Mirna-92A Promotes Cell Proliferation and Invasion Through Binding to KLF4 in Glioma
Total Page：16
File Type：pdf, Size：1020Kb
European Review for Medical and Pharmacological Sciences 2019; 23: 6612-6620 MiRNA-92a promotes cell proliferation and invasion through binding to KLF4 in glioma P.-J. LIU1, Y.-X. YE2, Y.-X. WANG3, J.-X. DU4, Y.-H. PAN5, X.-B. FANG6 1Department of Oncological Radiotherapy, the Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, China 2Department of Neurology, Jinan Zhangqiu District Hospital of TCM, Jinan, China 3Department of Medical Information Management, The People’s Hospital of Zhangqiu Area, Jinan, China 4Department of Neurology, The People’s Hospital of Zhangqiu Area, Jinan, China 5Imaging Department, Affiliated Yantai Yuhuangding Hospital of Qingdao University, Yantai, China 6Department of Neurosurgery, Central Hospital of Zibo, Zibo, China Abstract. – OBJECTIVE: Glioma is one of the Introduction most frequent brain tumors in adults, and it has a low 5-year survival rate. MicroRNA-92a (miR- Glioma is one of the most frequent brain tu- 92a) has been reported to be upregulated and mors in adults, which originated in precursors acted as an oncogene in many cancers. The pur- 1,2 pose of this study was to explore the molecular and glial cells . The 5-year overall survival rate mechanisms of miR-92a and kruppel-like factor of glioma is less than 10%, due to the extensive 4 (KLF4) in glioma. intracranial invasion and aggressiveness3,4. The PATIENTS AND METHODS: Western blotting effect of traditional treatments is still poor; there- assay and quantitative Real Time-Polymerase fore it is necessary to explore the mechanisms Chain Reaction (qRT-PCR) were applied to cal- and potential pathways for glioma prevention and culate the relative expression of interest pro- teins and mRNAs. Luciferase ability assay was clinical treatment. conducted to evaluate whether miR-92a was MicroRNAs (miRNAs), a type of endogenous targeting to KLF4. short non-coding RNA, could degrade or inhibit RESULTS: A higher expression of miR-92a mRNA translation by binding to the comple- was observed in glioma tissues compared with mentary sequences on the 3’-untranslated region the corresponding adjacent non-tumor tissues. (3’UTR) of target mRNA at post-transcriptional The upregulation of miR-92a predicted poor level5,6. Accumulating evidence indicated that prognostic characteristics of glioma. The over- expression miR-92a significantly promoted cell miRNA acted as an oncogene or tumor suppres- proliferation an invasion, while the knockdown sor, and regulated tumor process in various sides of miR-92a presented the opposite results. MiR- including cell proliferation, differentiation and 92a bound to KLF4 and mediated the expres- apoptosis7,8. MiR-92a has been reported to be an sion of KLF4 in glioma cells. The knockdown of oncogene in multiple of tumors, including naso- miR-92a inhibited cell invasion-mediated EMT. pharyngeal carcinoma, non-small cell lung can- Furthermore, the knockdown of miR-92a sup- 9-12 pressed cell proliferation through the KLF4/ cer, cervical and endometrial cancers . In non- AKT/mTOR signal pathway. small cell lung cancer, miR-92a has been reported 13 CONCLUSIONS: MiR-92a promoted the pro- to upregulate and promote the cell proliferation . liferation through the KLF4/AKT/mTOR signal Furthermore, miR-92a has been reported to sig- pathway in glioma. The newly identified miR- nificantly promote the cell viability and invasion 92a/KLF4/AKT/mTOR axis provides novel in- in cervical cancer14. Thus, we strongly believe that sight into the pathogenesis of glioma. miR-92a might play a great role in tumorigenesis and metastasis. Key Words Kruppel-like factor 4 (KLF4) belongs to the MiR-92a, Glioma, KLF4, Invasion, Proliferation. Kruppel family; it is thought to control the G1-to- 6612 Corresponding Author: Xinbo Fang, MD; e-mail: [email protected] Role of MiRNA-92a in glioma S transition of the cell cycle following DNA dam- siently transfection miR-92a mimic or inhibitor age by mediating the tumor suppressor gene p5315. were harvested after culturing for 48 h. Whereas, In colorectal cancer, KLF4 has been reported to the stable transfection cells were transfected with downregulate and inhibit the cell proliferation the plasmid containing miR-92a mimic or control through the NDRG2 signaling16. In non-small cell fragment and then selected by Geneticin (G418; lung cancer, KLF4 could activate the c-Met/Akt Thermo Fisher Scientific, Waltham, MA, USA). signaling pathway by decreasing the inhibition of The sequences for miR-92a were as follows: mim- β-Catenin on phosphorylation of c-Met to prevent ic sense, UAUUGCACUUGUCCCGGCCUG; in- blockade by gefitinib17. hibitor CAG GCC GGGACA AGU GCA AUA. RNA Extraction and Quantitative Patients and Methods Real Time-Polymerase Chain Reaction (qRT-PCR) Patients and Tissue Samples TRIzol reagent (Invitrogen, Carlsbad, CA, Glioma tissues and corresponding adjacent USA) was conducted to extract total RNA, which non-tumor tissues were obtained from 50 glioma contains miRNA and mRNA. PrimeScript RT patients who has been treated with surgery at the Reagent Kit (TaKaRa, Otsu, Shiga, Japan) was Affiliated Yantai Yuhuangding Hospital of Qing- applied to carry out the first cDNA chain syn- dao University from January 2015 to December thesis. QuantMir RT Kit (System Biosciences, 2017. All the patients did not accept any treat- Mountain View, CA, USA) and Real-time PCR ment before the surgical operation. All the speci- Mixture Reagent (TaKaRa, Otsu, Shiga, Japan) mens were snapped frozen in liquid nitrogen and were employed to perform qPCR of miR-92a and stored at -80°C. The study protocol was approved KLF4 expression under ABI 7900 Sequence De- by the Ethics Committee of the Affiliated Yantai tection System (Life Technologies, Gaithersburg, Yuhuangding Hospital of Qingdao University and MD, USA) with enzyme activation at 95°C for 5 all the patients provided informed consent before min, followed by 40 cycles at 95°C for 5 s and specimen collection. 60°C for 20 s, and a final extension at 65°C for 15 s. The internal reference of miRNAs and mRNAs Cell Line and Cell Culture were U6 and glyceraldehyde 3-phosphate dehy- The normal immortalized gliocyte HEB and drogenase (GAPDH), respectively. The relative two glioma cells (LN18 and LN229) were pur- expression was calculated in accordance with the chased from the American Type Culture Collec- 2-ΔΔCt method. The primers are: miR-92a forward: tion (ATCC, Manassas, VA, USA). Roswell Park 5’-CACCTATATTGCACTTGTCC-3’, reverse: Memorial Institute-1640 (RPMI-1640) medium 5’-TGCGTGTCGTGGAGTC-3’; U6 forward: (Gibco, Grand Island, NY, USA) were conducted 5’-CGCTTCGGCAGCACATATAC-3’, reverse: to culture all the cells, which were supplemented 5’-TTCACGAATTTGCGTGTCAT-3’; KLF4 For- with 10% fetal bovine serum (FBS; Gibco, Grand ward TTCCCATCTCAAGGCACAC, Reverse Island, NY, USA) stored at 37°C containing 5% : GGTCGCATTTTTGGCACT; GAPDH forward, CO2. 5’-GGTGGTCTCCTCTGACTTCAACA-3’ and reverse 5’-GTGGTCGTTGAGGGCAATG-3’. Vectors and Cell Transfection MiR-92a mimic, miR-92a inhibitor and cor- Protein Extraction and Western Blot responding miRNA control oligo were purchased Radioimmunoprecipitation assay (RIPA) Ly- from GenePharma (Shanghai, China). LN229 sis Buffer (ProMab Biotechnology, Richmond, cells were seeded into 6-well plate and cultured CA, USA) containing protease inhibitor (Thermo 12 h with 80% confluence. The transfection re- Fisher Scientific, Waltham, MA, USA) was used to agent and vectors were diluted by Opti-MEM/ isolate and extract total proteins on ice. After be- Reduced serum medium (Thermo Fisher Scien- ing centrifuged at 12,000 g for 20 min, the protein tific, Waltham, MA, USA) and mixed. The mix- lysate with equal amount was separated by 10% ture was then added in the 6-well plate and cul- sodium dodecyl sulphate-polyacrylamide gel elec- tured at 37°C incubator. The transfections were trophoresis (SDS-PAGE) gel. The proteins were performed using Lipofectamine 2000 Reagent electro-transferred onto polyvinylidene difluoride (Invitrogen, Carlsbad, CA, USA) according to (PVDF) membranes (Roche, Basel, Switzerland), the manufacturer’s protocol. The cells with tran- and then blocked in 5% bovine serum albumin 6613 P.-J. Liu, Y.-X. Ye, Y.-X. Wang, J.-X. Du, Y.-H. Pan, X.-B. Fang (BSA) for 1 h at room temperature. Subsequently, 48 h, 72 h, and 96 h. After incubation for 4 h at the membranes were incubated with antibodies 37°C, the medium was removed and was added against KLF4 (1:1000, Abcam, Cambridge, MA, 150 μL DMSO into each well. The absorbance USA; ab75486), p-AKT (1:1000, Abcam; ab8933), at 490 nm was measured on a microplate reader AKT (Cell Signaling Technology, Danvers, MA, (BioTek, Winooski, VT, USA). USA; #9272), p-mTOR (1:500, Santa Cruz Bio- technology, Santa Cruz, CA, USA; sc-293133), Transwell Assays mTOR (1:1000, Abcam, Cambridge, MA, USA; Transwell inserts (Corning Incorporated, ab32028), E-cadherin (1:1000, Abcam, Cambridge, Corning, NY, USA) covered with Matrigel (BD MA, USA; ab15148), N-cadherin (1:1000, Abcam, Biosciences, Franklin Lakes, NJ, USA) were Cambridge, MA, USA; ab18203) and Vimentin placed in 24-well plate and conducted lower and (1:1000, Abcam, Cambridge, MA, USA; ab8978) at upper two chambers. A total of 5×105 LN229 cells 4°C overnight. Then, the anti-rabbit IgG, horserad- resuspended by 200 μL RPMI-1640 medium free ish peroxidase (HRP) conjugated-linked antibody FBS were seeded into the upper chambers. The (Cell Signaling Technology, Danvers, MA, USA; lower chambers were filled with 500 μL nor- #7074) incubated the membranes for 2h at room mal RPMI-1640 medium containing 15% FBS temperature. Enhanced Chemiluminescence Kit served as chemoattractant. After incubating 48 h (ECL; Thermo Fisher Scientific, Waltham, MA, at 37°C humidified incubator with 5% CO2, the USA) was conducted to perform the interest pro- non-invaded cells were removed by cotton swabs, teins and exposed on Molecular Imager ChemiDoc whereas invaded cells were fixed by paraformal- XRS System (Bio-Rad, Hercules, CA, USA). dehyde and stained by crystal violet.