreover, the text‐based questions were then analyzed by categorizing them under the nine pre‐determined analytic categories of Socratic taxonomy. These categories depicted the questions that challenge the critical thinking skills of learners.The findings revealed that the text‐based question incorporated in the selected textbook of Pakistan Studies wasnot conducive to developing critical thinking skills among students. Except for one question, none of the questions fell under higher‐order thinking levels of revised Bloom's taxonomy. Furthermore, based on analytic categories, text‐based questions showed a little inclination towards the questions of clarification, whereas none represented other categories. Therefore, textbookdevelopers need to focus on the induction of critical thinking skills in the text‐based questions and tasks of textbooks. Keywords: Pakistan Studies, Critical Thinking, Secondary School, Qualitative Content Analysis, Textbook Analysis.
24. Muhammad, Y., Masood, S., & Anis, F. (2020). The Influence of a Five‐Day Adventure‐based Experience on International Students’ Perceptions of Self‐Effectiveness: A Case Study. Pakistan Social Sciences Review. 4(1). 776‐ 792. (Yaar Muhammad, Sajid Masood, Faisal Anis (Education/SSSH) Abstract: The purpose of this study was to investigate the influence of a five‐day adventure‐based experience on international students’ perceptions of life effectiveness and to determine the perceived changes qualitatively in the eight dimensions of life effectiveness. This study used a case study research design and examined the perceptions and experiences of sixteen students of Master’s in Outdoor Education at a Swedish university. Participants were interviewed after two weeks. After approximately one and a half months, two focus groups were conducted with the participants. The study concluded that a five‐day adventure‐based experience had little effect on international students’ self‐perceptions of personal capabilities and qualities. The factors identified were poor planning and the presence of already skillful and self‐efficacious persons and multicultural groups. However, it was identified that cultural factors might have contributed to some of the international students’ perceptions of their self‐effectiveness. Cultural identities may have worked as a powerful filter through which the adventure‐based experience was interpreted. Keywords: adventure, case study, international students, life effectiveness, perceptions.
25. Saleem, A., Muhammad, Y., & Masood, S. (2020). Support needs of novice public‐school teachers for effective management of elementary level classrooms in Lahore. Pakistan Social Sciences Review, 4(3). 682‐697. (Ayesha Saleem, Yaar Muhammad, Sajid Masood (Education/SSSH) Abstract: The purpose of this study was to develop an understanding of the support needs which novice teachers considered essential in their initial three years of service. A basic qualitative research design was used, and semi‐ structured interviews were conducted with a purposive sample comprising of 20 novice teachers who had less Research Outlook 2020 | 204
than three years of teaching experience at public‐elementary schools in Lahore. The result of the study indicated that novice teachers considered that both principal and senior teachers should guide them. It was found that half of the interviewed teachers were satisfied with the support of the principal and senior teachers, whereas other half reported principal did not help them, and senior teachers were involved in leg‐pulling. Most principals were co‐operative, and novice teachers could discuss their classroom management challenges with them like student’s absence, behavioral challenges, cleanliness, and lack of interest of parents/over‐involvement. Whereas some reported their principal did not listen to their challenges, and they could not discuss challenges with them. Most teachers received suggestions from principals such as keeping students involved, teaching slowly, and dealing with students’ behavioral challenges patiently. Keywords: classroom management, novice teachers, public‐ elementary schools, support needs.
26. Anwer, M., Masood, S. & Sarwar, M.N. (2020). How do Self‐regulation and retention in Math relate with classroom learning environment: Students’ perspective? Pakistan Journal of Distance and Online Learning, 6(1), 115‐127. (Sajid Masood (Education/SSSH) Abstract: This study investigated in Math and Classroom Learning Environment (CLE) through quantitative approach Public Schools of Punjab were the population of the study. Using random sampling, 997 respondents (Boys = 489, Girls = 508) from two districts (conveniently) were selected. The scale (Fraser, 2007). Self measured students’ self scale developed by the researchers was used. CLE and Retention in Math, similar perception regarding these variables with respect to their male counterparts. Findings revealed no significant relationship between CLE and SR of students for the whole sample as well; further, relationship betwe it was significant for females as compared to males. This study should be conducted at large scale and in varied setting for further implications. Keywords: Self‐regulation (SR), Retention in Math, Classroom Learning Environment (CLE), Gender.
27. Shabbir, M., Jabeen, S., & Masood, S. (2020). An Exploration of Reasons and Relationships between Female Teachers’ Anxiety towards Teaching Mathematics and Students’ Achievement. Pakistan Social Sciences Review. 4(2). 670‐679. (Sajid Masood (Education/SSSH) Abstract: This study explored the relationship between Teaching Mathematic Anxiety of Female Teachers and Students Learning Achievements. Moreover, a comparison was made on the basis of schools’ type and gender in context of teachers’ anxiety and students’ achievements scores. Explanatory mixed method design was adopted. The sample included 128 teachers of mathematics and 512 students of secondary school level selected from four towns of a district. The first research tool used to collect data from teachers was Mathematic Anxiety Rating Scale (MARS). The second research tool was Mathematic Subject based Test (MST) based on students’ mathematic course book. Mathematic based Subject Test was administrated to calculated 9th and 10th grades of students, learning achievements’ score in mathematics. Findings of the study show that Teaching Mathematic Anxiety of Female Teachers’ has significant effect on Students Learning Achievements. Keywords: anxiety, mathematics, achievement.
28. Masood, S., Siddiqui, G.K., Yasmin, T. & Shahbaz, S. (2020). Relationship of English language teachers’ self‐efficacy with students’ achievement in English. Pakistan Journal of Social Sciences, 40(2), 1139‐1146. (Sajid Masood (Education/SSSH) Abstract: The quantitative study employed survey method explored relationship between self‐efficacy of English language teachers and achievements of their English language students. Population of the study was English language teachers teaching in secondary schools of the district Kasur. A sample of 282 (Male 179; Female 103) English teachers (across gender and locale level) was selected through simple random sampling technique. The researcher used long form of Teachers’ Sense of Efficacy Scale developed by Hoy and Tschannen‐Moran (2001).
Research Outlook 2020 | 205
Originally this questionnaire consists of twenty‐four items, but the researcher adapted the scale for the current study with the permission of the original authors. The instrument was piloted, and its reliability was 0.95. Students’ achievement was their score in subject of English which was taken from their respective schools. The analysis identified that a significant relationship exists between achievement score of English language students and self‐efficacy of their teachers. It was further found that there is no difference in self‐efficacy of female and male teachers. Keywords: self‐efficacy, achievement, relationship.
29. Shabbir, M., Masood, S., & Siddiqui, G.H. (2020). Role of transformative learning interventions in developing conducive environment for female adult learners in higher education. Review of Economics and Developmental Studies, 6(2), 391‐400. DOI: https://doi.org/10.47067/reads.v6i2.217. (Sajid Masood (Education/SSSH) Abstract: The increasing number of female adult learners required a need for a deeper and more additional background related consideration on the effects contributing toward educational achievement for the learners who return to study. The aim of this study is to define the role of Transformative Interventions in developing Conducive Learning Environment for female adult learners in higher education with the consideration on hindrances faced, as they re‐engage and continuing their post‐compulsory educational passage. Qualitative approach with explanatory case study design has been employed to conduct this study. Semi‐structured open‐ ended interviews conducted for 16 purposefully selected female participants. Two private and two public universities were selected from which adult working students and experienced of having transformative learning interventions during their course. Moreover, the experiences and responses highlighted the needs, hindrances and expectations of the adult students in higher education. They identified reflective activities including article review and reflective writing, faculty support, seminars, educational conferences, presentations, projects on real life issues, discussion and introducing demanding courses are the important transformative learning interventions for developing Conducive environment for adults. The major factor responsible for developing Conducive environment was experiences and exposure by the adult learner and providing opportunities through the Andragogy and expertise. Notes on interviews and reflection journals were utilized to triangulate data to support these methods. Data analysis and results of the study indicated that participants experienced transformative learning interventions through both educational and non‐educational related activities held in university by Higher Education. Keywords: adult learners, transformative learning, conducive environment for learning, interventions.
30. Rafique, S., Masood, S., & Siddiqui, G.K. (2020). Comparison between Students’ Moral Development in Private and Public Sector Colleges. Pakistan Social Sciences Review, 4 (2), 582‐590. (Sajid Masood (Education/SSSH) Abstract: Moral feature of personality development focuses on the emergence and consideration of morality from infancy to maturity and change. Ideology of morality is defined as individual’s behavior with one another. The objectives of the current study are to compare perceptions regarding moral development in private and public sector colleges by gender and to find which sector is more effective for better moral development at the intermediate level in private and public colleges. Survey design was used for study. All colleges of Private and public in the Punjab province made up the population. The respondents included 626 students, 160 teachers and 30 administrators. Data was collected by using three questionnaires comprises on five‐point Likert scale. Validity of instruments was checked by Pilot testing. Administrators instrument reliability (α = 0.85), teachers (α = 0.93) and Students (α = 0.68) was accordingly. Normality tests, summary statistics, parametric statistics and box plot were applied. To compare the private and public sector, Non‐parametric tests were used. No difference was found in the female and male student’s perception regarding moral development. Also moral development of students is relatively better in public sector as compared to private sector colleges. Keywords: private sector, public sector, personality, moral development.
Research Outlook 2020 | 206
31. Masood, S., Siddiqui G. K., Lodhi, H., Ali, H. (2020). Assessment of Professional Learning Community in Private Schools of Lahore. Journal of Business and Social Review in Emerging Economies, 6(2), 619‐628. (Sajid Masood (Education/SSSH) Abstract: The purpose of the study was to investigate existence of professional learning community (PLC) in five private schools of Lahore. The researcher used an instrument Professional Learning Community Assessment Revised developed and revised by Olivier, Hipp, and Huffman (2010) to collect data from 800 teachers from five private reputed schools of the Lahore. The sample was selected conveniently because of very limited to no access to certain schools. With response rate of 80% and reliability of .951 in local context the data were analyzed. The analysis revealed existence of all dimensions of PLC in all five schools of the Lahore. Supportive condition (structure) was perceived as dominant dimension of the PLC. Insignificant difference was identified between perceptions of male and female teachers. Moreover ANOVA revealed that in Heaven school and Custodian school two dimensions of the PLC, shared and supportive leadership and shared values and vision are practiced better than other three schools: Shining star, Grammar, and Hospitality. This research has identified existence of PLC in private schools of the Lahore and invites researchers to explore the same in public schools and further investigate relationship of PLC with school effectiveness, students’ achievement, teachers’’ professional development and other variables. Keywords: professional learning, shred and supportive leadership, collaboration, vision and values, community.
32. Masood, S., Siddiqui, G. K., Lodhi, H., and Shahbaz, S. (2020). Effect of Leadership Styles on Organizational Citizenship Behavior and Employee Turnover Intention. Journal of Accounting and Finance in Emerging Economies, 6(2), 487‐495. (Sajid Masood (Education/SSSH) Abstract: The study is aimed at finding the effect of leadership styles on organizational citizenship behavior and employees’ turnover intentions. A descriptive survey research strategy was adopted over a sample of 240 respondents selected conveniently from eight universities of Pakistan. Multifactor Leadership Scale developed by the Williams and Anderson (1991) was used for data collection. Turnover Intention Scale developed by Roodt (2004) was used to determine employee turnover intention. Descriptive statistics along with ANOVA were used to analyze the data. The research indicated that transformational and transactional style of leadership have a positive relationship with organizational citizenship behavior whereas, laissez faire style has a negative relation with organizational citizenship behavior and positively related with employee turnover intention. Transformational and transactional style of leadership had an insignificant relation with employee turnover intention. Keywords: leadership, styles, turnover intention, Pakistan, organizational citizenship behavior, employee.
33. Ahmad, A., Jamil, M., & Muhammad, Y. (2020). Co‐Curricular Activities: A Case Study on Perspectives of Winning Secondary School Students. Kashmir Journal of Education. 1 (2). 77‐104. (Muhammad Jamil, Yaar Muhammad (Education/SSSH) Abstract: The purpose of this study was to investigate the perspectives of winning secondary school students about co‐curricular activities. It was a qualitative case study focusing on co‐curricular activities arranged at the secondary school level. Participants were selected through the purposive sampling of winning male students in different co‐curricular activities at tehsil level enrolled in grade IX and X secondary school of tehsil Wazirabad District of Gujranwala. An interview guide was developed based on relevant literature and keeping in view the purpose of the study to gather information from the students. Semi‐structured interviews and focus group sessions were used for data collection from the research participants. All the transcripts were transcribed and translated into the English language. Data were analyzed through qualitative content analysis using data displays for each participant and research themes. The data gained from the students uncovered various aspects that helped to understand the perspectives of winning cocurricular activities. Students believed that cocurricular
Research Outlook 2020 | 207
exercises had a positive outcome on students at the secondary school level. It was also found that active involvement in co‐curricular activities improved personal control to a certain level, tolerance in extreme circumstances, and duty towards allocated undertakings, level of cooperation, and positive conduct. They learned teamwork, administration qualities, discipline, selfconfidence, time management, persistence in extreme circumstances, responsibility towards prearranged tasks, and the development of positive actions. They also learned to handle critical situations. The perspectives also revealed that participation in such activities improved their health and avoidance of negative activities; thus, learning to spend their time positively. Further studies may be conducted with different methodologies and levels of students. Keywords: Co‐curricular Activities, Games and Sports, Secondary Level.
34. Ahmed, F., Muhammad, Y., & Anis, F. (2020). Developing Secondary School Teachers’ Positive Attitude towards Reflective Teaching: A Collaborative Action Research Study. Sir Syed Journal of Education & Social Research (SJESR). 3(4), 43‐53. (Faran Ahmed, Yaar Muhammad, Faisal Anis (Education/SSSH) Abstract: The purpose of this collaborative action research study was to develop reflective teaching practice through focus group discussions as a form of reflection conversations with nine chosen secondary school teachers in a private school. For data collection, two self‐constructed open‐ended questionnaires were used in this study: one before the focus group discussions and the second after the focus group discussions. Focus group discussions were held with teachers teaching English language, Urdu language, Science, Social Studies, Pakistan Studies. Focus group discussions were audiotaped and then transcribed for coding and thematic analysis. Based on that analysis, certain inferences were finalized. Professional development experience was found to be useful as participants accepted this new concept of reflective teaching with alacrity both for their development and the development of their students as well. Most of the participants described reflective teaching as beneficial to analytical skills as due this they could analyze performance and determine to be better in the future. In addition, they were of the view that it could also help develop the analytical skills of students. It is hoped that the participants’ detailed descriptions in this study will guide the selected school towards enhancing the performance of teachers in the form of better learning goals and students’ grooming so that they could be well prepared for a higher level of education and then professional education in the long run. Keywords: reflection, reflective teaching, critical thinking, qualitative research.
35. Iqbal, T., & Muhammad, Y. (2020). Using differentiated instruction in inclusive schools: A qualitative analysis of prospective teachers’ self‐efficacy. Journal of Inclusive Education. 4(1). 229‐257. (Yaar Muhammad (Education/SSSH) Abstract: Not Available. Keywords: not available.
36. Naz, M., Hani, U., & Muhammad, Y. (2020). Self‐Efficacy Beliefs of Pre‐Service Teachers Regarding Online Teaching. International Journal of Distance Education and E‐Learning (IJDEEL). 6(1), 47‐65. (Mariam Naz, Ume Hani, Yaar Muhammad (Education/SSSH) Abstract: Technological advancement in the rapidly changing world of work demands its use in every field, including education. In the current scenario, online education is the new normal. Therefore, future teachers should be aware of multiple instructional strategies and suitable ways of using technology to assist in the development of 21st‐century skills in learners. Keeping this fact into consideration, this study aims to explorethe self‐efficacybeliefs of pre‐service teachers regarding online teaching. The technological pedagogical content knowledge framework was employedto understand and describe the self‐efficacy beliefs of teachers for effective pedagogical practice in a technology‐enhanced learning environment.Through the use
Research Outlook 2020 | 208
of phenomenological case study design, this research investigates the self‐efficacy level, understanding, and expectations of future teachers regarding effective online teaching. Koehler and Mishra’s TPACK framework and Bandura’sself‐efficacy theory were used as the conceptual underpinningsof semi‐structured interviews conducted withfivepre‐service teachers enrolled in a teacher education program.The study founda high level of self‐efficacy perceived by pre‐service teachers. Also, pre‐service teachers were confident in using the TPACK framework for online teaching. The study suggests the use of technology‐based materials in the courses of teacher education related to technology integration for enhancing self‐efficacybeliefs of pre‐service teachers regarding online teaching. Keywords: TPACK framework, Self‐efficacy beliefs, Pre‐service teachers, On‐line teaching, 21stcentury skills.
37. Pirzada, G., Muhammad, Y., & Anis, F. (2020). Perspectives of Working Children on their Education and Life Goals: A Case Study. Research Journal of Social Sciences and Economics Review (RJSSER), 1(4), 122‐132. (Gouhar Pirzada, Yaar Muhammad, Faisal Anis (Education/SSSH) Abstract: Despite several interventions from the public, private and NGO sectors, the sustainability of education for working children has always been a challenge in Pakistan. Setting life goals is the first step towards achieving them, and setting life goals itselfis a life skill,not possessed by everyone. Children who possess this valuable skill tend to perform better in managing their careers, time, and life. A framework proposed by Cassandra Massey quite explicitly explains the various factors that working children need to consider and focus on while pursuing their life goals. It comprises eight attributes, including Self‐care, Relationships, Money, Personal development, Home‐life, Community, Passions, and Work‐life. It is essential to know‐how and to what extent these attributes affect the education and life goals of working children to understand their perspectives. The multiple case study research design wasused in this study toillustratethe issue and getting similar and contrasting patterns from responses of the five cases. Findingsfrom all five case studies that there existsa high determination and commitment towards education, and 4 out of 5 cases expressed there are high chances for them to be able to achieve their life goals.Based on findings variousimplications are discussed. Keywords: working children, education, life goals, work‐life, passion.
38. Pirzada, G., Muhammad, Y., & Anis, F. (2020). Promoting 21st‐Century TVET Skills in Pakistan: Teachers' Perceptions. Pakistan Social Sciences Review. 4(2), 986‐1001. (Gouhar Pirzada, Yaar Muhammad, Faisal Anis (Education/SSSH) Abstract: The purpose of this study was to understand and develop teachers’ perceptions about implementing and promoting 21st‐ century learning skills in TVET Pakistan. The qualitative research design was used, and a focus group session was conducted with purposive sampling of 12 teachers belonging to the public, private, and NGO based TVET providers of the country. The results of the study highlighted that both institutions and teachers have a pivotal role to play in promoting the 21st‐century TVET skills in Pakistan, specifically the 4Cs that include Communication, Critical thinking, Creativity, and Collaboration. Different perspectives and lived experiences were collected from TVET teachers regarding the promotion and implementation of 21st‐century TVET skills in light of the best global practices, which helped to deem the research phenomena more deeply. This study provides a rich understanding of factors responsible for the successful implementation of 21st‐century TVET skills in vocational institutes of Pakistan, which includes strong teachers’ orientation and support from their institutes. It also suggests the need for effective and ongoing interventions for continuing teachers’ capacity building to acquire and sustain these skills. This study provides useful insights for implementing a strong monitoring process that would help to evaluate the impact of implementing 21st‐century TVET skills. Keywords: 21st‐Century TVET Skills, Monitoring and Evaluation, Teachers’ Perceptions, TVET Sustainability TVET Teachers’ Capacity Building.
Research Outlook 2020 | 209
39. Siddiqui, M. F., Arif, M., & Muhammad, Y. (2020). Maintaining Discipline in Private Primary Schools in the Wake of Ban on Corporal Punishment: A Qualitative Case Study of Teachers’ Perspectives. Kashmir Journal of Education. 1 (2). 52‐76. (Malahat Fuad Siddiqui, Maliha Arif, Yaar Muhammad (Education/SSSH) Abstract: Maintaining discipline in the classroom is one of the major priorities in any school. A hike in students’ discipline issues is allegedly linked with teachers’ incompetence to manage classrooms after corporal punishment has been banned by the Government of Pakistan. Teachers do not enjoy the powers which they traditionally used to enjoy on the basis of their knowledge or position anymore, which has not only lowered teachers’ morale but also produced a lack of professional commitment and high retention rate among private school teachers in Lahore. This instrumental case study aimed at identifying teachers’ preparedness for effective classroom management techniques in the current scenario and how no‐corporal punishment has affected their satisfaction and commitment to their profession. The qualitative case study approach was adopted for the study, and four teachers of a private school in Lahore were purposively selected. The study used a self‐constructed semi‐ structured interview guide. The analysis of data revealed that teachers felt disempowered in classrooms not because the nocorporal punishment has been imposed, but due to their own inability to use alternates effectively. The teachers are aware of and are in favor of the ban; they, however, thought that the school administration and government of Pakistan should hold training sessions not only for teachers and administrators but also for parents. Keywords: classroom management, curriculum, corporal punishment, instruction.
40. Tahira, M., Muhammad, Y., & Masood, S. (2020). Early Childhood Teachers’ Attitudes towards Teacher‐directed Classroom Management Strategies in Inclusive Settings. Journal of Early Childhood Care and Education, 4, 37‐60. (Marryum Tahira, Yaar Muhammad, Sajid Masood (Education/SSSH) Abstract: This qualitative interpretative phenomenological study aimed to explore early childhood education (ECE) teachers’ attitudes (perceptions, feelings, and practices) towards classroom management strategies in inclusive early childhood education classroom settings in Lahore. Inclusive education is presently an extensively debatable issue in the education field around the world. Pakistan also lacks adequate provisions of inclusive education in schools, and there are insufficient awareness and training for teachers about inclusive education. However, proper awareness of inclusive education among teachers has the potential to improve the student’s positive outcomes. International theoretical literature suggests that ECE teachers often use teacher‐directed strategies in inclusive classrooms to achieve positive outcomes for all students. This study used the phenomenological research design, and semi‐structured interviews were conducted with 12 ECE teachers who were working in inclusive ECE classroom settings in Lahore. The interpretative phenomenological analysis of interview data was conducted using NVivo 12 software to analyze and generate themes. The findings highlight that most ECE teachers have positive attitudes towards teacher‐directed classroom management strategies that are considered effective in managing inclusive early childhood education classroom settings. However, they feel that the implementation of these strategies is challenging because of the presence of students with disabilities in their classes. This study provides a base for further research and, eventually, interventions. Keywords: inclusive education, lived experiences, early childhood, managing inclusive classroom.
41. Naz, A., Ashraf, F., & Iqbal, S. (2020). The Relationship between Higher Education and Women Empowerment in Pakistan. UMT Education Review, 3(2), 65–84. (Faiza Ashraf (Education/SSSH) Safia Iqbal (ORIC) UMT JOURNAL Abstract: Women empowerment is one of the critical dimensions of a feminist perspective. In patriarchal societies, women are oppressed and suppressed; hence higher education is considered a remedy to equip them to deal with issues arising from undue oppression and suppression. This study aimed to find the relationship between the attainment of higher education among women and women empowerment. The study has been carried out in Central Punjab, Pakistan. The study was framed under a correlational research design. Data was
Research Outlook 2020 | 210
collected from a sample of 200 respondents equally selected (50 from each) of four different universities, including the University of Gujrat, University of Management and Technology, Lahore, University of Minhaj, University of Lahore. A stratified random sampling technique has been utilized, whereby 200 samples were questioned through a structured questionnaire. The collected information was analyzed by using both descriptive and inferential statistics. Findings showed a strong correlation between the attainment of higher education and women empowerment. The correlation was determined among one independent variable (attainment of higher education) and four dependent variables, including the power of decision making, increased political participation, economic independence, respect, and self‐esteem.All variables have been found significantly associated with each other, which provides evidence that higher education attainment leads to women empowerment. Based on the findings of the study, it is concluded that higher education plays a significant role in liberating women from oppression and suppression. Keywords: Women empowerment, higher education, self‐respect, self‐esteem, economic independence.
Department of Gender Studies Research Articles 1. Salahuddin, A. (2020). Mystic Language and Symbols. Journal of Islamic Thought and Civilization (JITC), 10(1). Retrieved from https://journals.umt.edu.pk/index.php/JITC/article/view/646. (Ambreen Salahuddin (Gender Studies/SSSH) Abstract: This article explores the concept of unity of being in fiction by Pakistani women writers. The usage of mystic language and depiction of mystical and Sūfi symbols in literature can be traced back to ancient texts. However, it has been deemed alien for women to be Sūfis and have mystic experience, apart from a few exceptions. Indulging in formulating mystical symbols and using mystic language by women has not been perceived as too womanly. The main reason for this is the fact that women’s world‐view has been restricted and thus deemed limited. Complete works of fiction by Pakistani women writers writing in Urdu have been explored for this research. There are two steps in sample selection i.e. women fiction writers and their fiction. Women writers are selected on the basis of set criteria. Selection of text is done through theoretical sampling. Women fiction writers have used mystic symbols meaningfully at innumerable places in their works. By the study of these works, it can be concluded that women writers have indulged in using mystical language and symbols and have done it in a crafty manner, though retaining the traditional usage of these symbols and metaphors. Keywords: not available.
2. Rubab, I., & Parveen, S. (2020). Labor Rights in Islam: the Plight of Bonded Laborers in the Brick Kiln Industry of (Iram Rubab (Gender Studies/SSSH) .228‐213 ,(53)35 ,ﺍﻻﺿﻮﺍء Tehsil Pattoki. AL‐ADWĀ Abstract: Labor laws are an essential part of the Islamic framework as well as the conception of civil rights in Pakistan. Islam gives a dignified position to work, and its principles of justice advocate for just working hours, fair wages, a reasonable service contract, freedom to form associations, etc. Despite these religious and constitutional commitments, bonded and child labor is rampant in the brick kiln industry of the country. The present study discusses the plight of these trapped workers in light of survey data collected from 220 respondents belonging to the brick kilns of Tehsil Pattoki. The survey findings are categorized on the basis of nature of work and working hours, and different vulnerabilities of its respondents. The desk review of Islamic teachings with reference to labor provides a contrast to the situation at hand. After identification of these gaps, the study offers recommendations, most of which deal with policy‐making, pertaining to rehabilitation and reintegration of the workers currently trapped in this morally reprehensible practice. Keywords: bonded labor, Islam, justice, child labor, labor laws, Tehsil Pattoki.
Research Outlook 2020 | 211
3. Rubab, I., Aziz, A., & Usman, A., Amjad, A. (2020). Global Citizenship Education: Values to be taught in the Light of the Rising Identity Crisis. Pakistan Vision, 21(1), 386‐395. (Iram Rubab (Gender Studies/SSSH) Abstract: In the 21st century, the world has become a global village that is more interdependent and interconnected than ever. Economic, political and security situation of one country has an undeniable impact on other countries. This increased interdependence and interaction between people from diverse cultural backgrounds and a diffusion of ideas has given rise to an identity crisis. Questions like, ‘does progress in globalization and promotion of global citizenship mean that we are forging a unified national identity?’ lead to ‘sovereignty conflicts’ in the minds of young adults who have a desire to maintain their local identity. This article examines the problematic with reference to Pakistan and its state’s quest to achieve a homogeneous national identity that is ‘localized’ and ‘inward’ looking. It looks at how globalization is causing an identity crisis and how global citizenship education can lay foundations of an awareness, which embodies skills helpful in preparing young people as responsible global citizens while respecting their communal, cultural, and national identities. This can be done by promoting education that not only creates simple awareness or tolerance, but inculcates analytical and critical thinking to ensure a deeper understanding of the world issues and an ability to take decisive actions as active citizens. Keywords: not available.
4. Salahuddin, A. (2020). Khalida Hussain ki Gung Shehzadi aur Hélèn Cixous ki Medusa ka qehqaha [Khalida Hussain’s Gung Shehzadi and the laugh of Hélèn Cixous’s Medusa]. Bunyad, 11, 103‐117. (Ambreen Salahuddin (Gender Studies/SSSH) Abstract: This article studies and compares the main character of Khalida Hussain’s short story, ‘‘Gung Shehẓādī’’ (mute princess) and the symbol of Greek mythological goddess, Medusa from Hélèn Cixous's research paper, ‘‘The Laugh of the Medusa’’. For analysis, the theoretical lens of feminist theory of ‘forms of women consciousness’ as feminine consciousness, female consciousness and feminist consciousness is used. The character of mute princess is a powerful depiction of a woman’s constant struggle of self‐awareness in patriarchy and is thus a symbol of a woman being dragged out of her own mind and body. Cixous’s Medusa is the symbol of a woman’s wisdom, power and ownership over her own mind and body. Cixous demands that a woman should bring her own self to writing which should reflect feminist consciousness while Hussain's character of mute princess is a depiction of feminine consciousness. Keywords: feminism, Khalida Hussain, Helen Cixous, Greek Mythology.
5. Rass, I., Rasheed, I., & Iqbal, U. J. (2020). Attitudes and Perceptions of Medical Students Regarding Work Place Harassment Act An Interpretive Paradigm. Pakistan Journal of Medical & Health Sciences, 14(4), 1277‐1280. (Iram Rasheed (Gender Studies/SSSH) Abstract: Background: Harassment at workplace is a worldwide phenomenon and remains a major threat to the work performance of the workers. In this regard, Government of Pakistan introduced “The Protection against Harassment of Women at the Workplace Act 2010”. Objective: This study explores the attitudes and perceptions of medical students about the effectiveness of this act within the university environment. Methodology: The study is qualitative in nature and follows interpretive paradigm. In‐depth interviews were conducted with twenty male and female students from two universities (one from private sector and one from government sector). Thematic analysis was carried out to analyze data. Results: The results reflected that the majority of students were unaware of the legislation. It is found that the universities have generally failed to play a constructive role in raising awareness among the students about this harassment act.
Research Outlook 2020 | 212
Conclusion: Harassment committees were found to be ineffective. It is recommended that universities should not only increase awareness among the students through various steps but also implement this harassment act 2010 in letter and spirit to make it more effective. Keywords: Harassment Act 2010, Gender Justice, Women Empowerment, Work place Harassment. Conference Paper 1. Rubab, I. (2020). ‘Status of women inheritors in Islam: Practices and Challenges in Punjab'. Paper presented ,(ICESIWST‐2020) ﷺ at the 2nd International Conference: Emerging Social Issues of Women and Seerat e Tayyaba University of the Punjab, Lahore. November 4– 5, 2020. (Iram Rubab (Gender Studies/SSSH) Abstract: Inheritance is the primary mechanism that regulates the intergenerational transference of financial assets and property. Ownership and control of inherited property and assets can lead to economic, social, political and psychological prosperity of women. In Pakistan all intergenerational transfer of wealth is guided by Shariah law which is primarily based on clearly prescribed principles in Quran and hadith. However, in Punjab’s context the female share of inheritance is often denied contrary to the Islamic injunctions and in many cases women surrender by choice. The cases of denial and surrender persist despite 2011’s criminal law amendment that renders denial of female a criminal offense. The present study is an effort to understand this phenomenon. It analyzes the status of women inheritors in Islam along with cultural narratives that legitimize denial and promote surrender as an honorable choice. Simultaneously, the study investigates the institutional and structural barriers that prevent women from making a successful claim. Rawalpindi and Bahawalpur districts were selected as research sites. The study is ontologically grounded in interpretivist paradigm and epistemologically situated in social constructionist philosophy. The three tier sample of the study was selected through purposive sampling technique. Forty female participants, ten revenue officers, and ten legal and women rights experts were recruited for this study. Three types of in‐depth interview guides were developed to collect the data. The study results revealed that misinterpretation of divine directives along customs and culture mediate denial and surrender. Even though inheritance is transferred to women more often following the 2011 amendment, still most women cannot access or control that inheritance. Similarly, discrepancies within the LRMIS and NADRA system and tediously slow judicial processes further exacerbate the situation. It is suggested that a deconstruction of cultural narratives, creation of transparency within the digital record systems, and sensitization of police officers, revenue department staff and judges can improve the situation. Simultaneously increasing the number of female employees in these departments is equally important. Keywords: Women, Inheritance, Punjab, Institutional mechanism, Islam. Department of Islamic Thought & Civilization Research Articles 1. Shaukat, M. A., & Ahmad, H. (2020). A Historical Survey of Evolution in the Concept and Status of “Man” Greek to Modern Times. Journal of Islamic Thought and Civilization (JITC), 10(1). Retrieved from https://journals.umt.edu.pk/index.php/JITC/article/view/650. (Muhammad Awais Shaukat, Humaira Ahmad (ITC/SSSH) Abstract: Study of human nature has been one of the most important questions to which man has come across. Right from the period when man started thinking rationally, because of his curious and enquiring nature, he meditated about Universe, existence and nature of Man and his ultimate reality. The religious tradition claims that when Man first came to earth, he knew the answer to these questions in the light of divine guidance. It declared “Man” as the crown of all the creations and all the other things are created to serve him. The civilizations that didn’t have the luxury of divine guidance developed mythological explanations. It were the Greeks who for the first time developed an intellectual discourse to answer the basic question about the reality of Man and the Universe. The medieval period was dominated by religious traditions. All these traditions, though different from
Research Outlook 2020 | 213
one another, seem to agree to the point that Man is a special creation and the center of the Universe with some amount of divinity attributed to him. But after Renaissance, this view changed radically and the status of “Man” shrunk to an animal only who was thought‐to‐be guided by his own instincts and who was through and through a profane creation. This research aims at studying the concept of “Man” in different civilizations and explores the evolution of this concept from Greek to Modern times through analytical research method. Keywords: not available.
2. Mushtaq, S., Sami‐ullah, M. (2020). The Concept Of Death, Life After Death, and Visiting The Holy Shrines in Islamic Perspective. Hamdard Islamicus, 43(2), 434‐446. (Saima Mushtaq, Muhammad Sami‐ullah (ITC/SSSH) Abstract: This current was carried out to investigate the concept of death, life after death and visiting the holy shrines from an Islamic point of view. It is distributed into two significant parts. In the first part, the Islamic concepts of death, life after death, and the Day of Judgment were examined. The second part is concerned with one of the most undecided topics among different Islamic school of thoughts, those of graves and shrines and the cult of saints. We will be arguing that in spite of the fact that Muslims are not permitted (from fundamentalist perspectives) to build adorned holy shrines, the trends of saints are prevalent in many of the parts of the Muslim countries. It is contended that this phenomenon originates from the cultural rather than religious factors. In many of the cases, Muslims could not dissociate themselves of cultural aspects that inhibited or were unharmonious with the religious beliefs. It is asserted that the trends of saints are found more generally in the Sect of Shia than in the countries where Sunni sect is seen dominating. In reaction to the current continuous assaults on the holy shrines, the researchers recommend mutual and inter‐religious sect dialogues among the various sects of the Muslims. Keywords: Muslims, holy shrines, concept of death, life after death, religious factors.
3. Shah, H. S., Jamal, K. F. (2020). Role of Zakat, Waqf And Islamic Microfinance in Achieving Maqāsid Al‐ Sharīảh. Islamic Studies Research Journal Abḥāth, 5(17) 17‐34. (Hassan Shakeel Shah, Khurrum Faisal Jamal (ITC/SSSH) Abstract: Zakat is a pure poverty alleviation system offered in Islam which is its fourth pillar of faith and hence one finds no question on its authenticity and importance. Waqf, a non‐profit voluntary sector, has an important and integral role in building communities during various phases of their development. Further, the conventional microfinance programs are costly which involve riba (usury) too, a prohibited transaction in Islam. This is one factor why Muslims prefer Islamic microfinance for their business need but it is unfortunate that this system is not mature and effective. The problem is answered through Islamic principles, regulations, and laws which are called Shariah while Maqāṣid Al‐Sharīảh is basically the objectives of Islamic law. The central purpose of shariah is to facilitate the removal of hardships in lives of humans. The main objective of this paper is to discuss role of Zakat, waqf and Islamic microfinance under the principles of Maqāṣid Al‐Sharīảh. In this paper the separate relation of these poverty alleviation tools with five principles of Al‐daruriyyat from the perspective of Maqasid Al‐Shariah have been discussed. The findings of the paper show that zakat, waqf and Islamic micro finance has a positive impact on all human needs in the perspective of Maqasid al‐Shariah namely religion, knowledge, life, family and wealth. Hence, the study also provides an insight that without proper zakat distribution, utilizing waqf assets and providing useful Islamic micro financing, the requirement of maqasid al shariah cannot be fulfilled. This study indicates that, Al‐Din, Al‐Nafs, Al‐Nasb, and Al‐Mal these indicators has positive relationship with the involvement of zakat, Islamic microfinance program, while, the indicator of Al‐Aql has not significant relation with islamic microfinance program and even in zakat except different business knowledge in microfinancing and education and training by using zakat amount. while in case of waqf indicators of all five principles are significantly improved. Keywords: Islam, zakat, waqf, Islamic microfinace. Research Outlook 2020 | 214
4. Faraz, M. S., & Asiya, S. (2020). Impact of the Contextual Approach on the Qur’ānic Interpretations: An Analytical Study. JIHĀT‐UL‐ISLĀM, 14(1), 1‐20. (Syeda Asiya, Muhammad Samiullah (ITC/SSSH) Abstract: The contextual approach, according to contextualists, is the best methodology for cognizing the true spirit and the real message of the Qur’ān, as it provides such interpretations that are based on the values of equality, fairness and justice. The contextualists assert that they seek to promote an Islam which is more human‐ centred, peaceful and flexible. They also regard most of the classical Qur’ānic explanations, especially pertaining to certain social issues (like the Rights of Women, Interfaith Relations and Hudūd Punishments), to be historic, specific and context‐based. They argue that to determine the relevance of the Qur’ānic teachings today, such interpretations should be re‐understood, re‐interpreted and re‐applied according to the modern context and demands. They contextualize the Qur’anic interpretations on the name of modernity, rationality, liberty, success and universality. This article aims to understand the contextual approach as well as its impact on the Qur’ānic interpretations. The thoughts and philosophy of Fazlur Rahman, the twentieth‐century leading proponent of the contextual approach, are the major focus of this study. This study is an attempt to help the Muslims remove the evolving misunderstandings about Islam and stimulate them to implement the Qur’ānic wisdom in their thoughts and lives in a better way. Keywords: Al‐Qur’ān, Sharī‘ah, modernity, contextual approach, beliefs and practices, social justice.
5. Shaukat, M. A., & Basharat, T. (2020). Islamic Integration in the Social Studies for Schools in the National Curriculum of Pakistan. Pakistan Journal of Islamic Research, 21(2), 55‐70. (Tahira Basharat (ITC/SSSH) Abstract: There would be no one denying the fact that the phenomenon of Globalization has put a strong challenge to the Muslim world view and epistemology. It has set some internationally recognized standards for progress and prosperity. These advancements are the result of a series of intellectual movements in the west like, Renaissance, Reformation, Enlightenment, Modernity and post‐Modernism. So all the knowledge that is being produced internationally is in this Western frame of reference and epistemology. The National Curriculum developed by the Government of Pakistan is an effort to meet the needs of the nation and is being implemented across the country. This curriculum by and large is developed according to the modern standards but arguably it can be claimed that at some key points the Islamic perspective is missing. Especially in social sciences the concept of “Man” is described more or less in Western perspective. At school level social studies is a subject that should build the Islamic World View of the student. But seldom one finds something in this regard. This study will propose framework for developing the curriculum of Social Studies in Islamic perspective. Keywords: knowledge, islamization, world view, curriculum, epistemology, social sciences.
6. Sharif, M., & Basharat, T. (2020). The Sayyid Qutub and His Criticism on Western Civilization. Iḥyāʾalʿulūm ‐ Journal of Department of Quran O Sunnah, 20(2). Retrieved from https://joqs‐ uok.com/index.php/ihya/article/view/70. (Tahira Basharat (ITC/SSSH) Abstract: Sayyid Qutb was one of the most influential Islamic thinkers of the 20th Century. He fervently believed that Islam should govern the social, economic and political order of the society to improve the human condition and purge ills of society. He emphasizes that Islam must combat any system that usurps God’s sovereignty by giving man power over other men. Qutb argued that a key characteristic in the Islamic society was social justice that did not exist in the West because of its materialistic philosophy of life. He called upon the Muslims to examine Islam’s comprehensive philosophy of the universe, life and human kind. In his view, a clear understanding of the universe, and the harmony between the cosmos and life, would lead Muslims to a deep appreciation of Islam as a religion of unity, encompassing all elements of life. Keywords: civilization, west, syed qutab, criticism, implications.
Research Outlook 2020 | 215
7. Ali, M. A., & Basharat, T. (2020). IMĀM AL‐SHĀFIʿĪ’S APPROACH TOWARDS RECONCILIATION OF CONTRADICTORY AḤᾹDĪTH. Iḥyāʾalʿulūm ‐ Journal of Department of Quran O Sunnah, 20, (01). Retrieved from https://joqs‐ uok.com/index.php/ihya/article/view/80. (Tahira Basharat (ITC/SSSH) Abstract: Al‐Shāfiʿī (150‐204) is the founder of fiqh‐al‐Shāfiʿī. He was a great scholar of Ahādīth and jurisprudence. He started to discuss the hadīth sciences and wrote Ikhtilāf‐al‐Ḥadīth. In this article the methodology and style of al‐Shāfiʿī regarding conciliation of Contradictory Ahādīth has been discussed and analysed in the light of his book Ikhtilāf‐al‐Ḥadīth. He has discussed many issues in which he had found contradiction among the Ahādīth. In this article, his approach to conciliate the opposite Ahādīth has been analyses. Examples from his book Ikhtilāf‐ al‐Ḥadīth have been taken and discussed. Mostly he has conciliated the contradictory Ahādīth by describing that they belong to two different situations and sometimes he explained that there is no any difference in the Ahādīth, they only describe the detail of the matter. Keywords: not available.
8. Jan, S. M. W., Shah, H. S., & Othman, A. A. B. (2020). Evaluating the influence of Different Regulatory and Supervisory Bodies on the Business of Islamic Financial Institutions in Pakistan . Islamic Banking and Finance Review, 7, 1‐1. https://doi.org/10.32350/ibfr/2020/0700/444. (Hassan Shakeel Shah (ITC/SSSH) Abstract: Islamic financial market in Pakistan comprises of Islamic banking, Takaful and Islamic capital market which has been regulated and supervised by State Bank of Pakistan and Securities and Exchange Commission of Pakistan.Despite the regulatory and supervisory mechanism crafted by these authorities, there are other institutions i.e., The Council of Islamic Ideology, Federal Shariat Court and international institutions such as AAOIFI and IFSB which intervene and influence this practice. Based on descriptive analytical approach, the study finds that there is an overlapping situation in the authority over the business of IFIs. Therefore, it suggests that the current regulatory arrangement needs a distinctive sole authority over the business of Islamic financial institutions in Pakistan supported with adequate legal foundation. Keywords: not available.
School of Health Sciences (SHS) Department of Health Science Research Articles 1. Paramastri, R., Pratama, S. A., Ho, D. K. N., Purnamasari, S. D., Mohammed, A. Z., Galvin, C. J., Tanweer, A. . . . Iqbal, U. (2020). Use of mobile applications to improve nutrition behaviour: A systematic review. Computer Methods and Programs in Biomedicine, 192, 105459. doi: https://doi.org/10.1016/j.cmpb.2020.105459. (Afifa Tanweer (SHS) Abstract: Background and Objective: Mobile applications could be effectively used for dietary intake assessment, physical activity monitoring, behavior improvement, and nutrition education. The aim of this review is to determine the effectiveness of mobile applications in improving nutrition behaviors through a systematic review of literature. Methods: The review protocol was registered with PROSPERO: registration number CRD42018118809, and followed PRISMA guidelines. We involved original articles including mobile electronic devices for improving dietary intake, physical activity, and weight management in adult populations in this review. Data were retrieved from January 2010 to December 2018 with PubMed, Web of Science, Excerpta Medica Database (Embase), and Cumulative Index to Nursing and Allied Health Literature (CINAHL) as data sources. Authors individually screened the titles and abstracts, then full articles in order to obtain papers that met inclusion criteria. Results: The database search yielded 2962 records. After removing the duplicates and analyzing the full text papers a total of 8 original articles were reviewed. Two articles showed obvious bias and were not included in
Research Outlook 2020 | 216
our results or discussion. The remaining six articles with low to moderate bias risk were included in this systematic review. Three selected studies were randomized control trials (RCTs) with over 180 participants each. The other three studies were a nested trial, a case‐control trial, and a pilot RCT with 36, 162, and 24 participants respectively. All larger RCTs and the small case control trail showed significant improvements in some nutritional‐ health objectives measured. The other two trials showed insignificant improvements in outcomes measured between groups. Conclusion: This study highlights the potential significant health benefits acquirable through mobile health application‐assisted nutrition interventions. Some of these studies required significant financial and time input from providers for the application's utilization. Further studies, perhaps with multiple intervention arms, are required to compare across programs the elements that are essential for health benefits observed. Keywords: mobile application, mhealth, apps, nutrition, dietary behavior, healthcare technology.
2. Poulsen, P. R., Murtaza, G., Worm, E. S., Ravkilde, T., O'Brien, R., Grau, C., . . . Keall, P. (2020). Simulated multileaf collimator tracking for stereotactic liver radiotherapy guided by kilovoltage intrafraction monitoring: Dosimetric gain and target overdose trends. Radiotherapy and Oncology, 144, 93‐100. doi: https://doi.org/10.1016/j.radonc.2019.11.008. (Ghulam Murtaza (SHS) Abstract: Purpose: To investigate the potential benefit of multileaf collimator (MLC) tracking guided by kilovoltage intrafraction monitoring (KIM) during stereotactic body radiotherapy (SBRT) in the liver, and to understand trends of target overdose with MLC tracking. Methods: Six liver SBRT patients with 2–3 implanted gold markers received SBRT delivered with volumetric modulated arc therapy (VMAT) in three fractions using daily cone‐beam CT setup. The CTV‐toPTV margins were 5 mm in the axial plane and 10 mm in the cranio‐caudal directions, and the plans were designed to give minimum target doses of 95% (CTV) and 67% (PTV). The three‐ dimensional marker trajectory estimated by post‐treatment analysis of kV fluoroscopy images acquired throughout treatment delivery was assumed to represent the tumor motion. MLC tracking guided by real‐time KIM was simulated. The reduction in CTV D95 (minimum dose to 95% of the clinical target volume) relative to the planned D95 (DD95) was compared between actual non‐tracking and simulated MLC tracking treatments. Results: MLC tracking maintained a high CTV dose coverage for all 18 fractions with DD95 (mean: 0.2 percentage points (pp), range: 1.7 to 1.9 pp) being significantly lower than for the actual nontracking treatments (mean: 6.3 pp range: 0.6–16.0 pp) (p = 0.002). MLC tracking of large target motion perpendicular to the MLC leaves created dose artifacts with regions of overdose in the CTV. As a result, the mean dose in spherical volumes centered in the middle of the CTV was on average 2.4 pp (5 mm radius sphere) and 1.3 pp (15 mm radius sphere) higher than planned (p = 0.002). Conclusions: Intrafraction tumor motion can deteriorate the CTV dose of liver SBRT. The planned CTV dose coverage may be restored with KIM‐guided MLC tracking. However, MLC tracking may have a tendency to create hotspots in the CTV. Keywords: image‐guided radiation therapy, radiotherapy target organ alignment, intrafraction motion, kilovoltage intrafraction monitoring, multileaf collimator tracking.
3. Murtaza, G., Mehmood, S., Silvia Favretto, M., & Cora, S. (2020). Optimal VMAT Delivery for Elekta MLC Beam Modulator: A Study of Collimator Rotation for Head and Neck Planning. Journal of Medical Imaging and Radiation Sciences, 51(2), 289‐298. doi: https://doi.org/10.1016/j.jmir.2020.02.001. (Ghulam Murtaza, Shahid Mehmood (Medical Imaging Department/SHS) Abstract: Background: Well‐optimized treatment planning parameters are vital for optimum beam delivery in advanced radiotherapy techniques. The Elekta “Beam‐Modulator” (BM) is a high‐resolution multileaf collimation system where each individual leaf is 4 mm wide at the isocentre, without backup diaphragms and jaws. Its maximum aperture is 21 × 16 cm2, which results in a limited clinical use for the target geometry of maximum 20 cm in length. The collimator rotation provides an opportunity to treat slightly extended treatment length with Research Outlook 2020 | 217
optimal target coverage. The study aims to observe the collimator rotation influence on volumetric modulated arc therapy (VMAT) plan quality for different head and neck target geometries using limited field collimator of BM. Methods: Ten patients with head and neck cancer were planned by means of simultaneous integrated boost to deliver VMAT for five patients with three dose levels (70/60/56) and five patients with two dose levels (60/54). The single arc, dual arc, and combined two independent single arcs of 356° each were well optimized for four collimator angles (C) 15°,30°, 45°, and 90°. The plans were prepared for BM with SmartArc module of Pinnacle³ treatment planning system. Statistical significance (P ≤ .05) among collimator angles for planning target volume dose‐volume indices was calculated with Student's t‐test. Organ‐at‐risk doses were compared and monitor units were also evaluated as a parameter for dose‐delivery efficiency and out‐of‐field dose index. Results: The dual arc and combined two independent single arcs achieved planning objectives for C15°, C30°, and C45°. Single arc for all collimator angles and C90° for all VMAT schemes failed to achieve planning objectives. The spread of low dose bath 20, 35, and 40 Gy and deterioration of doses were higher towards periphery at C90° and statistically significant. Conclusion: The small and medium collimator angles for dual‐arc VMAT scheme(s) are suitable, whereas single arc and C90° are not suitable in VMAT implementation for Elekta Beam‐Modulator collimation system Keywords: VMAT, treatment planning, collimator rotation, limited field collimation.
4. Mustafa, F., Baig, A. A., Simbak, N., & MOB, M. O. B. (2020). Metabolism and Weight Loss: Genomic Perspective and Ketogenic Diet in Obesity. Malaysian Journal of Human Genetics, 1(2), 7‐12. (Faheem Mustafa (SHS) Abstract: Dietary modifications and healthy lifestyle have become important tools in managing rapidly increasing obesity prevalence globally. These dietary and lifestyle modifications for weight loss are time‐consuming and for that reason, dietary modifications with speedy effects are becoming popular. Ketogenic diet is one of these examples and it is being practiced by many individuals due to its tremendous weight‐reducing effect by downregulating lipogenic gene expression. The objective of this review paper is to investigate the effects of ketogenic diet on weight loss and metabolic gene expression. To study these effects; specific keywords such as ketogenic diet, genes expression, high fat diet, and weight loss were used in the PubMed portal and Cochrane library to curate studies. It was found that ketogenic diet reduces body weight by altering metabolic genes expression; decreases gene expression of lipogenic enzymes inclusive of fatty acid synthase (FASN), acetyl‐CoA synthetase2 (ACS2), glycerol‐3‐phosphate acyltransferase and malic enzyme. In addition, ketogenic diet had been found to increase the expression of enzymes responsible for lipolysis ([acyl‐CoA oxidase 1 (ACOX1), acetyl‐ coenzyme acyltransferase 1 (ACAA1), and HMG‐CoA lyase (HMGCL)]). Other hypotheses on the effectiveness of ketogenic diet in weight loss included increase in energy expenditure through gluconeogenesis, appetite suppressant effect, and increase in fat oxidation. There is a need to study and associate specific genes and epigenetics with a specific type of ketogenic diet for personalized implementation in the future. Keywords: Ketogenic Diet in Obesity, Genetics, Ketogenic diet, Weight loss.
5. Batool, A., Imran, S., Tanweer, A. (2020). Relative Nutritional And Phytochemical Composition Of Citrus Fruit Compartments‐ A Case Against Wasting Citrus Peels. NURTURE: Journal of Pakistan Home Economics Association, 14, (1). (Afifa Tanweer (Department of Nutrition Sciences\SHS) Abstract: Citrus fruits are known to contribute towards health considering their nutritional composition as well as bioactive ingredients. Although utilized at the industrial level, household‐level consumption of citrus peel is not a common concept. The current study was conducted to compare the composition of different citrus fruits as well as to compare their peels and pulps composition. Three samples of citrus fruits (oranges (Citrus Sinensis) [sample O], lemons (Citrus Limons) [sample L], and grapefruits (Citrus Paradisi) [sample G]) were selected. Two variables; type of fruit with three categories (O vs L vs G) and part of the fruit with two categories (peel vs pulp) Research Outlook 2020 | 218
were studied. Proximate contents (AOAC methods), antioxidant activity (modified DPPH bleaching), Ferrous ion chelating activity, and total phenol content (Folin‐ Ciocalteu method) were determined for each sample. Oneway ANOVA and post hoc analysis was run to note down differences among various samples. Except for moisture and fat, all other proximate components showed significantly higher amounts in peels compared with pulp. Fiber and ash contents were significantly higher in peels compared with pulps for all three fruits with a mean difference of L=10.1g, O= 9.29g, G= 10.19g for fiber and L= 0.18g, O=0.37g, G=0.10g for ash. Protein and carbohydrate were found in higher quantity in peels of Samples O and L (mean difference L=0.38g, O=0.15g for protein and L=8.1g, O=13.86g) while significantly lower in the peel of sample G (mean difference protein=1.14g, carbohydrate=0.98g). Antioxidant capacity, total phenolic content and chelating activity were found to be significantly higher in peels of L, O, and G though these contents were not significantly correlated (p>0.05) to one another. The findings of this study show that citrus fruits are a rich source of nutrients as well as phytochemicals. The peels of citrus fruits can serve as better sources of antioxidants, phenolic content, chelating properties, and some nutrients than their pulps. This study provides evidence for the benefits of utilizing peels at the household level while reducing food waste. Keywords: Phytochemicals, Citrus fruits, Citrus peels, Non‐nutrients, Health, Functional foods.
6. Fiza, S., Imran, S., & Tanweer, A. (2020). Thermal processing and lycopene content of tomatoes‐a public health perspective. NURTURE: Journal of Pakistan Home Economics Association, 14(1), 12‐17. (Afifa Tanweer (Department of Nutrition Sciences\SHS) Abstract: In this era of rising prevalence of chronic health conditions, functional properties of fruits and vegetables are of utmost emphasis. Lycopene, belonging to class of carotenoids, is one of the chief phytochemical known for being a natural colorant as well as for providing health benefits. Tomatoes are a major source of lycopene in the diet. However, tomatoes are not only used in raw but also in processed and cooked format in cuisines round the world. This necessitates the optimization of functional properties of cooked tomato products. The current study aims at describing potential health benefits of processed tomato puree through studying its lycopene content at various temperatures. A before and after 3 X 3 factorial experimental study design was used for this study. A comparison of lycopene content of tomatoes under following variants of processing was carried out: temperature (raw vs.75°C vs. 88°C) and time (5 vs.15 vs.30 minutes). Findings indicate that cooking improved the available lycopene content in tomato puree. Maximum values of lycopene were noted after treatment at 88 °C for 30 minutes (4.7 mg/100g compared to 0.20 mg/100g in raw). Optimization of lycopene content of cooked tomato puree by conscious monitoring of processing time and temperature would aid in achieving this goal. Keywords: lycopene, phytochemicals, thermal processing, retention, tomatoes.
Book/Book Chapters 1. Bacha, U., Rozman, U., & Turk, S. Š. (Eds.). (2020). Healthcare Access: Regional Overviews: intechopen. (Umar Bacha (Nutrition Sciences/SHS) Abstract: Healthcare Access ‐ Regional Overviews is a compilation of ten chapters consisting of case studies, research works, reviews, and expert opinions providing insight on the previous and current developments in the field of hygiene and infection control with practices to prevent or minimize the spread of infectious diseases. The book also addresses the status and healthcare access of the most neglecte. Keywords: not available. School of Food and Agricultural Sciences (SFAS) Department of Food and Agricultural Science Research Articles 1. Ma, Z., Zhao, Y., Khalid, N., Shu, G., Neves, M. A., Kobayashi, I., & Nakajima, M. (2020). Comparative study of oil‐ Research Outlook 2020 | 219
in‐water emulsions encapsulating fucoxanthin formulated by microchannel emulsification and high‐pressure homogenization. Food Hydrocolloids, 108, 105977. doi: https://doi.org/10.1016/j.foodhyd.2020.105977. (Nauman Khalid (SFAS) Abstract: In this study, we investigated the formulation and stability characteristics of monodisperse oil‐in‐water (O/W) emulsions encapsulating fucoxanthin using straight‐through microchannel emulsification (MCE). Monodisperse O/W emulsions stabilized by hydrophilically modified lecithin (ML), whey protein isolate (WPI), or polyoxyethylene (20) sorbitan monolaurate (Tw20) were stably formulated using straight‐through MCE. The resulting emulsions maintained the droplet sizes steadily at 30.3 ± 0.2 μm (ML), 32.3 ± 0.1 μm (WPI) and 29.0 ± 0.8 μm (Tw20) and the relative span factor (RSF) < 0.5 after 30 days storage at 25 °C. The fucoxanthin
retention (RTf) in the collected emulsions, decreased from 100% to 44.3 ± 0.1% (ML), 90.7 ± 5.4% (WPI) and 51.4 ± 10.6% (Tw20) after storage. Subsequently, we compared the characteristics of O/W emulsions which were formulated by 1 wt% Tw20 using high‐pressure homogenization (HPH) and MCE under the same storage and digestion conditions. After 15 days storage at 4, 25 and 50 °C, all emulsions revealed good physical stability, and there was no drastic change in the droplet sizes. In terms of chemical stability, MCE was pronouncedly better than HPH at the same level of storage temperature. In contrast, the free fatty acids (FFAs) release and fucoxanthin bioaccessibility in emulsions using HPH were significantly higher than MCE. The findings of our study give useful information for food and pharmaceutical industries which express more concern about the natural bioactive compounds for usage. Keywords: monodisperse emulsions, fucoxanthin, microchannel emulsification, droplet generation, physical and chemical stability, bioaccessibility.
2. Khan, F., Iqbal, S., Khalid, N., Hussain, I., Hussain, Z., Szmigielski, R., & Janjua, H. A. (2020). Screening and stability testing of commercially applicable Heliotropium crispum silver nanoparticle formulation with control over aging and biostability. Applied Nanoscience, 10(6), 1941‐1956. doi: 10.1007/s13204‐020‐01333‐x. (Nauman Khalid (SFAS) Abstract: Heliotropium crispum‐mediated assembly of silver nanoparticles exhibit profound antibacterial and anti‐biofilm effects against multiple drug‐resistant bacteria, but its stability and biocompatibility remain a hurdle in commercialization. Herein, we adopted a surface chemistry‐based steric repulsion approach to investigate the colloidal stability of H. crispum silver nanoparticles (HC‐AgNPs) and determine its application as a commercial antibacterial formulation. Two primary silver nanoparticles (AgNPs) were synthesized, i.e., HC‐AgNPs and citrate‐ HC‐AgNPs initially, which were then modulated to assemble various derivatives of AgNPs using polyethylene glycol (PEG) and polyvinylpyrrolidone (PVP) as stabilizing agents. Various parameters were assessed to investigate the morphology, colloidal physio‐chemistry, and surface capping using various analytical techniques, such as UV–Vis spectrophotometer, zeta–dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM, and transmission electron microscopy (TEM). Selective AgNPs were then screened on the basis of stability for up to 8 months, heat resistance at 100 °C, and bioactivity via MTT assay using HEP‐2, MCF‐7, and HCEC cell lines. The UV–Vis and electron microscope results revealed that HC‐AgNPs confer near‐spherical and slight triangular‐shaped morphology and the size of all synthesized AgNPs is in the range of 400–450 nm. All AgNPs synthesized from HC‐source have characteristic FTIR peaks recorded near 2931 cm−1, 1996 cm−1, and 825 cm−1. This study highlights promising evidence for the commercial application of HC‐AgNPs as an antimicrobial agent. Additionally, it provides a methodology for modulating the surface capping of biological nanoparticles and assesses its corresponding effect on the stability. Keywords: heliotropium crispum, silver nanoparticles, bioactivity, surface capping, biostability.
3. Amin, A., Ahmed, I., Khalid, N., Khan, I. U., Ali, A., Dahlawi, S. M., & Li, W.‐J. (2020). Insights on comparative bacterial diversity between different arid zones of Cholistan Desert, Pakistan. 3 Biotech, 10(5), 224. doi: Research Outlook 2020 | 220
10.1007/s13205‐020‐02204‐6. (Nauman Khalid (SFAS) Abstract: The present study was conducted to analyze bacterial diversity profle of Cholistan desert located in Pakistan. The study investigates the infuence of physicochemical parameters of soil on distribution of diferent bacteria at all taxonomic levels and also study the distribution pattern between diferent desert environments, particularly rhizospheric and bulk desert sands. Species richness showed phyla Proteobacteria and Chlorofexi as the dominant OTUs in all the samples. Besides the two phyla, the rhizospheric soils with root remnants were dominated by Firmicutes, Deinococcus‐Thermus, Actinobacteria and Acidobacteri, while phylum Thermotogae was present in signifcant quantity in rhizosheaths devoid of roots. In nonrhizospheric desert soils, a considerable number of OTUs belonged to phyla Proteobacteria, Chlorofexi, Bacteroidetes and Acidobacteria. An important fnding from this study is that a bulk portion of the OTUs were assigned to unclassifed taxa, indicating a large repertoire of unexplored taxa in the desert ecology of Pakistan. Distribution of taxonomic groups among various regions of the desert was collaborating well with the physicochemical parameters of the sites. The fndings of this study establish the fundamental relationships between desert ecosystem, specifc native plant and the total bacterial fora. This is the frst study of microbial community analysis of any desert in Pakistan and thus, will serve as a future platform to explore further on desert ecosystem functioning by employing the ever‐changing biotechnological tools. Keywords: bacterial community, desert sand, pyrosequencing, rhizosphere, 16S rRNA.
4. Collaborators, L. D. B. o. M. (2020). Mapping local patterns of childhood overweight and wasting in low‐and middle‐income countries between 2000 and 2017. Nature medicine, 26(5), 750‐759. (Nauman Khalid (SFAS) Abstract: A double burden of malnutrition occurs when individuals, household members or communities experience both undernutrition and overweight. Here, we show geospatial estimates of overweight and wasting prevalence among children under 5 years of age in 105 low‐ and middle‐income countries (LMICs) from 2000 to 2017 and aggregate these to policy‐relevant administrative units. Wasting decreased overall across LMICs between 2000 and 2017, from 8.4% (62.3 (55.1–70.8) million) to 6.4% (58.3 (47.6–70.7) million), but is predicted to remain above the World Health Organization’s Global Nutrition Target of <5% in over half of LMICs by 2025. Prevalence of overweight increased from 5.2% (30 (22.8–38.5) million) in 2000 to 6.0% (55.5 (44.8–67.9) million) children aged under 5 years in 2017. Areas most affected by double burden of malnutrition were located in Indonesia, Thailand, southeastern China, Botswana, Cameroon and central Nigeria. Our estimates provide a new perspective to researchers, policy makers and public health agencies in their efforts to address this global childhood syndemic. Keywords: obesity, risk factors, signs and symptoms, malnutrition.
5. Lara, G. R., Uemura, K., Khalid, N., Kobayashi, I., Takahashi, C., Nakajima, M., & Neves, M. A. (2020). Layer‐by‐ Layer Electrostatic Deposition of Edible Coatings for Enhancing the Storage Stability of Fresh‐Cut Lotus Root (Nelumbo nucifera). Food and Bioprocess Technology, 13(4), 722‐726. doi: 10.1007/s11947‐020‐02410‐3. (Nauman Khalid (SFAS) Abstract: Various strategies have been employed to improve the storage stability of fresh‐cut lotus root, which is prone to undesirable changes such as enzymatic oxidation. In our research, we targeted the formulation of polysaccharide‐based edible coatings with different ionic charges from natural gum sources, such as guar gum, xanthan gum, and chitosan, due to the limited information regarding its application as coating material for fresh‐ cut lotus root. We have also compared the effect of single layer coatings versus layer‐by‐layer deposition as edible coating techniques for fresh‐cut lotus root. Our results have shown that layer‐by‐layer coatings consisting of xanthan gum and chitosan were the most effective among all treatments, thereby reducing whiteness color (L*) changes and weight loss up to 60% and 86%, respectively. Overall, the layer‐by‐layer coating technique was Research Outlook 2020 | 221
more effective than single layer coating, which shows a promising strategy to increase the storage stability of fresh‐cut lotus root especially during transport and distribution. Keywords: edible coating, layer‐by‐layer deposition, stability, fresh‐cut, enzymatic browning.
6. Khan, S. (2020). Plague of Smog in Lahore, Pakistan: A Choking Situation. Asia Pacific Journal of Public Health, 32(2‐ 3), 133‐133. doi: 10.1177/1010539520917814. (Sipper Khan (SFAS) (Letter to editor) Abstract: Not available. Keywords: not available.
7. Ishaq, A., Rahman, U. u., Sahar, A., Perveen, R., Deering, A. J., Khalil, A. A., . . . Siddique, U. (2020). Potentiality of analytical approaches to determine gelatin authenticity in food systems: A review. LWT‐ food science and technology, 121, 108968. doi: https://doi.org/10.1016/j.lwt.2019.108968. (Ubaid ur Rahman (SFAS) Abstract: Authentication of gelatin in food matrices comes in prominence since various religious and cultural communities have selectivity and sensitivity regarding the consumption of various ingredients. Globally, several methods have been investigated to classify unknown gelatin into its species of origin. The most common techniques employed to distinguish different gelatin sources include calcium phosphate precipitation, amino acid analysis and ELISA but the major bottlenecks associated with the use of these approaches are the need of repeated results, intensive labor requirements and experience. To overcome the nuisance, other reliable, fast and modern techniques have also been introduced which have shown the potential to differentiate the various gelatin sources. These approaches include FTIR spectroscopy, HPLC, PCR, ELISA, ESI‐LC‐MS/MS, MALDI‐TOF, Nano‐UPLC‐ESIQ‐TOF‐MSE, UPLC/Q‐TOF‐MS and SPR biosensors. Accordingly, the major desideratum of the current treatise is to highlight the potential of various methods to discern the origin of gelatin. Keywords: gelatin authenticity, ftir spectroscopy, real‐time PCR, MALDI‐TOF, ELISA.
8. Taarji, N., Vodo, S., Bouhoute, M., Khalid, N., Hafidi, A., Kobayashi, I., . . . Nakajima, M. (2020). Preparation of monodisperse O/W emulsions using a crude surface‐active extract from argan by‐products in microchannel emulsification. Colloids and Surfaces A: Physicochemical and Engineering Aspects, 585, 124050. doi: https://doi.org/10.1016/j.colsurfa.2019.124050. (Nauman Khalid (SFAS) Abstract: In this study, we evaluated the performance of a mildly derived extract from argan by‐products in microchannel emulsification (MCE). Our aim is to produce stable monodisperse O/W emulsions using this extract as a sole emulsifier. Preliminary investigations about the characteristics of argan extract indicated the potential interaction between surface‐active components (i.e. saponins, proteins), in bulk phase prior to adsorption at the oil/water interface, resulting in the formation of biogenic complexes with strong interfacial properties. This is important for successful MCE as this technique depends exclusively on dynamic interfacial tension reduction for droplet formation. Nevertheless, upon performance of emulsification experiments, we also found that the complex composition of this extract could counteract its emulsifying efficiency, by creating a hydrophobic, or slightly hydrophilic, layer on the MC array plate surface. This resulted in unsuccessful emulsification using short MCs but did not affect the emulsification behavior in longer ones. Using longer MCs, we could produce stable monodisperse O/W emulsions, with similar droplet size (∼ 36 μm) and droplet size distribution (Relative span factor <0.25) to those obtained using Tween 80, and for up to 10 h of continuous emulsification. Keywords: argan by‐products, crude emulsifying extract, monodisperse emulsion, microchannel emulsification.
9. Rafiq, L., Zahoor, T., Sagheer, A., Khalid, N., Rahman, U. U., & Liaqat, A. (2020). Augmenting yogurt quality attributes through hydrocolloidal gums. Asian‐Australasian journal of animal sciences, 33(2), 323‐331. doi: 10.5713/ajas.18.0218. (Ubaid ur Rahman (SFAS) Abstract: Objective: The present work was undertaken to determine the possibility of using xanthan and guar Research Outlook 2020 | 222
gums as stabilizers to enhance the yogurt quality. Methods: Yogurt was manufactured from standardized milk (3.5% fat, 8.5% solid‐not‐fat contents) with the addition of 2% to 3% starter culture. Enzyme‐hydrolyzed xanthan gum (0.1%, 0.5%, 1.0%) and guar gum (0.1%, 0.5%, 1.0%) were added to the yogurt as stabilizers. Prepared yogurt samples were kept at refrigeration temperature (4°C±2°C) for 21 days and various quality and sensory parameters were studied at regular intervals (7 days). Results: Results showed that yogurt with 0.5% xanthan gum (T5) was best in terms of preventing syneresis and improving the viscosity, water holding capacity and texture of the product. Additionally, adding gums did not adversely affect the sensorial attributes of the product. Conclusion: Modified gums were found useful in augmenting yogurt quality and therefore addition of gums is highly recommended for manufacturing yogurt. Keywords: yogurt, syneresis, viscosity, xanthan gum, guar gum.
10. Melanie, H., Taarji, N., Zhao, Y., Khalid, N., Neves, M. A., Kobayashi, I., . . . Nakajima, M. (2020). Formulation and characterisation of O/W emulsions stabilised with modified seaweed polysaccharides. International Journal of Food Science & Technology, 55(1), 211‐221. doi: 10.1111/ijfs.14264. (Nauman Khalid (SFAS) Abstract: In this study, seaweed polysaccharides (alginate and carrageenan) were modified with dodecenylsuccinic anhydride (DSA), and their stabilising properties in oil‐in‐water (O/W) emulsion system were evaluated. The physicochemical characteristics were determined by droplet size, interfacial tension and ζ‐ potential and structurally verified by Fourier transform infrared spectroscopy (FTIR). Both CRG‐DSA and ALG‐DSA applied in O/W emulsion system exhibited smaller droplet sizes over the increasing concentration and were more stable during storage than native ones. The ζ‐potential of DSA‐modified seaweed polysaccharides has more negative charge compared with their native forms, owing to the additional carboxyl groups from modification reaction. In addition, DSA‐modified seaweed polysaccharides decreased the interfacial tension at soybean oil– water interface from 23.1 and 23.9 mN m−1 to 14.2 and 13.6 mN m−1, respectively. The successful modification reaction was confirmed by FTIR analysis. This study demonstrated that DSA‐modified seaweed polysaccharides may serve as prospective emulsifiers in food, pharmaceutical and other industrial fields. Keywords: Alginate, carrageenan, dodecenylsuccinic anhydride, O/W emulsion, physicochemical property.
11. Ishaq, A., Ebner, P. D., Syed, Q. A., & Ubaid‐ur‐Rahman, H. (2020). Employing list‐shield bacteriophage as a bio‐ control intervention for Listeria monocytogenes from raw beef surface and maintain meat quality during refrigeration storage. LWT, 132, 109784. doi: https://doi.org/10.1016/j.lwt.2020.109784. (Hafiz Ubaid‐ur‐ Rahman (SFAS) Abstract: Meat and meat‐based products represent augmented food safety concern due to their high susceptibility towards spoilage and ideal growth conditions for microorganisms. Therefore, it is vital to introduce safe, environment‐friendly and economic antimicrobial strategies for ensuring the safety of meat. In this regard, biological interventions are gaining attention globally. In the present exploration, we found that Listeria monocytogenes can survive and grow on raw beef surface at refrigeration temperature i.e., 4 ± 1 °C. Additionally, we examined the effect of applying List‐Shield bacteriophage on reducing L. monocytogenes numbers in experimentally contaminated beef samples. A significant reduction of approximately 2.3 logs was recorded in phage‐treated beef samples during the storage period of 15 days. Furthermore, phage did not adversely affect the color and pH values of stored beef samples. In addition, a significantly lower purge (3.37%) and nitrogenous losses (TVBN = 22.82 mg N/100 g) were attained by the beef samples treated with bacteriophage at the termination stage of storage. The study concluded that use of bacteriophage can be adopted as an innovative antimicrobial strategy to mitigate the growth of pathogenic bacteria from meat surface. Keywords: meat safety, food pathogens, bacteriophage, food biocontrol, meat quality.
Research Outlook 2020 | 223
12. Iqbal, R., Mehmood, Z., Baig, A., & Khalid, N. (2020). Formulation and characterization of food grade O/W nanoemulsions encapsulating quercetin and curcumin: Insights on enhancing solubility characteristics. Food and Bioproducts Processing, 123, 304‐311. doi: https://doi.org/10.1016/j.fbp.2020.07.013. (Rashid Iqbal, Nauman Khalid (SFAS) Abstract: Solubility of bioactive compounds (curcumin and quercetin) in aqueous phase is challenging while developing an emulsion‐based delivery system. Therefore, this study was designed to enhance the solubility of curcumin and quercetin in oil‐in‐water (O/W) nanoemulsions using modified starch (HI‐Cap‐100) as an emulsifier. The effect of different processing conditions (pH, ionic strength and temperature) were investigated on the mean droplet diameter and ζ‐potential over the period of 5 months. It was found that the nanoemulsions containing 5% (w/w) HI‐CAP‐100 along with 10% oil (w/w) yielded the most stable formulation with a mean particle size of 175.44 nm. Solubility of quercetin and curcumin was found to be maximum in nanoemulsions (2.07 and 39 times respectively) as compared to oil and water. Furthermore, stability of the emulsions under varying ionic strength (0.1−1 M NaCl) and pH (2–7) was found to be higher. Overall, it can be concluded that stability of nanoemulsions can be enhanced using natural ingredients. Keywords: nanoemulsions, solubility, modified starch, curcumin, quercetin, droplet diameter.
13. Reiner, R. C., Wiens, K. E., Deshpande, A., Baumann, M. M., Lindstedt, P. A., Khalid, N., . . . Hay, S. I. (2020). Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low‐income and middle‐ income countries, 2000–17: analysis for the Global Burden of Disease Study 2017. The Lancet, 395(10239), 1779‐ 1801. doi: https://doi.org/10.1016/S0140‐6736(20)30114‐8. (Nauman Khalid (SFAS) Abstract: Background: Across low‐income and middle‐income countries (LMICs), one in ten deaths in children younger than 5 years is attributable to diarrhoea. The substantial between‐country variation in both diarrhoea incidence and mortality is attributable to interventions that protect children, prevent infection, and treat disease. Identifying subnational regions with the highest burden and mapping associated risk factors can aid in reducing preventable childhood diarrhoea. Methods: We used Bayesian model‐based geostatistics and a geolocated dataset comprising 15 072 746 children younger than 5 years from 466 surveys in 94 LMICs, in combination with findings of the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2017, to estimate posterior distributions of diarrhoea prevalence, incidence, and mortality from 2000 to 2017. From these data, we estimated the burden of diarrhoea at varying subnational levels (termed units) by spatially aggregating draws, and we investigated the drivers of subnational patterns by creating aggregated risk factor estimates. Findings: The greatest declines in diarrhoeal mortality were seen in south and southeast Asia and South America, where 54∙0% (95% uncertainty interval [UI] 38∙1–65∙8), 17∙4% (7∙7–28∙4), and 59∙5% (34∙2–86∙9) of units, respectively, recorded decreases in deaths from diarrhoea greater than 10%. Although children in much of Africa remain at high risk of death due to diarrhoea, regions with the most deaths were outside Africa, with the highest mortality units located in Pakistan. Indonesia showed the greatest within‐country geographical inequality; some regions had mortality rates nearly four times the average country rate. Reductions in mortality were correlated to improvements in water, sanitation, and hygiene (WASH) or reductions in child growth failure (CGF). Similarly, most high‐risk areas had poor WASH, high CGF, or low oral rehydration therapy coverage. Interpretation: By co‐analysing geospatial trends in diarrhoeal burden and its key risk factors, we could assess candidate drivers of subnational death reduction. Further, by doing a counterfactual analysis of the remaining disease burden using key risk factors, we identified potential intervention strategies for vulnerable populations. In view of the demands for limited resources in LMICs, accurately quantifying the burden of diarrhoea and its drivers is important for precision public health. Keywords: not available.
Research Outlook 2020 | 224
14. Tsogtoo, B., Taarji, N., Melanie, H., Khalid, N., . . . Nakajima, M. (2020). Emulsion‐based extraction of β‐sitosterol and carotenoids from sea buckthorn (Hippophae rhamnoides) pomace. International Food Research Journal, 27(1), 55‐65. (Nauman Khalid (SFAS) Abstract: In the present work, we investigated oil‐in‐water (O/W) emulsion‐based extraction of β‐sitosterol and carotenoids from sea buckthorn pomace. We compared this new green extraction method with conventional extraction using organic solvents and oils. The objective of the present work was to evaluate the efficiency of these different extraction systems on the yields of bioactive compounds from plant‐based materials, and to determine the optimum extraction conditions for maximum extraction yield. Our results indicated that O/W emulsions, prepared without emulsifier using a high‐pressure homogeniser, had the highest extraction capability for β‐sitosterol and carotenoids, as compared to the other extraction systems. The optimum conditions were 65°C for 1 h extraction, using emulsifier‐free soybean O/W emulsions. Under these conditions, the extracted amounts were up to 32.0 mg/g dw (dry weight) for β‐sitosterol and 1.44 mg/g dw for total carotenoids. The obtained compounds were relatively stable at 5°C and 25°C for up to 28 days of storage. This emulsion‐based extraction method is promising for the extraction of β‐sitosterol and carotenoids that can be further applied into dietary nutritional supplements and fortified food. Keywords: green extraction method, bioactive compound, triacylglycerol, oil‐in‐water emulsion, organic solvent, extraction yield.
15. Sadiq, S., Rana, N. F., Zahid, M. A., Zargaham, M. K., Tanweer, T., Batool, A., Naeem, A., Nawaz, A., Rizwan‐Ur‐ Rehman, Muneer, Z., & Siddiqi, A. R. (2020). Virtual Screening of FDA‐Approved Drugs against LasR of Pseudomonas aeruginosa for Antibiofilm Potential. Molecules (Basel, Switzerland), 25(16), 3723. https://doi.org/10.3390/molecules25163723. (Rizwan‐ur‐Rehman (SFAS) Abstract: Pseudomonas aeruginosa is a Gram‐negative pathogenic bacterium that is present commonly in soil and water and is responsible for causing septic shock, pneumonia, urinary tract and gastrointestinal infections, etc. The multi‐drug resistance (MDR) phenomenon has increased dramatically in past years and is now considered a major threat globally, so there is an urgent need to develop new strategies to overcome drug resistance by P. aeruginosa. In P. aeruginosa, a major factor of drug resistance is associated to the formation of biofilms by the LasR enzyme, which regulates quorum sensing and has been reported as a new therapeutic target for designing novel antibacterial molecules. In this study, virtual screening and molecular docking were performed against the ligand binding domain (LBD) of LasR by employing a pharmacophore hypothesis for the screening of 2373 FDA‐approved compounds to filter top‐scoring hit compounds. Six inhibitors out of 2373 compounds were found to have binding affinities close to that of known LasR inhibitors. The binding modes of these compounds to the binding site in LasR‐LBD were analyzed to identify the key interactions that contribute to the inhibition of LasR activity. Then, 50 ns simulations of top hit compounds were performed to elucidate the stability of their binding conformations with the LasR‐LBD. This study, thus concluded that sulfamerazine showed the highest binding affinity for the LasR‐LBD binding pocket exhibiting strong inhibitory binding interactions during molecular dynamics (MD) simulation. Keywords: LasR inhibitors, virtual screening, pharmaco‐informatics.
16. Dahlawi, S. M., Nazir, W., Iqbal, R., Asghar, W., & Khalid, N. (2020). Formulation and characterization of oil‐in‐water nanoemulsions stabilized by crude saponins isolated from onion skin waste. RSC Advances, 10(65), 39700‐39707. https://doi.org/10.1039/d0ra07756a. (Wahab Nazir, Rashid Iqbal, Waqas Asghar (SFAS) Abstract: In the current work, a detailed study of crude saponins isolated from onion skin waste (OSW) was carried out to minimize the interfacial tension (γ) at oil–water interfaces, and to evaluate important factors on the formulation and characterization of nanoemulsions (NEs) stabilized by OSW saponins as a new natural Research Outlook 2020 | 225
emulsifier. It was found that OSW saponins are moderately strong surface‐active agents. The droplet size of OSW saponin‐stabilized NEs formulated by a high‐pressure homogenizer was significantly dependent on processing parameters, where volume mean droplet diameter (d4,3) decreased as homogenization pressure and emulsifier concentration increased. The d4,3 of NEs formulated from soybean oil, sunflower oil, and medium‐chain triglyceride (MCT) oil was <140 nm, which was much smaller than those prepared using orange oil (d4,3 > 800 nm). The OSW saponin‐coated droplets in soybean‐based NEs showed stability against thermal treatment (30– 90 °C, 30 min), pH (7–9), and ionic strength (NaCl < 50 mM). The NEs exhibited instability with droplet coalescence at relatively low pH (3–6), and high ionic strength (NaCl > 50 mM). The NEs stabilized by 0.5–1% (w/w) OSW were highly stable without an increase in d4,3 during the storage (60 days) at 25 °C. Overall, these results suggest that OSW saponins are an efficient natural emulsifier, with significant potential to replace synthetic emulsifiers in certain practical applications. Keywords: not available.
17. Vos, T., Lim, S. S., Abbafati, C., Abbas, K. M., Abbasi, M., Khalid, N., . . . . Murray, C. J. L. (2020). Global burden of 369 diseases and injuries in 204 countries and territories, 1990–2019: a systematic analysis for the Global Burden of Disease Study 2019. The Lancet, 396(10258), 1204‐1222. doi: https://doi.org/10.1016/S0140‐6736(20)30925‐ 9. (Nauman Khalid (SFAS) Abstract: Background: In an era of shifting global agendas and expanded emphasis on non‐communicable diseases and injuries along with communicable diseases, sound evidence on trends by cause at the national level is essential. The Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) provides a systematic scientific assessment of published, publicly available, and contributed data on incidence, prevalence, and mortality for a mutually exclusive and collectively exhaustive list of diseases and injuries. Methods: GBD estimates incidence, prevalence, mortality, years of life lost (YLLs), years lived with disability (YLDs), and disability‐adjusted life‐years (DALYs) due to 369 diseases and injuries, for two sexes, and for 204 countries and territories. Input data were extracted from censuses, household surveys, civil registration and vital statistics, disease registries, health service use, air pollution monitors, satellite imaging, disease notifications, and other sources. Cause‐specific death rates and cause fractions were calculated using the Cause of Death Ensemble model and spatiotemporal Gaussian process regression. Cause‐specific deaths were adjusted to match the total all‐cause deaths calculated as part of the GBD population, fertility, and mortality estimates. Deaths were multiplied by standard life expectancy at each age to calculate YLLs. A Bayesian meta‐ regression modelling tool, DisMod‐MR 2.1, was used to ensure consistency between incidence, prevalence, remission, excess mortality, and cause‐specific mortality for most causes. Prevalence estimates were multiplied by disability weights for mutually exclusive sequelae of diseases and injuries to calculate YLDs. We considered results in the context of the Socio‐demographic Index (SDI), a composite indicator of income per capita, years of schooling, and fertility rate in females younger than 25 years. Uncertainty intervals (UIs) were generated for every metric using the 25th and 975th ordered 1000 draw values of the posterior distribution. Findings: Global health has steadily improved over the past 30 years as measured by age‐standardised DALY rates. After taking into account population growth and ageing, the absolute number of DALYs has remained stable. Since 2010, the pace of decline in global age‐standardised DALY rates has accelerated in age groups younger than 50 years compared with the 1990–2010 time period, with the greatest annualised rate of decline occurring in the 0–9‐year age group. Six infectious diseases were among the top ten causes of DALYs in children younger than 10 years in 2019: lower respiratory infections (ranked second), diarrhoeal diseases (third), malaria (fifth), meningitis (sixth), whooping cough (ninth), and sexually transmitted infections (which, in this age group, is fully accounted for by congenital syphilis; ranked tenth). In adolescents aged 10–24 years, three injury causes were among the top causes of DALYs: road injuries (ranked first), self‐harm (third), and interpersonal violence (fifth). Five of the causes that were in the top ten for ages 10–24 years were also in the Research Outlook 2020 | 226
top ten in the 25–49‐year age group: road injuries (ranked first), HIV/AIDS (second), low back pain (fourth), headache disorders (fifth), and depressive disorders (sixth). In 2019, ischaemic heart disease and stroke were the top‐ranked causes of DALYs in both the 50–74‐year and 75‐years‐and‐older age groups. Since 1990, there has been a marked shift towards a greater proportion of burden due to YLDs from non‐communicable diseases and injuries. In 2019, there were 11 countries where non‐communicable disease and injury YLDs constituted more than half of all disease burden. Decreases in age‐standardised DALY rates have accelerated over the past decade in countries at the lower end of the SDI range, while improvements have started to stagnate or even reverse in countries with higher SDI. Interpretation: As disability becomes an increasingly large component of disease burden and a larger component of health expenditure, greater research and development investment is needed to identify new, more effective intervention strategies. With a rapidly ageing global population, the demands on health services to deal with disabling outcomes, which increase with age, will require policy makers to anticipate these changes. The mix of universal and more geographically specific influences on health reinforces the need for regular reporting on population health in detail and by underlying cause to help decision makers to identify success stories of disease control to emulate, as well as opportunities to improve. Keywords: not available.
18. Wang, H., Abbas, K. M., Abbasifard, M., Abbasi‐Kangevari, M., Abbastabar, H., Khalid, N., . . . Murray, C. J. L. (2020). Global age‐sex‐specific fertility, mortality, healthy life expectancy (HALE), and population estimates in 204 countries and territories, 1950–2019: a comprehensive demographic analysis for the Global Burden of Disease Study 2019. The Lancet, 396(10258), 1160‐1203. doi: https://doi.org/10.1016/S0140‐6736(20)30977‐6. (Nauman Khalid (SFAS) Abstract: Background: Accurate and up‐to‐date assessment of demographic metrics is crucial for understanding a wide range of social, economic, and public health issues that affect populations worldwide. The Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019 produced updated and comprehensive demographic assessments of the key indicators of fertility, mortality, migration, and population for 204 countries and territories and selected subnational locations from 1950 to 2019. Methods: 8078 country‐years of vital registration and sample registration data, 938 surveys, 349 censuses, and 238 other sources were identified and used to estimate age‐specific fertility. Spatiotemporal Gaussian process regression (ST‐GPR) was used to generate age‐specific fertility rates for 5‐year age groups between ages 15 and 49 years. With extensions to age groups 10–14 and 50–54 years, the total fertility rate (TFR) was then aggregated using the estimated age‐specific fertility between ages 10 and 54 years. 7417 sources were used for under‐5 mortality estimation and 7355 for adult mortality. ST‐GPR was used to synthesise data sources after correction for known biases. Adult mortality was measured as the probability of death between ages 15 and 60 years based on vital registration, sample registration, and sibling histories, and was also estimated using ST‐GPR. HIV‐free life tables were then estimated using estimates of under‐5 and adult mortality rates using a relational model life table system created for GBD, which closely tracks observed age‐specific mortality rates from complete vital registration when available. Independent estimates of HIV‐specific mortality generated by an epidemiological analysis of HIV prevalence surveys and antenatal clinic serosurveillance and other sources were incorporated into the estimates in countries with large epidemics. Annual and single‐year age estimates of net migration and population for each country and territory were generated using a Bayesian hierarchical cohort component model that analysed estimated age‐specific fertility and mortality rates along with 1250 censuses and 747 population registry years. We classified location‐years into seven categories on the basis of the natural rate of increase in population (calculated by subtracting the crude death rate from the crude birth rate) and the net migration rate. We computed healthy life expectancy (HALE) using years lived with disability (YLDs) per capita, life tables, and standard demographic methods. Uncertainty was propagated throughout the demographic estimation process, Research Outlook 2020 | 227
including fertility, mortality, and population, with 1000 draw‐level estimates produced for each metric. Findings: The global TFR decreased from 2∙72 (95% uncertainty interval [UI] 2∙66–2∙79) in 2000 to 2∙31 (2∙17– 2∙46) in 2019. Global annual livebirths increased from 134∙5 million (131∙5–137∙8) in 2000 to a peak of 139∙6 million (133∙0–146∙9) in 2016. Global livebirths then declined to 135∙3 million (127∙2–144∙1) in 2019. Of the 204 countries and territories included in this study, in 2019, 102 had a TFR lower than 2∙1, which is considered a good approximation of replacement‐level fertility. All countries in sub‐Saharan Africa had TFRs above replacement level in 2019 and accounted for 27∙1% (95% UI 26∙4–27∙8) of global livebirths. Global life expectancy at birth increased from 67∙2 years (95% UI 66∙8–67∙6) in 2000 to 73∙5 years (72∙8–74∙3) in 2019. The total number of deaths increased from 50∙7 million (49∙5–51∙9) in 2000 to 56∙5 million (53∙7–59∙2) in 2019. Under‐5 deaths declined from 9∙6 million (9∙1–10∙3) in 2000 to 5∙0 million (4∙3–6∙0) in 2019. Global population increased by 25∙7%, from 6∙2 billion (6∙0–6∙3) in 2000 to 7∙7 billion (7∙5–8∙0) in 2019. In 2019, 34 countries had negative natural rates of increase; in 17 of these, the population declined because immigration was not sufficient to counteract the negative rate of decline. Globally, HALE increased from 58∙6 years (56∙1–60∙8) in 2000 to 63∙5 years (60∙8– 66∙1) in 2019. HALE increased in 202 of 204 countries and territories between 2000 and 2019. Interpretation: Over the past 20 years, fertility rates have been dropping steadily and life expectancy has been increasing, with few exceptions. Much of this change follows historical patterns linking social and economic determinants, such as those captured by the GBD Socio‐demographic Index, with demographic outcomes. More recently, several countries have experienced a combination of low fertility and stagnating improvement in mortality rates, pushing more populations into the late stages of the demographic transition. Tracking demographic change and the emergence of new patterns will be essential for global health monitoring. Keywords: not available.
19. Murray, C. J. L., Abbafati, C., Abbas, K. M., Abbasi, M., Abbasi‐Kangevari, M., Khalid, N.,. . . Lim, S. S. (2020). Five insights from the Global Burden of Disease Study 2019. The Lancet, 396(10258), 1135‐1159. doi: https://doi.org/10.1016/S0140‐6736(20)31404‐5. (Nauman Khalid (SFAS) Abstract: The Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019 provides a rules‐based synthesis of the available evidence on levels and trends in health outcomes, a diverse set of risk factors, and health system responses. GBD 2019 covered 204 countries and territories, as well as first administrative level disaggregations for 22 countries, from 1990 to 2019. Because GBD is highly standardised and comprehensive, spanning both fatal and non‐fatal outcomes, and uses a mutually exclusive and collectively exhaustive list of hierarchical disease and injury causes, the study provides a powerful basis for detailed and broad insights on global health trends and emerging challenges. GBD 2019 incorporates data from 281 586 sources and provides more than 3∙5 billion estimates of health outcome and health system measures of interest for global, national, and subnational policy dialogue. All GBD estimates are publicly available and adhere to the Guidelines on Accurate and Transparent Health Estimate Reporting. From this vast amount of information, five key insights that are important for health, social, and economic development strategies have been distilled. These insights are subject to the many limitations outlined in each of the component GBD capstone papers. Keywords: not available.
20. Murray, C. J. L., Aravkin, A. Y., Zheng, P., Abbafati, C., Abbas, K. M., Khalid, N., . . . . Lim, S. S. (2020). Global burden of 87 risk factors in 204 countries and territories, 1990–2019: a systematic analysis for the Global Burden of Disease Study 2019. The Lancet, 396(10258), 1223‐1249. doi: https://doi.org/10.1016/S0140‐6736(20)30752‐2. (Nauman Khalid (SFAS) Abstract: Background: Rigorous analysis of levels and trends in exposure to leading risk factors and quantification of their effect on human health are important to identify where public health is making progress and in which cases current efforts are inadequate. The Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019 Research Outlook 2020 | 228
provides a standardised and comprehensive assessment of the magnitude of risk factor exposure, relative risk, and attributable burden of disease. Methods: GBD 2019 estimated attributable mortality, years of life lost (YLLs), years of life lived with disability (YLDs), and disability‐adjusted life‐years (DALYs) for 87 risk factors and combinations of risk factors, at the global level, regionally, and for 204 countries and territories. GBD uses a hierarchical list of risk factors so that specific risk factors (eg, sodium intake), and related aggregates (eg, diet quality), are both evaluated. This method has six analytical steps. (1) We included 560 risk–outcome pairs that met criteria for convincing or probable evidence on the basis of research studies. 12 risk–outcome pairs included in GBD 2017 no longer met inclusion criteria and 47 risk–outcome pairs for risks already included in GBD 2017 were added based on new evidence. (2) Relative risks were estimated as a function of exposure based on published systematic reviews, 81 systematic reviews done for GBD 2019, and meta‐regression. (3) Levels of exposure in each age‐sex‐location‐ year included in the study were estimated based on all available data sources using spatiotemporal Gaussian process regression, DisMod‐MR 2.1, a Bayesian meta‐regression method, or alternative methods. (4) We determined, from published trials or cohort studies, the level of exposure associated with minimum risk, called the theoretical minimum risk exposure level. (5) Attributable deaths, YLLs, YLDs, and DALYs were computed by multiplying population attributable fractions (PAFs) by the relevant outcome quantity for each age‐sex‐ location‐year. (6) PAFs and attributable burden for combinations of risk factors were estimated taking into account mediation of different risk factors through other risk factors. Across all six analytical steps, 30 652 distinct data sources were used in the analysis. Uncertainty in each step of the analysis was propagated into the final estimates of attributable burden. Exposure levels for dichotomous, polytomous, and continuous risk factors were summarised with use of the summary exposure value to facilitate comparisons over time, across location, and across risks. Because the entire time series from 1990 to 2019 has been re‐estimated with use of consistent data and methods, these results supersede previously published GBD estimates of attributable burden. Findings: The largest declines in risk exposure from 2010 to 2019 were among a set of risks that are strongly linked to social and economic development, including household air pollution; unsafe water, sanitation, and handwashing; and child growth failure. Global declines also occurred for tobacco smoking and lead exposure. The largest increases in risk exposure were for ambient particulate matter pollution, drug use, high fasting plasma glucose, and high body‐mass index. In 2019, the leading Level 2 risk factor globally for attributable deaths was high systolic blood pressure, which accounted for 10∙8 million (95% uncertainty interval [UI] 9∙51–12∙1) deaths (19∙2% [16∙9–21∙3] of all deaths in 2019), followed by tobacco (smoked, second‐hand, and chewing), which accounted for 8∙71 million (8∙12–9∙31) deaths (15∙4% [14∙6–16∙2] of all deaths in 2019). The leading Level 2 risk factor for attributable DALYs globally in 2019 was child and maternal malnutrition, which largely affects health in the youngest age groups and accounted for 295 million (253–350) DALYs (11∙6% [10∙3–13∙1] of all global DALYs that year). The risk factor burden varied considerably in 2019 between age groups and locations. Among children aged 0–9 years, the three leading detailed risk factors for attributable DALYs were all related to malnutrition. Iron deficiency was the leading risk factor for those aged 10–24 years, alcohol use for those aged 25–49 years, and high systolic blood pressure for those aged 50–74 years and 75 years and older. Interpretation: Overall, the record for reducing exposure to harmful risks over the past three decades is poor. Success with reducing smoking and lead exposure through regulatory policy might point the way for a stronger role for public policy on other risks in addition to continued efforts to provide information on risk factor harm to the general public. Keywords: not available.
21. James, S. L., Castle, C. D., Dingels, Z. V., Fox, J. T., Hamilton, E. B., Khalid, N., . . . Vos, T. (2020). Estimating global injuries morbidity and mortality: methods and data used in the Global Burden of Disease 2017 study. Injury Research Outlook 2020 | 229
Prevention, 26(Supp 1), i125‐i153. doi: 10.1136/injuryprev‐2019‐043531. (Nauman Khalid (SFAS) Abstract: Background While there is a long history of measuring death and disability from injuries, modern research methods must account for the wide spectrum of disability that can occur in an injury, and must provide estimates with sufficient demographic, geographical and temporal detail to be useful for policy makers. The Global Burden of Disease (GBD) 2017 study used methods to provide highly detailed estimates of global injury burden that meet these criteria. Methods In this study, we report and discuss the methods used in GBD 2017 for injury morbidity and mortality burden estimation. In summary, these methods included estimating cause‐specific mortality for every cause of injury, and then estimating incidence for every cause of injury. Non‐fatal disability for each cause is then calculated based on the probabilities of suffering from different types of bodily injury experienced. Results GBD 2017 produced morbidity and mortality estimates for 38 causes of injury. Estimates were produced in terms of incidence, prevalence, years lived with disability, cause‐specific mortality, years of life lost and disability‐adjusted life‐years for a 28‐year period for 22 age groups, 195 countries and both sexes. Conclusions GBD 2017 demonstrated a complex and sophisticated series of analytical steps using the largest known database of morbidity and mortality data on injuries. GBD 2017 results should be used to help inform injury prevention policy making and resource allocation. We also identify important avenues for improving injury burden estimation in the future. Keywords: not available.
22. James, S. L., Castle, C. D., Dingels, Z. V., Fox, J. T., Hamilton, E. B., Khalid, N., . . . Vos, T. (2020). Global injury morbidity and mortality from 1990 to 2017: results from the Global Burden of Disease Study 2017. Injury Prevention, 26(Supp 1), i96‐i114. doi: 10.1136/injuryprev‐2019‐043494. (Nauman Khalid (SFAS) Abstract: Background Past research in population health trends has shown that injuries form a substantial burden of population health loss. Regular updates to injury burden assessments are critical. We report Global Burden of Disease (GBD) 2017 Study estimates on morbidity and mortality for all injuries. Methods: We reviewed results for injuries from the GBD 2017 study. GBD 2017 measured injury‐specific mortality and years of life lost (YLLs) using the Cause of Death Ensemble model. To measure non‐fatal injuries, GBD 2017 modelled injury‐specific incidence and converted this to prevalence and years lived with disability (YLDs). YLLs and YLDs were summed to calculate disability‐adjusted life years (DALYs). Findings: In 1990, there were 4 260 493 (4 085 700 to 4 396 138) injury deaths, which increased to 4 484 722 (4 332 010 to 4 585 554) deaths in 2017, while age‐standardised mortality decreased from 1079 (1073 to 1086) to 738 (730 to 745) per 100 000. In 1990, there were 354 064 302 (95% uncertainty interval: 338 174 876 to 371 610 802) new cases of injury globally, which increased to 520 710 288 (493 430 247 to 547 988 635) new cases in 2017. During this time, age‐standardised incidence decreased non‐significantly from 6824 (6534 to 7147) to 6763 (6412 to 7118) per 100 000. Between 1990 and 2017, age‐standardised DALYs decreased from 4947 (4655 to 5233) per 100 000 to 3267 (3058 to 3505). Interpretation Injuries are an important cause of health loss globally, though mortality has declined between 1990 and 2017. Future research in injury burden should focus on prevention in high‐burden populations, improving data collection and ensuring access to medical care. Keywords: not available.
23. Haagsma, J. A., James, S. L., Castle, C. D., Dingels, Z. V., Fox, J. T., Khalid, N., . . . Vos, T. (2020). Burden of injury along the development spectrum: associations between the Socio‐demographic Index and disability‐adjusted life year estimates from the Global Burden of Disease Study 2017. Injury Prevention, 26(Supp 1), i12‐i26. doi: 10.1136/injuryprev‐2019‐043296. (Nauman Khalid (SFAS) Abstract: Background The epidemiological transition of non‐communicable diseases replacing infectious diseases Research Outlook 2020 | 230
as the main contributors to disease burden has been well documented in global health literature. Less focus, however, has been given to the relationship between sociodemographic changes and injury. The aim of this study was to examine the association between disability‐adjusted life years (DALYs) from injury for 195 countries and territories at different levels along the development spectrum between 1990 and 2017 based on the Global Burden of Disease (GBD) 2017 estimates. Methods Injury mortality was estimated using the GBD mortality database, corrections for garbage coding and CODEm—the cause of death ensemble modelling tool. Morbidity estimation was based on surveys and inpatient and outpatient data sets for 30 cause‐of‐injury with 47 nature‐ of‐injury categories each. The Socio‐demographic Index (SDI) is a composite indicator that includes lagged income per capita, average educational attainment over age 15 years and total fertility rate. Results For many causes of injury, age‐standardised DALY rates declined with increasing SDI, although road injury, interpersonal violence and self‐harm did not follow this pattern. Particularly for self‐harm opposing patterns were observed in regions with similar SDI levels. For road injuries, this effect was less pronounced. Conclusions The overall global pattern is that of declining injury burden with increasing SDI. However, not all injuries follow this pattern, which suggests multiple underlying mechanisms influencing injury DALYs. There is a need for a detailed understanding of these patterns to help to inform national and global efforts to address injury‐related health outcomes across the development spectrum. Keywords: not available.
24. Wiens, K. E., Lindstedt, P. A., Blacker, B. F., Johnson, K. B., Baumann, M. M., Khalid, N., . . . Reiner, R. C. (2020). Mapping geographical inequalities in oral rehydration therapy coverage in low‐income and middle‐income countries, 2000–17. The Lancet Global Health, 8(8), e1038‐e1060. doi: https://doi.org/10.1016/S2214‐ 109X(20)30230‐8. (Nauman Khalid (SFAS) Abstract: Background Oral rehydration solution (ORS) is a form of oral rehydration therapy (ORT) for diarrhoea that has the potential to drastically reduce child mortality; yet, according to UNICEF estimates, less than half of children younger than 5 years with diarrhoea in low‐income and middle‐income countries (LMICs) received ORS in 2016. A variety of recommended home fluids (RHF) exist as alternative forms of ORT; however, it is unclear whether RHF prevent child mortality. Previous studies have shown considerable variation between countries in ORS and RHF use, but subnational variation is unknown. This study aims to produce high‐ resolution geospatial estimates of relative and absolute coverage of ORS, RHF, and ORT (use of either ORS or RHF) in LMICs.Methods We used a Bayesian geostatistical model including 15 spatial covariates and data from 385 household surveys across 94 LMICs to estimate annual proportions of children younger than 5 years of age with diarrhoea who received ORS or RHF (or both) on continuous continent‐wide surfaces in 2000–17, and aggregated results to policy‐relevant administrative units. Additionally, we analysed geographical inequality in coverage across administrative units and estimated the number of diarrhoeal deaths averted by increased coverage over the study period. Uncertainty in the mean coverage estimates was calculated by taking 250 draws from the posterior joint distribution of the model and creating uncertainty intervals (UIs) with the 2∙5th and 97∙5th percentiles of those 250 draws.Findings While ORS use among children with diarrhoea increased in some countries from 2000 to 2017, coverage remained below 50% in the majority (62∙6%; 12 417 of 19 823) of second administrative‐level units and an estimated 6 519 000 children (95% UI 5 254 000–7 733 000) with diarrhoea were not treated with any form of ORT in 2017. Increases in ORS use corresponded with declines in RHF in many locations, resulting in relatively constant overall ORT coverage from 2000 to 2017. Although ORS was uniformly distributed subnationally in some countries, within‐country geographical inequalities persisted in others; 11 countries had at least a 50% difference in one of their units compared with the country mean. Increases in ORS use over time were correlated with declines in RHF use and in diarrhoeal mortality in many locations, and an estimated 52 230 diarrhoeal deaths (36 910–68 860) were averted by scaling up of ORS coverage between 2000 and 2017. Finally, we identified key subnational areas in Colombia, Nigeria, and Sudan Research Outlook 2020 | 231
as examples of where diarrhoeal mortality remains higher than average, while ORS coverage remains lower than average.Interpretation To our knowledge, this study is the first to produce and map subnational estimates of ORS, RHF, and ORT coverage and attributable child diarrhoeal deaths across LMICs from 2000 to 2017, allowing for tracking progress over time. Our novel results, combined with detailed subnational estimates of diarrhoeal morbidity and mortality, can support subnational needs assessments aimed at furthering policy makers’ understanding of within‐country disparities. Over 50 years after the discovery that led to this simple, cheap, and life‐saving therapy, large gains in reducing mortality could still be made by reducing geographical inequalities in ORS coverage. Keywords: not available.
25. Deshpande, A., Miller‐Petrie, M. K., Lindstedt, P. A., Baumann, M. M., Johnson, K. B., Khalid, N., . . . Reiner, R. C. (2020). Mapping geographical inequalities in access to drinking water and sanitation facilities in low‐income and middle‐income countries, 2000–17. The Lancet Global Health, 8(9), e1162‐e1185. doi: https://doi.org/10.1016/S2214‐109X(20)30278‐3. (Nauman Khalid (SFAS) Abstract: Background Universal access to safe drinking water and sanitation facilities is an essential human right, recognised in the Sustainable Development Goals as crucial for preventing disease and improving human wellbeing. Comprehensive, high‐resolution estimates are important to inform progress towards achieving this goal. We aimed to produce high‐resolution geospatial estimates of access to drinking water and sanitation facilities. Methods We used a Bayesian geostatistical model and data from 600 sources across more than 88 low‐income and middle‐income countries (LMICs) to estimate access to drinking water and sanitation facilities on continuous continent‐wide surfaces from 2000 to 2017, and aggregated results to policy‐relevant administrative units. We estimated mutually exclusive and collectively exhaustive subcategories of facilities for drinking water (piped water on or off premises, other improved facilities, unimproved, and surface water) and sanitation facilities (septic or sewer sanitation, other improved, unimproved, and open defecation) with use of ordinal regression. We also estimated the number of diarrhoeal deaths in children younger than 5 years attributed to unsafe facilities and estimated deaths that were averted by increased access to safe facilities in 2017, and analysed geographical inequality in access within LMICs.Findings Across LMICs, access to both piped water and improved water overall increased between 2000 and 2017, with progress varying spatially. For piped water, the safest water facility type, access increased from 40∙0% (95% uncertainty interval [UI] 39∙4–40∙7) to 50∙3% (50∙0–50∙5), but was lowest in sub‐Saharan Africa, where access to piped water was mostly concentrated in urban centres. Access to both sewer or septic sanitation and improved sanitation overall also increased across all LMICs during the study period. For sewer or septic sanitation, access was 46∙3% (95% UI 46∙1–46∙5) in 2017, compared with 28∙7% (28∙5–29∙0) in 2000. Although some units improved access to the safest drinking water or sanitation facilities since 2000, a large absolute number of people continued to not have access in several units with high access to such facilities (>80%) in 2017. More than 253 000 people did not have access to sewer or septic sanitation facilities in the city of Harare, Zimbabwe, despite 88∙6% (95% UI 87∙2–89∙7) access overall. Many units were able to transition from the least safe facilities in 2000 to safe facilities by 2017; for units in which populations primarily practised open defecation in 2000, 686 (95% UI 664–711) of the 1830 (1797–1863) units transitioned to the use of improved sanitation. Geographical disparities in access to improved water across units decreased in 76∙1% (95% UI 71∙6–80∙7) of countries from 2000 to 2017, and in 53∙9% (50∙6–59∙6) of countries for access to improved sanitation, but remained evident subnationally in most countries in 2017.Interpretation Our estimates, combined with geospatial trends in diarrhoeal burden, identify where efforts to increase access to safe drinking water and sanitation facilities are most needed. By highlighting areas with successful approaches or in need of targeted interventions, our estimates can enable precision public health to effectively progress towards universal access to safe water and sanitation. Keywords: not available. Research Outlook 2020 | 232
26. Boukria, O., El Hadrami, E. M., Sameen, A., Sahar, A., Khan, S., Safarov, J., . . . Aït‐Kaddour, A. (2020). Biochemical, Physicochemical and Sensory Properties of Yoghurts Made from Mixing Milks of Different Mammalian Species. Foods, 9(11), 1722. (Sipper Khan (SFAS) Abstract: Among developed countries, bovine milk production makes a major contribution towards the economy. Elevating consumer demand for functional foods has triggered a niche for non‐bovine milk‐based products. Mixing milks from different species can be a strategy to increase the consumption of non‐bovine milk and enable consumers and dairy companies to benefit from their nutritional and technological advantages. Thus, this review aimed to gather the most important research on yoghurts derived from processing mixtures of milks of different species. We discuss the impact of milk mixtures (i.e., species and milk ratio) on nutritional, physicochemical, sensory, rheological and microbiological properties of yoghurts. More specifically, this paper only highlights studies that have provided a clear comparison between yoghurts processed from a mixture of two milk species and yoghurts processed from a single species of milk. Finally, certain limitations and future trends are discussed, and some recommendations are suggested for future research. Keywords: milk, mixture, yoghurt, nutrition, rheology, sensory, camel milk, cow milk, ewe milk, goat milk.
27. Syed, Q. A., Rashid, Z., Ahmad, M. H., Shukat, R., Ishaq, A., Muhammad, N., & Rahman, H. U. U. (2020). Nutritional and therapeutic properties of fenugreek (Trigonella foenum‐graecum): a review. International Journal of Food Properties, 23(1), 1777‐1791. doi: 10.1080/10942912.2020.1825482. (Hafiz Ubaid Ur Rahman (SFAS) Abstract: Current lifestyle, eating habits, stress, environmental factors and intensive use of synthetic chemicals in food processing and agriculture have radically increased the progression of several human diseases. Globally, researchers have been looking for natural therapeutic substances that can be used to treat or delay the onset of these lifestyle‐related disorders. Numerous types of medicinal plants have shown the potential to be frequently used in the therapeutics due to the presence of several bioactive compounds. Among these, fenugreek is an important herb which has been recognized as an imperative medicinal plant by various scientists around the world. This herb has been widely reported as beneficial against numerous diseases such as cancer, hypercholesterolemia, diabetes and inflammation. Due to its medicinal value, the extracts/powders from different parts of fenugreek have been effectively utilized in food and pharmaceutical industries. Accordingly, the present review is an attempt to highlight the important nutritional benefits and curative applications of fenugreek as an effectual therapeutic agent against different diseases. Keywords: Fenugreek seeds, Trigonella foenum‐graecum, health benefits, therapeutic value, flavonoids, cancer.
Book/Book Chapters 1. Khan, S., Iqbal, R., Khan, R. S., & Khalid, N. (2020). Bioavailability of nanoencapsulated food bioactives. In S. M. Jafari (Ed.), Release and Bioavailability of Nanoencapsulated Food Ingredients (Vol. 5, pp. 449‐481): Academic Press. (Sipper Khan, Rashid Iqbal, Rao Sanaullah Khan, Nauman Khalid (SFAS) Abstract: not available. Keywords: not available. School of Textile & Design (STD) Department of Textile & Design Research Articles 1. Saleemi, S., Naveed, T., Riaz, T., Memon, H., Awan, J. A., Siyal, M. I., . . . Bae, J. (2020). Surface Functionalization of Cotton and PC Fabrics Using SiO2 and ZnO Nanoparticles for Durable Flame Retardant Properties. Coatings, 10(2), 124. (Tayab Naveed (STD)
Research Outlook 2020 | 233
Abstract: In recent years, the use of functional textiles has attained attention due to their advantageous health and safety issues. Therefore, this study investigated the flame retardancy on cotton (COT) and polyester‐cotton (PC) fabrics treated with different concentrations of silica and zinc nanoparticles through a sol‐gel finishing technique. FTIR, SEM, and TGA were conducted for the characterization of coated fabric samples. The FTIR and SEM of Pristine and Treated Cotton and PC fabrics illustrated that the SiO2 (silica dioxide) and ZnO (Zinc oxide) nanoparticles were homogeneously attached to the fiber surface, which contributed to the enhancement of the thermal stability. The starting thermal degradation improved from 320 to 350 °C and maximum degradation was observed from 400 to 428 °C for the COT‐2 cotton substrate. However, the initial thermal degradation improved from 310 to 319 °C and the highest degradation from 500 to 524 °C for the PC substrate PC‐2. The outcomes revealed that the silica has a greater influence on the thermal properties of COT and PC fabric samples. Additionally, the tensile strength and flexural rigidity of the treated samples were improved with an insignificant decrease in air permeability. Keywords: flame retardant, sol‐gel coating, silica and zinc oxide nanoparticles, cotton, PC, fabric.
2. Assefi Pour, R., Bagheri, R., Naveed, T., Ali, N., Rehman, F., & He, J. (2020). Surface functionalization of wool via microbial‐transglutaminase and bentonite as bio‐nano‐mordant to achieve multi objective wool and improve dyeability with madder. Heliyon, 6(9), e04911. doi: https://doi.org/10.1016/j.heliyon.2020.e04911. (Tayab Naveed (STD) Abstract: Recently, natural dyes have a widening scope in various traditional and advanced applications due to their eco‐friendly environment. However, improved dyeability of natural dyes still remains a challenging task. This research was aimed to achieve multi‐objective wool with improved dyeability using bio‐nano‐mordant composed of m‐Trans‐glutaminase, m‐TGase, and bentonite nanoclay. Wool fiber was treated through sonochemical method using different concentrations of m‐TGase and bentonite. The surface morphology of wool fabric samples was examined by field emission‐scanning electron microscopy (FESEM), and Fourier transform Infrared Radiation (FTIR). Further, wool samples treated at different conditions were applied to madder for dyeability examination. The optimum conditions of color coordinates, color strength, K/S, and washing fastness of madder on treated wool fabric with m‐TGase and bentonite, were also examined. The results revealed well‐ made interactions among m‐TGase, bentonite, and wool fibers. In addition, surface morphology was strongly influenced by variations in enzyme concentrations so that extra addition of m‐TGase lead to clear damage scales or less cuticle surface in SEM images. Moreover, the results showed that the value of K/S for treated wool samples was better than untreated samples. Indeed, amongst all, 5% concentrations of bio‐nano‐mordant for m‐TGase and bentonite have the most constructive K/S values. Similarly, results of ΔE and antibacterial investigations also confirmed its superiority. Keywords: materials science, nanotechnology, biotechnology, bio‐nano mordant, bentonite nanoclay, microbial transglutaminase, wool, natural dye, madder.
3. Tusief, M. Q., Malik, M. H., Mohsin, M., Asghar, H. N., Iqbal, M., & Mahmood, N. (2020). Eco‐Friendly Degradation of Reactive Blue Dye Enriched Textile Water by Floating Treatment Wetlands (FTWs) System Applying the Strategy of Plant‐Bacteria Partnership (Part‐B). Pakistan Journal of Scientific and Industrial Research Series A: Physical Sciences, 63A(1), 40‐47. (Mumtaz Hasan Malik (STD) Abstract: Textile dye enriched effluents have been credited to be heavily polluted and highly hazardousto environment. Cleaning of textile wastewater from these dangerous pollutants is a deeply concernedissue of the industry. Various physico‐chemical and biological techniques are being practiced to remediatethese effluents. But all these strategies have limitations at any corner of their application. Floating treatmentwetlands (FTWs) are acknowledged as economical treatment options for various kinds of wastewater.Their efficacy has been ascribed in many lab‐scale and pilot‐scale studies, however scarceness of publisheddata lies in sense of Research Outlook 2020 | 234
application of this technique using free floating aquatic plants for treating majorprimary reactive blue dye enriched textile water. So, the present study attempted to evaluate the performanceof this method using two free floating aquatic plants, “Eichhornia crassipes” and “ Pistia stratiotes” todevelop a lab scale FTWs system augmented with two pollutant degrading and plant growth promotingbacteria, “Bacillus cereus” and “Bacillus subtilis” after four retention times, 0, 24, 48 and 72 h. One controland eight FTW treatment reactors were established containing plants and bacteria separately or incombination. This system was applied to treat reactive blue dye enriched textile wastewater preparedsynthetically. A remarkable reduction in pollutant indicating parameters, BOD, COD and colour concentrationwas observed for treatment reactor having Eichhornia crassipes and Bacillus cereus combination for72 h retention time. All this stamped the authenticity of this plant‐ microbial enhanced FTWs techniqueto treat textile wastewater and opened an era of its on‐site application. Keywords: floating treatment wetlands, plant‐bacteria partnership, textile wastewater treatment, reactiveblue dye.
4. Sagar, R., , Lifang, C., , Ali, A., , Khan, M. F., , Abbas, M., , Malik, M. I., , Khan, K., , Zeng, J., , Anwar, T., , & Liang, T., (2020). Unusual magnetotransport properties in graphene fibers. Physical chemistry chemical physics : PCCP, 22(44), 25712–25719. https://doi.org/10.1039/d0cp05209d. (Mudassar Abbas (STD) Abstract: Graphene, purely sp2‐hybridized, has already been extensively studied for magnetoelectronics, however, the magnetotransport properties of graphene fibers (GrFib) have not been explored very well to date. Herein, unique magnetotransport properties of graphene fibers are detected. All the GrFib‐samples show the highest positive magnetoresistance (MR ∼ 60%) at room temperature (300 K) that gradually decreases (MR ∼ 37%) at low temperature (5 K), indicating quite different behavior for a graphene derivative. The MR of three different morphologies are compared: single graphene sheet (60‐100% at 300 K and 100‐110% at 5 K under an applied magnetic field of 5 T), graphene foam (GF‐100% at 300 K and 158% at 5 K under an applied magnetic field of 5 T), and graphene fiber (60% at 300 K and 37% at 300 K under an applied magnetic field of 5 T), and found that each morphology has a different magnitude of MR under similar magnitude of magnetic field and temperature. Unlike graphene and GF, GrFib shows a decreasing trend of MR at low temperatures, violating commonly used weak anti‐localization phenomena in graphene. Technologically, each morphology of graphene has a unique set of magnetotransport properties that can be considered for particular magnetoelectronic devices depending upon the mechanical, electrical, and magnetotransport properties. Keywords: not available.
5. Tayyab, N., Javeed, A. A., Sayed, R. Y., Mudassar, A., Faisal, R., Ahmad, F., . . . Muhammad, A. (2020). Dyeing and colour fastness of natural dye from Citrus aurantium on Lyocell fabric. Industria Textila, 71(4), 350‐356. (Mudassar Abbas, Ahmad Fraz (STD) Abstract: The use of natural dyes for textiles has attained attention due to their ecology, minimum impact on the environment and pollution. Therefore the objective of this study is to dye Lyocell fabric with natural dye extracted from orange peel for comparative analysis of colour efficiencies (K/S), CIE L*a*b* values and the colour fastness properties. The mordants applied were ferrous (II) sulphate and copper (II) sulphate. For the extraction of the dye, the aqueous extraction method was used. The pre‐mordanting method was used and the dyeing effect on Lyocell fabric was analyzed at concentrations of 2% and 4%. It was observed that the mordant type employed had an influence on the colour efficiency and the colour coordinates of fabric dyed with Citrus aurantium dye. The colour efficiency (K/S: 4) and colour fastness to washing, light, rubbing and perspiration in all the dyed samples were better and excellent (grade 4–5) at 4% concentration. In overall results, the pre‐mordanting method at 4% concentration gives the best results of colour efficiency and colour fastness properties. The performance analysis of colour fastness was also statistically significant at the 0.05 level. Keywords: natural dyes, orange peel, Lyocell, extraction, mordant, colour fastness. Research Outlook 2020 | 235
Institute of Liberal Arts (ILA) Department of Linguistics and Communications Research Articles 1. Sarfraz, R., Ashfaq, N., Abid, F., Riaz, S., & Niazi, A. (2020). Tracing the patriotic streaks among the national anthem of Pakistan and Turkey: A depiction of nationalism. International Journal of Psychosocial Rehabilitation, 24(6), 694‐703. doi: 10.37200/IJPR/V24I6/PR260071. (Rida Sarfraz, Naheed Ashfaq, Faiza Abid, Sadia Riaz, Aisha Niazi (Department of Linguistics & Communications/ILA) Abstract: The national anthem is always sung at the learning institutions or during the country’s special occasions. Various countries regard their national anthem as the back bone of patriotism and expression of their strength of national identity. National anthem reveals entities that have a special noble role to play in the country’s prosperity. This paper will probe the highly defined patriotic streaks among the national anthem of two Muslim countries that are Pakistan and Turkey. Due to the enriched heritage and significant historical affiliation of both aforementioned countries, their respective national anthem is specifically portraying the various aspects exhibited via the mode of language. Furthermore; the paper will explore the linguistic aspects as well as pragmatic paradigms to peel out the layers of the meaning mentioned in these anthems. For the analysis of these anthems, an analytical framework was formulated and used which has been adapted from So (2005). It also incorporates both contextual and linguistic analyses of the text under discussion. Moreover, it will look for the notion of metafunctions of language (Halliday&Hasan, 1989), in order to examine relation between language use and context of situation. This framework will help us to determine many dimensions like nationalism, patriotism, refuge, faith, determination, wishes etc which draws us towards the exactness of the meaning of the national anthems of both countries. Keywords: nationalism, patriotic streaks, independence, national anthem.
2. Rafi, M. S., (2020). Dialogic Content Analysis of Misinformation about COVID‐19 on Social Media in Pakistan. Linguistics and Literature Review 6(Special Issue): 1‐11. (Muhammad Shaban Rafi (Department of Linguistics & Communications/ILA) UMT JOURNAL Abstract: This study aims to explore the most common misinformation topics about COVID‐19, people's perceptions concerning disinformation, and its consequences. A purposive sample of 50 posts and thousands of comments on coronavirus was drawn from social media networking sites. The data were also collected through informal interviews of 30 participants of different demographic backgrounds. The selected data were analyzed as dialogic communicative content between the participants. The study reveals that the most common topics regarding coronavirus misinformation are about cure and conspiracy theories. The participants have shown a mixed response towards the misinformation. The study has concluded the severe consequences of misinformation concerning the virus. Hence, I would like to recommend compulsory social media education for the internet users regarding how to respond to such a crisis while abiding by the Internet regulations. Keywords: misinformation, conspiracy theories, social media, covid‐19, racism, social media education.
3. Khan, A. A., Khalid, A., & Rahman, G. (2020). Tense Driven Asymmetries and Clitic Placement in Compound Verbs of Pashto. Global Language Review, V(I), 67‐75. doi: 10.31703/glr.2020(V‐I).08. (Arshad Ali Khan, Amina Khalid (Department of Linguistics & Communications/ILA) Abstract: The tense driven asymmetry of the Pashto clause is analyzed from the perspective of the minimalist framework. The study proves that the split ergativity in Pashto is tense based and does not have the aspect driven features proposed by Roberts (2000). The study argues that the object is assigned a theta role by the V and the subject is assigned a theta role by the little v. The accusative case is assigned by the little v but the nominative and ergative cases are assigned by T. It claims that the T head assigns multiple cases as the split ergativity is tense Research Outlook 2020 | 236
driven. It highlights the syntactic effects of the possible phonological processes in combining some of the closely adjacent words and making a single phonological word. The study also discusses clitic placement and prosodic inversion to refute the assumption that perfective feature is a strong feature in Pashto. Keywords: tense driven asymmetry, split ergativity, compound verb, perfective and imperfective aspects.
4. Khan, A. A., Khalid, A., & Rahman, G. (2020). The Integration of Embedded Language Islands in Pashto‐English Bilingual data. Hamdard Islamicus, 43(1), 439‐459. (Arshad Ali Khan, Amina Khalid (Department of Linguistics & Communications/ILA) Abstract: This study offers a discussion on the integration of English Embedded Language islands in Pashto‐ English bilingual data. It investigates the function of Embedded Language islands, in the morphsyntax of Pashto language. It also shows the types and pragmatic force behind English EL islands. The study use Matrix Language Frame model to explore the role of the two languages in the process of codeswitching. It also explains the pragmatic force behind the selection of the EL islands. A data of 14 hours is collected from AVT Khyber; YouTube channel, which covers a wide range of take shows and interviews. The data is analyzed for the research question: How do Embedded Language islands figure in overall clause structure of Pashto‐English Codeswitching? The data is also analyzed for the types of EL islands and the pragmatic force behind the speakers’ intention. The findings of the study show English (islands) multiword insertion is following the structure dependency rule of the Embedded Language in order to retain the well‐formedness with the overall grammatical frame of Pashto langue. Most of the Embedded Language islands are fixed expressions and the multiword are collocated with each other. In most cases the Embedded Language Islands is used as its counterpart in Pashto language lack the same pragmatic force. Keywords: morphsyntax, embedded Language Islands, Pashto‐English, bilingual, codeswitching.
5. Shahabullah, Rahman, G., & Khan, A. A. (2020). Syllabification of English Words by Pashto Speakers. Global Language Review, V(I), 18‐28. doi: 10.31703/glr.2020(V‐I).03. (Arshad Ali Khan (Department of Linguistics & Communications/ILA) Abstract: Syllabification of words plays a vital role in learning native like pronunciation. The present study tried to explore the syllabification of English words by Pashto speakers. The study aimed to put light on the problematic areas for Pashto speakers in terms of syllabification of English words. The data was collected from twenty undergraduate students and analyzed with reliable scientific tools. The analyzed data proved that English words having triphthongs were problematic for Pashto speakers. In addition to it, words having syllabic consonants were also problematic for Pashto speakers. Furthermore, words containing ‘x’ in spelling also proved to be problematic for Pashto speakers. English words having the syllable structure CVC.VC were incorrectly syllabified CV.CVC. Pashto speakers faced problems in the identification of syllable boundaries in words where consonant clusters are used. The study recommends that Pashto speakers need proper training for learning correct syllabification of English words. Keywords: English Words, Syllabification, Pashto Speakers.
6. Khan, A. A., Anees. M., & Rahman, G. (2020). The Patterns of Code‐Switching in Pashto‐English Bilingual Data. Global Social Science Review, V(I), 123‐133. doi:10.31703/gssr.2020(V‐I).13. (Arshad Ali Khan (Department of Linguistics & Communications/ILA) Abstract: This study investigated the most dominant patterns of code switching in Pashto English bilingual data. The data was collected in the form of a semi‐structured interview and analyzed in the light of the framework of the Matrix Language Frame model. The study found out that insertion is the dominant pattern of code switching. The Embedded Language noun was the most prevalent switched element in the morpho‐syntax frame of Matrix Language. The second most embedded language insertion in the matrix language was the English nonfinite verbs Research Outlook 2020 | 237
in Pashto light verb construction. The Embedded language island was the third most dominant pattern. The switched elements in the bare DP and the bilingual VP are content words following the Morpheme Order and System Morpheme principles of Pashto. Keywords: alternation, congruent lexicalization, insertion, patterns of code, switching, morphosyntactic constraints.
7. Rahman, G., Anees. M., & Khan, A., A. (2020). Topicalization in Pashto. Global Social Sciences Review, V(I), 163‐ 171. doi:10.31703/gssr.2020(V‐I).17. (Arshad Ali Khan (Department of Linguistics & Communications/ILA) Abstract: The present study is concerned with the phenomenon of topicalization in Pashto. It analyzed the information status of the referents in a sentence and their grammatical functions. The study is another contribution after the work of Roberts (2000) and Rahman (2014). The study was descriptive in nature and it found out the relationship between subject and topic in a sentence. The grammatical function of the subject and the topic were found out coincidentally occurring with the topic of the sentence. Both the subject and topic were found out commonly appearing at the initial position of the sentence. If the topic was any other constituent than the subject, then topicalization happened. The topicalized element is moved to the second or initial position of the sentence. Word order is determined by the information status of the referents where the topic comes first followed by the focused constituents, if not overruled by intonational prominence. Keywords: grammatical function, information status, pashto, topicalization.
8. Khan, S., Khan, A. A. (2020). Morphosyntactic influence of L1 (Punjabi) on L2 English: a study of possessive adjectives. Hamdard Islamicus, 43(2), 700‐720. (Sarwar Khan, Arshad Ali Khan (Department of Linguistics & Communications/ILA) Abstract: The paper investigates the Morphosyntactic influence of L1 (Punjabi) on L2 (English) in the use of possessive adjectives by intermediate level students in ESL Class room setting. It also focuses how the difference between the possessive adjectives of both the languages creates hurdles in the process of learning of second language. It further suggests effective procedure to control the erroneous constructions of second language learners in the use of possessive adjectives. It also concentrates on improving the writing and speaking skills of the learners by removing the chances of errors in the use of possessive adjectives of second language. It also implies that the effective teaching of possessive adjectives promotes the process of second language learning. For the study, a questionnaire was distributed among randomly selected 36 students of intermediate level to record their second language constructions in which they were to use possessive adjectives. In the light of evidence found in this research, it is concluded that for aggrandizing the process of L2 learning and for developing the writing and speaking skills of the learners, the appropriate use of possessive adjectives of L2 cannot be ignored. Keywords: not available.
9. Khan, A. A. Rukhsana, K., Abid, F., Khalid, A. (2020). A counter‐orientalistic approach: comparative exploration ofthematic universality in English poet John Keats and Pashto poet Ghani Khan. Hamdard Islamicus, 43(2), 818‐ 832. (Arshad Ali Khan, Faiza Abid, Amina Khalid (Department of Linguistics & Communications/ILA) Abstract: Western literary schoolsmostly relegateoriental literature, especially that which is in local oriental languages, as regional, communal and/or lacking universality in its appeal –and thus not to be regarded as mainstream. The Indian sub‐continent, though having a profoundly rich literary legacy in its local languages, is no exception from such marginalizing treatment. Adopting a counter‐orientalistic approach, this study,however, argues similarities betweenthe profundity and complexities of sensibilities and perceptions of the famous Englishpoet John Keats and Pashtopoet Ghani Khan. Thepoets represent diverse cultureswith diverse ideologies,but it is hypothesized that theyhavestraits of resemblance in their poetry; affection,
Research Outlook 2020 | 238
loveliness, nature and eternityrepresent to the both of them strikingly similar meanings of life.This assumptioncontradicts the traditional colonialist and the neo‐imperialist discourse that considerseastern literary worksas secondary to the mainstream between the two transcend the stereotypically drawn boundary of binary polarity that privileges „us‟ over „them‟. Keywords: counter‐orientalism, thematic Affinity, cultural diversity, Johan Keats, Ghani Khan.
10. Khan, N. W., Rizvi, S. Z., Farooq, M. (2020). The Study of English Loan Word Phonology in Urdu. International Journal of Psychosocial Rehabilitation, 24(9), 4720‐4728. doi: 10.37200/IJPR/V24I9/PR290502. (Syeda Zahida Rizvi (Department of Linguistics & Communications/ILA) Abstract: This paper elucidates the exploration of loan word phonology in Urdu language. It is an attempt to examine loan words in Urdu language specifically that have been taken from English language. The paper attempts to trace the innateness of loan words in Urdu and its gradually becoming “native” through the phonological phenomena of variation in vowels, insertion, borrowing, deletion of vowels and conversion in morphosyntactic features of the loan word phonology. The words studied; are the most frequently used in Urdu language by native speakers so that these loan words have become an integral part of daily conversation these words are spoken under the umbrella of Urdu words’ pronunciation influence. The paper culminations with an analysis and discussion of the factors behind naturalization of loan words in a specific language. Keywords: loan words, morphological, phonological, Urdu language.
11. Rizvi, S. Z., Khan, N. W., Farooq, M. (2020). A multimodal discourse analysis of e‐advertisement visuals. International Journal of Psychosocial Rehabilitation, 24(10), 4473‐4492. doi: 10.37200/IJPR/V24I10/PR300443. (Syeda Zahida Rizvi (Department of Linguistics & Communications/ILA) Abstract: This research tends to investigate the persuasive and attractive modes used in an e‐advertisement visual by the advertisers to persuade and affect the buyers or viewers. As the study deals with semiotic modes along with language in a visual, to that end, the Multimodal Discourse Analysis of Kress & Leeuven, (1996) is employed as a framework for analyzing the collected data. Three Meta functions will help in interpreting three meanings, i.e., representational, interactional and compositional given through different elements of the selected visuals and meaning of each element which in some way influences the others in the context. The data for the research includes six e‐advertisement visuals, taken from different online shopping sites through random sampling. The data was analyzed like semiotic resources, focus on the font, capitalization, boldness etc. in detail. The findings will help the consumers to have an insight about the advertisement tactics adopted by the advertisers. Keywords: e‐advertisement, multimodal discourse analysis, three meta functions, manipulative language.
12. Farooq, M., Mahmood, A., & Khan, A. A. (2020). Re‐syllabification and Multiple Pronunciations in Urdu. Al‐Qalam, 25(1), 290‐310. (Mahwish Farooq, Arshad Ali Khan (Department of Linguistics & Communications/ILA) Abstract: This is a sequel work deals with the confirmation of phonological rules for re‐syllabification and multiple pronunciations of Urdu vocabulary, at larger scale, in speech of Pakistani speakers. The motivation of study is the identification of re‐syllabification and multiple pronunciations in 10 hours audio‐corpus of a native Pakistani Urdu speaker. This speech corpus has identified 103902 words with different annotations. The observations have identified the multiple pronunciations of same tokens (Farooq & Mumtaz, 2016), (Farooq & Mahmood, 2020). These tokens have same parts‐of‐speech (POS), spellings and meanings but different pronunciations which ultimately becomes the cause of re‐syllabification in different contexts. CLE annotated speech corpus has been used as baseline of this research (Mumtaz, et al., 2014), (Habib, Hijab, Hussain, & Adeeba, 2014). Later, the multiple pronunciations and re‐syllabification phenomenon have been cross checked in the speech of 29 native Pakistani Urdu speakers for the identification and confirmation. Consequently, the results of data analysis have Research Outlook 2020 | 239
also confirmed; the re‐syllabification is more context dependent rather than speaker dependent. Moreover, stress is major supra‐segmental feature which becomes the reason of multiple pronunciations by causing segmental substitution and attain the status of alternative pronunciations (Farooq & Mumtaz, 2016). Multilingual effect also causes re‐syllabification in Urdu lexical items in mental lexicon of speakers. The alternative pronunciations have been triggered by restructuring and re‐syllabifications of Urdu vocabulary in speech of 30 Pakistani Urdu speakers. But this paper currently deals with the re‐syllabification of Urdu vocabulary depending only on the phoneme or segment alternation. Finally, it is concluded that stress alternation is one major cause to raise re‐syllabification and multiple pronunciations on Urdu speech in Pakistan. The multiple pronunciations will identified the rules of ‘word‐level phonology’ in Urdu; based on some special rules as exceptions. Keywords: tokens, restructuring, re‐syllabification, alternativeor multiplepronunciations, phonemic alternation.
13. Abid, F., Sarfraz, R., Ashfaq, N., & Niazi, A. (2020). Multimodal analysis of the political posters before election campaign (2018) in pakistan. International Journal of Psychosocial Rehabilitation, 24(8), 11682‐11689. doi: 10.37200/IJPR/V24I8/PR281142. (Faiza Abid, Rida Sarfraz, Naheed Ashfaq (Department of Linguistics & Communications/ILA) Abstract: This paper will analyze the political posters used for election campaignsof different but prominent Pakistani political parties like Pakistan Peoples Party (PPP), Pakistan Tehreek e Insaaf (PTI) and Pakistan Muslim League Noon (PML‐N).The study will supremely focus on the representation of their leader through posters and later on it will pinpoint the similarities and possible differences between each of the poster especially emphasizing on what they denote. To instigate the target audience to vote for the particular party itis significant to study the main linguistic and visual strategies. That is used to highlight the power and presence of a politician. While keeping in mind the cult of persuasion we must concentrate that how these parties grip the audience/ voters to an emotional extent that they actually get seriously attached with the concerned party.For the analysis, this research will focus on nine significant posters that have been selected randomly. These posters belong to three prominent Political parties that are present in the country. They will use these postersin the election campaigns’2018 and will roll these throughout the country for their target audience. Therefore, the researcher has used critical discourse analysis tools to identify the discursive strategies used. These strategies will help to persuade the Pakistani population to vote for their preferred politician. Van Leeuwen’s (2008), social actor theory will assist in order to understand of how participants are represented. As far as images are concernedKress and van Leeuwen’s(2006) visual grammar will be use.These politicians have been symbolically treated as to inspire the masses and presented as warriors and saviors that can lift up the misery from people. These posters have chronic impact on the psychology of the people that instigate them to vote or to support their respective party Furthermore, this study will also probe various tactics that have been implied by the political partiesin their posters to create a powerful discourse that hit audience emotionally and provoke them for specific action. Keywords: Critical discourse analysis, Political discourse, Posters, Social actors’ theory, Visual grammar.
14. Ahmad, S.S., Asim Mahmood, M., Azhar, W. (2020). A corpus based transitivity analysis of newspaper articles on floods. International Journal of Psychosocial Rehabilitation, 24(8), 7242‐7263. doi: 10.37200/IJPR/V24I8/PR280740. (Sumera Shan Ahmad (Department of Linguistics & Communications/ILA) Abstract: Aim of the current research is to explore distributions and functions of six processes of transitivity analysis in flood related Newspaper articles. No matter a country is developed, developing or under developed, floods bring drastic results in the whole world without discrimination. They are one of major causes of social unrest. Since, newspapers can be considered as a good and authentic source of information, so a small corpus of twenty (20) English newspaper articles addressing the issue of floods in Pakistan has been collected for the above purpose. Data was analyzed by transitivity analysis proposed by Halliday and Matthiessen (2014). It has six functions which have been further subdivided into many functions to explore any text. This analysis helps out in Research Outlook 2020 | 240
finding writing patterns which are followed in writing newspaper articles on the topic of floods. This study explores which procedure they use to follow in order to convey such pieces of news and do they suggest possible strategies too to overcome them. The study reflects that material and mental processes remained more dominant in the data and with the help of them, usually media partners try to sensationalize the writings and blame government officials as responsible of this undesirable situation. Verbal, behavioral and existential processes have been used very little. Keywords: floods, newspaper articles, transitivity analysis.
15. Bhatti, Z. I., Akbar, A., Khan, Z., & Ishfaq, S. (2020). Gender Stratification by Variants/n/and/ɽ/in Lahore city: The ̃ Labovian Paradigm. International Journal of English Linguistics, 10(2), 294‐310. doi: 10.5539/ijel.v10n2p294. (Zafar Iqbal Bhatti, Anila Akbar, Zarmina Khan, Saadia Ishfaq (Department of Linguistics & Communications/ILA) Abstract: The study is an investigation of language within the social context of the community in which it is spoken, carried out in 2019 in a region with a particular linguistic background, Lahore, the capital of Punjab, Pakistan. This research investigates the stratification of nasal variants /n/ and /ɳ/ in the Lahore city, relating parameter of gender. This research was intended to determine the male and female use of the nasal variants /n/ and /ɳ/, indicates that gender‐based differences in male/female linguistic behavior in the Lahore speech community. A structured interview was administered in order to examine this issue of social stratification by language. In this regard, this study becomes a Labovian methodological replica in the present context. The results show several statistically significant differences in linguistic usage among different groups of people residing in Lahore city. This research was intended to determine whether men and women were different with respect to the use of nasal variants /n/ and /ɳ/. Moreover, an examination of the social class and regionality (urban/rural) is also under consideration in the present research. Keywords: linguistic variant, gender, stratification, education, social class.
16. Bhatti, Z. I., Asif, S., Akbar, A., Ismail, N., & Najam, K. (2020). The impact of peer scaffolding through process approach on efl learners’academic writing fluency. Epistemology, 7(1), 102‐110. (Zafar Iqbal Bhatti, Sadia Asif, Anila Akbar (Department of Linguistics & Communications/ILA) Abstract: The abstract of the papers fulfills the 5 essential conditions to help the reader to know what the study is all about, firstly the purpose of the study which is to examine the impact of peer scaffolding through process approach. Secondly, the sources from where the data are elicited, it is from 49 EFL learners studying at university. Thirdly, the method which is, according to the researches that participants were randomly assigned to two groups, one the control group and the other experimental group. Fourthly, the general results, after using SPSS 16, enhancement as words per minute average words in some basic areas of writing fluency, , has been pointed out. The researches applied process approach to present the improvement of this peer scaffolding technique on the academic writing of the learners of English as a foreign language. The future implications can definitely bring drastic changes in the domain of EFL. The researchers also mentioned the key terms of this research study. These five pieces of information from the abstract provides the basic concept of this study and an interesting aspect of EFL by employing a peer scaffolding technique. (Kessler’s Bourassa, 2001), which focused at the point of whether peer scaffolding has any effect on academic writing fluency, through process approach. This abstract analysis can be summarized for better understanding. Keywords: not available.
17. Naeem, T., Bhatti, Z. I., Zafar, S., & Asif, S. (2020). Discursive Ethnocentrism in Morrison’s Sula: A Study of Racial Speech Acts. Hamdard Islamicus. 43 (2). 447‐464. (Tamsila Naeem, Zafar Iqbal Bhatti, Shabana Zafar, Sadia Asif (Department of Linguistics & Communications/ILA) Research Outlook 2020 | 241
Abstract: This qualitative study aims to investigate the role of discursive ethnocentric practices of the white used to exploit the black community in Toni Morrison’s Sula (1973), which presents tragic condition of marginalized black living in postcolonial context. The applied theoretical model is based on Judith Butler’s postulates about racial speech acts presented in her famous book, Excitable Speech (1997). For the purpose of analysis, relevant excerpts are taken through purposive sampling technique from the selected novel. In the light of the analysis it is found that the racial acts, which are the aftermaths of socio‐political determinations, become discursive practices and nurture hostility among different groups in a society. The people, who foresee their benefits and interests in highlighting these differences, try to coin specific terms which help create an environment of ethnocentrism in which the identity is formed or deformed in binaries. The study also underlined some relational speech acts with racial speech. Keywords: ethnocentrism, discursive racism, racial speech acts, postcolonial context, exploitation, black community, sula.
18. Anjum, N., Ahmed, M., Khan, Z., Akbar, A., & Najam, K. (2020). “CALL ME MALCOLM” a true design of looking glass self‐theory in western culture. Epistemology, 7(1), 138‐144. (Zarmeena Khan, Anila Akbar (Department of Linguistics & Communications/ILA) Abstract: This research paper is an attempt to explore difficulties of the transgendered people as portrayed in the Holly wood documentary “Call Me Malcolm” with special reference to the Charles Horton Cooley’s looking glass self‐theory. The direction and Production are given by Joseph Parlagreco in 2004 and released in March, 2007 in USA. The communal behavior with transgendered people, due to their gender identity is highlighted in Western society. The “role of society” is the major component of looking glass design that creates pessimistic environment in the life of Malcolm, who suffers a lot in life. Various aspects of the theory are carefully chosen to observe the height of difficulties faced by transgender people in the selected documentary and are analyzed within the framework of Qualitative methodology. Transgender are poorly treated as it is portrayed in the context of western society. They are not accepted in the society. To elucidate the problems of transgender, discriminatory behaviors adopted by the society due to odd physical condition towards Malcolm (a transgender child), on other transgender community and audience is discussed in this paper. By analyzing the dialogues from original text call me Malcolm it is concluded that Malcolm is struggling for existence; He fights and ultimately able to survive Although his culture and ethics are strong, but struggle for survival was a perplexing task to bridge the gap between transgender and a common man in the western world. Keywords: Malcolm, society, western, call, transgender, struggle.
19. Hasan, W., Bhatti, Z. I., Akbar, A., & Khan, Z. (2020). Representation of identities: a study of language on wheels. Al‐Qalam, S(1), 20‐35. (Zafar Iqbal Bhatti, Zarmeena Khan, Anila Akbar (Department of Linguistics & Communications/ILA) Abstract: Language written on domestic and commercial vehicles attracts people in the surrounding and is a source of entertainment. It conveys different messages and has hidden meanings also. Owners and drivers get different thingswritten on their vehicles. This paperproposes that writings on the wheels besides attracting people represent identities of their owners and drivers. It is qualitativeand exploratory study. Data werecollected from 100 vehiclesthrough observation from fivecrowdedareas i‐e Mall Road, Canal Road, Jail Road and main boulevard Gulbergof Lahore(Pakistan)through purposive sampling technique. A list of all the writings from these 100 vehicles was formed for analysis. For theoretical framework, Fairclough’s three‐dimensional model in critical discourse analysis (CDA) was followed to interpret identities. Analysis of the collected data shows that these writings include phrase, verse, quotesin different styles of calligraphy and art. Analysis also highlights that people reveal their social, political, religious, cultural and intellectual identities through these inscriptions. These writings are not for just decoration and fun sake,but they convey hidden meanings too. Research Outlook 2020 | 242
Keywords: language, wheels, critical discourse analysis, identities.
20. Bashir, R., Asif, S., Saleem, A. (2020). Revisiting Lexeme Based Theory’s Word Formation Rules; Counter Evidence From Urdu. International Journal of Management, 11(9), 2020, pp. 276‐286. (Sadia Asif (Department of Linguistics & Communications/ILA) Abstract: The purpose of the current study is to evaluate the application of Lexeme Based Theory on Urdu language, because it claims to engulf, the all aspects of all languages, through its Word Formation Rules (WFRs). In this article, Urdu nouns and adjectives are carefully selected and scrutinized for the processing of these rules. This theory asserts to be universal, because of its rules and declares that morphology enjoys its autonomous position due to these principles, and it does not get crippled to be shouldered by syntax for the building up of meaning. Roots are idiosyncratic and diversification of meaning is confined within the territories of the root, even after inflection and derivation; semantic restriction Isomorphic attributes do not let the root astray from its original meaning. So, on the one hand this theory talks about the integrity of the word (mental lexicon) and on the other side, it says that “phrase like structure do not give unified meaning” Aronoff; 1976. and the word categories (Parts of Speech) never appear like a phrase. They never leave their lexical bases, thus follow No Phrase Constraint (NPC) strictly. This research analysis these two rules and poses these proceeding questions; if Urdu language follows the NPC rule and from where does the Urdu roots inherit their meanings. For this purpose, few of the nouns and adjectives were selected. They were authenticated by the native speakers’ repertoire, and further their word categories and meanings were testified by consulting Urdu dictionaries. The results concluded that Urdu word formation, sometimes do not follow the NPC, thus put the lexical integrity of Aronoff (1976;2010) at stake. Secondly, Urdu language has many polysemic words and their meanings are not self‐emergent, unless they are processed in a context (syntax). So, the autonomy of morphology is also defied. This research will be a good addition to many of the languages, where this theory is failed to be fully applicable, in spite of its recent revision. Keywords: Lexeme Based Theory, No Phrase Constraint, Lexeme and Polysemy, Urdu Nouns and Adjectives.
21. Hafsa, G., Ahmad, S., & Haroon, S. (2020). Traditional Practices in Terms of Compositional Competence of L2 Learners: A learners’ Perception Approach. International Review of Social Sciences (IRSS), 8(12), 279 ‐ 287. (Shumaila Ahmad, Sidra Haroon (Department of Linguistics & Communications/ILA) Abstract: Syntactic error is the major cause of failure at graduation level in government colleges of Pakistan. The study is qualitative and exploratory in nature to find out reasons behind compositional incompetence. Grammar comprehension is very important for the organization of knowledge. Learners become aware of the functions of language through grammar knowledge, thus compositional competence depends upon the grammatical knowledge. This article approaches compositional competence from two perspectives of grammar teaching: Traditional method based upon GTM and Transformational Generative Grammar by Chomsky. The sample for the intended study is 6 BSc students of 4th year. The sample has been purposefully selected as their teacher has been giving them practice according to the recursive principle of Chomsky‟s Transformational Generative Grammar and Krashen‟s affective filter hypothesis. Data is collected through an open‐ended interview and is analyzed thematically. In the end, suggestions are given for the effective teaching methodology for the development of cognitive operationalization. Keywords: Affective Filter, Cognitive Control, Compositional Competence, Inhibitory Control, Linguistic Complexity, Metalinguistic, Recursive Rule, Syntax Error, Traditional Method.
22. Bashir, M., Sarfraz, R., Khubaib‐ur‐Rehman, & Javed, M. (2020). Protrusion of Simon de Beauvoir, A Propelled Portrayal of Feminism in Orlando on Elizabethan Epoch. Journal of Communication and Cultural Trends, 2(1), 31‐
Research Outlook 2020 | 243
40. Retrieved from https://journals.umt.edu.pk/index.php/jcct/article/view/1156. (Rida Sarfraz, Khubaib‐ur‐ Rehman (Department of Linguistics & Communications/ILA) UMT JOURNAL Abstract: It is a stiff known fact that in chauvinistic society, a female has been taken as a suppressed commodity. The ultimate dependence is the main factor in the marginalization of females in society. Although, in a country where the female population is more than men’s, such topics of female subjugation can be traced from the shared history. This study aims at the various factors through which the main character of the movie and novel “Orlando” has gone through the acute transformation from a weaker position to being in command and strong. This paper is based on the qualitative methodology and it will probe traces through which the protagonist is viewed through the lens of Simon de Beauvoir’s Second Sex and gender differences (Beauvoir, 1993). Complete analysis in terms of the body language from being submissive to outrageous, from vulnerable to gaining strength, this research will significantly try to scan all the aspects through which a character is transformed. This paper will also try to probe the socio‐psychological factors through which an individual suffers through the anguish (Ranjan, 2019 ). The protagonist's anguish has been depicted and will be analyzed in the light of famous feminist theorist Simon de Beauvoir's “The Second Sex” (Beauvoir, 1976). While engaging and clashing for the dependability this investigation likewise examines the complexities agonized over the opportunity of enunciation of the protagonist from the two portrayals that are film and text. This examination will open vistas to contemplate the grievance forced by the financial components that pressurises a person, as far as possible, where one has to decide between giving up or revolting against the shackles of society. By the execution of Beauvoir's idea on the screen transformation of "Orlando" composed by Virginia Woolf (Woolf, 1993), the spitting image of women in Elizabethan civilization and her insurrection is illustrated. This paper is a significant effort to highlight the cobwebs encapsulating an individual and their strife to survive and breathe in the same existing world. Keywords: delinquent for womenfolk, Orlando, subversion, Simone de Beauvoir. Conference Paper 1. Alam, M. (2020). 2D Language Mapping of Pakistan: A Prototype Development. Paper presented at the 1st National Conference on Linguistics Challenges in Regional Integration and Globalization FAST‐National University, Lahore Campus. (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: This study intends to provide a two‐dimensional language mapping of Pakistan to highlight the dominant language(s) of the different cities in Pakistan. It is observed that how more often than not, it is difficult to find out what is the dominant language of a region because it is difficult to carry out the research necessary to map it effectively and efficiently. Language and the use of different languages in different regions are very important in order to understand their cultures, norms, and values. Initial data of languages being spoken in different cities of Pakistan is gathered through online resources and researches as well as conducting short interviews by the local residents of these respective regions we find out what language predominately exists in these regions. An integrated developer for Java applications was used to develop 2D model for the language mapping of Pakistan. The application was divided into three layers with data being stored into a separate file. It also features if a city has more than one dominant language. The researcher tries providing an accurate map of these cities and their languages so that one can find out how to classify them according to their regions. Future implication includes development of a comprehensive web‐based application for language mapping of Pakistan. Keywords: Language mapping, Pakistani Languages, Dominant Language, Java Applications.
2. Alam, M. (2020). Machine learning based Urdu sentence splitter: A prototype development. Paper presented at the 1st National Conference on Linguistics Challenges in Regional Integration and Globalization FAST‐National University, Lahore Campus. (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: The aim of this research is to look into basic Natural Language Processing (NLP) techniques and hopes to achieve an unparalleled performance in Urdu sentence splitting, such that it may be used as a stepping stone
Research Outlook 2020 | 244
for further research in other areas of NLP. For our model we have used Regex and Python that performs sentence splitting after preprocessing on the dataset provided. However, as Urdu proves to be more complicated with unclear word boundaries, joining of words as compared to other languages so to deal with it our model works on the basis of delimiters and provides an accuracy of 83% on a dataset. This language splitter can be used in tandem with other advanced language manipulation techniques to do marvels in the un‐researched area of Natural Language Processing in Urdu. Keywords: Machine Learning, Urdu Sentence Splitters, Delimiters, Pre‐Processing.
3. Alam, M. (2020). Teachers’ and Learners’ Perceptions on the use of Linguistic Landscape for the Melioration of Pragmatic Competence at Undergraduate Level. Paper presented at the 1st National Conference on Linguistics Challenges in Regional Integration and Globalization FAST‐National University, Lahore Campus. (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: Internationalization and globalization has enabled English language to flourish in urban spaces around the world (Seidlhofer, 2017). In Pakistan, English is used in all spheres of life, including office spaces and public domains. Moreover, public signage in the cities in Pakistan is also dominated by English language (Manan, David, Dumanig, & Channa, 2017). This creates new opportunities for English language learning and teaching in terms of contextualized and authentic language material for learners and teachers. In the context of increasing interest in the linguistic landscape as a site of language and literacy learning, this paper studies learners’ and teachers’ perceptions on use of linguistic landscape as resource material for improving pragmatic competence. The study follows mixed method approach to have participants’ perception about linguistic landscape. The quantitative part of the study consists of questionnaire for learners and Statistical Package for the Social Sciences to analyse leaerners’ data. Qualitative data is collected from language teachers through open‐ended interviews and analyse through Krueger’s framework. The sample of the study consisted of 94 undergraduate students and six language teachers. The significant results show that both learners and the teachers have a positive attitude towards the use of linguistic landscape for the improvement of pragmatic competence. The study on the basis of its findings recommends that English language teachers may find linguistic landscape helpful resource to improve learners’ pragmatic competence. Keywords: pragmatic competence, linguistic landscape, perceptions, authentic resource, English language classroom.
4. Raza, H., Alam, M. (2020). Relationship between Performance and Emotional Intelligence on Listening English Test of Undergraduate Students in Pakistan. Paper presented at the 1st National Conference on Linguistics Challenges in Regional Integration and Globalization FAST‐National University, Lahore Campus. (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: Emotional intelligence carries a significant role in language education which provides an opportunity to the learners to improve their language knowledge and performance by applying their emotional intelligence skills. However, this relationship of knowledge and performance is not much focused in English language teaching. Therefore, the current study focuses on the exploration of relationship between knowledge and performance of Pakistani undergraduate English language learners and their Emotional Intelligence in English Listening Test. 50 undergraduate students from Computer Science department enrolled in Communication Skills course at National University of Computer and Emerging Sciences, Lahore took part in the study. Activity named as “Polar Bear” from British Council’s website for the collection of listening test data. While, for the emotional intelligence data collection Bar‐On Emotional Quotient Inventory adapted from Acar’s (2001) was used. The listening test was marked against the rubric which is used and approved by the English department. The data was analyzed with the help of statistical software for calculating Pearson correlation. The results have presented a clear and significant relation between Pakistani undergraduate student’s performance in a listening task and Research Outlook 2020 | 245
emotional intelligence. Future studies can explore defined relationship through varied sample size and methodology. Keywords: Emotional Intelligence, Personality Development, Language Education.
5. Raza, H., Alam, M. (2020). Developing Pakistani Sign Language to Written Text System: A Prototype Development. Paper presented at the 1st National Conference on Linguistics Challenges in Regional Integration and Globalization FAST‐National University, Lahore Campus. (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: In Pakistan there are less privileged people in terms of their ability to speak or hear. The major hurdle they face is towards the communication with ordinary people. Therefore, this research aims to bridge that gap and provide a resource for their communication. The research has focused on using neural network model for the processing of Pakistani Sign Language to recognize and convert the hand signs to the Urdu written text. The input dataset was preprocessed by setting up a threshold and converting the images to grayscale. The preprocessed images then sent to the neural network model where they were classified. The neural network model is designed in a way that the classified image is matched with the required target and on the basis of the error found during classification, the weights were adjusted and propagated further. As a result, by using 250 neurons in the hidden layer, about 0.94 accuracy has been achieved. Such precision on the test pictures implies that the utilization of the proposed regular Neural Network system shows a higher efficiency in the recently utilized model. In future, more efficient framework can be built up by using this architecture. In addition to this, the system can be expanded for the dynamic gestures as well. Keywords: Pakistan sign language, text system, neural network, communication.
6. Farooq, A., Alam, M. (2020). Chicana Feminism: A Sojourn from Territorialization to Detteritorialization in Ana Castillo’s The Guardians. Paper presented at the Applied Research International Conference 2020. London (Virtual). (Meesum Alam (Department of Linguistics & Communications/ILA) Abstract: This study aims at exploring the “Mexic‐Amerindian” identity and racial challenges of the main protagonist, Regina in The Guardians while living on borderlands. The identity deals with the issues of women whose ethnicity is grounded in Mexican descent but they are currently living and adapting the ways of American lifestyle. Borderlands are largely represented as physical territories; however, some are constructed in the human minds. The research is peculiar to the social impact of the border than the geographical one. The theoretical framework being used in this paper is Chicana Feminism as it deals with issues of gender and racial discriminations that affect the progress of women of the Chicana community. The study illustrates the protagonist’s movement towards a better future even in the bleakest of times. As living on the borderlands, Regina oscillates between the margins and continuously deconstructs the superior notions through her experiences and stresses on the difference of opinion. Her character further elaborates that a woman can transcend the gender and ethnological stereotypes through continuous struggle and perseverance. The transition of the character aspires at awakening the consciousness among the women who have been restricted by social constraints of their society and allows them to explore the positive character traits that would emancipate in difficult circumstances. Keywords: Mexic‐Amerindian identity, Borderland literature, Racial challenges, Gender discrimination, Chicana Feminism.
7. Ahmad, S., Ejaz, M., & Haroon, S. (2020). The pedagogic implications of emojis in the digitised system of education. Paper presented at the 3rd International Conference on Innovation in Teaching and Learning (ICITL‐ 2020). Department of Education Faculty of Social Sciences International Islamic University Islamabad Pakistan. (Shumaila Ahmad, Munza Ejaz, Sidra Haroon (Department of Linguistics & Communications/ILA) Research Outlook 2020 | 246
Abstract: Effective communication takes place when a message is sent by the sender and received by the receiver in the same context and with same meaning. Multiple modes (writing, pictograms, signs, symbols etc.) of communication reinforce each other to make the process more effective. One of those modes is emojis, a mode, near to pictograms and is considered to have the same universal meaning. Being graphical representations, Emojis are open to interpretation. New generation is much keen to use digital resources and emojis too, to present their thoughts and feelings more vividly. The objective of the study is to explore whether same emojis render different meanings to different individuals. It will discuss different interpretations of whatsApp emojis by university students at graduate level which results in miscommunication. Quantitative research design is used. A self‐administered survey questionnaire (closed ended), carrying 50 randomly selected emojis used in whatsApp with different meaning interpretations were given to 100 graduate students of universities (2 public and 2 private) which are randomly selected. Data were analyzed through SPSS and interpreted for results. Descriptive statistics like mean and standard deviation 40 was used and inferential tests like independent sample t‐test were applied to find the effects of gender. Results will show the difference in the opinion/ interpretation of same emojis by different participants. It is also expected that differences in gender will also affect the interpretation of meaning. This research will be helpful to justify the view that meanings change from culture to culture, gender to gender and even in same gender as well. Keywords: emojis, meaning, communication, whatsapp, culture, gender.
8. Ahmad, S., Haroon, S. & Azhar, M. A.(2020). Sociolect and the Cognitive Development of Youth. Paper presented at the 6th International Conference of the Linguistic Association of Pakistan (ICLAP‐2020). (Shumaila Ahmad, Sidra Haroon (Department of Linguistics & Communications/ILA) Abstract: Language is the tool which is used to express feeling and interconnect with others. It is the center of human life and communication is the essence of any language. As Heller (2007) says that language exercise is socially and politically enroot. This paper discussed the change happening in Urdu language usage in our youth by the influence of socio‐lect/social media. It discussed the factors which become the cause of this change. This paper underlays the impressive behavior of our youth towards the extreme practice of English lexis in their social media language/socio‐lect. Although English is a lingua franca all over the world such excessive use of this language created a schema in our youngster’s minds that the more they use it the more they will be called modern and educated. The present study has observed the changes happening at what level in our Urdu language. A qualitative research paradigm has been used which is multi‐method in focus, involving an interpretive, naturalistic approach to its subject matter (Denzin & Lincoln, 2005). It is used to examine the change happening in our Pakistani English. Research has been conducted through collecting different status updates randomly and by collecting some comments of the active users of social networks. Keywords: sociolect, social media, impressive behaviour, lingua franca, schema, social network. Department of English and Literary Studies Research Articles 1. Safdar, M., & Yasmin, M. COVID‐19: A threat to educated Muslim women's negotiated identity in Pakistan. Gender, Work & Organization, 27, 683– 694. doi: 10.1111/gwao.12457. (Muhammad Safdar (English and Literary Studies) (SKT Campus) Abstract: This study attempts to explore how the lockdown/containment measures taken by the government during the COVID‐19 pandemic have threatened educated Muslim women's negotiated identity regarding wifehood and motherhood in urban Pakistan and how they struggle to reposition to reconstruct it. Through semi‐ structured interviews, making an in‐depth comparative study of three differently situated cases (Muslim women), this study argues that the abnormal situation that has ensued from the pandemic has reinforced the
Research Outlook 2020 | 247
vulnerability of women's nascent negotiated identity by landing them in a space where they are supposed by the normative structures to step back to carrying out their traditional responsibilities as ‘good’ wife and mother during the crisis. It has found that the pandemic has similarity in its impacts for the women in their familial lives, despite their being variously situated and resistive, due to the general religio‐culturally defined patriarchal social behaviour of the place (Pakistan) toward women and lack of action on the part of the state for implementing its laws of women's empowerment.. Keywords: COVID‐19, identity, motherhood, muslim women, Pakistan, wifehood.
2. Perveen, A., & Anwar, N. (2020). Moratorium or Achievement: Identity Statuses in Mohsin Hamid’s The Reluctant Fundamentalist. Global Social Sciences Review, 1, 283‐290. 10.31703/gssr.2020(V‐I).29. (Nadia Anwar (English and Literary Studies) Abstract: The Reluctant Fundamentalist (2007) traces the evolution of Changez’s sense of belonging by encompassing a substantial part of his life odyssey, ranging from his movement to the US for higher studies to his disillusionment and redirection of fundamental desires. This study explores those transformative stages that help shape his identity. For this purpose, James Marcia’s theory of identity achievement has been used as a theoretical framework. Marcia (1980) contends that certain situations and events (called ‘crises’) act as catalysts to prompt identity moratorium. The internal conflict caused by such catalysts stimulates adolescents to probe into their beliefs, goals and values. Changez also encounters the four statuses described by Marcia i.e., identity diffusion, foreclosure, moratorium and final achievement. Consequently, a refraction in his sense of belonging takes place ‐ from love for American exceptionalism to love for Pakistan and Islam (Morey, 2011). This study evaluates the level of identity achievement in Changez as a result of this refraction. Keywords: Identity achievement, identity moratorium, Islam, Pakistan, sense of belonging, fundamental.
3. Malik, S., & Anwar, N. (2020). Female Corporeality and the Sublimation of Pain: A Study of The Pakistani Bride by Bapsi Sidhwa. NUML Journal of Critical Inquiry, 18(II), 43‐63. (Shamsa Malik, Nadia Anwar (English and Literary Studies) Abstract: This study explores in detail the crisis of female corporeality and how the self sublimates the resultant pain into psychological empowerment. Pakistani women have long been viewed as having no space for themselves. They could not master their choices or muster up courage to fight for the fulfillment of their desires. Similarly, the female characters in Bapsi Sidhwa’s novel The Pakistani Bride (1990) appear to be oppressed and marginalized entities, dependent on men for their socio‐economic needs. Yet, this research argues that their corporeal pain transforms into a psycho‐emotional haven providing them a space of their own to think and make their own decisions. This specific strand has been a neglected area of research in the Sub‐continental context. The research design used in this study is qualitative while the textual analysis is used as a method to analyze the data. The research pursues feminist literary standpoint theory posited by bell hooks (2004) in the postcolonial feminist context, while the Foucauldian (1979) concept of “Panopticism” (p. 195) and “Docile Body” (p. 135) are threaded to highlight the concept of complete physical and mental surveillance of the autonomous body/person in order to investigate the shift of gender/power roles from male hegemony to female empowerment. Keywords: corporeality, sublimation, suppression, marginalization, empowerment.
Research Outlook 2020 | 248
School of Professional Psychology (SPP) Department of Clinical Psychology (DCP) Research Articles 1. Mukhtar, S. (2020). Are individuals with cardiovascular disease at risk of COVID‐19‐related mental health problems or individuals with cardiovascular disease at risk of cardiovascular disease‐related mental health problems during COVID‐19? A psychological‐psychiatric perspective. Medical hypotheses, 144, 109919‐109919. doi: 10.1016/j.mehy.2020.109919. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
2. Mukhtar, S., & Rana, W. (2020). COVID‐19 and individuals with mental illness in psychiatric facilities. Psychiatry research, 289, 113075‐113075. doi: 10.1016/j.psychres.2020.113075. (Sonia Mukhtar (DCP/SPP)(Letter to editor) Abstract: Not available. Keywords: not available.
3. Mukhtar, S., & Mukhtar, S. (2020). Mental Health and Psychological Distress in People with Diabetes during COVID‐ 19. Metabolism ‐ Clinical and Experimental, 108. doi: 10.1016/j.metabol.2020.154248. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
4. Mukhtar, S. (2020). Pakistanis' mental health during the COVID‐19. Asian journal of psychiatry, 51, 102127‐ 102127. doi: 10.1016/j.ajp.2020.102127. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
5. Mukhtar, S. (2020). Mental Health and Psychosocial Aspects of Coronavirus Outbreak in Pakistan: Psychological Intervention for Public Mental Health Crisis. Asian journal of psychiatry, 51, 102069‐102069. doi: 10.1016/j.ajp.2020.102069. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
6. Rana, W., Mukhtar, S., & Mukhtar, S. (2020). Mental health of medical workers in Pakistan during the pandemic COVID‐19 outbreak. Asian journal of psychiatry, 51, 102080‐102080. doi: 10.1016/j.ajp.2020.102080. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
7. Zulfiqar, L., & Rafiq, M. (2020). Exploring experiences and coping strategies of nurses working in intensive care unit: A qualitative study. Anaesthesia, Pain & Intensive Care, 24(1), 42‐49. (Lamae Zulfiqar, Muhammad Rafiq (DCP/SPP) Abstract: Background: The nursing profession is in its developing stages in the country yet when it comes to the work itself, the environment can be very competitive. Though nurses, in general, go through a tough time, it is the intensive care unit (ICU) nurses who have to be on their toes all the time. Those working in the pediatric department, deal with young patients requiring constant supervision and care compared to other ICUs. Research Outlook 2020 | 249
The aim of the current project was to explore the experiences and coping strategies of nurses working in pediatric ICUs in a public sector hospital of Lahore, Pakistan. Methodology: Semi structured in‐depth interviews were conducted with 5 nurses who were working in pediatric ICU (PICU) in a public sector hospital. All the nurses were female. Results: The data was managed and analyzed using NVivo 12 version. The four superordinate themes, e.g. vocational problems, psychological problems, biosocial problems and coping had 11 master themes and 70 sub themes. Conclusion: Nurses in PICU face a lot of problems in their everyday work life, yet they have found their own ways to cope with their stress. Regardless the shortage of staff and constant complaints against them, nurses of PICU find solace in religious coping and socialization (as much as they can get). These results will help authorities to look into the problems and provide suitable solutions. Keywords: pediatric intensive care unit, nurses, stress, hospital, public sector, coping, phenomenology.
8. Rafiq, M. (2020). Circle therapy for headache management: case studies. Anaesthesia, Pain & Intensive Care, 24(1), 101‐104. DOI: https://doi.org/10.35975/apic.v24i1. (Muhammad Rafiq (DCP/SPP) Abstract: Recent findings have indicated that hypnotic interventions produce significant decrease in pain intensity. This current case studies are focused to highlight significant impact on pain management including headache. All the patients underwent a complete observation and clinical interview and only patients with psychological pain were included in the study group. For the management of headache, a novel hypnotic intervention ‐ Circle Therapy (CT), was applied on a group of ten patients indicating their pain intensity in the range of 8‐10 on subjective pain rating scale. According to rating scale, headache above 8 was considered as severe, 5‐8 moderate and < 5 as mild. CT is a brief hypnotic technique limited to about 10 min. Post hypnosis ratings were also measured. The pre and post hypnosis data were recorded and analyzed by paired samples t test.Use of CT showed significant results between pre and post rating e.g. 9 ± 0.25 vs. 1 ± 0.21 (p < 0.001). This brief CT intervention provided an immediate relief from headache, however, this is limited to few case studies focusing on just headache. So, we recommend large sample studies to document the effects of CT in different types of pain. Keywords: pain management, circle therapy, headache, suggestibility, hypnosis, brief psychotherapy.
9. Mukhtar, S. (2020). Psychosocial Impact of COVID‐19 on Older Adults: A Cultural Geriatric Mental Health‐Care Perspectived. Journal of Gerontological Social Work, 63(6‐7), 665‐667. doi: 10.1080/01634372.2020.1779159. (Sonia Mukhtar (DCP/SPP) (Letter) Abstract: Not available. Keywords: not available.
10. Mukhtar, S. (2020). Feminism and gendered impact of COVID‐19: Perspective of a counselling psychologist. Gender, Work & Organization, 27, 827– 832. doi: 10.1111/gwao.12482. (Sonia Mukhtar (DCP/SPP) Abstract: When women, girls and gender‐diverse people — who have been disproportionately impacted by the COVID‐19 pandemic outbreak since the public health crisis has also become a crisis for feminism — will identify and acknowledge their organismic phenomenological self, wholeness and growth will be fully functioning. Psychological aspects for the public health emergency operated through counselling psychologists to manage mental health, emotional, psychological, cognitive, behavioural, relational and social impacts are fundamental. And the role of counselling psychologists in maintaining personal mental health and their clients is a crucial indicator of collective wellbeing. This perspective is embedded in the gendered approach and feminist framework which attempts to explore and offer the embodied intersectional and divergent impact on living during the COVID‐19 pandemic lockdown.
Research Outlook 2020 | 250
Keywords: awareness, counselling psychologist, COVID‐19 (coronavirus), feminism, gendered impact, growth mental health.
11. Mukhtar, S. (2020). Psychological health during the coronavirus disease 2019 pandemic outbreak. International Journal of Social Psychiatry, 66(5), 512‐516. doi: 10.1177/0020764020925835. (Sonia Mukhtar (DCP/SPP) Abstract: Background: The current ongoing pandemic outbreak of COVID‐19 (Coronavirus Disease 2019) has globally affected 213 countries and territories with more than 2.5 million confirmed cases and thousands of casualties. The unpredictable and uncertain COVID‐19 outbreak has the potential of adversely affecting the psychological health on individual and community level. Currently all efforts are focused on the understanding of epidemiology, clinical features, mode of transmission, counteract the spread of the virus, and challenges of global health, while crucially significant mental health has been overlooked in this endeavor. Method: This review is to evaluate past outbreaks to understand the extent of adverse effects on psychological health, psychological crisis intervention, and mental health management plans. Published previous and current articles on PubMed, EMBASE, Google Scholar, and Elsevier about psychological impact of infectious diseases outbreaks and COVID‐ 19 has been considered and reviewed. Comments: COVID‐19 is leading to intense psychosocial issues and comprising mental health marking a secondary health concern all around the world. Globally implementing preventive and controlling measures, and cultivating coping and resilience are challenging factors; modified lifestyle (lockdown curfew, self‐isolation, social distancing and quarantine); conspiracy theories, misinformation and disinformation about the origin, scale, signs, symptoms, transmission, prevention and treatment; global socioeconomic crisis; travel restrictions; workplace hazard control; postponement and cancellation of religious, sports, cultural and entertainment events; panic buying and hoarding; incidents of racism, xenophobia, discrimination, stigma, psychological pressure of productivity, marginalization and violence; overwhelmed medical centers and health organizations, and general impact on education, politics, socioeconomic, culture, environment and climate – are some of the risk factors to aggravate further problems. Keywords: COVID‐19, coronavirus pandemic, mental health, social and behavioral epidemiology, psychological problems, psychosocial issues, misinfodemics, stigma, resilience, coping, mindfulness and well‐being.
12. Mukhtar, S. (2020). Mental health and emotional impact of COVID‐19: Applying Health Belief Model for medical staff to general public of Pakistan. Brain, behavior, and immunity, 87, 28‐29. doi: 10.1016/j.bbi.2020.04.012. (Sonia Mukhtar (DCP/SPP) (Letter to editor) Abstract: Not available. Keywords: not available.
13. Rasool, A., & Mahmood, Z. (2020). Post‐traumatic Stress Reaction and Internally Displaced Persons: A Psychosocial Approach. Clinical and Counseling Psychology Review (CCPR), 2(1). (Aisha Rasool, Zahid Mahmood (DCP/SPP) UMT JOURNAL Abstract: The concept of involuntary displacement inside the country is growing day by day. Globally, researchers have suggested that due to prolonged internal displacement the Internally Displaced Persons (IDPs) usually suffer from mental health issues. The current study was carried out with the purpose of investigating the psychosocial reactions of trauma in IDPs, who were subjected to displacement due to the military operation in the region, with no concurrent aim of diagnosing them with Post‐traumatic Stress Disorder (PTSD). It was a cross‐sectional study and 104 (M= 31.20, SD=9.32) IDPs were sampled for it. Post‐traumatic Stress Diagnostic Scale (PDS) was administered on IDPs. The findings revealed that around 17% of them showed severe symptoms. The women were at more risk for PTSD as compared to men. Although no significant differences were found in both genders when it was about impairment in daily life functioning and both were equally affected. The satisfaction of life was decreased; too, on many symptoms results were significant. It was revealed that symptom severity Research Outlook 2020 | 251
decreased when the duration of displacement increased. The results were described according to cultural manifestation. Keywords: not available.
14. Saleem, S., Asghar, A., & Mahmood, Z. (2020). Perceived Parental Rearing Practices, Interpersonal Relationships and Psychological Problems in College Students. Bahria Journal of Professional Psychology, 19(2), 01‐11. (Sadia Saleem, Ayesha Asghar, Zahid Mahmood (DCP/SPP) Abstract: The need of belongingness is said to be one of the basic human need. The quality of parent‐child relationship provides a base to develop long term, intimate and deep emotional bonds among individuals. The current study is aimed to explore the predictive relationship of perception of parental practices and quality of interpersonal relationship with psychological problems among college students. In a quantitative correlation survey research design, 321 participants (54 % boys & 46% girls) from different colleges of Lahore were selected through stratified random sampling. The age range of the participants was 15‐20 years (M=17.32; SD=1.00). Three scales Egna Minnen Betraffenda Uppdostran – A (EMBU‐A; Gerlsma, Arrindell, Veen, & Emmelkamp, 1991), Interpersonal Difficulties Scale (Saleem, Ihsan, & Mahmood, 2014) and General Health Questionnaire‐30 (Goldberg & Williams, 1988) and a demographic form were given to participants. Findings of the study showed that perceived parental rejection and interpersonal problems are the significant predictors of psychological problems in college students. Results are discussed in terms of counseling and cultural perspectives. Keywords: Perceived parental rearing practices, interpersonal relationships, psychological problems, college students.
15. Rafiq, M., Wasay, M., Ramos, Raúl Pérez. (2020). Management of spasticity and psychological symptoms through hypnosis in stroke survivors. Anaesthesia, Pain & Intensive Care, 24(3), 291‐301. DOI: https://doi.org/10.35975/apic.v24i3.1278. (Muhammad Rafiq (DCP/SPP) Abstract: Studies have shown that stroke survivors are associated with physical as well as psychological symptoms. Spasticity is the main physical issue associated with stroke survivors and stress, anxiety, and depression are common. This study was conducted to investigate any effect of hypnosis on the psychological symptoms (anxiety, stress, and depression) and on the spasticity in the stroke survivors. Keywords: psychological symptoms, anxiety, stress, depression, spasticity, hypnosis, circle technique, stroke.
16. Anthony, S., Subhan, S., Saleem, S., & Mahmood, Z. (2020). Mental Toughness Scale for Pakistani University Students: A Validation Study. Pakistan Journal of Psychological Research, 35(4), 693‐706. https://doi:org/10.33824/PJPR.2020.35.4.37. (Sarah Anthony, Sara Subhan, Sadia Saleem, Zahid Mahmood (DCP/SPP) Abstract: The current mental toughness is multidimensional construct that help the individual to show persistent strength and preservation during the high competitive situations. The university life is the most vulnerable and pressured time for the university students. The aim of the current study was to determine the psychometric properties of the Mental Toughness Scale (MTS) in university students. A total of 306 participants (151 men and 155 women) with the age range of 18‐25 (M = 20.66; SD = 1.36) were administered the Mental Toughness Scale, the Resilience Scale and the Student Problem Checklist. The results of the Exploratory and Confirmatory factor analysis yielded a three factor solution Sense of Personal Competence, Problem Solving Skills and Social Competence. Further, the MTS was found high internal consistency, reliability, construct and discriminant validity. The results pave the way for application of the Mental Toughness of University students of Pakistan and are discussed in light of cultural implications. Keywords: mental toughness, university students, mental health problems.
Research Outlook 2020 | 252
17. Ashfaq, A., Saleem, S., Karamat, N., & Mahmood, Z. (2020). Psychosocial problems in pregnant women: A psychometric study. Rawal Medical Journal, 45(4), 826‐829. (Amber Ashfaq, Sadia Saleem, Nosheen Karamat, Zahid Mahmood (DCP/SPP) Abstract: Objective: To explore the frequently reported psychosocial problems during pregnancy and develop a valid and reliable assessment procedure that can be further use for counseling purposes. Methodology: The current study is a mixed methods design comprised semi‐structure interview technique to explore the lived experience of psychosocial problems and to generate item pool and factor analysis to establish psychometric properties of the newly developed scale. 150 pregnant women with all the three trimesters were selected through purposive sampling technique and given the Psycho social problems of Pregnant Women Scale (PPSPW) and Depression Anxiety Stress Scale (DASS‐SF) along with a demographic Performa. SPSS 20 was used for analysis. Results: A total of 150 pregnant women from urban and ruler areas with the age range of 20‐ 40 were selected from different Govt. and private gynecological departments of Lahore. There were an equal proportion of participants from each trimester. The results of factor analysis revealed a four‐factor solution namely Somatic Problems, Apprehension about Future, Lack of Family Support and Low Mood. PPSPW found to have high internal consistency and concurrent validity. The tool developed in the current study would be helpful for measuring the psychosocial issues women face during their phase of pregnancy. Conclusion: Pregnant women experience serious psychosocial problems which if not identified early and timely may lead to serious mental health consequences not only for the new mother, the child but for whole family. Keywords: Pregnancy, psychosocial problems, child bearing.
18. Sarwar, A., Subhan, S., Saleem, S., & Mahmood, Z. (2020). Risk and vulnerability factors of breakup distress in young adults. Rawal Medical Journal, 45(4), 890‐893. (Anila Sarwar, Sara Subhan, Sadia Saleem, Zahid Mahmood (DCP/SPP) Abstract: Objective: To identify the risk and protective factors in young adults experiencing breakup distress in Lahore, Pakistan. Methodology: It was a quantitative study with correlational research design and included 142 participants (75 women; 67 men) who experienced romantic relationship breakup and were studying in university. They were selected through purposive sampling with the mean age of 21.12 (SD=2.49). All participants were given the protocol comprising Romantic Relationship Breakup; EMBU_A (My Memories of Upbringing) and demographic variables. Results: Paternal Rejection and Overprotection were found to be highly significant for increasing the risks of distress associated with romantic relationship breakup in young adults. Also, the women are more vulnerable to experience psychosocial distress after romantic relationships breakup. Conclusion: The breakup distress variation is determined by numerous risk and protective factors particularly parental practices. Thus, it’s imperative to identify those factors to reduce the distress associated with breakup in adults. Keywords: Distress, psycho‐emotional, multidimensional.
19. Aslam, S., & Mahmood, Z. (2020). Psychosocial problems in nurses: A psychometric approach. Rawal Medical Journal, 45(4), 910‐914. (Saba Aslam, Zahid Mahmood (DCP/SPP) Abstract: Objective: To develop a Psychosocial Problems scale for nurses in Pakistan. Methodology: This study was conducted by exploring the construct of psychosocial problems from 300 nurses from government hospitals through semi structured interview. List of 40 items were finalized by excluding the repetition which were further validated by the experts. Content validity indexed was applied to finalize the list Research Outlook 2020 | 253
after expert validation so the 40 items were retained which further piloted on 30 nurses for assessing the user friendliness of scale. Sample of 300 nurses for exploratory and 700 nurses for confirmatory factor analysis was selected with mean age 30.34±2.90 years. They were given the psychosocial problems scale (PSPS), DASS‐21 (Depression, Anxiety, Stress Scale), Self‐esteem scale along with a demographic form. Results: Exploratory factor analysis with varimax rotation yielded three factors solution named as intrapersonal, work related and exhaustion which were further validated through confirmatory factor analysis and found to be the best fit model as the x2/DF=4.33 , CFI=0.93, NFI=.91, TLI= .90 and RMSEA=.06. The PSPS found the sound psychometrics as test retest reliability was .95, split half reliability was .97 also have sound concurrent and discriminant validity. Conclusion: PSPS was found to have sound psychometrics as well as having the best representation of the psychosocial problems among nurses. Further, it discussed in terms of counseling services and improving mental health among nurses. Keywords: Psychometric, mental health, nurses.
20. Sultana, S., Saleem, S., & Mahmood, Z. (2020). Coping with the stress of congenital visual impairment. Rawal Medical Journal, 45(4), 898‐901. (Safia Sultana, Sadia Saleem, Zahid Mahmood (DCP/SPP) Abstract: Objective: To explore the different coping strategies used by congenitally visually impaired young adults to cope with the burden of disability. Methodology: An open‐ended interview technique was used to gather item pool from 35 visually impaired individuals (20 men and 15 women) with age range 18 to 26 years (mean=21.29±2.65). A list of 25 items were further validated by experts and piloted on 10 participants (5 men and 5 women). Lastly, a sample of 426 (62% men and 38% women) visually impaired young adults aged 16 ‐28 years were tested for psychometric properties of Coping Strategies Scale for Visually Impaired (CSS‐VI) along with Depression Anxiety Stress Scale. Results: Factor Analysis generated three factors of CSS‐VI, emotion venting, active problem solving and support seeking strategies. The CSS‐VI was found to have good internal consistency, and discriminant validity. Conclusion: The results suggest that individuals with congenital VI use more positive coping to curtail the stress associated with their dysfunction. Keywords: Congenital visual impairment, coping strategies, scale development.
21. Suneel, I., Saleem, S., & Mahmood, Z. (2020). Mental health functioning of adult children of alcoholic fathers in Pakistan. Rawal Medical Journal, 45(1), 140‐143. (Sadia Saleem, Zahid Mahmood (DCP/SPP) Abstract: Objective: To ascertain functionality of the mental health among adult‐children of alcoholic fathers in comparison to the adult‐children of non‐alcoholic fathers in a culture where alcohol related beverages is prohibited by the law on religious grounds and drinking is socially discouraged. Methodology: This correlational study had 200 subjects in both groups (experimental and comparison groups). The age range was 18‐25 years. The mental health functioning was assessed by using General Heath Questionnaire‐GHQ30. Results: Adult‐children of Alcoholic fathers scored significantly higher on screening (T (198) =3.41, P=0.001) and severity score (T (198) =5.73, P=0.001) as compared to adult‐children of non‐alcoholic fathers Conclusion: This study could act as an impetus for further research and also create awareness about the problems faced by the adult‐children of alcoholics. Moreover, intervention strategies could be developed to help this vulnerable population. Keywords: Children of alcoholics, mental health, alcoholism, Pakistan.
Research Outlook 2020 | 254
22. Azhar, M., Saleem, S., & Mahmood, Z. (2020). Perceived parenting and distress tolerance as predictors of mental health problems in university students. Journal of Research in Social Sciences (JRSS), 8(1), 91‐105. (Maha Azhar, Sadia Saleem, Zahid Mahmood (DCP/SPP) Abstract: Certain perceived parental rearing styles have considerably been linked to mental health problems. The association is yet to be made in terms of its predicting along with an individual’s abilities of distress tolerance. Following the correlational research design, 300 university students, age range of 16 – 25 years (M=20.05, SD=1.75) using purposive sampling strategy was recruited and given a demographic questionnaire, Egna Minnen Betraffande Uppfostran (EMBU‐A) Distress Tolerance Scale and Depression Anxiety Stress Scale‐Short Form (DASS 21SF). Hierarchical Regression analysis indicated that experiencing high maternal rejection and high maternal over‐protection along with having low distress tolerance level predicts more mental health problems in undergraduates of Pakistan. We have further implied the results in the context of collectivist culture which has provided valuable insight for counselling interventions in university setting for future stakeholders of community. Keywords: anxiety, depression, distress tolerance, over‐protection, rejection, stress.
23. Rafiq, M., Bashir, U., Hasnain, J. (2020). COVID‐19 survivors and neuropsychological issues: A way forward. Anaesthesia, Pain & Intensive Care. 24(6). 667‐670. (Umaiza Bashir (DCP/SPP) Abstract: Background: This brief article focuses on highlighting the importance of possible neuropsychological manifestations among the Coronavirus Disease 19 (COVID‐19) survivors. Studies have evidenced that like other Coronaviruses, COVID‐19 is highly contagious and also responsible for the development of mild to severe respiratory symptoms. As COVID‐19 is a recently emerged pandemic that has resulted in more than six hundred thousand deaths around the globe as of July 2020 and most of the researches has focused on the physical manifestations. Purpose: The purpose of this review article was to highlight the importance of COVID‐19 infection in perspective to mental health in those patients who are survived. Methodology: For this purpose, an intensive literature review was conducted through different scientific search engines including PubMed, Google Scholars, Science Direct, etc. Results and Conclusion: There is very limited data available on manifestations including psychological and neuropsychological. Studies have shown that viral infections including viruses from Coronaviridae have been implicated in the nervous system including the brain. So, it is important to investigate the post‐COVID‐19 infection in neuropsychological aspects. Such studies will highlight the importance of post‐COVID‐19 complications and will also help in redesigning the treatment plan for mental health. Keywords: COVID‐19, neuropsychological issues, mental health, Coronavirus Disease 19 Survivors, depression, anxiety, stress.
24. Gul Butt, M., Mahmood, Z., & Haroon, M. (2020). Modified Dialectical Behaviour Therapy with Borderline Personality Traits: An Outcome Study. Pakistan Journal of Medical and Health Sciences, 14(4), 1062 ‐ 1065. (Zahid Mahmood (DCP/SPP) Abstract: The present study was conducted with an aim to find the effectiveness of modified Dialectical behaviour therapy (DBT) with borderline personality traits (BPT) in Pakistani population. Experimental research design was used, in which one control group and one experimental group were taken having 34 subjects in each group. DBT was applied with experimental group whereas, treatment as usual (TAU) was provided to control group. The experimental group received 16 individual therapy sessions, along with firstfollow‐up and second follow‐up after every four months and completed a one‐year duration. Findings of the study have revealed that Dialectical behaviour therapy remained quite efficient in treating borderline personality traits, according to Gul, Mahmood Borderline Personality Traits Scale (GMBPTS) at pre, mid, post, first follow‐up and second follow‐up assessments. Research Outlook 2020 | 255
Keywords: Internalizing distress, Perceptual Insecurity, Impulsivity, Conflictual dependence, Emotional Liability, Dialectical Behaviour Therapy. Conference Paper 1. Bashir, U. (2020). Perfectionism turns into Obsessive Compulsive Behaviors in COVID‐19 Pandemic. Paper presented at the One Day e‐Conference on COVID‐19: The Changing Horizons. 20 July. (Umaiza Bashir (DCP/SPP) Abstract: T.H. was 21 years old female who was a BS student of 3rd semester in university. Online sessions were arranged for her and total number of sessions with the client was 4. She came with presenting complaints of feeling low most of the time, communication problem with father especially when he goes out and come back home, according to client her father does not care much about preventative measures for COVID‐19. She was experiencing disturbed thoughts regarding corona virus and wash her hands frequently. She was also having problems related to online classes and learning as well which cause lack of satisfaction for academic work. The psychological assessment was done through Clinical Interview, Perceived Ratings of Problems, Vertical Descent and Functional Analysis. It was revealed in Clinical Interview that she had negative perception of others, fear of failure, unable to maintain relationship with class fellows. Assessment result showed low confidence and excessive ruminations regarding small issues which cause marked disturbance in academics and family relationships since past one month. On the basis of detailed psychological assessment, the client’s suspected problem seemed to be having predisposed tendencies of perfectionism, and now having excessive obsessions with some depressive symptoms as well. The management plan was devised using interventions of Cognitive Behaviour Therapy after developing rapport. She was given psychoeducation to improve understanding of problem through insight building, ABC model and case formulation. Problem solving exercises to improve communication styles and academic issues. Reframing to alter her thought patterns as well as deep breathing and other distraction techniques to control anxiousness were done. Keywords: not available.
2. Bashir, U. (2020). Demographic Correlates and Predictors of Psychological Strengths against COVID‐19 Pandemic. Paper presented at the International E‐ Conference on “Psychosocial Wellness and Rehabilitation: Challenges for Practitioners during Pandemic", Centre for Clinical Psychology, University of the Punjab, Pakistan. (Umaiza Bashir (DCP/SPP) Abstract: Aim and Background: Existing Corona virus pandemic it has diverse effects on people’s physical and mental health. That’s why the current study was planned to focus on the positive side of the corona virus pandemic. Psychological strengths were explored during lock down period which helped individuals to cope up with the pandemic stress. Method: Cross sectional research deign was used in which 371 participants were included. Participant’s age was between 18 years to 60 years (M= 40.6, SD=176.9). Both men and women filled study questionnaires via online google form including demographic variables, indigenous scale for psychological strengths and family communication scale. Results: Results revealed that psychological strengths were prevailing on larger scale in general population. Age, gender, family system and family communication were found out as the predictors of psychological strengths against COVID‐19 stress. Participants living in nuclear family system had more psychological strengths as compare to participants living in joint family system. Current study’s finding would be helpful for and future recommendations and implementation of psychological treatment of pandemic stress. Keywords: covid‐19, pandemic, psychological strengths, stress.
Research Outlook 2020 | 256
Department of Applied Psychology Research Articles 1. Waseem, F., Jibeen, T., & Iqbal, W. Z. (2020). Determinants of Life Satisfaction: Role of Living Arrangements, Social Status, and Perceived Satisfaction in Women. Journal of International Migration and Integration, 21(2), 335‐349. doi: 10.1007/s12134‐019‐00654‐3. (Tahira Jibeen (Psychology\SPP) Abstract: Living arrangements, social status, and perceived freedom may have a powerful effect on women’s satisfaction with life. Perceptions of satisfaction were studied by testing these independent variables: living arrangements (living with in‐laws vs. separately) and social status (being married to army officer vs. civilian), with the dependent variables of perceived freedom and satisfaction with life. The sample comprised 104 women (age = 32.36, SD = 6.59) married to civilians (51%) and army officers (48%) in Lahore, Pakistan. Women married to army officers and not sharing with in‐laws were more likely to indicate a higher level of freedom and satisfaction compared to women married to civilians and living with in‐laws. Further, a mediational analysis revealed that the effect of living arrangements on satisfaction was mediated by womens’ reported freedom. Keywords: living arrangements, social status, freedom, satisfaction, socio‐cultural norms, changed family roles.
2. Ashraf, F., Jibeen, T., & Masood, A. (2020). Perceived Stress in Relation to Obsessions and Compulsions in South Asian Adults: Moderating Role of Socio‐demographic Characteristics. Community Mental Health Journal, 56(4), 680‐691. doi: 10.1007/s10597‐019‐00529‐y. (Tahira Jibeen (Psychology\SPP) Abstract: This study examines perceived stress associated with obsessions and compulsions (OC) in a normative sample of adults. The aim was to discover whether socio‐demographic characteristics (i.e., gender, marital status, employment status, age and education) had a moderating effect on perceived stress and OC symptoms. The participants were 362 Pakistani adults (M age = 26.82 years, SD = 4.75; males = 188, females = 174) and the findings were based on a demographic questionnaire, the perceived stress scale (Cohen et al., in Applied multiple correlation/regression analysis for the behavioral sciences, Taylor & Francis, London, 1983), and the Padua inventory of obsessive compulsion disorder symptoms (Burns et al., in Behav Res Ther, 34(2), 163–173, 1996). A series of stepwise regression analyses showed that socio‐demographic characteristics (employment status, age, and education) significantly moderated the relationship between perceived stress and OC symptoms. The current findings have implications for clinicians and researchers in generating effective stress management programs and learning mechanism for managing OC symptoms, particularly in the context of socio‐demographic characteristics. Keywords: obsessions and compulsions, perceived stress, socio‐demographic characteristics, adults.
3. Qayyum, S., Tariq, S., & Younas, F. (2020). Sick building syndrome and job performance in women factory workers. Journal of Postgraduate Medical Institute (Peshawar‐Pakistan), 34(1). (Shahnila Tariq (Psychology\SPP) Abstract: Objective: To investigate the relationship between sick building syndrome (SBS) and job performance of women factory workers. Methodology: This was a correlational study. A sample of 200 women working in different industrial sectors including pharmaceuticals, hosiery, polyester fiber, and stitching units was recruited with purposive sampling technique,. Indoor Air Quality (IAQ)1 was employed to assess sick building syndrome while Individual Work Performance Questionnaire (IWPQ)2 was used to assess job performance. Results: Results for correlation analyses revealed significant relationship between SBS and job performance while demographic variables including age, family system, working hours as negatively correlated with SBS and job performance. Moreover, SBS was found to be a significant negative predictor of job performance, while age was found to be a significant negative predictor of contextual and adaptive performance domains of job performance. Conclusion: It was concluded that SBS negatively affects the performance level of the factory workers. Keywords: factory workers, job performance, sick building syndrome.
Research Outlook 2020 | 257
4. Liaqat, H., Malik, T. A., Bilal, A. (2020). Impact of Masculinity and Normative Male Alexithymia on Interpersonal Difficulties in Young Adult Males. Mediterranean Journal of Clinical Psychology, 8(2). https://doi.org/10.6092/2282‐1619/mjcp‐2488. (Ahmed Bilal (Psychology\SPP) Abstract: The study of psychology of men and masculinity received scientific attention recently focusing on gender differences and its impact in communicating and expressing emotions. It has been proposed that men, who had been discouraged as boys in expressing and talking about their emotions showed difficulty in identifying and expressing emotions throughout their lives which has been termed as normative male alexithymia (Levant, 2011). Emotions are related to many vital functions, and its awareness leads to healthy intrapersonal and interpersonal functioning. The present study aimed to explore the impact of masculinity and normative male alexithymia on interpersonal difficulties in young adult males. Assessment measures included a demographic form, sex role attitude scale, normative male alexithymia scale, and interpersonal difficulties scale. Sample of the study (N=232) included young adult males (Age = 18 to 24) who were approached through the universities of Lahore. Results suggested that with the increase in traditional masculinity, normative male alexithymia and interpersonal difficulties also increases. Further it was found that traditional masculinity predicted interpersonal difficulties and normative male alexithymia aggravate the relationship. Moreover, normative male alexithymia mediates the relationship between traditional masculinity and interpersonal difficulties. Findings of the study were explained and future implications were discussed. Keywords: masculinity, normative male alexithymia, interpersonal difficulties.
5. Tariq, S., Farooq, M., Malik, S. (2020). Psychological Experience of University Students in COVID‐19 Lockdown: A Qualitative Research. Pakistan Social Sciences Review, 4(3), 807‐823, doi:10.35484/pssr.2020 (4‐III) 57. (Shahnila Tariq (Psychology\SPP) Abstract: The rapid spread of corona virus disease 2019 (COVID‐19) is causing stress and challenges for people from all fields of life. This pressure also affected the students due to lockdown in country and closing of educational institutes in Pakistan. The objective of the present study is to explore the psychological experience of university students during COVID‐19 lockdown. Using a descriptive phenomenological approach, 20 students were selected from private and public universities, with equal distribution based on gender. Telephonic interviews were conducted and data were analyzed by using Colaizzi’s 7‐step method. It can be concluded that during the lockdown, students experienced mixed emotions. In the initial stage, positive emotions were dominant but negative emotions appeared gradually. Use of coping strategies for adaptation and adjustment played a significant role in maintaining the students’ mental health. Keywords: COVID‐19, lockdown, psychological experience, university students.
6. Ayub, S., & Malik, F. (2020). Experiences of Cyber Harassment and Social Adjustment in Female University Students: Moderating Role of Self‐Efficacy. Pakistan Journal of Psychological Research 35(3), 523‐544. (Sumaira Ayub (Psychology\SPP) Abstract: The present study investigated the moderating role of self‐efficacy in relationship between experiences of cyber harassment experiences and social adjustment in female university students. A purposive sample of 365 female students of universities in Lahore with age ranging from 17‐30 years (M = 20.93, SD = 2.39) was taken. Urdu versions of Cyber Harassment Experience Scale (Ayub & Malik, 2017), Generalized Self‐efficacy Scale (Schwarzer & Jerusalem, 1995), Bell?s Social Adjustment Scale (Bell, 1934), and Coping with Cyber Harassment Questionnaire‐modified (Ayub & Malik, 2017) were used. The results showed that overall experience of cyber harassment was not related with social adjustment; however, one of its subscales unauthorized use of identity information showed negative relationship with social adjustment. Further, the results showed negative relationship between overall experiences of cyber harassment and self‐efficacy, while a positive relationship was found between self‐efficacy and social adjustment. The results of moderation through hierarchical regression
Research Outlook 2020 | 258
indicated nonsignificant interaction between self‐efficacy and unauthorized use of identity information subscale of experiences of cyber harassment. Further, internal coping and reporting response (external coping) positively and no. of social media friends negatively predicted social adjustment in female university students. Keywords: Cyber harassment, self‐efficacy, social adjustment, unauthorized use of identity information, cyber terrorization, coping.
7. Farooqi, R., Ashraf, F., & Nazeer, I. (2020). Interpersonal Communication, Teamwork Effectiveness, and Organizational Commitment in Pakistani Nurses. Pakistan Journal of Psychological Research, 35(4), 675‐692. (Iram Nazeer (Psychology\SPP) Abstract: The current study was focused on identifying how interpersonal communication affects teamwork effectiveness and organizational commitment in nurses. The sample of (N = 150) nurses were recruited through purposive sampling technique from a public hospital of Lahore. To test the study assumptions, Socio‐ Communicative Orientation Scale (Richmond & McCroskey, 1990), Teamwork Effectiveness Self‐Assessment Questionnaire (Sterling & Selesnick, 1988), and Organization Commitment Scale (Allen & Meyer, 1990) were used. Results showed that interpersonal communication was directly proportionate to teamwork effectiveness and all measures of organizational commitment. Whereas, team effectiveness was partially linked with dimensions of organizational commitment. Furthermore, findings showed that organizational commitment (affective commitment and normative commitment) was predicted by measures of interpersonal communication that is assertiveness and responsiveness. Interpersonal communication may play a leading role in developing organization commitment, therefore, efforts should be made to improve and enhance the interpersonal communication skills of nurses in Pakistan. Keywords: Interpersonal communication, teamwork effectiveness, organizational commitment, nurses.
Conference Paper 1. Saddiqa, A., & Tariq, S. (2020). Communication Competence, Self‐Control and Professional Excellence in Academic Departmental Heads. Paper presented at the International Conference on Women Leadership, Psychology and Social Sciences 2020, Andhra Pradesh. https://conferencealerts.com/show‐event?id=228626. (Shahnila Tariq (Psychology\SPP) Abstract: Present study explored the relationship between communication competence, self‐control and professional excellence in the academic departmental heads. It was hypothesized that communication competence and self‐control are correlated with the professional excellence. Correlational research design and purposive sampling technique was used to collect data from 75 HODs of public and private universities (40 males & 35 females). Self‐Perceived Communication Competence Scale (SPCC) by McCroskery et a., (1988), Desirability of Control Scale by Burger and Cooper,(1979) and Professional Excellence Scale by (Tomar & Dhiman, 2013) were used as assessment measures. There was significant positive relationship found between communication competence, self‐control and professional excellence in academic heads. It was further found that communication competence and self‐control are significant predictors of professional excellence in academic heads. The findings of this research will be helpful in improving professional excellence in departmental academic heads. Keywords: Communication competence, Self‐control, Excellence, Professional excellence.
2. Tariq, S., Farooq, M., & Fatima, I. (2020). Psychological Experience of University Students in COVID‐19 Lockdown: A Qualitative Research. Paper presented at the International Meritorious Multidisciplinary Virtual Conference, Online Event. (Shahnila Tariq (Psychology\SPP) Abstract: The rapid spread of coronavirus disease 2019 (COVID‐19) is causing stress and challenges for people from all fields of life. This pressure also affected the students due to lockdown in country and closing of
Research Outlook 2020 | 259
educational institutes in Pakistan. The objective of the present study is to explore the psychological experience of university students during COVID‐19 lockdown. Using a descriptive phenomenological approach, 20 students were selected from private and public universities, with equal distribution based on gender. Telephonic interviews were conducted and data were analyzed by using Colaizzi’s 7‐step method. The psychological experience of students during COVID‐19 lockdown can be summarized into 5 themes. First, mixed emotions in which positive emotions were present in the beginning of the lockdown consisting of blessing in disguise which gradually led to negative emotions as a feeling of isolation, and mental health issues, stress, and hopelessness. Second, psychological adjustment included supporting lockdown and feeling sympathy for poor people. Third, burdened online classes which were due to mistrust on the online teaching and evaluation system. The fourth was cognitive and lifestyle restructuring, developing a careful attitude. Finally, fifth was coping strategies by focusing on the solution of the problem, dealing with emotions, and using religion as the ultimate goal for dealing with all problems. It can be concluded that during the lockdown, students experienced mixed emotions. In the initial stage, positive emotion were dominant but negative emotions appeared gradually. Use of coping strategies for adaptation and adjustment played a significant role in maintaining the mental health of the students. Keywords: psychological experience, COVID‐19, university students, lockdown, qualitative. School of Professional Advancement (SPA) School of Professional Advancement Research Articles 1. Anwar, A., Kee, D. M. H., & Ahmed, A. (2020). Workplace cyberbullying and interpersonal deviance: understanding the mediating effect of silence and emotional exhaustion. Cyberpsychology, behavior and social networking. 3(5), 290‐296. doi: 10.1089/cyber.2019.0407. (Aizza Anwar (SPA) Abstract: Workplace cyberbullying (WCB) is a new form of hostility in organizations in which information technology is used as a means to bully employees. The objective of this study is to determine the association between WCB and the interpersonal deviance (ID) of victims through parallel mediation through the ineffectual silence of employees and emotional exhaustion (EE). Conservation of resource (COR) theory and affective events theory were used as the study's guiding framework, and data were drawn from 351 white‐collar employees who were employed in a variety of industries—such as banking, telecommunications sector, education, health care, insurance, and consultancy—in Lahore, Pakistan. The results show that ineffectual silence negatively mediated the relationship between cyberbullying and deviance, decreasing the level of deviance of employees who used silence as a coping mechanism. EE, however, positively mediated the relationship between cyberbullying and deviance. This means that when employees felt emotionally overwhelmed they retaliated by engaging in deviant behaviors and acting as a bully toward colleagues. Drawing on the COR theory and the affective events theory, the findings show that WCB has an impact on ID. From a practical standpoint, the study reveals that WCB can lead to ID and it also may associate with large financial costs and workplace disruptions. Thus, organizations should establish a culture that prevent employees from engaging in WCB and adopt practices of prevention and intervention because it is not only harmful to the employees but also to the organization. Keywords: emotional exhaustion, interpersonal deviance, silence, workplace cyberbullying.
2. Anwar, A., Waqas, A., Zain, H. M., & Kee, D. M. H. (2020). Impact of Music and Colour on Customers’ Emotional States: An Experimental Study of Online Store. Asian Journal of Business Research, 10(1), 104. doi: DOI: 10.14707/ajbr.200077. (Aizza Anwar, Hafiz Muhammad Zain (SPA) Abstract: Retailers try their best to make their online store environment more entertaining and attractive to capture customers’ attention. Therefore, it is interesting and beneficial to explore how the store environment impacts the customer emotions in store and how these emotions change customer’s buying behaviour. The main
Research Outlook 2020 | 260
focus of this study is to measure the impact of atmosphere cues, such as colour and music on respondent’s emotional response and their shopping behaviour in an online store. Respondents were exposed to different combinations of music and colour, and both cues had significant impacts on the respondent’s emotional response and behavioural intention. The questionnaire responses of 230 valid respondents from Pakistan revealed that cool colours and fast tempo music showed greater levels of pleasure and arousal as compared to slow tempo music with warm colours. Arousal and pleasure were also found to be significant parameters for predicting behaviour intention. Respondent’s in fast tempo music with cool colour environment showed more approach behaviour in comparison to slow tempo music with warm colours. An efficient online store environment is proposed, incorporating suitable music and colour attributes that will result in more time spent in‐store, repurchasing, and revisiting. The outcomes of the study assist online retailers in Pakistan to make the shopping environment attractive and enjoyable. Keywords: atmospheric cues, online store, online buying behaviour, emotional response, behavioural intention. arrangements, affordable housing, Punjab, Pakistan, low‐income groups, policy framework.
3. Munir, F., Abiodullah, M., & Aslam, F. (2020). Employees’ Perception of School Leaders’ Efficacy and its Impact on their Adaptive Performance. Sukkur IBA Journal of Management and Business, 7(1), 55‐74. (Farhat Munir (SPA) Faiza Aslam, (ORIC) Abstract: The fast‐paced changes in the education sector at secondary school’slevel demand a highlevel of adaptability. Several factors have been explored through research that affects employees’ adaptability. The purpose of this study was to explore the relationship between employees’ perception of leaders’ efficacy and its impact on their adaptive performance. 266 academic and administrative employees were randomly selected, as a sample for the purpose of this study, from 50 private secondary schools located in Lahore, Pakistan. Pearson correlation and multiple linear regression analysis (were used to analyze/evaluate the data) were run for data analysis and a significant positive relationship was found between the employees’ perception of leaders’ efficacy and their adaptive performance. Keywords: employees’ perception, leader action self‐efficacy, leader mean self‐efficacy, leader self‐regulation efficacy, adaptive performance.
4. Khan, M. N. A., Mirza, A. M., & Saleem, I. (2020). Software Risk Analysis with the use of Classification Techniques: A Review. Engineering, Technology & Applied Science Research, 10(3), 5678‐5682. (Imran Saleem (SPA) Abstract: Risk analysis and management is a critical aspect of the software development process. Various risks are associated with every phase of the software development lifecycle. The early identification of risks in each phase of software development coupled with mitigating plans can help to reduce the cost of the product and increase software quality. This study aims to explore various tools and techniques used in the literature of analyzing and managing risks. Most risk analysis techniques have been applied in the requirement analysis phase, so there is a scarcity of tools supporting automated risk analysis. Accommodating various types of risk factors to predict the software risks reduces the accuracy of the classifier. Keywords: risk analysis, software risk, classification techniques.
5. Shuja, A., Yazdani, N., & Shuja, A. (2020). Investigating Resilience and Performance of Emergent Financial Technology Startups Endorsed by Knowledge Management. Journal of Independent Studies & Research: Management & Social Sciences & Economics, 18(1). 1‐14. (Aleena Shuja (SPA) Naveed Yazdani (Management\SBE) Abstract: The paper seeks to examine the effect of knowledge management on resilience and performance of emergent financial technology startups (Fintechs) in Lahore, Pakistan through the development of dynamic capabilities when confronted with environmental dynamism. Based on the tentative deductions derived from Research Outlook 2020 | 261
Dynamic Capability View (DCV) of emergent financial sector ventures, this paper employs Partial Least Square for Structured Equation Modeling in order to investigate these hypotheses. Sample of current cross‐sectional study involves empirical analysis performed on primary data assembled from knowledge workers employed in emergent financial technology startups. Knowledge management practices also have a positive impact on the developing dynamic capabilities of the organization. Implementation of effective knowledge management practices results in reconfiguring and advancing the companies’ dynamic competences under the conditions of dynamism and unexpected changes occurring in the external business environment. Consequently, fin‐techs succeed to accomplish their goals of spirit, adaptive capacity i.e. increased resilience and escalated performance. Keywords: Dynamic capabilities, environmental dynamism, long term performance, organizational resilience, knowledge workers.
6. Zain, M., Saadat, Z., Khan, M. A., & Arbi, K. A. (2020). Analytical Review of Bullwhip Effect in Manufacturing and Services Supply Chain: Analyzing How Workload Creates Bullwhip in Service Sector. International Journal of Management, 11(9). 1318‐1335. (Muhammad Zain, Zakee Saadat, Majid Ali Khan, Khalil A. Arbi (SPA) Abstract: The current study examines the effect of the Bullwhip phenomena in both manufacturing and services industry based on a literature survey. The cause and impact of the bullwhip effect have been determined, besides the methodology is determined to mitigate this effect. For this purpose, Mcdonald’s case has been considered to better understanding the reasons for the bullwhip for the product. The way forward has been proposed to cope with the bullwhip problem. The study also reviews the literature on the service sector, especially in the health sector. Moreover, the difference between the services and manufacturing industry is determined in this study so that both kinds of firms can get benefit by making it part of their system to mitigate the bullwhip effect. The study concludes by pointing out the roadmap for future studies based on the previous reviews done in this regard. Keywords: Bullwhip Effect, Service Sector, Supply Chain, Manufacturing, Analytical Review.
7. Gilani, A., Qureshi, H. A., & Zain, M. (2020). Effect Of Social Media Usage On Entrepreneurial Leader Ship. International Journal of Management, 11(10), 1117‐1134. doi: 10.34218/IJM.11.10.2020.101. (Anusha Gilani, Muhammad Zain (SPA) Abstract: A quantitative study is conducted to examine the effect of social media usage on entrepreneurial leadership. Today, entrepreneurial leaders are needed in the competitive business world because they keep themselves updated with the latest technology knowledge which is helpful for the growth of their businesses. The main research question of my study is, does any relationship exist between social media usage and entrepreneurial leadership. A cross‐sectional study is conducted. The data is collected, with the help of detailed questionnaire, from the sample size of 253 entrepreneurs who use social media for their businesses. The collected data is then analyzed by applying analysis and tests in SPSS. The exploratory data analysis results showed that youngsters use social media more than the elders and Facebook is the most popular platform used by the entrepreneurs. The results of the regression analysis indicate a positive significant relationship between social media usage and entrepreneurial leadership. The R square value is 0.494 which shows that 49.4% of the variance in entrepreneurial leadership is because of social media usage. Keywords: social media, entrepreneurship, entrepreneurial leadership, entrepreneurs, leadership, leaders. 8. Nisa, M., Fatima, A., Sohail, S., Kazmi, S., Ahmad, A., & Gilani, S. A. (2020). Effects of Kegel exercises for the management of pelvic floor muscles weakness after episiotomy. Rawal Medical Journal, 45, (4). 830‐833. (Shiza Kazmi (SPA) Abstract: Objective: To evaluate effectiveness of Kegel exercises for management of post‐episiotomy weak pelvic floor musculature.
Research Outlook 2020 | 262
Methodology: This experimental trial conducted at National Hospital, Faisalabad, included 45 women with diagnosed pelvic floor muscles (PFM) weakness after episiotomy. Subjects were pre‐instructed to perform Kegel exercises according to given protocol. Outcome measures were pain intensity and strength of PFM; assessed by visual analogue scale (VAS) and vaginal digital examination along with modified oxford grading scoring system, respectively. Results: Out of 45 women, 19 (42.2%) had complaint of pain and urinary incontinence. By applying Friedman test, the median pain score was 5.00 before intervention while it was reduced to 3.00 after 3 weeks of performing exercises. The median manual muscle testing (MMT) score was 2.00 before intervention, but it remains 2.00 after 3 weeks. Patients showed better results for pain (p=0.000) and for pelvic muscles strength (p=0.000). Conclusion: Kegel exercises are simple and cost‐efficient method as they relieved patient’s pain and improved incontinence. They helped in improving pain after episiotomy therefore they should be included in post‐natal patient care program. Keywords: Kegel exercises, pelvic floor muscles, visual analogue scale.
9. Ali, M., Arbi, K. A., Raza, B., Malik, S., & Sheikh, L. (2020). Does managerial coaching effect subordinates'feedback orientation? Mediating role of affective supervisory commitment. Polish journal of management studies, 22(2). 9‐21. (Khalil Ahmed Arbi (SPA) Abstract: Managerial coaching has become a widely used human resource development strategy to improve various employee outcomes within organizations. However, existing literature lacks empirical evidence regarding the effectiveness of managerial coaching and less known about how managerial coaching influences subordinate feedback orientation through the mediating effect of employees' commitment to the supervisor. This study uses a structured questionnaire to gather data from a cross‐sectional sample of 257 employees working in the banking sector of Lahore, Pakistan, with a response rate of approximately 57%. Structural Equation Modeling (SEM) is used to test the proposed hypotheses. The results reveal that managerial coaching has a positive and direct significant impact on the subordinate feedback orientation and affective supervisory commitment. Affective supervisory commitment has a positive and direct significant relationship with the subordinate feedback orientation. Affective supervisory commitment also mediates the indirect relationship between managerial coaching and subordinate feedback orientation. This research also provides implications for managers and leaders, specifically looking to improve various employee outcomes through managerial coaching in the workplace. Keywords: managerial coaching, affective supervisory commitment, subordinate feedback, orientation, social exchange.
10. Ayesha, A. G., & Czukor, G. (2020). Authority, personality, and its effects on conflict resolution behaviour among students of Istanbul Bilgi University. UMT Education Review, 3(2), 01–28. (Ayesha Gul Arif (Project Management/SPA) UMT JOURNAL Abstract: The aim of this experimental study was to examine how undergraduate students as participants resolve a conflict in response to authority status manipulation of the opponent person (low: a fellow student; high: a university professor), considering the moderating role of participants’ personality traits. 320 Psychology undergraduate students from Istanbul Bilgi University, aged 19‐23 participated in an online survey. The participants first completed the Turkish version of the NEO‐FFIand then they completed the modified Turkish version of the Thomas‐Kilmann Mode Instrument (TKI). It was hypothesised that highly agreeable participants who were faced with a professor in a conflict would show a accommodating resolution style. Whereas extroverted participants who faced a fellow student inwere predicted to displaycompetitiveness in the conflict. A moderated regression analysis was applied. The results showed the opposite effects, students who were in
Research Outlook 2020 | 263
conflict with the professor were more competitive and students who were in conflict with fellow students showed more accommodation. Limitations and future research possibilities are also discussed. Keywords: conflict resolution, authority, personality, NEO‐FFI, TKI.
11. Kanwal, A., Maqsood, R., & Karim, M.(2020). The impact of meaningful work on employee identity and the mediating role of employee resilience. Journal of Applied Research and Multidisciplinary Studies, 1(1), 30–47. (Rimsha Maqsood, Meena Karim (Project Management/SPA) UMT JOURNAL Abstract: The currentstudy focusedon the impactof meaningful work on employee identity with a mediating role foremployee resilience. Data was collected from a sample of 154 employees currently working inthe service sector(call centers)of Lahore, Pakistan. Thestudy was quantitative and thedata was analyzed using AMOSsoftware. For this purpose, Confirmatory Factor Analysis (CFA) was used to checkthe model fit statistics and themediation effect of employee resilience was analyzed using Preacher and Hayes’(2004) median analysis. Convergent validity was measured through factor loading and AVE value verification of indices;whereas reliability was approved through Cronbach’s alpha. The findings of the currentstudyrevealed that meaningful work playsasignificant role in enhancingemployee resilience, whichenables them to cope with challenging situations and thus maintainingtheir identity.In the service sector, where employees continuously deal with customers,resilience becomes the key to attract and retain potential customers, whichallows them to deliver exceptional client service with confidence. This research isamong a limited number of studies available on this topic and itwill bean importantaddition to research literature highlighting the impact of meaningful work and employee resilience onemployee performance in the context of call centersemployees working inLahore, Pakistan. Keywords: employee identity, employee performance, employee resilience, meaningful work, service sector. Conference Proceedings 1. Khalid, A., Tahir, M. H., Asghar, H. M. B., Munir, M., Arshed, N., & Hafeez‐ur‐Rehman. (2020, 26‐27 Oct. 2020). A Meta‐Analysis of Foreign Direct Investment and Economic Growth: An Empirical evidence from Pakistan during COVID 19 Policymaking. Paper presented at the 2020 International Conference on Data Analytics for Business and Industry: Way Towards a Sustainable Economy (ICDABI). (Asma Khalid, Muhammad Hamdan Tahir, Hafiz Muhammad Bilal Asghar (SPA) Mubbasher Munir, Noman Arshed, Hafeez‐ur‐Rehman (Economics/SBE) Abstract: Purpose: Present study is based on the impact of Foreign Direct Investment on the Economic Growth of Pakistan. In this paper, a time‐series data has been collected for the variables Foreign Direct Investment (FDI), Gross Capital Formation (GCF), Inflation rate (IR), and Gross Domestic Product (GDP) since the year 1970‐2018 from World Bank Development Indicators. Some tests have been performed regarding the significance of data using regression, correlation analysis, and normality test (Kolmogorov‐Smirnov) using SPSS software. In this research, an alternative hypothesis has been built to analyze the significance of this data. Discussions and recommendations have been given in this paper to implicate on the economy for growth and development measures.Design/Methodology/Approach: The data from WDI and other worldwide authentic sources were used from 1970‐2018 to perform models using regression analysis and advanced machine learning methods.Findings: Regression and correlation analysis have been used on the variables. Its result indicates a positive relationship among the variables FDI and GDP whereas it shows a negative correlation among the variables GCF, IR concerning GDP.Limitations: Data is predictable based on the variables taken. It has been collected for the recent years up till 2018. It can only predict a certain variation caused by the increase of a particular independent variable that is FDI, GCF, and IR. Future variation in variables cannot be predicted. The results are specifically related to Pakistan and cannot be justified for other countries.Practical implications: Strong industrial network clusters must be formed by the policymakers to gain investor loyalty and will also help companies to form capital and also sustain a strong supply chain management. Higher FDI inflows will aid the ongoing project of Pakistan which is the Diamer
Research Outlook 2020 | 264
Bhasha Dam. Due to the pandemic stated as COVID‐19, FDI will actively play a role in maintaining ventilators in hospitals that have become a current need. An increase in inflation shows a negative impact on the economy of Pakistan. Considering the prevailing situation where unemployment level, job opportunities not being available and no productivity level is being achieved due to the current Pandemic i.e. COVID‐19, policymakers must take initiative in reducing consumer prices so that all the preceding situations could have positive effects on the economic growth of Pakistan. Keywords: Foreign Direct Investment (FDI), Gross Capital Formation (GCF), Inflation rate (IR), and Gross Domestic Product (GDP), World Bank Development Indicators. Conference Paper 1. Mahmood, M. T., Aslam, F. (2020). Motives of Revaluation of Property Plant and Equipment: A Qualitative Study of Public Companies in Pakistan. Paper presented at the 6th International Conference on Doing Responsible and Sustainable Business: Challenges under Belt & Road Initiative (ICIBM‐2020) University of Central Punjab, Lahore (UCP), Pakistan 6‐7 Feb 2020.(Mohyuddin Tahir Mahmood (SPA) Faiza Aslam (ORIC) Abstract: The purpose of this research paper is to analyze the management’s motives behind the revaluation of Property, Plant and Equipment (PPE) by public companies in Pakistan. Purposive sampling technique is used for selection of respondents who are information rich in the relevant area. Semi structured interviews were conducted to collect data from the respondents. Analyses based on interviews transcriptions, field notes and tag clouds suggest that management has certain motives regarding revaluation of PPE. Among those, financing from the banks, improvement in debt to equity ratio and performance of the organization, positive signals to the potential investors, and reduction in political cost are the main motives of the management behind revaluation of PPE. By focusing on these motives, companies may formulate policies to revalue their PPE and then decide the frequency of revaluation. This research can also assist the future researchers in unfolding motives in the financial sector. Keywords: revaluation, PPE, IAS, motives, public companies, debt to equity ratio.
2. Khalid, A., Mouser I., Asghar, H. M. B., Tahir, M. H., Munir, M. (2020). The Role of Service Quality and Brand Trust in Building Service Brand Equity. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Asma Khalid, Imran Mouser, Hafiz Muhammad Bilal Asghar, Muhammad Hamdan Tahir (SPA) Mubbasher Munir (Economics/SBE) Abstract: Not Available. Keywords: not available.
3. Khalid, A., Asghar, M. H., Tahir, M. H., Munir M., Arshed, N., & Hafeez‐ur‐Rehman. (2020). Relationship of Foreign Direct Investment and Economic Growth: A Meta‐Analysis of Pakistan Economy. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Asma Khalid, Hafiz Muhammad Bilal Asghar, Muhammad Hamdan Tahir (SPA) Mubbasher Munir, Noman Arshed, Hafeez‐ur‐Rehman (Economics/SBE) Abstract: Not available. Keywords: not available.
4. Chaudhry, A., Akhtar, S. & Munir, M. (2020). Comparison of Online Learning and Traditional Learning. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Ayesha Chaudhry, Shanzay Akhtar (SPA) Mubbasher Munir (Economics/SBE) Abstract: Not available. Keywords: not available.
Research Outlook 2020 | 265
5. Shaheen, I., Munir, M., & Nadeem, S. (2020). The Corona Virus and The Great Influenza Pandemic: Meta Analysis on Mortality, Economic Activity, Social Consequences, Biological War and Unemployment. Paper presented at the 7th International Conference on Business Management (ICoBM) 2020, Online. (Iqra Shaheen, Sehrish Nadeem (SPA) Mubbasher Munir (Economics/SBE) Abstract: Not available. Keywords: not available. Book/Book Chapters 1. Mahmood, M. T. (2020). Fundamentals of Accounting for BS, BBA and B.Com Students (2nd ed.): ILMI Kitan Khana. (Mohyuddin Tahir Mahmood (SPA) Abstract: Not available. Keywords: not available. School of Commerce and Accountancy (SCA) School of Commerce and Accountancy Research Articles 1. Sadia, Z., Humayun, A., Shafiq ur, R., Shan, E., Amer, S., Farhat, Y., & Shehnila, A. (2020). Effect of excess Fluoride consumption on Urine‐Serum Fluorides, Dental state and Thyroid Hormones among children in “Talab Sarai” Punjab Pakistan. Open Chemistry, 18(1), 119‐128. doi: https://doi.org/10.1515/chem‐2020‐0012. (Amer Shakeel (SCA) Abstract: 190 children aged 7‐18 years from an endemic fluorotic village “Talab Sarai (n = 130) and a non‐ fluorotic, control, village “Ottawa” (n = 60) were selected for comparison. Children were examined for fluoride (F‐) concentration in drinking water, urine, and serum as well as Dental fluorosis (DF) and thyroid hormone levels. The mean concentration of water fluoride (WF) in the sample group was 6.23 mg/L, urine fluoride (UF) 3.38 mg/L, and serum fluoride (SF) 0.21 mg/L, while DF was 93.07%. Significant elevations (P = 0.000) in the concentration of all these four variables were observed in sample group children as compared to control. Mean Free Tetra‐ iodothyronine (FT4), Free Tri‐iodothyronine (FT3) and Thyroid Stimulating Hormone (TSH) concentrations in the sample group were 16.64pmol/L, 5.57 pmol /L and 4.41 mlU/L, respectively. No marked difference in FT4 (P = 0.1) was noted, while significant elevations in FT3 and TSH (P = 0.000) were found in the sample relative to the control group. 80% of the children displayed clear thyroid hormonal derangements, with 36.92% having high TSH and 43.07% with FT3 and FT4 disorders. A moderate to strong correlation among WF, UF, SF and DF (r = 0.94, 0.60, 0.60, 0.72) and a very strong correlation between WF and TSH (r = 0.9) were observed. Our results suggest that excess F‐ level that is four times greater than the “safe limit” is not only increasing fluoride concentration in body fluids but is also affecting thyroid hormones in 4 out of 5 children which could lead to abnormal physical and mental growth in later developmental stages. Keywords: Water fluoride, Urine and Serum fluorides, Dental fluorosis, FT4, FT3 TSH.
2. Shakeel, A., Rasheed, B., Ahmed, M., & Bakhsh, A. (2020). Effectiveness of the Role of Internal Audit Function: A Perception of External Auditors of Pakistan. Paradigms, SI(1), 75‐80. doi: 10.24312/20000112. (Amer Shakeel, Burhan Rasheed (SCA) Abstract: Internal Audit Function (IAF) is considered as an important element of corporate governance. It can contribute to good corporate governance only if it operates effectively. There are many stakeholders of IAF like Board of Directors (BoD), the firm’s management, external auditors etc. All these stakeholders have their different needs and also have different perception regarding IAF. In this study, we tried to explore the perception of external auditors regarding the role and effectiveness of the IAF. For this purpose, we interviewed with eight Research Outlook 2020 | 266
external auditors of different audit firms. As per the findings of this study, the role of IAF includes checking the compliance and evaluation of internal controls, risk management and fraud risk management. This paper further concluded that the current role of IAF can be more effective by making IAF independent and by the induction of the personnel with right qualification, skills and relevant experience. External auditors can also get benefits from effective IAF. Keywords: Internal audit function, corporate governance, external auditors, board of directors.
3. Ahmad, K. M., ul Rahman, R., Akram, M., Mustafa, M., & Malik, Z. F. (2020). Managerial Motives Underlying the Revaluation of Non‐Current Tangible Assets: A Study of Non‐Financial Sector Companies Listed on Pakistan Stock Market. Paradigms, S1 (1). 111‐119. DOI: 10.24312/20000117. (Zohair Farooq MaliK (SCA) Abstract: According to generally accepted accounting principles as applicable in Pakistan, all the listed companies, in addition to the company’s act 2017, must follow international accounting / financial reporting standards. For subsequent measurement IAS‐16 PPE gives the companies two options, either measure their non‐ current tangible assets on Cost model or revalue them. As the objective of the FS is to fulfil the information needs of the users, especially the shareholders, and fair value measurement provides more relevant information through which the quality of decision making of the shareholders can be improved. In addition, the management as an agent of the shareholders may have their own motives for measuring the NCA on fair value. The purpose of this research is to find out the management motives underpinning the revaluation of NC tangible assets. For the said purpose 10 years data was collected i.e., for the period from 2009‐2018 for 109 companies listed on Pakistani stock market which revalued their noncurrent tangible assets during that period. This study examined the different motives of management like leverage, size of the firm, fixed assets intensity, liquidity, growth, ownership structure, bonus issue, disclosure and CFO have on the revaluation decision. For the analysis purpose the study used Logistic regression model as the predicted variable is binary in nature which is coded as dummy variable. The findings show that the leverage has no significant impact on the decision to revalue the NCA. As for as size of the firm is concerned, this revealed a positive and a significant impact on the decision to revalue the non‐current assets. The study found that the fixed assets intensity has a significant impact on the decision to revalue the non‐current assets. The relationship between the liquidity and revaluation decision was found negative but insignificant. The results also cleared a positive and almost significant relationship between the revaluation decision and growth and a negative but significant relationship between the revaluation decision and presence of foreign investors in the portfolio of shareholders. Stock dividend or bonus shares issuance has no significant association with the dependent variable. Cash flow from operations negatively and significantly related to the predicted variable. Eventually it was concluded that size of the, fixed asset intensity, growth opportunities and decline in the operational cash flows will motivate the management to revalue the non‐current assets according to IAS ‐16. Keywords: SOFP, SOCI, SCIE, SOCF, NCA, FS, Positive Accounting Theory, Information Asymmetry, Revaluation.
4. Ilyas, U., Butt, M. U., & Gulzar, M. (2020). Employing panel ARDL model to unfold significance of economic variables in determining stock market performance. Academic Journal of Social Sciences (AJSS), 4(3), 655‐671. (Muhammad Gulzar (SCA) Abstract: This study explores the impact of exports(EXP), foreign direct investment(FDI), foreign exchange reserves(FER), inflation(IF) and interest rate(IR) with the aid of Panel ARDL model with co‐integration upon not only overall on all 35 sectors of Pakistan stock exchange but also on all firms of all sectors as well to overcome the deficiencies of conventional index base studies which provides only a cumulative picture of response of stock market with changing macroeconomic variables(MEV) which provides inadequate information to stakeholders for their decision making. To achieve this objective monthly data for the period of 2005‐2020 in panel form were used and results indicates that current study has superiority over past studies as overall sector and firms from Research Outlook 2020 | 267
same sectors shows differing response to changes in value of MEV. This study has its applicability beyond geographical boundaries on developing economies. Keywords: developing economies, panel ARDL model, macro economic variables, stock market performance.
5. Danish, M. H., & Hafeez‐ur‐Rehman. (2020). Social Capital as a Resource of Subjective Well‐Being: Mediating Role of Health Status. Forman Journal of Economic Studies, 16, 181‐212. doi: DOI: 10.32368/FJES.20201608. (Muhammad Hassan Danish (SCA) Hafeez‐ur‐Rehman (Economics\SBE) Abstract: Increase in social capital increases the social support in society, thus improves the health and well‐ being of an individual. This paper aims to analyze the role of social capital on subjective well‐being (happiness, life satisfaction, and worth of life) and self‐reported health status. The study deploys the Generalized Structural Equation Model with order logit to link social capital with health and subjective well‐being (SWB) of people by utilizing the data of 1566 households and individuals in Punjab, Pakistan. Results of the study illustrate that social trust and the number of friends are strong predictors of self‐reported health (SRH) status and subjective well‐being of people. While memberships with organizations or alike is a weak predictor of SRH, it significantly affects the happiness of people. Our results also depict that SRH is the strong mediator between social capital and SWB; improved social networks lower the risk of poor health status, which improves the level of happiness and life satisfaction. The study suggests that a balanced distribution of different kinds of social networks is important for the self‐reported health and subjective wellbeing of people in Pakistan. Keywords: Health, Pakistan, Social Capital, Subjective Wellbeing.
6. Ilyas, U., Butt, M. U., & Gulzar, M. (2020). Exploring novel approach in determining stock performance. Academic Journal of Social Sciences (AJSS), 4(3), 655‐671. (Muhammad Gulzar (SCA) Abstract: his study explores the impact of exports(EXP), foreign direct investment(FDI), foreign exchange reserves(FER), inflation(IF)and interest rate(IR)with the aid of Panel ARDL model with co‐integrationupon not only overall on all 35 sectors of Pakistan stock exchangebut also on all firms of all sectors as well to overcome the deficiencies of conventional index base studies which provides only a cumulative picture of response of stock market with changing macroeconomic variables(MEV) which provides inadequate information to stakeholders for their decision making. To achieve this objective monthly data for the period of 2005‐ 2020 in panel form were used and results indicates that current study has superiority over past studies as overall sector and firms fromsame sectors shows differing response to changes in value of MEV. This study has its applicability beyond geographical boundaries on developing economies. Keywords: Developing Economies, Panel ARDL Model, Macro Economic Variables, Stock Market performance. Conference Paper 1. Yasser, F., Kalim, R. (2020). Application of Ijarah Al Ashkhaas in Personal Banking – A Missing Opportunity by Islamic Banks of Pakistan. Paper presented at the 4th International Conference on Islamic Banking & Finance (ICIBF 2020) Impact of Covid‐19 outbreak on Micro, Small & Medium Eterprices (MSMEs) & Way forword for Islamic Finanial Instituions at IOBM, Karachi. (Online presentation), November 4‐5, 2020. (Farah Yasser (SCA) Rukhsana Kalim (Economics/SBE) Abstract: Islamic banking is expanding and the same is the case with Islamic financial products. The banks are using different modes of Shariah based finance for the variety of their products and services. Ijarah is one of the most commonly used forms of finance for the wide range of Islamic consumer and corporate products. There are two broad categories of Ijarah; Ijarah al Ayaan and Ijarah al Ashkhaas. Ijarah al Ayyan is the hiring of the usufruct of a fixed asset and is most commonly used for car finance and house finance. Ijarah al Ashkhaas is less practiced and fewer banks are using it as compared to the first type of Ijarah. Generally Ijarah al Ashkhaas (also known as service Ijarah) is used for personal banking for education, wedding, travel and medical financing facilities around
Research Outlook 2020 | 268
the globe. There are twenty two Islamic banking institutions including five full fledge Islamic banks in Pakistan but there is not a single product based on service Ijarah facility. Therefore, the main objective of this study is to explore the need to develop service Ijarah based personal finance by Islamic banks of Pakistan. This paper also discusses the concept and application of Ijarah al Ashkhaas, the model and process of service Ijarah financing by banks globally and possible adoption of service Ijarah facility by Islamic banks in Pakistan. This paper concludes that service Ijarah financing is beneficial for all stakeholders and Islamic banks of Pakistan should offer personal finance on service Ijarah basis. Keywords: Ijarah Al Ashkhaas, Service Ijarah, Personal Banking, Islamic banking, Pakistan. School of Law and Policy (SLP) School of Law and Policy Research Articles 1. Hameed, U., Mubeen, M., & Khan, N. A. (2020). Appraisal of Corporate Entity. Journal of Law and Society Policy, 2, 1‐13. (Usman Hameed, Nyma Anwar Khan (SLP) Abstract: It is settled law that a company despite having no kith and kin, is legal person, and has been bestowed with all the rights inherent in natural persons such as right to own property, right to sell property, right to contract and right to sue etc. The purpose of this paper is to examine how the notion of a company being separate legal entity is merely a legal fiction that has been invented by natural persons in order to maximize profits. It is posited that under this shield, the general public is at times misdirected on behalf of company by its official members, as any illegal act done by officers of a company can be conveniently covered up under the veil of corporation. Therefore, a corporate entity is merely a fabricated story given legal cover through the process of incorporation in order to outwit the general public. Keywords: not available.
2. Hameed, U., Khan, N. A. (2020). Community Participation, the Missing Link in Pakistan’s ADR System – The Way Forward. RSIL Law Review, 1. 156‐184. (Usman Hameed, Nyma Anwar Khan (SLP) Abstract: Not Available. Keywords: not available. School of Media and Communication Studies (SMCS) School of Media and Communication Studies Research Articles 1. Shafiq, Z., Hussain, T., & Ali, H. A. (2020). English‐role of religion in indian cinema. The Scholar‐Islamic Academic Research Journal, 6(1), 231‐251. doi: 10.29370/siarj/issue10ar16. (Tanveer Hussain (SMCS) Abstract: Relationship between cinema and religion is as old as the history of cinema. Since the beginning of commercial feature films in the sub‐continent (now Pakistan, India and Bangladesh), religion was used as a tool of acceptance and popularity of this new medium. Until now the use of religion is common in the cinema industries of India and Pakistan. This paper is part of a major project that attempts to explore the use of religion in the sub‐continent region. The current paper only focuses on its one dimension which is to study the role of religion in Indian cinema and the ways it has used religion as one of its major narrative tools. Due to the excessive use of religious and mythological elements in films, this paper offers an analysis of selected horror films. The study established that Hinduism gains a superior position from Islam and Christianity in Indian horror. However, all the films show respect to these religions. Moreover, when the religious force confronts the secular, the ‘monster’ in these films punishes the secular and leaves the believers. Keywords: religion, islam, hinduism, secularism, cinema.
Research Outlook 2020 | 269
2. Adnan, M., Hussain, T., & Nawaz, M. B. (2020). Television and Marital Family Discourses in Pakistan: Islamic Values and Urdu Drama Narratives. Pakistan Journal of Islamic Research, 21(1), 103‐112. (Tanveer Hussain (SMCS) Abstract: The advancement of television in the globe has been amazing. Television has become a constant feature in the family circle over the past few years and television drama has become an important source for education, entertainment and information for billions of individuals around the globe. Television drama in Pakistan has the potential to educate and affect the people. So the question arises that the Pakistani television dramas are promoting the Islamic culture or not. The main purpose of selecting Pakistani dramas for this research is to find out that how these dramas present the marital family issues. This study focuses on Islamic values, marital family and narratives of Pakistani dramas. It is highly needed to investigate that what sort of contents are being disseminated in the name of entertainment. In contemporary society, where divorce rate is increasing day by day, it is the need of the time to have great in‐depth look of Urdu televise drama. The study concluded that the stories of almost all the Urdu dramas presented by the different channels show some confusion and rift in family relationships that lead to the marital family deterioration. Most of the schemes of these dramas are directly contrary to the spirit of Islamic teachings and beliefs. Generally, illicit relations or extramarital relations are shown in such a way that they can detract its viewers and generation is ruined in this way. All these thoughts are anti to Islamic teachings and values. Keywords: television, Urdu drama, Islamic values, marital family, Pakistan.
3. Safdar, G., Javed, M. N., & Amin, S. (2020). Use of Internet for Education Learning among Female University Students of Punjab, Pakistan. Universal Journal of Educational Research, 8(8), 3371‐3380. doi: 10.13189/ujer.2020.080809. (Muhammad Naeem Javed (SMCS) Abstract: Current era is called era of internet technology. Internet provides platform where various channels are just one click far away. The core aspire of this research study was to explore internet use for educational learning targeting public universities female students belonging to Punjab Pakistan. The study recorded student’s internet usage pattern, level of usage, preferred viewing sites, favorite visiting sites, and most usage time and core reasons of using internet. It also analyzed demographic information of respondents such as hostelries or home, class and urban or rural areas. The study crossed checked the opinion regarding internet usage as well as demographic characteristics. The data was collected using survey methodology. A total sample size of N=1157 respondents were taken from six selected public sectors universities with highest student statistical rate using multi‐level sample technique. The collected data was analyzed using SPSS and study focused how female university students think about internet as a medium of educational learning at undergraduate, graduate and post‐graduate level. The study concluded that internet usage is more common and is the source of inspiration among female for educational learning and enhanced learning trends and searching educational content. Using internet causes dual learning i.e. educational and technological for female and due to multimedia content, internet is a more effective source of learning for female than text books. Keywords: internet, educational learning, female university students, Punjab Province.
4. Hussain, T., Javed, M. N., & Shahwar, D. (2020). The Reflection of River Warfare in Pakistani and Indian Press: Dispute, Management and Strategies. Global Regional Review, V ((II)), 1‐10. (Tanveer Hussain, Muhammad Naeem Javed (SMCS) Abstract: This study provides an overview of Pak‐India River warfare over the sharing of water and management failure which led to serious water crises and disaster especially in Pakistan. Water resources are diminishing day by day water is become a scarce commodity in the world with every passing day. It is rapidly emerging a source Research Outlook 2020 | 270
of tension and dispute between two nations (Pakistan and India), which is a destabilizing factor of international peace and regional harmony. The content analysis used as research methodology while data collected from editorials and articles published in “The News” and “The Telegraph”. This research covers the period between 2018 and 2019. The results showed that “The News” gives more coverage and large space related to the Pak‐ India River Warfare as compared to “The Telegraph”. Furthermore, “The News” has a clear stance for the solution of Pak‐India River Warfare rather than Indian newspaper “The Telegraph”. Keywords: Pak‐India river warfare, role of newspapers, management.
5. Hussain, T., Awan, N. K., & Javed, M. N. (2020). Psychological Effects of Social Media Resulting in Isolation Among Students of Lahore: A Cross‐Sectional Study. International Review of Social Sciences (IRSS), 8(9), 118‐134. (Tanveer Hussain, Noman Khalid Awan, Muhammad Naeem Javed (SMCS) Abstract: The present research focuses on the effect of media platforms on more separation of students. Learners to scientific advancement start to be using social media channels e.g Facebook messenger google video Snapchat and many others that have seen many methods of impacting one’s lifestyles. Using such social networks they are violently isolated short tempered ill. The study focuses on the effects of student isolation. The research examines the effects of isolation in students, how isolation changed their lives their behaviors towards people and how the use of social media effected their health in general. To achieve these objectives we conducted quantitative method like questionnaires and surveyor by manipulating preexisting statistical data using computational techniques. In the research 52.2 percent accepted the psychological effects of isolation, Result shows that 57.6 percent people said that they are effected by the use of social media, research says that 27.4 percent says that they will spend their time with friends which shows that people have vast effects of social media excessive use and they want some other activities of healthy activities to get rid of the social media to avoid any further health and mental and other kind of socializing problems. Keywords: effects, psychology, social, media, Lahore.
6. Javed, M. N., Basit, A., & Hussain, T. (2020). Climate Change in the Mainstream Pakistani Press: Coverage and Framing Trends. Global Political Review, V(I), 192‐204. doi:10.31703/gpr.2020(V‐I).22. (Muhammad Naeem Javed, Abdul Basit, Tanveer Hussain (SMCS) Abstract: Climate change is a global phenomenon; its outcome affects societies around the world. Due to the systemic effects of climate change, Pakistan frequently suffers from natural disasters. The present study explored the press coverage and framing trends about three climate issues (1) Climate change and global warming (2) climate change and water scarcity (3) agriculture and food security. The study was based on content analysis. In this research, editorials of four newspapers; The Nation, The News, Nawa‐i‐Waqt and Jang were examined during 2011 to 2018. It was census study and all editorials were examined during the period of 8 years. The results showed that all four newspapers highly covered issues of water scarcity in Pakistan and however, gave less coverage to the issue of agriculture and food security. Thus, overall editorial coverages increase with every passing year and mainstream Pakistani press framing trends were remain very positive and suggestive. Keywords: climate change, mainstream press, newspaper coverage, framing trends.
7. Zahra, M., Hussain, T. & Shahwar, D. (2020). Role of Technology in Developing Oral Fluency among Intermediate Students. Global Regional Review, V(I), 442 ‒ 459. http://dx.doi.org/10.31703/grr.2020(V‐I).48. (Tanveer Hussain (SMCS) Abstract: Use of technology develops learner oral fluency, as well as their other learning skills. The recent research is on the role of modern technology in developing oral fluency of English among the students of intermediate level. The objective of the paper is to answer the question, what role technology plays in developing the oral fluency of learners? This study has been built on the hypothesis that technology has a positive influence Research Outlook 2020 | 271
on oral fluency, as by using technology learners enhance their oral fluency. In order to check our hypothesis this study used the quantitative data through questionnaire from 200 students (both male and female) aged between 17‐19 years, at intermediate level from Government Emerson College Multan and Government Degree College Multan. The framework employed in this study is the input hypothesis by Stephen Krashen (1977). The hypothesis that technology plays positive role in developing oral fluency among students is proved in conclusion. Keywords: modern technology, oral fluency, use of technology in second language learning.
8. Chaudhary, M. U., Hussain, T. & Ghani, A. (2020). Role of FM Radio on Pakistani Youth: Socio‐Political Perspective. Global Political Review,V(I),172‐181, doi:http://dx.doi.org/10.31703/gpr.2020(V‐I).20. (Tanveer Hussain (SMCS) Abstract: This research paper is being presented to know and evaluate the socio‐political influence of FM radio on Pakistan youth. At the time of partition and inception of Pakistan, Radio Pakistan was the only electronic medium available in the country. Radio has been the most powerful and useful informative/ educative tool for the reason that it has excellent outreach as compared to all other electronic mediums; with passing years it has been turning into a neglected medium due to the policies of sitting governments who have used radio medium for propagation of their agendas and made this useful source of information, an extol tool which only focused actions of government, instead of disseminating education, highlighting different social, cultural and political issues and awareness campaigns for the masses. Concrete and stunning efforts are still required to get maximize yield and benefit from the radio medium in Pakistan. Keywords: FM radio, youth, social, political.
9. Waheed, S., Saleem, N., Riaz, A., & Bukhari, S. F. (2020). Islam and myths about family planing: The impact of greenstar media advertisement campaign on the mindset of the rural dwellers of Pakistan. Journal of Islamic Thought and Civilization 10 (1), 332‐347. https://doi.org/10.32350/jitc.101.18. (Saima Waheed (SMCS) Abstract: Religious guidance in Islam is derived primarily from the Holy Qur’ān and Sunnah. For cases not discussed in the Holy Qur’ān, Muslims refer to ijtihad and ijma, that is, they strive to find solutions for the existing problems by reinterpreting Islamic decrees while utilizing the ultimate superintendent sources (Holy Qur’ān and Sunnah) and seek consensus. The study aims to investigate the effects of Greenstar media advertisement campaign on the mindset of the rural dwellers of Pakistan through selective exposure technique. Greenstar marketing tends to educate the rural populace about population control and guides them about different birth control methods, such as contraceptive pills. The researchers carried out a survey with a sample of 200 respondents, out of which 100 were male and 100 were female. Data was collected by providing two questionnaires to take sample from different age groups developed on a five point Likert scale. The results of the study highlighted that regardless of exposure to Greenstar media advertisement, rural men still showed a rigid attitude towards using these products (p value = 0.000). On the other hand, rural women considered local midwives more knowledgeable and expert about the matter at hand (p value = 0.002) and were reluctant towards using Greenstar products that were advertised on the mainstream media due to the pressure of their husbands (p value = 0.000). Keywords: Greenstar products, Islam, media advertisement campaign, mindset, myths, family planning, Pakistani villagers.
10. Naeem, T., Khan, M. H., & Khaliq, F. A. (2020). Cultural Imperialism through Hollywood Cinematic Media on Pakistani Youth. International Journal of Media and Information Literacy, 5 (1), 90‐102. doi: 10.13187/ijmil.2020.1.90. (Mohsin Hassan Khan (SMCS) Abstract: Cinematic media is a very powerful tool, used by developed countries in the modern world, with a deliberate purpose to transmit their cultural legacy by projecting a variety of attractive features to influence the minds of youth. This study aims to scrutinize the impact of Hollywood cinematic media on Pakistani youth. The Research Outlook 2020 | 272
theoretical framework applied in this study is based on the Theory of Cultural Imperialism, propounded by Her Herbert Schiller in 1973. The theory postulates that the Western media has a strong effect on the Third World countries by imposing on them Western cultural standards and hence are destroying their own cultures. The study is quantitative based on a mixed survey, which consists of close‐ended questions along with the opinions of the respondents. SPSS is used to compute the obtained data. The findings demonstrate that the Hollywood movies leave a significant impact on Pakistani youth, since they are prominently engrossed to the lifestyle of American culture. The study suggests that it is responsibility of Pakistani people and media authorities to pay serious heed to control such movies, which prove to be serious threat to their own cultural values. Keywords: cinematic media, cultural imperialism, Pakistani youth.
11. Noureen, A., Hussain, T. & Warrich, Haseeb Ur Rehman. (2020). Hollywood Interpretative Overview on Communism: An Analysis of Pre, During & Post‐Cold War Era. Global Mass Communication Review, V(I), 1‐14. doi:10.31703/gmcr.2020(V‐I).01. (Tanveer Hussain (SMCS) Abstract: The US’s communist or socialist fright began in the late 1800s, the moment when blue‐collar workers stood up in opposition to get their fundamental integrity, remuneration betterment etc., and the attainment of such integrities from intercontinental supremacies, and to have remained in opposition to such economical way of mechanism. The fears of communism and their followers of anti‐harmony to US community were seen among the structural class systems of ethnic interconnectedness. The elementary struggle is related to the portrayal of Communism and their followers in Hollywood productions. It relates to exacerbating negatively frame about their ideological depictions, communist countries and the individuals interlinked with it. Keywords: Hollywood, ideology, propaganda, communism, social constructivism.
12. Hussain, T., Rafique, S., & Basit, A. (2020). Online Learning at University Level amid COVID‐19 Outbreak: A Survey of UMT Students. Global Educational Studies Review, V(III), 1‐16. https://doi.org/10.31703/gesr.2020(V‐III).01. (Tanveer Hussain, Abdul Basit (SMCS) Abstract: This research inquires impact of COVID‐19 outbreak on education. It measured the effectiveness and productivity of online learning during pandemic. Online mode of education. Knowing the role of information and communication technologies in assisting and facilitating online learning was also one of the main objectives. Online Survey was conducted for data collection. Sample was selected from University of Management and Technology using simple random sampling. According to the results, respondents agreed that COVID‐19 has affected education at university level badly. Respondent agreed that sudden switch to online learning due to COVID‐19 has created unrest among students. Respondents also strongly agreed that online leaning is less effective and classroom leaning is more effective. In current research, it has been observed that respondents strongly disagreed and 19.50% disagreed that ICTs have facilitated them during their online leaning amid COVID‐ 19. Keywords: COVID‐19, online leaning, ICTs.
13. Hussain, T., Shahwar, D. & Basit, A. (2020). A Speech Act Analysis of the First Speech of Imran Khan as Prime Minister . Global Political Review ,V(II),1‐10, doi: 10.31703/gpr.2020(V‐II).01. (Tanveer Hussain, Abdul Basit (SMCS) Abstract: This paper aims to highlight the speech acts which have been working behind the first speech that has delivered by Imran Khan as Prime Minister of Pakistan at 26, July 2018. It is a political discourse that attracts the researcher's interest. The objective of this paper is to answer what type of speech acts have been used by Imran Khan, the overlapping of what speech acts occur in Imran Khan's speech and what direct and indirect speech acts have been used by Imran Khan. The findings revealed that his speech includes representative acts (27.083%), expressive acts (1.041%), declarative acts (7.291%), directive acts (25%), commissive acts (39.583%) out of the Research Outlook 2020 | 273
total 100% of data. This paper‐based on both qualitative and quantitative analysis of discourse. The framework employed in this study is the Speech Act theory that has introduced by J.L Austin in 1962 and further developed by J.R Searle (1969). Keywords: locutionary act, illocutionary act, perlocutionary act, speech act analysis, direct speech acts, indirect speech acts.
14. Hussain, T., Imtiaz, I., & Iqbal, A. (2020). Family Relations after the Emergence of Social Media: A Comparative Analysis of Single‐Family and Joint Family Systems. Global Regional Review, V(I), 544‐551. doi:10.31703/grr.2020(V‐I).57. (Tanveer Hussain, Iqra Imtiaz (SMCS) Abstract: This study's main aim is to explore the impact of social media on family ties. A quantitative method of survey is used to gather data. The survey is conducted both face‐to‐face and through emails. One hundred respondent take part in this research through a survey while media displacement theory implemented on present research. Statistics indicate that people living in a single‐family group use more social media than people living together. Findings also say people are using social media to escape family problems. There is a small disparity between the people who live in both family systems on whether or not social media eliminates the original family. The present research suggests more awareness in better usage of social media to avoid family values destruction. Keywords: social media, family communication, survey, media displacement.
15. Hassan, A., Rizvi, W. R., & Hussain, T. (2020). Cross‐border news framing of social issues in India and Pakistan’s English dailies. Academic Journal of Social Sciences (AJSS), 4(3), 566‐578. http://ojs.lgu.edu.pk/index.php/ajss/article/view/1159. (Abul Hassan, Tanveer Hussain (SMCS) Abstract: This study analyzedcross border news coverage by India and Pakistan’s English dailies (The Timesof India, The Hindu, Dawn and The Nation) from 1stJune 2014 to 31stMay 2018 by focusing on Social indicators such asreligion, culture and social structure which arefurther sub‐divided into issues.The study implied quantitative and qualitative approaches andanalyzed the content of 4480 news withdirectional analysis. Twosample proportion tests applied as per the significance and association of variables. It was found that more coveragegiven to the religious news than other social indicators. Cultural indicator was given most positive and religious news most negative coverage among the indicators while Hindu‐Muslim issues was given most negative coverage among news issues.The content denoted war ratherthanpeace journalism. This study recommendspractice of peace journalism to promote neutral opinion about culture and especially religious thoughts among people from both sides. Keywords: culture, religion, hindu‐muslim, news coverage, peace journalism.
16. Iqbal, A., Hussain, T., Javed, N. (2020). Media and Foreign Policy on Pak‐Afghan Relations (1997‐2005): The Role of US and Pakistani Press. Journal of Peace, Development and Communication (JPDC), 4 (2) 454–477. https://doi.org/10.36968/JPDC‐V04‐I02‐24. (Tanveer Hussain (SMCS) Abstract: The main purpose of the present research is to investigate Pak‐Afghan relations in the editorials of US newspapers, The Washington Post & The New York Times and Pakistani newspapers Dawn & The News related to the following issues during the period 1997‐2005; A) US as a factor in Pak‐Afghan relation, B) Coverage of Islam/Muslims regarding war on terrorism, C) Pakistan’s stance on Pak‐Afghan bilateral relations, and D) US’s stance on Pak‐Afghan bilateral relations. The time period to be examined in this proposed study spans over eight years regarding the editorial coverage of Pak‐Afghan relations in the US and Pakistani leading English Press. Triangulation method based on qualitative and quantitative method was used to conduct the present research. The results show that the editorial contents of USA and Pakistani newspapers were not different regarding Pak‐ Afghan relations before and after 9/11. The incident of 9/11 changed the American foreign policy towards developing and least developing nations especially Muslims states like Pakistan, Afghanistan, Iraq, and Iran etc. Research Outlook 2020 | 274
Pakistani press highlighted the issues regarding the Pak‐Afghan relations before and after 9/11 as a favorable and conducive, related to Muslim/Islam regarding war on terrorism. The study suggested that instead of the focus on military resolution of the different problems, rather social bilateral negations should be prioritized which would be long lasting and full of mutual respects and honor. Keywords: media, foreign policy, editorials, newspapers, relations, contents, Pak‐Afghan.
17. Khan, Z., Khan, M. H., & Asghar, R. (2020). Journalists’political affiliation and organizational pressure: understanding the reality of panama leaks. Research Journal of Social Sciences, 18, 28‐43. (Mohsin Hassan Khan (SMCS) Abstract: This research paper investigates the political affiliations of journalists and the pressure they faced from their concerned organization during the coverage of Panama leaks issues. In order to know the views of the journalists connected with Panama leaks issues, data were collected from them through in‐depth interviews as part of the qualitative method. The results describe that the reporting of the case was highly influenced by the political affiliation and there was a lot of indirect and direct pressure on that's from the organization during the coverage of Panama leaks issues. The journalists supported their favorable parties in the reports of the Panama leaks in lines with their affiliated political agenda and outlines. On the other hand, organizations also put pressure on the journalists to do reporting according to suit the political interest of the organization and increase the financial benefits. The advertiser had a strong influence on the content of the news and the advertiser exercised its pressure on the owner of the organization to exert pressure on the journalists. In this study, the researcher focused on the Hierarchy of influences model to analyze and study all those factors within or outside organization which is affecting news. Keywords: journalist, political affiliation, organizational pressure, panama leaks.
18. Noor, U. S., Humera, S., & Khan, M. H. (2020). Persuasive strategies and video games: an insight into age of Empire III. International Journal of Media and Information Literacy, 5(2), 191‐198. doi: 10.13187/ijmil.2020.2.191. (Mohsin Hassan Khan (SMCS) Abstract: This study investigates the role of visual signs and modes in the meanings interpretation of visual depiction and also the ideology behind this visual manifestation. It also explores various persuasive strategies through the semiotic manifestation of the video game Age of Empire III. This study reflects the way of meaning making in which video game has been designed to incorporate itself in the virtual world. So, multimodal semiotic analysis of video game: Age of Empire III has been undertaken in the light of G. Kress, T. Leeuwen’s (Kress, Leeuwen, 2001) theory of multimodal communication and S. Littlejohn’s (Littlejohn, 1999) concepts of elements, environment, game design, and gameplay, and storyline and action outcome interactions. It is a qualitative type of research. The multimodal framework and concepts of various terms have been used as an eclectic approach in the study. The study reveals that this video game’s manifestation is an indirect programming of the player in the game who plays and follows the instructional pattern whereas the game introduces the semiotics in form of game choices and gives players the thought of free will. This dual potential has manifested to persuade and provide entertainment to the player or viewer. Keywords: multimodal semiotic discourse analysis (MSDA), social semiotics, age of empire III, video game, visuals, modes, signs.
19. Khuhro, R. A., Adnan, H. B. M., Junejo, Z. I., & Khan, M. H. (2020). Advertiser Pressure: A Climate Change Content Agenda‐Cutting Paradox in Pakistani Media. Media Education (Mediaobrazovanie), 60(4), 664‐674. doi: 10.13187/me.2020.4.664. (Mohsin Hassan Khan (SMCS) Abstract: Mass media is a part of the political economy and operates like other businesses in the market economy to earn profits. Though, media sells its content as a commodity to the customers and its consumption decides its Research Outlook 2020 | 275
rating and circulation figures. In that context, the figures attract advertisers to advertise their products through these highly rated and circulated media outlets. However, most of the revenue of any media organisation is gathered through advertisements. Thus, most of them became dependent on advertisers for revenue generation and it generates 'extramedia influence' on media content, which is called advertiser pressure. Therefore, with this background, the fundamental objective of this study is to explore advertiser pressure on climate change content in the media in Pakistan. The data was collected through qualitative semi‐structured in‐depth interviews from purposively sampled 15 environmental journalists who are working for local and mainstream Pakistani press/media. Findings revealed that advertisers' pressure influences all types of content in the media in Pakistani media. However, advertiser pressure impacts more on climate change content because it is a soft news subject and needs more investment. Additionally, results showed that government advertisers influence more than corporations because the government is the primary advertisers for media content in Pakistan. Keywords: media influences, external influences, advertiser pressure, Pakistani media, climate change.
20. Khaliq, F. A., Naeem, T., & Khan, M. H. (2020). Impact of Critical National Identity Discourse on Youth in Pakistan: A Proximization Analysis of Pakistani English Newspapers. Media Education (Mediaobrazovanie), 60(3), 404‐415. doi: 10.13187/me.2020.3.404. (Mohsin Hassan Khan (SMCS) Abstract: The study aims to find out the spatial, temporal and evaluative proximization strategies used by the opinion writers to project Pakistan’s National Identity in the two leading English newspapers of Pakistan: DAWN and The News. The goal set for the study is to find out the impact of critical representation of Pakistan’s National Identity Discourse on Pakistani youth. The study focuses on the issue of Pakistan’s National Identity projection during the ongoing war on terror in Pakistan from 2007‐2017. Purposive sampling method is used to collect the data. The epistemological framework of the study is based on Anderson’s (1991) Imagined Communities. The empirical foundation is based on Hart’s (2014) Critical Cognitive Discourse Analysis. Both qualitative and quantitative methods are employed by using Corpus Linguistics as a quantitative tool and proximization analysis as interpretative tool in the present study. To generate the frequencies and concordance lines of lexical items, Antconc is used. The results show that opinion writers used the spatial and temporal deixis to create the negative image of Pakistan during the last decade by linking events of past from collective memories with present. They used temporal and spatial proximization strategies to build the Critical National Identity Discourse of Pakistan by presenting it as a negative imagined community. Pakistani youth is shown as marganalisedcommunity. The evaluative proximization strategy shows that the discourse leaves a negative impact on Pakistani youth. Keywords: imagined communities, national identity of Pakistan, critical cognitive discourse analysis, proximization strategy.
21. Shehzad, M., Iqbal, A., & Hussain, T. (2020). Influence of Cellular Network TV Advertisements on Brand Switching Behavior of Pakistani Consumers at District Mandi Bahhuddi. Asian Journal of International Peace & Security (AJIPS), 4(1), 250‐258. (Tanveer Hussain (SMCS) Abstract: Television advertisements have a great impact on the buying and selling behaviour of consumers. The advertisers’ primary purpose is to reach consumers and influence their awareness, buying behavior and attitudes. Companies invest on the products to keep in mind the consumers’ needs, and behaviour. The main aim of the research is to explore: whether television advertisements of cellular networks have some significant effects on the brand switching behaviour of the consumers, and; which cellular network has catchy advertisements to influence consumers to switch brand. Survey method was used to data collection from 300 male & female respondents of district Mandi Bahhuddin through purposive sampling technique. This was conducted under the theoretical underpinnings of the likelihood model of persuasion. The results indicated that: there was a significant link between current service providers and catchy and effective advertisements of cellular companies; there was a significant association between cellular networks and the impact of television advertisements on Research Outlook 2020 | 276
brand switching behaviour, and; Ufone advertisements were more attractive, influential and catchy. Television advertisements of cellular companies significantly change the minds of viewers which lead to brand switching. Keywords: television, advertisement, cellular networks, brand switching, behavior.
22. Iqbal, A., Khan, A. Z., & Hussain, T. (2020). US Foreign Policy Towards Pakistan: Editorial Treatment of US & Pakistani Press. Global Strategic and Security Studies Review (GSSSR), V(III), 1‐10. https://doi.org/10.31703/gsssr.2020(V‐III).01. (Tanveer Hussain (SMCS) Abstract: This research has been designed to investigate US foreign policy towards Pakistan.It has been summarized while analyzing the US foreign policy towards Pakistan vis‐à‐vis US‐Pak relations before and after Trump being elected as President, the US’ shift in policy towards Pakistan might not be as drastic for the Pakistani as public statements of the Trump administration propose, because the prospect of treating Pakistan as an enemy is such a frightening one that most American policymakers would rather avoid it than confront it with real seriousness. In current circumstances, it is likely that the US will treat Pakistan as what is colloquially called a "frenemy". However, reductions in military assistance and downgrading of Pakistan’s status as a major non‐NATO ally are still a possibility. Keywords: Foreign Policy, Pak‐US Relationship, Trump Administration, Policymakers, Military Assistance, Frenemy.
23. Hussain, T., Iqbal, A., & Yaseen, M. A. (2020). Influence of Westernized Culture on Women Via Television Drama and Films: A Survey of Lahore District. Global Regional Review, V(IV), 43‐58. https://doi.org/10.31703/grr.2020(V‐ IV).05. (Tanveer Hussain (SMCS) Abstract: The study is conducted to investigate the “Influence of westernized culture on eastern women via tv drama and films.” Tv drama and films playan important role in women and youth life as it influences their lifestyle, dressing sense and language as well. In this research, the researcher wants to know the influence of western culture on eastern women. The data was collected from a sample of 130 women in Lahore via an online questionnaire survey. Five research questions were developed in this research which focuses on the influence of western culture on eastern women, their lifestyle, dressing sense, their speaking style and for how long the influence remains on them. The researcher analyzed that there are choices to women whether to influenced or not but the western culture replacing eastern culture and playing an important role in people’s life through drama and film content. It’s also the fact that only a small number of women are in favor to ban the western content. Keywords: western culture, eastern women, drama, film.
24. Hussain, T., & Shabir, G. (2020). Developmental Journalism in Pakistani and Indian Print Media: A comparative study of leading English and Urdu dailies. Global Media Journal‐Pakistan Edition. XIII (I). 17‐35. (Tanveer Hussain (SMCS) Abstract: This research explores the development journalism in Pakistani and Indian newspapers (Daily Dawn, Daily Jang, Daily Times of India and Daily Sahafat) during 2012 to 2014. The researcher observed fifteen different development categories and finds out that the overall news coverage of development aspects remained only 5.34% in which more focused remained on health, education, infrastructural and economic development as health developmental coverage remained 14.76%, education 14.74%, infrastructural development 13.54%, and economic development remained 11.71% of overall development coverage while population control and national integrity developmental news remained less than all other development categories. The ratio of favorable developmental news remained more than unfavorable and neutral While Indian newspapers given 3.59% more developmental coverage than the Pakistani newspapers, same as Urdu newspapers given 0.71% more developmental coverage than the English selected dailies. Two communication theories; development media theory & development communication used as theoretical framework. The development media theory supports Research Outlook 2020 | 277
the research as selected newspapers highlighted the problems of society member’s life in development perspective but the newspapers did not use communication in systematic way as the development communication. The study recommended the development journalism trainings for journalists and systematic promotion & implementations of DJ. Keywords: development, journalism, communication, Project, construction, economic.
25. Iqbal, A., Hussain, T., & Aslam, R. (2020). Exposure to Social Media Advertisements and Youth’s Response. Global Regional Review, V(III), 144‐150. https://doi.org/10.31703/grr.2020(V‐III).16. (Tanveer Hussain (SMCS) Abstract: The major purpose of this study is to examine the effects of social media advertising on the purchase behaviour of young university students. The study employed an exploratory research design and cross‐sectional survey technique. On the basis of a comprehensive literature review, research hypotheses were formulated to investigate the relationship between study variables. The primary data were collected using questionnaires from students of public sector universities operating in the city of Faisalabad, Pakistan. Non‐probability and convenience sampling were adopted in the selection of target respondents, which were 283 students, both day‐ scholars and boarding students. The findings reveal that social media advertising affects the purchasing behaviour of social media users. The recommendations of the study are that the companies should concentrate more on promotional activities using social networks as this is more effective, less costly and accessible to a large number of target audiences. Keywords: social media marketing, consumer buying behaviour, social media advertisement, buying decision process, youth response.
26. Iqbal, A., Gul, U., & Nasir, N. (2020). Impact of Music on Vocally Expressed Emotions and Moods in Nostalgia. Global Mass Communication Review. V(III), 84‐94. doi: 10.31703/gmcr.2020(V‐III).07. (Noorulain Nasir (SMCS) Abstract: The impetus of this research work is to study the impact of musical therapy and songs to excite the human emotion with respect to the past memory. At the primitive music history, music was the tool of entertainment and was in the access of elite class only. But now a day it is in the access of every hand in the form of mobile music player. This will figure out the role of music in our life with respect to its role in emotion driving ability. Considering the influence and the role of music in controlling our psychology, it is much important that it should be used as positive emotion driver. This research will help us to explore the use of music in our routine life and endeavours to determine its value to our emotions. Private school teachers will be asked to share their experience about Nostalgia remembering their past. Keywords: music therapy, mixed emotion, nostalgia, remixing of songs, emotion. trigger, mood changer.
27. Nasir, N., Iqbal, A., Shehzad, M. (2020). Child Presentation on Mainstream News Channels and Wellbeing of Victims. Global Social Sciences Review ,V(III),11‐23, doi: 10.31703/gsr.2020(V‐III).02. (Noorulain Nasir (SMCS) Abstract: Child abuse is one of those issues of society that is very difficult to talk about because it creates a sense of shame and guilt and so on but due to avoiding an open debate about it the spiral of silence is increasing over time. This research study aims at examining the way child abuse cases like Zainab case has been portrayed on news channels and the impact it leaves on the minds of victims. The researcher analyzed the BOL news channel, especially their news bulletins and headlines. The quantitative research methodology was used. Survey method was employed, 100 questionnaires were distributed among students of UMT. Cultivation theory has been used in order to draw the theoretical framework of this study. Findings suggested that the irresponsible role of media in this specific issue might cause great stress and other psychological disorders among the victim and their families. Keywords: child abuse, zainab case, victim families, wellbeing, civilization.
Research Outlook 2020 | 278
28. Zaidi, A., Hanan, A., Ali, F., & Awais, M. (2020). Media Objectification and Women Clothing Buying Behavior: Social Comparison and Self‐Gratification as Mediators. International Journal of Media and Information Literacy. 5(2). 227‐236. doi: 10.13187/ijmil.2020.2.227. (Alina Zaidi (SMCS) Abstract: The aim of the current research is to explore the mediating role of self-gratification and social comparison in explaining the relationship between media objectification and clothing buying behavior in women. For this purpose, correlational research design was employed using 400 female participants within the age ranges of 18-29 selected by convenient sampling. The data was collected using developed questionnaire. The results from Pearson Product Moment correlation highlighted that media objectification (MO) was found to be strongly related with self-gratification (SG), social comparison (SC) and clothing buying behavior (CBB) in women. The results from Path Analysis using AMOS highlighted the mediating role of SC and SG in explaining the relationship of media objectification with women clothing buying behavior. The finding from the study highlighted that besides media objectification in predicting women clothing buying behavior, SC and SG also plays significant roles, these results fills the gaps in the literature pertaining to clothing buying behavior. Keywords: consumer perspective; media objectification, social comparison, self‐gratification, women clothing.
School of Governance and Society (SGS) School of Governance and Society Research Articles 1. Fatima, M., & Azhar, A. (2020). Examining the Pro‐Environmental Behavior of Employees in Private Organizations of Pakistan. Governance and Management Review (GMR), 5(2), 1‐26. (Aisha Azhar (SGS) Abstract: Pro‐environmental behavior (PEB) has received considerable attention in business and other social sciences disciplines. However, very few studies have focused upon the PEB in organizational settings and no study has examined the employees‟ PEBs in Pakistani organizations. Building upon the existing theories in other disciplines, this study examines how PEB is influenced by organizational characteristics, i.e. organizational environmental policy, organizational citizenship behavior and transformational leadership. Data were collected by means of self‐report surveys from employees of major private organizations with proportionate sampling of companies following environmental practices versus organizations not following environmental practices. Multiple regression analysis was employed to test the proposed model. The findings indicate that organizational environmental policy positively influences the workplace PEBs. Organizational citizenship behavior also positively influences the PEB. Transformational leadership does not influence the workplace PEBs. Keywords: pro‐environmenral behavior, organizational citizenship behavior, transformational leadership. School of Architecture and Planning Department of Architecture Research Articles
1. Ramla Toor, Saima Gulzar, & Faiqa Khilat. (2020). Condition Assessment. Journal of Art, Architecture and Built Environment (JAABE), 3(1). https://journals.umt.edu.pk/index.php/JAABE/article/view/553 .(Ramla Toor, Saima Gulzar, Faiqa Khilat (Architecture/SAP) UMT JOURNAL Abstract: not available. Keywords: not available. 2. Hamna Ahmed, Ayesha Mehmood Malik, Saad Mujahid, & Rabia Khan. (2020). Study of Utilizing Residual Spaces under Flyovers in Lahore, Pakistan. Journal of Art, Architecture and Built Environment (JAABE), 3(1).
Research Outlook 2020 | 279
Retrieved from https://journals.umt.edu.pk/index.php/JAABE/article/view/552 .(Hamna Ahmed, Ayesha Mehmood Malik, Saad Mujahid, Rabia Khan (Architecture/SAP) UMT JOURNAL Abstract: Residual spaces are the leftover spaces such as the spaces under flyovers. These spaces further act as physical barriers in the city’s urban form.. The spaces under flyovers have been neglected, left underused, even in some cases, remain frightening, and unattractive. These spaces provide local communities with various opportunities. In the city of Lahore, there is a lack of public places that enhance social interaction. There are many possibilities of transforming the dead and unused spaces under flyovers into creative venues for various communal activities. This paper attempts to focus on the concept and importance of leftover spaces, while identifying and analyzing the type of social space according to the presented concept of Lefebvre. Keywords: flyovers, public spaces, representation of space, residual spaces, urban social space. 3. Shirwani, R., Gulzar, S., Asim, M., Umair, M., & Al‐Rashid, M. A. (2020). Control of vehicular emission using innovative energy solutions comprising of hydrogen for transportation sector in Pakistan: A case study of Lahore City. International Journal of Hydrogen Energy, 45(32), 16287‐16297. doi: https://doi.org/10.1016/j.ijhydene.2019.02.173. (Rummana Shirwani, Saima Gulzar, Muhammad Umair, Muhammad Ahmad Al‐Rashid (Architecture/SAP) Abstract: Energy, either from non‐renewable or renewable sources, is of paramount importance as the progress of a country is gauged on economic development. However, with the use of non-renewable energy resources, the environmental degradation is exacerbating with every passing day in developing countries including Pakistan. On the contrary, the developed countries are resorting to sustainable and renewable energy resources to achieve sustainable development goals. The primary consumer of the non‐renewable energy sources is transportation sector in Pakistan, with the total consumption amounting to almost two‐third of the total utilization. Keeping in view the existing energy expenditures and its share in environmental pollution by transportation sector, Lahore Metropolitan area has been selected for this research paper. This research analyzed the environmental data collected from multiple road junctions of Lahore City. In light of the existing data, the research exhibited improvements in overall environmental quality by comparing the existing and proposed energy solutions comprising of Hydrogen in transportation sector. The comparison carried out by utilizing International and National Environmental quality standards. Additionally, research also addresses the energy savings with the transition from non‐renewable energy sources to renewable and innovative energy solutions. Keywords: energy, environment, Pakistan, hydrogen energy. 4. Malik, A. M., Awan, M. Y., Gulzar, S., Haroon, F., & Rashid, M. (2020). Redefined Energy Efficient Strategies to Achieve Thermal Comfort in Contemporary Houses in Lahore, Pakistan. Technical Journal, 25(01), 1‐7. (Ayesha Mehmood Malik, Muhammad Yusuf Awan, Saima Gulzar, Faiza Haroon, Memoona Rashid (Architecture/SAP) Abstract: The past few decades have witnessed a visible rise in energy consumption by the residential users. The adverse change can be partially attributed to a modernistic and apathetic approach to house designs which do not adhere to the local realities of climate, topography and orientation. The paper aims at investigating current strategies and techniques of energy conservation and efficiency being implemented by four selected architects namely, Kamil Khan Mumtaz Associates, Ghayyoor Obaid, Saad and Aqrab Rana(Side Words) and Nabeel Wali (Wali and Associates), in the domain of residential architecture. A cross‐analysis of the residential projects by these architects was carried out to identify the customized techniques adopted to deal with the semi‐arid climate of Lahore. Semi‐structured interviews were undertaken with the architecture professionals to acquire primary data for the research. Meanwhile a number of books, journals, magazines, research papers, essays and blogs (both in printed form and online) were consulted regarding the literature review. Architects in Lahore are capitalizing on a number of passive means such as roof insulation, cavity walls, wall insulation, sun shades, trees
Research Outlook 2020 | 280
placement, courtyards, and natural ventilation with stack effect, brisesoleil, verandahs and terraces with the aim of creating houses that correlate with the site topography, climatic conditions, winds and solar path in addition to the latest materials to develop eco‐friendly houses. Keywords: energy efficient, house design, Lahore. 5. Malik, A. M., Rashid, M., Awan, M. Y., & Gulzar, S. (2020). Shrines an Derelict Veracity‐Case of Data Ganj Baksh: Shaikh Ali Bin Usman Al Hajveri Lahore. Pakistan Journal of Engineering and Applied Sciences, 27(2). (Ayesha Mehmood Malik, Memoona Rashid, Muhammad Yusuf Awan, Saima Gulzar (Architecture/SAP) Abstract: The shrines and their custodians in our society are valued as respect in our society. The department of Aukaf is in charge for managing the waqf properties attached to religious establishments. This paper discusses the institutional and legislative framework surrounding architectural conservation of shrines sited in Lahore along with other powers and urban milieu of these shrines that affect them. The data collected for this research are based on primary and secondary sources. The research findings are that there has been a recent trend of large‐ scale institutional approach towards reconstructing shrines buildings which generated with the Data Darbar Complex project. Other Grand mosques, along with public amenities and commercial areas are developed on waqf properties to increase revenues and facilitate za'ireen. Older but smaller mosques are mostly demolished in the wake of constructing modern and bigger mosques while shops are created on the peripheries to generate rental income. The future recommendation focuses on the need for incorporating aesthetical values in development projects aimed for places of spirituality. This demands inclusive project management techniques based on modern conservation trends in which the architects play a vital role. Training of the management staff and craftsman ship regarding the conservation techniques is highly needed for the future maintenance of these shrines. Keywords: Shrines, Data Darbar, Aukaf Department, Lahore, Conservation. 6. Nasim, A., & Malik, A. (2020). Restoration of the Forgotten Glory: Samadhi of Bhai Vasti Ram, Lahore. Journal of the Pakistan Historical Society Historicus (J.P.H.S.). LXVIII(1), 41‐57.(Abeer Nasim, Ayesha Mehmood Malik (Architecture/SAP) Abstract: Restoration of historic buildings is hard and requires skilled labour and good craftsmanship. The artisan who works in the restoration of old buildings and monuments learnt the skills and techniques from their ancestors. These skills are transferred from generation to generation since the time of the Mughuls (1524‐1712) and Sikhs (1764‐1849). Pakistan has a variety of structures built in different eras that have importance in the architectural character of Pakistan. This paper describes the Decorative Architectural features of Samadhi of Bhai Vasti Ram, Causes of decay of Samadhi, its importance and architectural significance. Restoration of Samadhi mob was completed in 2018 after it suffered a massive mob attack due to Babri Mosque incident in 1992. The restoration of Samadhi has been done by the Department of Archaeology and Museums, Pakistan. Keywords: Samadhi, Vasti Ram, Restoration, Lahore, Archaeology, Decay, Ornamentation.
7. Malik, A. M., Rashid, M., Shah, M. W., Ali, I. (2020). Bridging the gap. Walled cities: Peshawar and Lahore. Journal of Asian Civilizations. 43(1). (Ayesha Mehmood Malik, Memoona Rashid, Mir Wali Shah, Iftikhar Ali (Architecture/SAP) Abstract: Walled cities of Peshawar and Lahore shares both architectural characters and decaying patterns. This research is based on the historical background of both cities, their architectural and spatial evolution through various ruling regimes and the nature of conservation efforts. The aim of this research is to understand the similarities and relatable developments over the period of time as both share a dramatic similarity in many disciplines. While British rulers built their own cantonment outside of the cities, Post‐independence times saw massive commercialization of walled city and destruction of historical buildings. In year 2006, Lahore launched a conservation effort to restore the Royal Trail in assistance with the World Bank. The success of this project led to Research Outlook 2020 | 281
the enactment of Walled City of Lahore Authority (WCLA). In Peshawar the Khyber Pakhtunkhwa Government has launched a successful Heritage Trail in Walled city as a pilot project. This paper will compare the strategies and institutional frameworks present in both the cities along with the future direction for the conservation of Peshawar walled city. Keywords: Walled city, Peshawar, Lahore, architecture features, institutional framework.
8. Ahmad, Z. T., & Aslam, S. (2020). Comparative Study of Architecture of the Great Mosque at Samarra, Iraq and Ibn Tulun Mosque at Cairo, Egypt. Journal of Islamic Thought and Civilization (JITC), 10(2). https://doi.org/10.32350/jitc.102.16. (Zahid Tauqeer Ahmad, Seemin Aslam (Architecture/SAP) Abstract: Ever since the emergence of Islam, mosque has always been the most dominant feature in any Islamic built environment. Over the course of time, mosque architecture has gone through a process of various forms of uses and expressions in terms of its transformation. Its style, layout, building form, type of ornamentation used, building materials and construction technology usually provide vital information not only about the practice of Islam in general but also about the timeline, prevailing geopolitical environment, religious conviction, purpose, need and the region in which the mosque was built. This research paper emphasizes the study of the general characteristics of the two earliest examples of mosques in Islamic architecture through extensive literature review. It also highlights the historical and geopolitical context, built form, size, shape, configuration, color, texture, materials used, scale and type of decorative elements of the two most outstanding and heavily restored mosques to date. Keywords: Islam, mosque architecture, great mosque Samarra, ibn tūlūnmosque Cairo, construction technology, calligraphy, restoration, decorative elements.
9. Malik, A. M., Awan, M. Y., Gulzar, S., Ahmed, A., & Rashid, M. (2020). Passive Techniques Analysis of Residential Buildings for Energy Efficient Modern Residences in Lahore. Technical Journal, 25(03), 19‐25. (Ayesha Mehmood Malik, Muhammad Yusuf Awan, Saima Gulzar, Ayesha Ahmed, Memoona Rashid (Architecture/SAP) Abstract: The forces of globalization have reshaped the world, resulting into the present‐day architecture that has lost its relevance with the local climate, culture and social background. Modern architecture all over the world has similar features, materials and form, regardless of the region and has employed energy intensive methods to achieve thermal comfort. The traditional architecture was responsive to climate and region, to achieve thermal comfort in all building typologies in the past. This paper aims to seek the knowledge about the passive strategies for heating and cooling, employed in the residential buildings in past in order to formulate guidelines for designing new houses in Lahore, Pakistan. For this purpose, an extensive study of traditional and modern residential buildings in context of Lahore, Pakistan has been conducted, to analyze form, features, elements, and materials in addition to the active and passive cooling / heating techniques, construction methods of both typologies. The final step is the formulation of guidelines to achieve energy efficiency in residential architecture through the adaptation of passive techniques employed in vernacular architecture in order to provide innovative solutions of the modern times. Keywords: Energy Efficient Housing, Climate Responsive, Traditional Residential Architecture, Modern Housing, Passive Techniques. 10. Toor, R., Gulzar, S., & Khilat, F. (2020). Condition Assessment: Identification of Threats and Review of the Existing Structures of Wah Gardensfor the Prioritization of Treatment Recommendations. Journal of Art, Architecture and Built Environment, 3(1), 99‐128. https://doi.org/10.32350/jaabe.31.06. (Ramla Toor, Saima Gulzar, Faiqa Khilat (Architecture/SAP) UMT JOURNAL Abstract: Wah Gardens’ historic fabric and physical environment including their cultural setting, buildings, water landscaped gardens, and artistic creations reflect the rich cultural heritage of the Mughal period. Wah Gardens Research Outlook 2020 | 282
that once depicted the prospects of regality and magnificence lie in ruins presently due to the climatic conditions, negligence of the concerned authorities and anthropogenic vandalism. These cultural assets are the physical evidence of the past. They carry a distinct and unforgettable image in the life of residents that needs to be preserved for future generations to give them their own sense of place and identity. The objective of this research is to identify the threats faced by this marvellous heritage site and review the condition of the heritage structures in order to preserve this cultural heritage resource for the future. Condition assessment and review was carried out to record the existing situation of the buildings as well as the surrounding landscape in order to develop appropriate recommendations for reviving the essence of this vibrant cultural heritage site. The prioritization of recommendations was formulated according to the condition assessment of the Wah Gardens. Keywords: conservation, heritage, Mughal, WahCantt, Wah Gardens.
Department of City and Regional Planning (SAP) Research Articles
1. Nawaz, M., & Akbar, S. (2020). Is Lahore's urban system ready to sustain climate change? The case in Pakistan. European Journal of Climate Change, 2, 22‐32. doi: 10.34154/2020‐EJCC‐0202‐22‐32/euraass. (Muhammad Shafaat Nawaz (City and Regional Planning/SAP) Abstract: Lahore, the second largest city of Pakistan and home to more than 12 million people with annual population growth rate of 2.4%, has experienced deadly smog duration since last three years. Climate Change is a global challenge and administrations in major cities around the globe have started addressing the issue on top level. Lahore has also seen establishment and operation of various public sector institutions/offices which explicitly or implicitly claim to help Lahore sustain changing needs of urban system due to climate change. However, little is documented yet whether how effective have these interventions been at institutional level. This paper investigates policies, plans, procedures and regulations (whichever available) for seven relevant government offices on the basis of five key assessment areas to explore whether Lahore’s urban system is ready to sustain the challenge of Climate Change. The investigation covers the debate on policy to the plan level. Institutional abilities of selected government offices have been analyzed to ascertain their efficacy. In essence; the capacity of current system has been documented, the gaps in the system have been outlined and the prospective solutions for the way forward have been suggested in this study. Keywords: Lahore, climate change, urban planning, mitigation, adaptation, policy. 2. Wahab, S., Malik, S., Samsuddin, M. N., Yusoff, A., & Rashid, M. A. (2020). Influence of Work Environment on Research and Commercialization : Leading & Complimenting National Policy on Science and Technology Success. Asia Pacific Journal of Social Science Research, 5(1), 39‐50. https://doi.org/10.37263/apjssr.v5i1.90.(Muhammad Shafaat Nawaz (City and Regional Planning/SAP) Abstract: Lecturers are encouraged to engage in multi‐discipline researches following the current direction by the Ministry of Education, Malaysia. By considering one’s role as a lecturer that holding an administration post or high loading of teaching hours can lecturers take on the additional responsibility of conducting research? The capacity and capabilities of these lecturers are questionable. An effective work environment and type of support required can be vital to the success of any research success or even completion. This paper studies the influence of the work environment to research work and commercialization among university lecturers. In completing this study, a total of 200 lectures selected from universities across the northern region of Peninsular Malaysia as respondents. The questionnaire was distributed to these respondents as part of quantitative research. The finding of this study indicates that with work environment factor such as good support among peers will greatly impact research and commercialization work which lead to the success National Policy on Science, Technology
Research Outlook 2020 | 283
and Innovation (NPSTI). To conclude this study, relevant approaches and suggestions were listed to be applied following the intention of this study. Keywords: teaching workload, peer support, research and commercialization, national policy, science and technology. 3. Al‐Rashid, M. A., Nahiduzzaman, K. M., Ahmed, S., Campisi, T., & Akgün, N. (2020). Gender‐Responsive Public Transportation in the Dammam Metropolitan Region, Saudi Arabia. Sustainability, 12(21), 9068. (Muhammad Ahmad Al‐Rashid (City and Regional Planning/SAP) Abstract: The limited availability of public transportation in Saudi Arabia leads to an increased demand for private vehicles. An increase in using private cars does not meet the global sustainability goals, e.g., reducing energy consumption and improving the air quality. Road users should be encouraged to use sustainable mobility modes, particularly public transportation, equally accessible to both men and women However, women’s mobility has been somewhat limited and challenged in spatio‐temporal terms, and partly due to socio‐cultural barriers. This study attempts to understand the gender experience of a sample of public transport users and consider their aspirations and needs into daily mobility. A survey campaign (structured interviews and online questionnaires) was launched in the Dammam Metropolitan Region (DMR), taking four different types of respondents into account. The results suggest a predominant preference for taxis for shopping and leisure activities due to a poor public transport service, pivotally characterized by limited operational routes, hours, and infrastructure. This study ponders upon the adequacy of the supporting infrastructures and interior design of the public buses to women’s needs and compare them with global best practices. The results suggest that, due to the absence of a gender‐responsive design and infrastructure, women are forced to use taxis, although privacy and a sense of insecurity often become concerns when traveling alone or with children. The study results allow future research to be expanded, considering women’s mobility patterns, needs, and embedded barriers by comparing the results with current transport policies, plans, and practices. Keywords: public transportation, gender‐responsive design, sustainable mobility, gendered need, Saudi Arabia. Institute of Aviation Studies Institute of Aviation Study Research Articles 1. Khan, F. N., Ayiei, A., Murray, J., Baxter, G., & Wild, G. (2020). A Preliminary Investigation of Maintenance Contributions to Commercial Air Transport Accidents. Aerospace, 7(9), 129. https://doi.org/10.3390/aerospace7090129. Abstract: Aircraft maintenance includes all the tasks needed to ensure an aircraft’s continuing airworthiness. Accidents that result from these maintenance activities can be used to assess safety. This research seeks to undertake a preliminary investigation of accidents that have maintenance contributions. An exploratory design was utilized, which commenced with a content analysis of the accidents with maintenance contributions (n = 35) in the official ICAO accident data set (N = 1277), followed by a quantitative ex‐post facto study. Results showed that maintenance contributions are involved in 2.8 ± 0.9% of ICAO official accidents. Maintenance accidents were also found to be more likely to have one or more fatalities (20%), compared to all ICAO official accidents (14.7%). The number of accidents with maintenance contributions per year was also found to have reduced over the period of the study; this rate was statistically significantly greater than for all accidents (5%/year, relative to 2%/year). Results showed that aircraft between 10 and 20 years old were most commonly involved in accidents with maintenance contributions, while aircraft older than 18 years were more likely to result in a hull loss, and aircraft older than 34 years were more likely to result in a fatality. Keywords: accidents, aircraft, airworthiness, aviation, maintenance, safety.
Research Outlook 2020 | 284
Conference Proceedings 1. Batul, B., Jamil, Z., & Sohail, A. (2020). Effect of Similarity Distortion on the Scaled Model of a Pressure Vessel‐ A Case Study of Propellant Tank. Paper presented at the 2020 17th International Bhurban Conference on Applied Sciences and Technology (IBCAST). Islamabad, Pakistan. 14‐18 Jan. 2020. (Beenish Batul, Zukhraf Jamil (IAS) Abstract: This paper investigates the effect of similarity distortions on the structural similitude performed on the full scale prototype propellant tank in order to develop its scaled model. Propellant tanks act as pressure vessels and find their use in various aerostructures ranging from launch vehicles to missiles. They require extensive and costly testing to qualify which can be reduced by performing tests on the scale down model and using its results to accurately predict the prototype performance. Structural similitude using dimensional analysis is the widely used method of developing scaled models of pressure vessels in order to reduce the cost of manufacturing and testing. One of the problems encountered in dimensional analysis is the lack of complete similarity due to variations in the material properties, geometrical parameters and other factors between the prototype and the scaled model. These variations, called similarity distortions, result in partial similarity model that can affect the overall testing results. In this paper, the similarity distortions due to the change in material, wall thickness and head ratio of the propellant tank are studied. The objective to analyze these distortions is to achieve reliable test results and at the same time identify the structural parameters whose complete similarity cannot be violated. For comparison and overall analysis, a linear pattern of scale factors for different levels of distortions is presented for the development of scaled models. Results show that partial similarity in the scale factor of head ratio does not give satisfactory results. However, partial similarity in the material properties and wall thickness of the scaled pressure vessel can be overcome and the method to achieve this is presented. Keywords: propellant tank, pressure vessels, dimensional analysis, partial similarity. Center for Teaching and Learning (CTL) Center for Teaching and Learning Research Articles
1. Asif, S., Afzal, I., & Bashir, R. (2020). An Analysis of Medium of Instruction Policies in the Education System of Pakistan with Specific Reference to English Medium Education. Sir Syed Journal of Education & Social Research, 3(2), 370‐382. (Sadia Asif (CTL) Abstract: A critical examination of the trends, issues, and challenges in policy and practice of English language education in Pakistan is the main concern of this paper. This is done first by describing the practice of teaching English in varied instructional situations. Second, the paper historically reviews the language education policies since Pakistan’s independence in 1947. Third, the consequences of using English as the medium of instruction are discussed. A longitudinal large scale study is done to highlight the fact that English as medium of instruction at primary school level can distort the teaching and learning activities for students and teachers in rural areas of Pakistan and student drop‐out rate can even get higher in those areas. The data was collected from the interviews of twenty teachers working in government and semi government schools at primary level. Based on the information obtained from the target participants, teaching at the same level but in different schools, the author argues that mother tongue education at the primary level is the most appropriate method to enhance the educational performance of students and a positive approach to bilingual education must be taken to resolve the challenges associated with the medium of instruction policies in the education system of Pakistan. Moreover, the data also shows that adopting English as a medium of instruction in Public schools may lead to low motivation level among students and it can hinder the development of English as a second language among learners. Furthermore, a difference in home language and school language may also hamper development and concepts formation in students at school level. Therefore, it is recommended that before implementing any language as Research Outlook 2020 | 285
medium of instruction at school level, one must review the history of Pakistani education system and must keep in mind the linguistic differences of the society and unavailability of resources is also a major hindrance in implementation of any language policy. The results of this study confirm that the pedagogical effectiveness could only be achieved through the mother tongue and provides clear evidence for the usage of native languages as a medium of education in schools. Keywords: medium of instruction, urdu medium schools, bilingual education, language policies, private schools.
2. Afzal, M. I., Mohsin, L. A., & Asif, S. (2020). Distance Learning, Pedagogical Practices and Communication Problems: A Learner‐Centered Approach. International Review of Social Sciences (IRSS), 8(9), 34‐48. (Sadia Asif (CTL) Abstract: The recent COVID‐19 pandemic has brought changes and opened new horizons in every field of human life. This development has altered ways of learning and pedagogy generally all over the world but particularly in developing countries like Pakistan. Due to closure of institutions, distance learning (online classes system) has been emerged as an alternate that includes revised content, assessment procedures, teaching approaches, novel learning experiences, modern ways of communication and interactional patterns. The study is an effort to examine the role of technology in effectiveness or ineffectiveness of communication in online classroom, students and teachers participation in online class communication and communication issues that are faced by the students and teachers in distance learning classroom. The current study is based on qualitative descriptive case study approach. The sample for the study was purposively selected 20 students and 20 teachers from the Department of English Language and Literature, UOL, Lahore, Department of Linguistics and Communications, UMT Lahore, Department of Zoology, Kinnaird College for Women, Lahore and Department of Humanities, COMSATS Lahore. Equal number of students and teachers were chosen as respondents from each of the aforesaid universities. This study is embedded in the communication interpersonal theory of Coordinated Management of Meaning (CMM) by W. Barnett Pearce & Vernon Cronen (1980). The interviews data was categorized and organized into content themes for interpretation. This study provided an insight into students’ experiences and teachers’ perspectives while they communicate during online classes. The current study findings provided information about role of technology in effectiveness or ineffectiveness of communication in distance learning settings, reduction in student‐teacher and student‐student communication in online classes and problems that teachers and students faced when they communicate in online class. Keywords: Distance Learning, Online Class, Pedagogical Practices, Communication Problems, Learner‐Centered Approach, Coordinated Management of Meaning (CMM).
3. Mohsin, L. A., Asif, S., & Afzal, M. I. (2020). Comparative Analysis of Urdu and English Texts of “Subh‐e‐Azadi” by Faiz Ahmed Faiz. Research Journal of Social Sciences and Economics Review (RJSSER), 1(3), 129‐135. (Sadia Asif (CTL) Abstract: The translation of a poetic work is difficult because it needs to transfer poetic strategies, rhyme, and rhythm, and complex themes. Therefore, the translation lacks many structural and thematic features of the source text. The comparative translational analysis of a poem explores all these features and evaluates the translation in comparison to the source language (SL. The present study is the comparative analysis of Urdu text and English translated text of a milestone of “Subh‐e‐Azadi” by Faiz Ahmed Faiz, translated by Agha Shahid with the title “Dawn of Freedom” under the domain of Peter Newmark’s model of translation. The poem was written in the backdrop of the creation of Pakistan with the dominant theme of lack of accomplishment of the promised dawn of equality, justice, and freedom. This article is a comprehensive account of the comparative analysis of both texts of the poem about strategies and procedures of translation, thematic and structural variations, translation shifts or transpositions, transference of meanings, and semantic variations. Keywords: comparative analysis, translation, transposition, transference, independence. Research Outlook 2020 | 286
4. Mohsin, L. A., Afzal, M. I., & Asif, S. (2020). Communication Barriers of English Teachers and Students at Private and Public Sector Intermediate Colleges. International Review of Social Sciences (IRSS), 8(12), 1‐18. (Sadia Asif (CTL) Abstract: The purpose of this study is to statistically analyze the barriers to effective communication between English teachers and students in the classroom, which results poor imparting of knowledge as well as dull and less interactive classrooms. Effective Communication is a key to proficient teaching because it entails the process by which ideas, information, opinions, attitudes and skills are conveyed to students irrespective of the contents and methodology of teaching which become futile in case of poor communication. The present study finds out all those barriers with the research tool of a questionnaire in a survey research with a quantitative design in data collection but descriptive approach in its interpretation. The data was collected from all the English teachers working in private and public sector intermediate colleges of the District, Narowal. All the barriers were categorized into their domains and types in order to better understand them and devise appropriate strategies to tackle them. Moreover, in order to find out the difference of barriers between the public sector teachers and private sector teachers, the statistical calculation of demographic data was carried out. In the light of the study, suggestions and strategies were suggested accordingly to render guide lines for teachers and suggest appropriate teaching activities to redeem the effects these barriers. Keywords: Communication, English Teaching, Teacher‐Student Relationship, Communication Barriers. Office of Research Innovation and Commercialization (ORIC) Research Articles 1. Khan, M. N. A., Mirza, A. M., Wagan, R. A., Shahid, M., & Saleem, I. (2020). A Literature Review on Software Testing Techniques for Smartphone Applications. Engineering, Technology & Applied Science Research, 10(6), 6578‐6583. (Mahwish Shahid (ORIC) Imran Saleem (SPA) Abstract: Smartphone applications are getting popular and have become a necessity. There numerous smartphone applications ranging from entertaining to gaming and from utility to mission‐critical. Almost everything on the web is now in hands of Smartphone users, which makes this domain very important and its quality should not be compromised. Achieving the desired quality is not an easy task for the mobile platform as it has its limitations. To produce a quality app, developers and testers need to test and assess the app in numerous ways to ensure the best trait of the application. In this concern, some efficient and mature techniques are required to test smartphone applications. In this study, the techniques, approaches, and models to assess mobile apps covering major prospects and angels to test mobile apps are identified. Our focus is on assessing the existing techniques and to evaluate them on standard validation parameters. Keywords: android, model based testing, functional testing, app testing, functional refactoring.
2. Khan, M. N. A., Mirza, A. M., Shahid, M., Wagan, R. A., & Saleem, I. (2020). State of Quality Engineering Practices: The Pakistan Perspective. Engineering, Technology & Applied Science Research, 10(5), 6309‐6315. (Mahwish Shahid (ORIC) Imran Saleem (SPA) Abstract: This study analyzes the state of quality engineering practices being exercised in the software industry of Pakistan. Statistics have been collected and analyzed to access important aspects of quality engineering including quality policy, review mechanism, quality assurance activities and practices, quality standards and models, and quality management systems. For this purpose, an elaborated questionnaire was prepared to pertain to various aspects of quality management and more than 30 software houses and software development organizations were surveyed in Islamabad and Rawalpindi. The survey results and a description of the concluding remarks are reported in this paper.
Research Outlook 2020 | 287
Keywords: quality assurance, software testing, software quality models, software quality engineering, quality management system.
3. Saeed, M. I., Raza, S., & Ali, F. (2020). Economic Growth a Catalyst to Income Inequality: an Empirical Study of Russia. PalArch's Journal of Archaeology of Egypt/Egyptology, 17(4), 3092‐3102. (Muahmmad Ibrahim Saeed, Sidra Raza (ORIC) Faran Ali (IBF) Abstract: The main objective of the study is to empirically examinetheimpact of income inequalityon economic growthofRussianFederation. Annual time series data has been taken from 1988 to 2017. Phillips‐Perrontest isapplied to make the data stationary at level and first difference. ARDL Bound approach to cointegration is used to check the long run relationship between income inequality and economicgrowth. The long runand the short runresults show that there is a positive and significant impact of income inequality on economic growthof Russia. Furthermore, the error correction term(ecm)is statistically significant at 5% and has a negative sign. The value of ecm is ‐0.80which shows that 80% of the disequilibrium in the level of Gross Domestic Product (GDP)of the previous year’s shock adjust back to the long run equilibrium in the current year. Keywords: not available.
4. Saeed, M., Raza, S., & Ali, F. (2020). To Mull Remittance and Misery Index of Selected Asian Countries: A Panel ARDL Approach. International Review of Management and Business Research, 9(3). 157‐163. (Muahmmad Ibrahim Saeed, Sidra Raza (ORIC) Faran Ali (IBF) Abstract: The objective of the study is to empirically probe the impact of misery index on remittance. Six Asian countries have been selected for the period of 1980‐2016. The study uses panel ARDL approach with Cointegration. The results of Kao test shows that remittances and misery index are co‐integrated. Panel ARDL results show that misery index has a positive and significant impact on remittances in the long run but it is negative and insignificant in the short run. The results underpin the altruism theory in remittance sending behavior in the selected Asian countries. Remittance and unstable macroeconomic condition are directly proportional to each other in Asian developing countries. The government may scrutinize and determine the threshold level of instability otherwise the inflow of remittance might decrease. Keywords: Altruism, Ardl, Inflation, Misery Index, Remittance, Unemployment.
5. Naveed, M. A., Shaukat, R., & Anwar, M. A. (2020). Development and Validation of a Covid‐19 Literacy Scale. Library Philosophy and Practice (e‐journal). (Fall 10‐5‐2020). (Rozeen Shaukat (ORIC) Abstract: This research intended to develop and validate a Covid‐19 Literacy Scale (CLS). This study was conducted in two phases. In the first phase items were generated based on an extensive literature review, public advisory platforms, and public service messages related to Covid‐19. After that these statements were submitted to a panel of experts for content and face validity. While in the second phase, a cross‐sectional survey was conducted using students of three university from the province of Punjab, Pakistan for construct validity and reliability. An online questionnaire was administered among students with permission from the concerned authorities. A total of 369 responses received which were imported in SPSS for data analysis. The construct validity was assessed through exploratory factor analysis and the reliability of the instrument was determined using Cronbach alpha coefficient. The results indicated a 23‐items scale structured into two dimensions, namely, ‘infection spread and symptoms’ (11 items) and ‘infection prevention and treatment’ (12 items), Each statement had loading strengths greater than .56 and the model explained 66.6% of the total variance. The values of reliability coefficient for overall scale (CA = .970) as well as for both sub‐dimension such as ‘infection spread and symptoms’ (CA = .957) and ‘infection prevention and treatment (CA = .936) were great. The correlation coefficients of test retest ranged from 0.71 to .87 which also appeared at satisfactory level. Thus, the newly developed instrument appeared as a reliable and valid measure for Covid‐19 literacy assessment. This research Research Outlook 2020 | 288
would make a worthwhile contribution to health literacy in general and Covid‐19 literacy in particular as no such scale was available in the existing literature. Keywords: Covid‐19 pandemic, Health Literacy, Covid‐19 Literacy Scale, Pakistan.
6. Shaukat, R., & Naveed, M. A. (2020). Perceptions of Bankers towards Issues of Islamic Banking in Pakistan. Journal of Islamic Thought and Civilization, 10(2). 206‐222. https://doi.org/10.32350/jitc.102.12. (Rozeen Shaukat (ORIC) Abstract: This study intended to investigate the current issues in the regulation of Islamic banking from the perspective of Islamic bankers in Pakistan. A cross‐sectional survey of 165 bankers, recruited through stratified convenient sampling procedure, working at different Islamic banks in Lahore was conducted using a questionnaire. Descriptive statistics were applied using SPSS for data analysis. The results indicated that a large majority of the survey participants had postgraduate level of education, experience from 6‐15 years, and belonged to either middle management or senior management. These participants perceived that limited role of policy institutions, gap in theory and practice, poor perception of people about Islamic banking, lack of short‐ term and long‐term avenues, regulators’ preference of Shariah auditing rather than Shariah supervision, lack of financial services availability/branch networks, limited product offerings, non‐availability of IB courts to resolve disputes, non‐availability of research centres for Islamic banking, lack of trained staff, shortage of training opportunities and inadequacy of the curriculum for Islamic banking were the key issues faced by Islamic banking in Pakistan. However, the least issues that Islamic bankers faced were related to IB institutional and regulatory structures. The results generated evidence based pragmatic insights for policymakers and regulators in making strategic decisions for the development and growth of Islamic banking in Pakistan. This research makes a worthy contribution to the existing literature as no such study has addressed particularly the regulatory issues of Islamic banking in Pakistan. Keywords: challenges, Islamicbanking, Islamic finance, issues, Pakistan, regulations.
7. Naveed, M. A. & Shaukat, R. (2020). Assessing the Levels of COVID‐19 Literacy Among University Students. International Journal of Librarianship and Information Science (IJoLIS). 5. 1‐9. (Rozeen Shaukat (ORIC) Abstract: Purpose: This study assessed the levels of COVID‐19 literacy among university students in Pakistan. Design/methodology/approach: A cross‐sectional survey method was adopted using an online questionnaire for data collection. A total of 371 received questionnaires were analyzed by calculating the means, standard deviations, Pearson correlations, and t‐test. Research limitation(s): The results should be generalized with caution as study is not the representative of the whole university students’ community in Pakistan. Key finding(s): A large majority (83.3%) of students had COVID‐19 literacy at a sub‐optimal level as more than half of the sample exhibited literacy at moderate levels, followed by those having low levels. There was a statistically significant relationship of COVID‐19 literacy with the geographical background, which meant that the urban student had higher literacy as compared to rural students. Practical implication(s): These findings had serious implications for public health in Pakistan calling for an improvement in health education. The university and library administration should develop a need‐based mechanism to improve health literacy of students as they act as an agent of information delivery for those around them. Contribution to knowledge: It would be a worthy contribution to the existing literature on health literacy in general and COVID‐19 literacy in particular as limited research has been conducted so far. Keywords: COVID‐19 pandemic, health literacy, COVID‐19 literacy, university libraries, Pakistan.
8. Haq, N. U., Laeeq, H., & Usman, M. (2020). Association between Precious Metal Prices and UK Stock Market: The Case of FTSE 100 Index. Pakistan Journal of Multidisciplinary Research (PJMR). 1(1). 110‐126. (Naveed ul Haq, Hood Laeeq (ORIC)
Research Outlook 2020 | 289
Abstract: Stock market of a country is highly sensitive to the both external and domestic factors, and precious metal prices i.e. gold, silver,platinum, and palladium is one of those factors. In the recent years, the fluctuations in precious metal prices gained the attention of many analysts, scholars, and academicians. This study examines the association between precious metal prices and London largest stock market FTSE 100 index. The current study uses monthly time series data covering the period of 2000‐2016. Findings of this study reveal that there is a bivariate correlation exists among silver and gold, Platinum and gold and Platinum and silver, but no long run equilibrium exists among precious metal prices and UK stock market. Results of VAR model shows a significant and negative gold impact as well as platinum and palladium prices on FTSE 100 index in short run, while silver prices have no impact on UK stock market. Results of Granger Causality shows that all precious metal prices Granger Cause the FTSE 100 index in short run. Further, we apply impulse response function (IRF) after VAR model to observe the transmission dynamics of precious metal and stock market prices. Graphic results of impulse response function also tell us that silver prices have no effect of shock in the other variables prices. Considering the volatility dynamics of precious metals prices provides a guideline for rational investors for deciding how and where to invest during the times of low and high volatile regimes. Keywords: Precious metals, UK stock market, Vector autoregressive, model, Johansen Co Integration, Granger Causality, Impulse response, function.
9. Nasir, S., Arbi, K. A., Sheikh, L., & Javed, S. (2020). Measuring relative industrial innovation in relation to establishment’s co‐location and infrastructure accessibility, comparative industrial performance of Punjab. International Journal of Management (IJM), 11(12), 2378‐2389. doi: 10.34218/IJM.11.12.2020.225. (Sadiqa Nasir, Sana Javed (ORIC) Khalil Ahmad Arbi (SPA) Abstract: Mixed economies in developing countries face challenges and opportunities both for their co‐location. Co‐ location in developing countries is associated with dedicated infrastructural supply. The paper presents a logistic regression model to summarize the key predictors as contributors for innovation measures in firms. The data used in the study is taken from The World Banks’ Universal Enterprise survey data conducted for many countries. Scope of the study is the comparison of innovative measures introduction and practices in all industries except agriculture sector in Punjab, a province with most economical significance. Analysis shows that marketing innovation and spending on R&D are the key indicators primarily affected by co‐location as they have had higher odds ratio in the model analysis. Amongst infrastructure inequality electricity provision and use of electronic communication are important contributors to innovation practices in stakeholder’s view from manufacturing and services industry of Punjab Province. Keywords: logistic regression, innovative, Investment in R&D.
10. Alexander, S., Asghar, A. (2020). The Relationship among Teachers’ Self‐Efficacy Beliefs, Student Motivation and Effective Teaching. UMT Education Review, 3(2), 85–109. (Ali Asghar (ORIC) UMT JOURNAL Abstract: Student engagement is among the emerging discourses in education research. It is a significant factor in students' academic success and involves the student and the university's contributions. The literature extensively reports the studies that establish and explore the relationship between academic processes and student engagement; however, administrative processes are less focused. This study empirically tested the effect of administrative processes (admission, facilities management, counseling, and governance) and academic processes (teaching, learning, assessment & feedback, research & development) on student engagement. A survey instrument comprising 73 items was used to collect the data from 368 students of two private universities in Lahore, Pakistan. Except for the demographic fields, all items were gauged over a 7‐point Likert scale with 1‐7 (strong disagreement to the strong agreement). The reliability score of the pilot was 0.96, and of the final data, 0.92. Descriptive statistics were applied to explain the demographic characteristics of the sample. Smart PLS was used to draw structure equation models (SEM) by computing Partial Least Square (PLS) regression scores. Results Research Outlook 2020 | 290
have predicted strong and positive relationships between administrative processes, academic processes, and student engagement. PLS‐SEM showed that both administrative processes and academic processes almost equally affect student engagement. The discussion of results revealed that administrative processes, though equally important as academic processes, but previous research shows less focus on it. The study concluded that emotional engagement is the least focused area by the administration as well as academia. The study suggests the private universities in Lahore to focus on improving their focus on developing emotional engagement of their students to reap loyalty and organizational commitment of their students. Keywords: academic process, administrative process, private universities, student engagement.
Conference Proceedings 1. Haq, N. U., Ullah, R., & Todeva, E. (2020). From R&D to Innovation and Economic Growth: An Empirical‐ Based Analysis from Top Five Most Innovative Countries of the World. Proceedings of the II International Triple Helix Summit, Lecture Notes in Civil Engineering 43, Springer Nature Switzerland AG. (Naveed ul Haq (ORIC) Abstract: This paper discusses the linkage between innovation and the economic growth of a country and what are the factors that shape largely the technology and technological advances of a country. We look at the effect of innovation policies in Pakistan on developing the innovation system and on innovation spillover effects at organizational and institutional levels.The present study undertakes the world’s most innovative countries for finding the relationship between R&D, innovation and economic growth. Among the countries discussed are Sweeden, Switzerland, and the United Kingdom. Keywords: R&D, Innovation, Economic growth, GMM, Innovative countries of the world.
Conference Paper 1. Sadiq, R., Younas, K. & Nosheen, S. (2020). Impact of Enterprise Risk Management on Firm Value. Paper presented at the Second International Conference on Business and Entrepreneurship Research (ICBER), The Islamia University of Bahawalpur, Pakistan 20‐21 Feb 2020. (Ramla Sadiq, Kinza Younas, Safia Nosheen (ORIC) Abstract: The purpose of this study is to investigate the relationship between ERM (crediting) ratings and firm’s value and to examine whether the implementation of ERM increases financial performance.In this study, we used available credit rating as an alternative for each country because SAARC (Pakistan, India, Bangladesh, and Sri Lanka) countries do not have S&P credit rating. For analysis purpose, we used a Dynamic panel data model, and to deal with the endogeneity issue GMM (Generalized Method of Moments) is used. Theories are tested by using the System GMM (SGMM). The value of Q is the highest in Sri Lankan firms. Similarly, the ERM‐score has the highest mean score for Pakistani firms followed by India, Bangladesh, and Sri Lanka. For the ROE, the indications of the assessed coefficients are positively significant in all samples. ROE is considered to be more vital, thus ROE upgrades their valuation. Furthermore, with the help of analysis, we came to know the effect of credit rating and other firm control variables on ROA. The ERM‐score and ROA are found to have positive and measurably notable values. The peripheral impacts show that an increase of one score in rating score results in a normal rise of 0.34 in Pakistani, 0.02 in Indian, 0.0083 in Bangladeshi, and 0.0087 in Sri Lankan firms. Keywords: not available.
2. Shaukat, R. (2020). Current Issues in Islamic Banking Regulations: A Bankers’ Perspective. Paper presented at the in 5th Global Forum on Islamic Economics, Finance and Banking (IEFB) on March 11‐ 12, 2020. UMT, Lahore. (Rozeen Shaukat (ORIC) Abstract: Not available. Keywords: not available.
Research Outlook 2020 | 291
Institute of Islamic Perspective and Guidance (IIPG) Research Articles 9. Hanna‐e‐Kalbi, Basharat, T. 2020. A Comparative Study of the Personality Formulates of Ghazali and Freud. Journal of Islamic Thought and Civilization, 10, (2). https://doi.org/10.32350/jitc.102.13. (Hanna‐e‐Kalbi (IIPG) Tahira Basharat (ITC/SSSH) Abstract: This research is a comparative study of the types of nafs and the types of personality described by Ghazali and Freud, respectively. Types of personality described by Ghazali are al‐nafs al‐ammara, al‐nafs al‐ lawwama and al‐nafs al‐mutma'inna. The types of personality according to Freud are id, ego and super‐ego. Other faculties that help in training or shaping the types of nafs are rooh (soul), qalb (heart), and aql (mind). They also play a vital role in the functioning of id, ego and super‐ego. This article defines the above mentioned types of personality presented by both Ghazali and Freud. It also discusses their functions encompassing their differences and similarities and strives to find out if they complement each other. It was found that there is much similarity in both types of personality formulates. Id and nafs ammarah are the same, while nafs lawwama was found to be comprising both ego and super‐ego. However, the concept of nafs mutma’innah is found only in Islamic theology. Thematic and comparative study methods of qualitative research were used in this research. This is a literature based study. Ghazali’s study is based on the Qur’an and Sunnah. Hence, Ihya’ ‘Uloom‐id‐Deen and The Ego and The ID remain the major sources of this study. Keywords: The Qur’ān, Sunnah, ID, ego and super‐ego, nafs, nafs ammara, nafs lawwama, nafs mutma'inna.
Research Grand
1. Hussain, A. (2020). Identification, characterization and functional analysis of resistance genes in cotton. University of Management and Technology, Lahore ‐ Pakistan International Foundation for Science, 12000 USD. (Athar Hussain (Life Sciences/SSC)
library.umt.edu.pk
Research Outlook 2020 | 292
Summary of UMT Research Outlook 2020
Table I School/Department wise listing of Publications School\Departments Articles Proceeding Conference Books/Book Total Papers Papers Chapter
School of Sciences (SSC)
Department of Mathematics 147 1 2 1 151
Department of Life Science 56 2 3 61
Department of Chemistry 36 2 38
Department of Physics 16 16
Total 255 3 4 4 266
School of System & Technology (SST)
Department of Computer Science 65 4 69
Department of Software Engineering 2 8 10
Departments of Informatics & Systems 11 6 17
Total 78 18 96
School of Engineering (SEN)
Department of Mechanical Engineering 3 3
Department of Electrical Engineering 6 6 2 14
Department of Industrial Engineering 5 5
Department of Civil Engineering 12 1 13
Total 26 7 2 35
School of Business and Economics (SBE)
Department of Management 18 3 1 22
Department of Operations & Supply 5 5 Chain
Department of Information Systems 3 3
Department of Marketing 10 2 12
Research Outlook 2020 | 293 Department of Economics 38 8 3 49
Department of Quantitative Methods 4 4
Department of Finance 11 1 12
Department of Banking and Finance 5 5
Total 94 5 9 4 112
School of Social Sciences & Humanities (SSSH)
Department of Political Science & 15 5 20 International Relations Department of Sociology 3 3
Department of Special Needs Education 2 2
Department of Education 41 41
Department of Gender Studies 5 1 6
Department of Islamic Thought & 8 8 Civilization
Total 74 6 80
School of Health Science (SHS)
SHS 6 1 7
Total 6 1 7
School of Food and Agricultural Sciences (SFAS)
SFAS 27 1 28
Total 27 1 28
School of Textile & Design (STD)
STD 5 5
Total 5 5
Institute of Liberal Arts (ILA)
Department of Linguistics & 22 8 30 Communications
Department of English & Literary 3 3 Studies
Research Outlook 2020 | 294 Total 25 8 33
School of Professional Psychology (SPP)
Department of Clinical Psychology (DCP) 24 2 26
Department of Applied Psychology 7 2 9
Total 31 4 35
School of Professional Advancement (SPA)
SPA 11 1 5 1 18
Total 11 1 5 1 18
School of Commerce and Accountancy (SCA)
SCA 6 1 7
Total 6 1 7
School of Law and Policy (SLP) SLP 2 2 Total 2 2 School of Media and Communication Studies (SMCS)
SMCS 28 28
Total 28 28
School of Governance and Society (SGS)
SGS 1 1 Total 1 1
School of Architecture and Planning
Department of Architecture 10 10
Department of City and Regional 3 3 Planning Total 13 13
Institute of Aviation Studies (IAS) Department of Aviation Studies 1 1 2
Total 1 1 2 Center for Teaching and Learning (CTL) CTL 4 4
Total 4 4
Research Outlook 2020 | 295 Office of Research Innovation and Commercialization (ORIC) ORIC 10 1 2 13
Total 10 1 2 13 Institute of Islamic Perspective and Guidance (IIPG) IIPG 1 1 Total 1 1 Grand Total 698 36 41 11 786
Research Outlook 2020 | 296