CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007)

Post-transcriptional Control of the MCT-1-associated DENR/DRP by RNA-binding Protein AUF1

KRYSTYNA MAZAN-MAMCZARZ and RONALD B. GARTENHAUS

University of Maryland, Marlene and Stewart Greenebaum Cancer Center 9-011 BRB, 655 West Baltimore Street, Baltimore, Maryland 21201, U.S.A.

Abstract. Background: There is often a poor correlation bind to discrete regions of DENR/DRP mRNA and that AUF1 observed between protein and RNA in eukaryotic systems, silencing increases DENR/DRP protein levels. Conclusion: Our supporting the emerging paradigm that many of the data established a cell density-dependent interaction of AUF1 abnormalities in a cancer cell’s proteome may be achieved by protein with DENR/DRP mRNA that modulates DENR/DRP differential recruitment of mRNAs to polysomes referred to as protein levels. the translational profile. The MCT-1 oncogene product has recently been shown to interact with the cap complex and to The MCT-1 oncogene product initially identified in a modulate the translational profile of cell lines when MCT-1 human lymphoma cell line and mapped to was highly expressed. The MCT-1 protein modifies mRNA Xq22-24 (1) has recently been shown to interact with the translational profiles through its interaction with DENR/DRP, cap complex and to modulate the translational profile of a protein containing an SUI1 domain involved in recognition both human lymphoma and embryonic kidney cell lines of the translation initiation codon. It has been shown when MCT-1 was highly expressed (2) There is often a poor previously that the protein levels of DENR/DRP go up in correlation observed between protein and RNA in parallel with increasing cell density, however the mechanism(s) eukaryotic systems (3, 4), supporting the emerging paradigm underlying this increase is poorly understood at present. The that many of the abnormalities in a cancer cell’s proteome 3’-untranslated region (3’UTR) of DENR/DRP was found to may be achieved by differential recruitment of mRNAs to have a high number of uracyl (U)- and adenine (A)-rich polysomes referred to as the translational profile (5). The sequences (AREs). Many RNA-binding (RBPs) have MCT-1 protein modifies mRNA translational profiles been shown to recognize and bind to mRNAs that contains through its interaction with DENR/DRP, a cell density AREs generally present in the 3’UTR of mRNAs. RBPs binding regulated protein containing an SUI1 domain involved in to AREs such as AUF1, BRF1, KSRP, and TTP are known to recognition of the translation initiation codon (2, 6). A regulate mRNA turnover, while TIAR and TIA-1 influence model for how MCT-1 transforms cells has recently been mRNA translation. Materials and Methods: We assessed the proposed in which MCT-1 bound to DENR/DRP binds to association of several ARE binding proteins with DENR/DRP the cap complex with enhanced translation initiation of mRNA by reverse transcription of the RNA obtained after target mRNAs by scanning and recognition of the initiation immunoprecipitation of cell lysates from HEK 293 cells codon through its SUI1 domain (2). It has been growing at varying levels of cell density. HEK 293 cells were demonstrated in previous work (7) that the protein levels of transfected with an AUF1 silencing vector (shRNA), and DENR/DRP go up in tandem with increasing cell density of protein levels of DENR/DRP were analyzed by Western tumor cell lines. This increase in DENR/DRP protein level blotting. Results: We demonstrated that both HuR and AUF1 may be related to the altered translational profiles seen in the transformed phenotype (8, 9). The mechanism(s) underlying the increase in protein level of DENR/DRP is poorly understood at present. Post- Correspondence to: Ronald B. Gartenhaus, University of Maryland, transcriptional regulatory processes such as RNA Marlene and Stewart Greenebaum Cancer Center 9-011 BRB, 655 splicing and maturation, mRNA transport, stability, and West Baltimore Street, Baltimore, Maryland 21201, U.S.A. Tel: translation are becoming increasingly recognized as critical +410 328 3691, Fax: +410 328 6559, e-mail: rgartenhaus@ som.umaryland.edu mechanisms of gene regulation in mammalian cells. These control mechanisms are primarily governed by RNA-binding Key Words: MCT-1 oncogene, post-transcriptional control, proteins (RBPs) that associate with mRNAs and regulate DENR/DRP, AUF1, RNA-binding protein. their processing (10). Many RBPs have been shown to

1109-6535/2007 $2.00+.40 233 CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007) recognize and bind to mRNAs that contains uracyl (U)- or PCR analysis of mRNAs. RNA from IP material was reverse adenine (A)-rich sequences (known as AREs) generally transcribed by using random hexamers/oligo(dT) mixture and present in the 3'-untranslated regions (3’UTRs) of mRNAs Superscript II Reverse Transcriptase (Invitrogen) and subjected to both conventional PCR and quantitative real-time PCR (qPCR) (11). AREs have been described in 3’UTRs of mRNAs analysis using gene-specific primer pairs: 5’TCTCGAACTC encoding cell cycle regulatory proteins, cytokines, CTGACCTCGT and 3’GGTGAGGAAGCCAAATTCAA for oncogenes, tumor suppressor , transcription factors DENR mRNA and, 5’CGGAGTCAACGGATTTGGTCGTAT and and growth factors (12, 13). RBPs binding to AREs such as 3’AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA. AUF1, BRF1, KSRP, and TTP have been shown to regulate Negative control reactions were prepared in parallel without the mRNA turnover, while TIAR and TIA-1 influence mRNA addition of reverse transcriptase. Each reaction was performed in translation (14-19). HuR and Hu-related proteins can be triplicate, and three independent reactions were run simultaneously. GAPDH cDNA served as the internal control. PCR products were involved in controlling both the stability and translation of visualized by electrophoresis in 1% ethidium bromide-stained ARE-mRNAs (20-23). agarose gels. The BioRad iCycler and iQ SYBR Green supermix Recently, in recognition of RBPs influence on the (BioRad) was used to carry out the qPCR analysis. expression of genes that are essential to key cellular functions including stress response, and tumorigenesis, they Biotin pull-down assays. PCR fragments containing the T7 RNA have become the focus of intensive investigation. Since polymerase promoter sequence (CCAAGCTTCTAATACGACTC DENR/DRP is a recently described translational regulatory ACTATAGGGAGA (T7)) were used as templates for in vitro transcription of DENR fragments – the DENR 5’-untranslated molecule containing the important SUI1 domain we sought region (5’UTR), DENR coding region (CR) and different fragments to further examine its regulation. Here, we demonstrate that of 3’-untranslated region (3’UTR) – using biotinylated CTP. Primers both HuR and AUF1 RBPs interact with DENR/DRP used for the amplification of DENR transcripts were following: (T7) mRNA. The data presented establish a cell density- CGGGGAGACGAGTTGCAT and CCCCGCTGGATTCAGA dependent interaction of AUF1 protein with DENR/DRP AAT for 5’UTR, (T7) GTTTGTGAAATGGCTGCTGA and mRNA that modulates DENR/DRP protein levels. CCAAGATCTTCGATGCTGTC for CR, (T7) AAGAAGTGAA TTTGAAAATTTGTCTG and CGCCTGTAATCCCACCTACT Materials and Methods for 3’A, (T7) AGTGATTCTCCTGCCTCAGC and CATAAGTTTT ATGCAAGGCTGATT for 3’B, (T7) GAACCAGTAAGCCACT TCTTTGA and TTCAAGATTGTAATTTGCATGG for 3’C, (T7) Cell culture and transient transfections. Human embryonic kidney HEK AGAACCCATGGAACCCTTG and GGAGACCAGGTTTTACT 293 cells were cultured in Dulbecco's modified essential medium GTTGC for 3’D. Two micrograms of biotinylated transcripts was (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal incubated with 40 Ìg of cytoplasmic lysate for 30 min at 25ÆC. bovine serum and antibiotics. Cells were plated at 20% (low), 60% ~ Complexes were isolated with paramagnetic streptavidin-conjugated (middle) and 95% (high) confluences, and collected for analysis ~ Dynabeads (Dynal), and the pull-down material was analyzed by after 24hrs. Plasmids used to silence AUF1 (pSILENCER-AUF1) Western blotting. and a corresponding control vector (pSILENCER) were generous gifts from Dr. M. Gorospe (NIA, Baltimore, MD). Transfections Western blot analysis. For Western blot analysis, 20 Ìg of total or were performed using Lipofectamine 2000 (Invitrogen). Cells were 30 Ìg of cytoplasmic proteins were resolved by electrophoresis in then collected for analysis 72 hrs after transfection; experiments were SDS-containing polyacrylamide gels and transferred onto performed three times independently. polyvinylidene difluoride (PVDF) membranes. Blots were probed with monoclonal antibodies recognizing DENR/DRP (BD Immunoprecipitation (IP) of ribonucleoprotein (RNP) complexes. IP of Pharmingen), HuR, ·-tubulin (Santa Cruz Biotechnology, Inc.), ‚- RNP complexes, were used to assess the association of endogenous Actin (Abcam, Cambridge, UK), or AUF1 polyclonal antibody ARE binding proteins (HuR, AUF1, TIAR, and TIA-1) with (Upstate Biotech.). Following incubation with appropriate endogenous DENR/DRP mRNA and were carried out as described secondary antibodies, signals were detected with enhanced previously (22, 24, 25). Briefly, 20x106 HEK 293 cells were harvested chemiluminescence. at low, medium and high density culture conditions and lysed in cytoplasmic lysis buffer containing 20 mM Tris-HCl (pH 7.5), 100 Results and Discussion mM KCl, 5 mM MgCl2, 0.3% IGEPAL CA-630, RNaseOUT and protease inhibitor cocktail. After 5 min incubation on ice, and centrifugation the supernatant (3 mg) was incubated (1 h, 4ÆC) with DENR/DRP mRNA associates with ARE binding proteins 100 Ìl of a 50% (v/v) suspension of Protein-A Sepharose beads HuR and AUF1. We recently demonstrated that MCT-1 and precoated with 30 Ìg IP antibodies of the following: anti-HuR, anti- DENR/DRP interact with the translation machinery, and TIAR, anti-TIA-1 [Santa Cruz Biotech.], and anti-AUF1 [Upstate are found in the same RNP sedimentation fraction as the Biotech.], or control immunoglobulin IgG (BD Pharmingen]). Beads eIF4E and eIF2 components of the translation initiation were then washed with NT2 buffer (50 mM Tris-HCl [pH 7.4], 150 complex (2). The SUI1 domain has a secondary structure mM NaCl, 1 mM MgCl2, and 0.05% Nonidet P-40) and incubated (20 min, 55ÆC) in 100 Ìl NT2 buffer containing 0.1% SDS and 0.5 mg/ml fold corresponding to that of a number of ribosomal Proteinase K. RNA was extracted using phenol and chloroform proteins and RNA-binding domains. The function of SUI1 method in the presence of GlycoBlue (Ambion). in eIF1 is to scan along the mRNA to locate the initiation

234 Mazan-Mamczarz and Gartenhaus: Regulation of DENR/DRP by RNA-binding Protein AUF1

Figure 1. Sequence of DENR/DRP mRNA, depicting U-rich and AU-rich sequences (red) in DENR/DRP 3’-untranslated region (3’UTR).

codon and to discriminate between cognate and noncognate TIAR, and TIA-1) with DENR/DRP mRNA by reverse initiation codons. The protein levels of MCT-1 appear to be transcription of the RNA obtained after immuno- mediated in part by its phosphorylation state induced precipitation (IP) of HEK 293 cell lysates and PCR analysis through the RAF/MEK/ERK signaling pathway (26). as described (22). We found that both HuR and AUF1 However, there is scant data related to the regulation of significantly bind endogenous DENR/DRP mRNA (17-fold DENR/DRP protein levels. We were interested in and 10-fold enrichment, respectively) compared to the investigating potential mechanism(s) for regulating levels of abundance of DENR\DRP mRNA in the control IgG IP DENR/DRP protein. In order to pursue this we examined samples (Figure 2). No significant binding was observed the DENR/DRP mRNA sequence. The presence of a when assessing the presence of additional AREs RBPs, relatively long (~2,300 bp) DENR/DRP 3’-untranslated TIAR and TIA-1. HuR binds to target mRNAs containing region (3’UTR) with a high number of U-rich and AU-rich AREs and alters their expression by either enhancing their sequences (AREs) (red) suggested to us that the stability, modulates translation, or both (20-22). AUF1 DENR/DRP mRNA was suitable for interaction with RBPs (hnRNP D), the ARE-binding protein preferentially (Figure 1). This prompted us to explore further the localized in the nucleus is expressed as a family of four regulation of DENR/DRP vis a vis its interaction with protein isoforms (p37, p40, p42, and p45) arising through RNA-binding proteins (RBPs) (see below). pre-mRNA alternative splicing (28). All isoforms enhance AREs are emerging as critical post-transcriptional transcript destabilization causing decay of target mRNAs regulatory sequences with mounting data linking mRNA (29). Both HuR and AUF1 bind mRNAs encoding cell cycle turnover with translation (27). We directly assessed the regulatory factors, growth factors, cytokines, oncoproteins association of several ARE binding proteins (HuR, AUF1, and, stress response proteins (11, 30).

235 CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007)

however, not to the 5'UTR and coding region. There is a sequence overlap observed in the 3’B fragment that binds both HuR and AUF1. While previous work has shown that endogenous HuR and AUF1 are capable of associating with the same target RNAs on nonoverlapping sites (24), the binding of both HuR and AUF1 to the same sequence is a novel finding. This last piece of data suggests that both proteins do not compete for binding to DENR/DRP 3’UTR, but may bind simultaneously to the ENR\DRP mRNA. Further investigation is ongoing in our laboratory in order to determine the functional significance of this simultaneous interaction with DENR\DRP mRNA. DENR/DRP protein level goes up with increasing cell density and is associated with decreased binding of AUF1 to DENR/DRP mRNA. In the last several years it has become clear that the efficiency of expression of key proteins involved in cell growth regulation, proliferation or cell death may be controlled at the translational level by changes in the activity of components of the protein synthesis machinery (31, 32). It is well established that starvation or lack of nutrients impairs protein synthesis in mammalian cells and tissues. While global inhibition of protein synthesis is a common response to stress conditions, there is a subset of mRNAs whose translation is enhanced during low nutrient state such as high-density growth conditions. In response to environmental stresses, a family of protein kinases phosphorylates eIF2 to alleviate cellular injury or alternatively induce apoptosis. Phosphorylation of eIF2 reduces global translation, allowing cells to conserve Figure 2. HuR and AUF1 bind endogenous DENR/DRP mRNA. The resources and to initiate a reconfiguration of gene association of endogenous ARE binding proteins (HuR, AUF1, TIAR, and expression to effectively manage stress conditions (33). TIA-1) with endogenous DENR/DRP mRNA was assessed by reverse transcription of the RNA obtained after IP of HEK 293 cell lysates by Accompanying this general protein synthesis control, eIF2 using either control (IgG) or specific antibodies. RT reaction was followed phosphorylation induces translation of specific mRNAs, by either conventional PCR (left) visualized after electrophoresis in which assist in the regulation of genes involved in ethidium bromide-stained agarose gels or qPCR (right) depicting the metabolism, the redox status of the cells and apoptosis (33). means from three independent experiments. Background amplification of We observed that the levels of DENR/DRP protein are GAPDH in the IP material was used as normalization control. increased commensurate with increasing cell density (Figure 4) as reported in an earlier publication (7). This change in DENR/DRP protein level did not appear to be related to HuR and AUF1 bind to distinct sites of DENR/DRP 3’UTR. cell cycle phase (data not shown). Since DENR/DRP Both HuR and AUF1 have been shown to recognize and mRNA interacts with the ARE binding proteins HuR and bind to mRNAs that contains U-rich or A+U-rich AUF1 under basal conditions, we asked whether there was sequences (AREs) generally present in the 3'-untranslated a differential association with either or both of these ARE regions of mRNAs (11). In order to precisely determine the binding proteins under high density growth conditions. sites of interaction of DENR/DRP mRNA with both HuR Several studies support the notion that post-transcriptional and AUF1 we used pull down assays to assess the ability of events may provide principal mechanisms to control the endogenous HuR and AUF1 to bind discreet biotinylated expression of critical genes in response to cellular stresses DENR/DRP transcripts as previously described (25). For (34-36). AUF1 enhances transcript destabilization causing this purpose, several biotinylated transcripts spanning the decay of target mRNAs (29). Under varying cellular density DENR/DRP mRNA regions (Figure 3, schematic) were conditions we examined the association of endogenous AUF1 synthesized (see Materials and Methods). As shown in with endogenous DENR/DRP mRNA by reverse Figure 3, HuR and AUF1 specifically bind in vitro to distinct transcription of the RNA obtained after IP of cell lysates sites of biotinylated DENR/DRP 3’UTR transcripts from synchronized HEK 293 cells as previously described

236 Mazan-Mamczarz and Gartenhaus: Regulation of DENR/DRP by RNA-binding Protein AUF1

Figure 3. HuR and AUF1 bind in vitro to distinct site of biotinylated DENR/DRP 3’UTR transcripts. (Top) Schematic of DENR/DRP mRNA, depicting the transcripts (5’UTR, CR, and 3’UTR - A, B, C and D fragments) used for biotin pull-down analysis. (Bottom) Pull down assays to assess the ability of endogenous HuR and AUF1 binding to biotinylated DENR/DRP transcripts. Two Ìg of each indicated (as above) biotinylated transcript were incubated with 40 mg of HEK 293 cytoplasmic cell lysates, whereupon their association with HuR or AUF1 was detected by Western blotting.

Figure 4. DENR/DRP protein levels increase with increasing cell density. HEK 293 cells were plated at ~20% (low), 60% (middle) and ~95% (high) confluence. Twenty-four hour later cells were collected and the total protein levels of DENR/DRP, HuR, AUF1 and ‚-Actin (loading control) were assessed by Western blotting.

(25). We found a cell density-dependent association of endogenous AUF1 to endogenous DENR mRNA in low (20% confluence) and high density (95% confluence) (Figure Figure 5. The association of endogenous HuR and AUF1 to endogenous 5). The DENR/DRP mRNA present in the IP material using DENR/DRP mRNA in low and high density cells. HEK 293 cells were ant-AUF1 antibody on lysates from high-density cells was less plated either at 20% confluence (low density) or 95% confluence (high abundant compared with the IP material from low-density density). Twenty-four hours later cell lysates were prepared and IP assays were performed using, either HuR, AUF1 or IgG antibodies. Presence of cells. To directly assess whether AUF1 can control the DENR/DRP as well as the loading control GAPDH was assessed by DENR/DRP expression, AUF1 protein levels in HEK 293 reverse transcription followed by qPCR (experiments were performed three cells were knocked down by using a vector expressing a times independently; representative result is shown).

237 CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007)

influence of posttranscriptional gene regulatory processes on the regulation of genes that are involved in tumorgenesis. Improved understanding of these processes will provide additional mechanistic insights into malignant transformation and should help facilitate the development of improved treatment strategies in the future.

References

1 Prosniak M, Dierov J, Okami K, Tilton B, Jameson B, Sawaya BE and Gartenhaus RB: A Novel Candidate Oncogene, MCT- 1, Is Involved in Cell Cycle Progression. Cancer Res 58: 4233- 2337, 1998. 2 Reinert LS, Shi B, Nandi S, Mazan-Mamczarz K, Vitolo M, Bachman KE, He H and Gartenhaus RB: MCT-1 protein interacts with the cap complex and modulates messenger RNA Figure 6. AUF1 silencing increases DENR/DRP expression. HEK 293 translational profiles. Cancer Res 66(18): 8994-9001, 2006. cells were transiently transfected with either a control (Vector) or AUF1 3 Kleijn M, Scheper GC, Voorma HO and Thomas AA: silencing vector (shRNA), and cellular fractions prepared 72 hrs later. AUF1, DENR/DRP, and ·-tubulin levels from cytoplasmic fraction were Regulation of translation initiation factors by signal analyzed by Western blotting. transduction. Eur J Biochem 253(3): 531-544, 1998. 4 Gygi SP, Rochon Y, Franza BR and Aebersold R: Correlation between protein and mRNA abundance in yeast. Mol Cell Biol 19(3): 1720-1730, 1999. 5 Dua K, Williams TM and Beretta L: Translational control of hairpin RNA (shRNA) targeting all AUF1 isoforms. As the proteome: relevance to cancer. Proteomics 1(10): 1191- shown in Figure 6, reduction of AUF1 levels revealed 1199, 2001. heightened DENR/DRP protein levels under basal conditions 6 Yoon HJ and Donahue TF: The suil suppressor locus in using cytoplasmic lysates of HEK 293 cells. Taken together, Saccharomyces cerevisiae encodes a translation factor that these findings indicate that the reduction in AUF1 binding to functions during tRNA(iMet) recognition of the start codon. Mol Cell Biol 12(1): 248-260, 1992. DENR/DRP mRNA contributes to increased expression of 7 Deyo JE, Chiao PJ and Tainsky MA: drp, a novel protein DENR/DRP in high-density cells. However, given the expressed at high cell density but not during growth arrest. complex biology of AUF1 such as isoform-specific differences DNA Cell Biol 17(5): 437-447, 1998. in their binding affinities (37) or subcellular localization (38), 8 Rajasekhar VK, Viale A, Socci ND, Wiedmann M, Hu X and further work is indicated in order to more completely Holland EC: Oncogenic Ras and Akt signaling contribute to understand the relevance and specific mechanism of AUF1 glioblastoma formation by differential recruitment of existing on DENR/DRP regulation. mRNAs to polysomes. Mol Cell 12(4): 889-901, 2003. 9 Rajasekhar VK and Holland EC: Postgenomic global analysis Experiments reported over the past several years, of translational control induced by oncogenic signaling. including genome-wide microarray approaches, have Oncogene 23(18): 3248, 2004. demonstrated that many eukaryotic RBPs associate with 10 Keene JD: Ribonucleoprotein infrastructure regulating the flow multiple mRNAs both in vitro and in vivo. This multi- of genetic information between the genome and the proteome. targeted binding property of RBPs has led to a model of Proc Natl Acad Sci USA 98: 7018-7024, 2001 regulated gene expression in eukaryotes that is termed the 11 Ross J: mRNA stability in mammalian cells. Microbiol Rev 59: post-transcriptional operon (39). It will be informative 423-450, 1995. employing RIP-Chip and related methods to identify 12 Chen CY and Shyu A-B: AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20: functionally related subsets of mRNAs (40) that are co- 465-470, 1995. regulated with DENR/DRP through modulation of their 13 Khabar KS: The AU-rich transcriptome: more than interferons association with the AUF1-RNP complex under high cell and cytokines, and its role in disease. J Interferon Cytokine Res density growth conditions. The data derived from these 25: 1-10, 2005. experiments will enhance our understanding of AUF1 14 Zhang W, Wagner BJ, Ehrenman K, Schaefer AW, DeMaria function and additionally will help to elucidate crucial links CT, Crater D, DeHaven K, Long L and Brewer G: underlying the regulation of genes that control cellular Purification, characterization, and cDNA cloning of an AU- rich element RNA-binding protein, AUF1. Mol Cell Biol 13: proliferation, immortalization, tumor suppression, 7652-7665, 1993. oncogenesis and senescence. Although details of these 15 Carballo E, Lai WS and Blackshear PJ: Feedback inhibition of regulatory mechanisms need further experimental Macropage Tumor Necrosis Factor-alpha Production by demonstration, the findings presented here emphasize the Tristetraprolin. Science 281(5379): 1001-1005, 1998.

238 Mazan-Mamczarz and Gartenhaus: Regulation of DENR/DRP by RNA-binding Protein AUF1

16 Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M, Maritim B, 29 Laroia G, Cuesta R, Brewer G and Schneider RJ: Control of Chen S, Gueydan C, Kruys V, Streuli M and Anderson P: TIA- mRNA decay by heat shock-ubiquitin-proteasome pathway. 1 is a translational silencer that selectively regulates the Science 284: 499-502, 1999. expression of TNF-alpha. EMBO J 19: 4154-4163, 2000. 30 Lin S, Wang W, Wilson GM, Yang X, Brewer G, Holbrook NJ 17 Anderson P and Kedersha N: Stressful initiations. J Cell Sci and Gorospe M: Down-regulation of cyclin D1 expression by 115: 3227-3234, 2002. prostaglandin A2 is mediated by enhanced cyclin D1 mRNA 18 Stoecklin G, Colombi M, Raineri I, Leuenberger S, Mallaun M, turnover. Mol Cell Biol 20: 7903-7913, 2000. Schmidlin M, Gross B, Lu M, Kitamura T and Moroni C: 31 Cormier P, Pyronnet S, Salaun P, Mulner-Lorillon O and Functional cloning of BRF1, a regulator of ARE-dependent Sonenberg N: Cap-dependent translation and control of the cell mRNA turnover. EMBO J 21: 4709-4718, 2002. cycle. Prog Cell Cycle Res 5: 469-475, 2003. 19 Gueydan C, Droogmans L, Chalon P, Huez G, Capul D and 32 Holcik M and Sonenberg N: Translational control in stress and Kruys V: Identification of TIAR as a protein binding to the apoptosis. Nat Rev Mol Cell Biol 6(4): 318-327, 2005. translational regulatory AU-rich element of tumor necrosis 33 Wek RC, Jiang HY and Anthony TG: Coping with stress: eIF2 factor · mRNA. J Biol Chem 274: 2322-2326, 1999. kinases and translationalcontrol. Biochem Soc Trans 34(Pt 1): 20 Brennan CM and Steitz JA: HuR and mRNA stability. Cell Mol 7-11, 2006. Life Sci 58: 266-277, 2001. 34 Fan J, Yang X, Wang W, Wood III WH, Becker KG and 21 Kullmann M, Gopfert U, Siewe B and Hengst L: ELAV/Hu Gorospe M: Global analysis of stress-regulated mRNA turnover proteins inhibit p27 translation via an IRES element in the p27 using cDNA arrays. Proc Natl Acad Sci USA 99: 10611-10616, 5’UTR. Genes Dev 16: 3087-3099, 2002. 2002. 22 Mazan-Mamczarz K, Galban S, López de Silanes I, Martindale 35 Kawai T, Fan J, Mazan-Mamczarz K and Gorospe M: Global JL, Atasoy U, Keene JD and Gorospe M: RNA-binding protein mRNA stabilization preferentially linked to translational HuR enhances p53 translation in response to ultraviolet light repres-sion during the endoplasmic reticulum stress response. irradiation. Proc Natl Acad Sci USA 100: 8354-8359, 2003. Mol Cell Biol 24: 6773-6787, 2004. 23 Lal A, Kawai T, Yang X, Mazan-Mamczarz K and Gorospe M: 36 Gorospe M: HuR in the mammalian genotoxic response: post- Anti-apoptotic function of RNA-binding HuR effected through transcriptional multitasking. Cell Cycle 2: 412-414, 2003. prothymosin ·. EMBO J 24: 1852-1862, 2005. 37 Wagner BJ, DeMaria CT, Sun Y, Wilson GM and Brewer G: 24 Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL Structure and genomic organization of the human AUF1 gene. and Gorospe M: Concurrent versus individual binding of HuR Genomics 48: 195, 1998. and AUF1 to common labile target mRNAs. EMBO J 23(15): 38 Sarkar B, Lu JY and Schneider RJ: Nuclear import and export 3092-3102, 2004. functions in the different isoforms of the AUF1/heterogeneous 25 Mazan-Mamczarz K, Lal A, Martindale JL, Kawai T and nuclear ribonucleoprotein protein family. J Biol Chem 278(23): Gorospe M: Translational repression by RNA-binding protein 20700-20707, 2003. TIAR. Mol Cell Biol 26(7): 2716-2727, 2006. 39 Keene JD and Tenenbaum SA: Eukaryotic mRNPs May 26 Nandi S, Hachem A, Sinnathamby L, Mazan-Mamczarz K, Represent Posttranscriptional Operons. Molecular Cell 9: 1161- Hagner P, He H and Gartenhaus RB: Phosphorylation of MCT- 1167, 2002. 1 by p42/44 MAPK is required for its stabilization in response 40 Keene JD, Komisarow JM and Friedersdorf MB: RIP-Chip: the to DNA damage. Oncogene Oct 2; [Epub ahead of print], 2006. isolation and identification of mRNAs, microRNAs and protein 27 Wilusz CJ and Wilusz J: Bringing the role of mRNA decay in components of ribonucleoprotein complexes from cell extracts. the control of gene expression into focus. Trends Genet 20: 491- Nature Protocols 1: 302-307, 2006 497, 2004. 28 Wilson GM and Brewer G: The search for trans-acting factors controlling messenger RNA decay. Prog Nucleic Acids Res Mol Received March 13, 2007 Biol 62: 257-291, 1999. Accepted March 19, 2007

239