DOCSLIB.ORG

Post-Transcriptional Control of the MCT-1-Associated Protein DENR/DRP by RNA-Binding Protein AUF1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Post-Transcriptional Control of the MCT-1-Associated Protein DENR/DRP by RNA-Binding Protein AUF1 CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007) Post-transcriptional Control of the MCT-1-associated Protein DENR/DRP by RNA-binding Protein AUF1 KRYSTYNA MAZAN-MAMCZARZ and RONALD B. GARTENHAUS University of Maryland, Marlene and Stewart Greenebaum Cancer Center 9-011 BRB, 655 West Baltimore Street, Baltimore, Maryland 21201, U.S.A. Abstract. Background: There is often a poor correlation bind to discrete regions of DENR/DRP mRNA and that AUF1 observed between protein and RNA in eukaryotic systems, silencing increases DENR/DRP protein levels. Conclusion: Our supporting the emerging paradigm that many of the data established a cell density-dependent interaction of AUF1 abnormalities in a cancer cell’s proteome may be achieved by protein with DENR/DRP mRNA that modulates DENR/DRP differential recruitment of mRNAs to polysomes referred to as protein levels. the translational profile. The MCT-1 oncogene product has recently been shown to interact with the cap complex and to The MCT-1 oncogene product initially identified in a modulate the translational profile of cell lines when MCT-1 human lymphoma cell line and mapped to chromosome was highly expressed. The MCT-1 protein modifies mRNA Xq22-24 (1) has recently been shown to interact with the translational profiles through its interaction with DENR/DRP, cap complex and to modulate the translational profile of a protein containing an SUI1 domain involved in recognition both human lymphoma and embryonic kidney cell lines of the translation initiation codon. It has been shown when MCT-1 was highly expressed (2) There is often a poor previously that the protein levels of DENR/DRP go up in correlation observed between protein and RNA in parallel with increasing cell density, however the mechanism(s) eukaryotic systems (3, 4), supporting the emerging paradigm underlying this increase is poorly understood at present. The that many of the abnormalities in a cancer cell’s proteome 3’-untranslated region (3’UTR) of DENR/DRP was found to may be achieved by differential recruitment of mRNAs to have a high number of uracyl (U)- and adenine (A)-rich polysomes referred to as the translational profile (5). The sequences (AREs). Many RNA-binding proteins (RBPs) have MCT-1 protein modifies mRNA translational profiles been shown to recognize and bind to mRNAs that contains through its interaction with DENR/DRP, a cell density AREs generally present in the 3’UTR of mRNAs. RBPs binding regulated protein containing an SUI1 domain involved in to AREs such as AUF1, BRF1, KSRP, and TTP are known to recognition of the translation initiation codon (2, 6). A regulate mRNA turnover, while TIAR and TIA-1 influence model for how MCT-1 transforms cells has recently been mRNA translation. Materials and Methods: We assessed the proposed in which MCT-1 bound to DENR/DRP binds to association of several ARE binding proteins with DENR/DRP the cap complex with enhanced translation initiation of mRNA by reverse transcription of the RNA obtained after target mRNAs by scanning and recognition of the initiation immunoprecipitation of cell lysates from HEK 293 cells codon through its SUI1 domain (2). It has been growing at varying levels of cell density. HEK 293 cells were demonstrated in previous work (7) that the protein levels of transfected with an AUF1 silencing vector (shRNA), and DENR/DRP go up in tandem with increasing cell density of protein levels of DENR/DRP were analyzed by Western tumor cell lines. This increase in DENR/DRP protein level blotting. Results: We demonstrated that both HuR and AUF1 may be related to the altered translational profiles seen in the transformed phenotype (8, 9). The mechanism(s) underlying the increase in protein level of DENR/DRP is poorly understood at present. Post- Correspondence to: Ronald B. Gartenhaus, University of Maryland, transcriptional gene regulatory processes such as RNA Marlene and Stewart Greenebaum Cancer Center 9-011 BRB, 655 splicing and maturation, mRNA transport, stability, and West Baltimore Street, Baltimore, Maryland 21201, U.S.A. Tel: translation are becoming increasingly recognized as critical +410 328 3691, Fax: +410 328 6559, e-mail: rgartenhaus@ som.umaryland.edu mechanisms of gene regulation in mammalian cells. These control mechanisms are primarily governed by RNA-binding Key Words: MCT-1 oncogene, post-transcriptional control, proteins (RBPs) that associate with mRNAs and regulate DENR/DRP, AUF1, RNA-binding protein. their processing (10). Many RBPs have been shown to 1109-6535/2007 $2.00+.40 233 CANCER GENOMICS & PROTEOMICS 4: 233-240 (2007) recognize and bind to mRNAs that contains uracyl (U)- or PCR analysis of mRNAs. RNA from IP material was reverse adenine (A)-rich sequences (known as AREs) generally transcribed by using random hexamers/oligo(dT) mixture and present in the 3'-untranslated regions (3’UTRs) of mRNAs Superscript II Reverse Transcriptase (Invitrogen) and subjected to both conventional PCR and quantitative real-time PCR (qPCR) (11). AREs have been described in 3’UTRs of mRNAs analysis using gene-specific primer pairs: 5’TCTCGAACTC encoding cell cycle regulatory proteins, cytokines, CTGACCTCGT and 3’GGTGAGGAAGCCAAATTCAA for oncogenes, tumor suppressor genes, transcription factors DENR mRNA and, 5’CGGAGTCAACGGATTTGGTCGTAT and and growth factors (12, 13). RBPs binding to AREs such as 3’AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA. AUF1, BRF1, KSRP, and TTP have been shown to regulate Negative control reactions were prepared in parallel without the mRNA turnover, while TIAR and TIA-1 influence mRNA addition of reverse transcriptase. Each reaction was performed in translation (14-19). HuR and Hu-related proteins can be triplicate, and three independent reactions were run simultaneously. GAPDH cDNA served as the internal control. PCR products were involved in controlling both the stability and translation of visualized by electrophoresis in 1% ethidium bromide-stained ARE-mRNAs (20-23). agarose gels. The BioRad iCycler and iQ SYBR Green supermix Recently, in recognition of RBPs influence on the (BioRad) was used to carry out the qPCR analysis. expression of genes that are essential to key cellular functions including stress response, and tumorigenesis, they Biotin pull-down assays. PCR fragments containing the T7 RNA have become the focus of intensive investigation. Since polymerase promoter sequence (CCAAGCTTCTAATACGACTC DENR/DRP is a recently described translational regulatory ACTATAGGGAGA (T7)) were used as templates for in vitro transcription of DENR fragments – the DENR 5’-untranslated molecule containing the important SUI1 domain we sought region (5’UTR), DENR coding region (CR) and different fragments to further examine its regulation. Here, we demonstrate that of 3’-untranslated region (3’UTR) – using biotinylated CTP. Primers both HuR and AUF1 RBPs interact with DENR/DRP used for the amplification of DENR transcripts were following: (T7) mRNA. The data presented establish a cell density- CGGGGAGACGAGTTGCAT and CCCCGCTGGATTCAGA dependent interaction of AUF1 protein with DENR/DRP AAT for 5’UTR, (T7) GTTTGTGAAATGGCTGCTGA and mRNA that modulates DENR/DRP protein levels. CCAAGATCTTCGATGCTGTC for CR, (T7) AAGAAGTGAA TTTGAAAATTTGTCTG and CGCCTGTAATCCCACCTACT Materials and Methods for 3’A, (T7) AGTGATTCTCCTGCCTCAGC and CATAAGTTTT ATGCAAGGCTGATT for 3’B, (T7) GAACCAGTAAGCCACT TCTTTGA and TTCAAGATTGTAATTTGCATGG for 3’C, (T7) Cell culture and transient transfections. Human embryonic kidney HEK AGAACCCATGGAACCCTTG and GGAGACCAGGTTTTACT 293 cells were cultured in Dulbecco's modified essential medium GTTGC for 3’D. Two micrograms of biotinylated transcripts was (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal incubated with 40 Ìg of cytoplasmic lysate for 30 min at 25ÆC. bovine serum and antibiotics. Cells were plated at 20% (low), 60% ~ Complexes were isolated with paramagnetic streptavidin-conjugated (middle) and 95% (high) confluences, and collected for analysis ~ Dynabeads (Dynal), and the pull-down material was analyzed by after 24hrs. Plasmids used to silence AUF1 (pSILENCER-AUF1) Western blotting. and a corresponding control vector (pSILENCER) were generous gifts from Dr. M. Gorospe (NIA, Baltimore, MD). Transfections Western blot analysis. For Western blot analysis, 20 Ìg of total or were performed using Lipofectamine 2000 (Invitrogen). Cells were 30 Ìg of cytoplasmic proteins were resolved by electrophoresis in then collected for analysis 72 hrs after transfection; experiments were SDS-containing polyacrylamide gels and transferred onto performed three times independently. polyvinylidene difluoride (PVDF) membranes. Blots were probed with monoclonal antibodies recognizing DENR/DRP (BD Immunoprecipitation (IP) of ribonucleoprotein (RNP) complexes. IP of Pharmingen), HuR, ·-tubulin (Santa Cruz Biotechnology, Inc.), ‚- RNP complexes, were used to assess the association of endogenous Actin (Abcam, Cambridge, UK), or AUF1 polyclonal antibody ARE binding proteins (HuR, AUF1, TIAR, and TIA-1) with (Upstate Biotech.). Following incubation with appropriate endogenous DENR/DRP mRNA and were carried out as described secondary antibodies, signals were detected with enhanced previously (22, 24, 25). Briefly, 20x106 HEK 293 cells were harvested chemiluminescence. at low, medium and high density culture conditions and lysed in cytoplasmic lysis buffer containing 20 mM Tris-HCl (pH 7.5), 100 Results and Discussion mM KCl, 5 mM MgCl2, 0.3% IGEPAL CA-630, RNaseOUT and protease inhibitor cocktail. After 5 min incubation on ice, and centrifugation
Load more

Recommended publications
  • Activities of Ligatin and MCT-1/DENR in Eukaryotic Translation Initiation and Ribosomal Recycling
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Activities of Ligatin and MCT-1/DENR in eukaryotic translation initiation and ribosomal recycling Maxim A. Skabkin,1,3 Olga V. Skabkina,1,3 Vidya Dhote,1 Anton A. Komar,2 Christopher U.T. Hellen,1,4 and Tatyana V. Pestova1,5 1Department of Cell Biology, State University of New York Downstate Medical Center, Brooklyn, New York 11203, USA; 2Center for Gene Regulation in Health and Disease, Department of Biological, Geological, and Environmental Sciences, Cleveland State University, Cleveland, Ohio 44115, USA Eukaryotic translation initiation begins with ribosomal recruitment of aminoacylated initiator tRNA (Met- Met Met tRNA i) by eukaryotic initiation factor eIF2. In cooperation with eIF3, eIF1, and eIF1A, Met-tRNA i/eIF2/ GTP binds to 40S subunits yielding 43S preinitiation complexes that attach to the 59-terminal region of mRNAs and then scan to the initiation codon to form 48S initiation complexes with established codon–anticodon base- pairing. Stress-activated phosphorylation of eIF2a reduces the level of active eIF2, globally inhibiting translation. However, translation of several viral mRNAs, including Sindbis virus (SV) 26S mRNA and mRNAs containing hepatitis C virus (HCV)-like IRESs, is wholly or partially resistant to inhibition by eIF2 phosphorylation, despite Met requiring Met-tRNA i. Here we report the identification of related proteins that individually (Ligatin) or together (the oncogene MCT-1 and DENR, which are homologous to N-terminal and C-terminal regions of Ligatin, Met respectively) promote efficient eIF2-independent recruitment of Met-tRNA i to 40S/mRNA complexes, if attachment of 40S subunits to the mRNA places the initiation codon directly in the P site, as on HCV-like IRESs and, as we show here, SV 26S mRNA.
    [Show full text]
  • Crystal Structure of the DENR-MCT-1 Complex Revealed Zinc-Binding Site Essential for Heterodimer Formation
    Crystal structure of the DENR-MCT-1 complex revealed zinc-binding site essential for heterodimer formation Ivan B. Lomakina,1, Sergey E. Dmitrievb, and Thomas A. Steitza,c,2 aDepartment of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06520-8114; bBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, 119234 Moscow, Russia; and cHoward Hughes Medical Institute, Yale University, New Haven, CT 06520-8114 Edited by Jennifer A. Doudna, University of California, Berkeley, CA, and approved November 29, 2018 (received for review June 5, 2018) The density-regulated protein (DENR) and the malignant T cell- of the ribosomal complex with DENR-MCT-1 at 6-Åresolution amplified sequence 1 (MCT-1/MCTS1) oncoprotein support nonca- (13). It showed that the structure of the C-terminal domain of nonical translation initiation, promote translation reinitiation on a DENR (C-DENR) is similar to that of the canonical translation specific set of mRNAs with short upstream reading frames, and initiation factor 1 (eIF1), which controls the fidelity of trans- regulate ribosome recycling. DENR and MCT-1 form a heterodimer, lation initiation and scanning. Moreover, C-DENR binds the 40S which binds to the ribosome. We determined the crystal structure of ribosomal subunit at the same site as eIF1. These data suggest a the heterodimer formed by human MCT-1 and the N-terminal do- similar mechanism for DENR-MCT-1 and eIF1 in discriminating main of DENR at 2.0-Å resolution. The structure of the heterodimer the initiator tRNA in the P site of the 40S subunit, which is reveals atomic details of the mechanism of DENR and MCT-1 inter- crucial for translation initiation, reinitiation, and ribosomal action.
    [Show full text]
  • Deconvolution of Expression for Nascent RNA Sequencing Data 3 1 2 (≤ 25 Bp) (Supplementary Fig
    Page 1 of 10 Bioinformatics 1 2 3 Downloaded from https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btab582/6348164 by Cold Spring Harbor Laboratory user on 18 August 2021 4 5 6 7 Subject Section XXXXX 8 9 10 Deconvolution of Expression for Nascent RNA 11 12 sequencing data (DENR) highlights pre-RNA 13 14 isoform diversity in human cells 15 Yixin Zhao 1,3, Noah Dukler 1,3, Gilad Barshad 2, Shushan Toneyan 1, Charles 16 2 1,∗ 17 G. Danko and Adam Siepel 18 1Simons Center for Quantitative Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA 19 2Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA 20 3These authors contributed equally to this work. 21 22 ∗To whom correspondence should be addressed. 23 Associate Editor: XXXXXXX 24 25 Received on XXXXX; revised on XXXXX; accepted on XXXXX 26 27 Abstract 28 Motivation: Quantification of isoform abundance has been extensively studied at the mature-RNA level 29 using RNA-seq but not at the level of precursor RNAs using nascent RNA sequencing. 30 Results: We address this problem with a new computational method called Deconvolution of Expression 31 for Nascent RNA sequencing data (DENR), which models nascent RNA sequencing read counts as a 32 mixture of user-provided isoforms. The baseline algorithm is enhanced by machine-learning predictions 33 of active transcription start sites and an adjustment for the typical “shape profile” of read counts along a 34 transcription unit. We show that DENR outperforms simple read-count-based methods for estimating gene 35 and isoform abundances, and that transcription of multiple pre-RNA isoforms per gene is widespread, with 36 frequent differences between cell types.
    [Show full text]
  • 2020 Program Book
    PROGRAM BOOK Note that TAGC was cancelled and held online with a different schedule and program. This document serves as a record of the original program designed for the in-person meeting. April 22–26, 2020 Gaylord National Resort & Convention Center Metro Washington, DC TABLE OF CONTENTS About the GSA ........................................................................................................................................................ 3 Conference Organizers ...........................................................................................................................................4 General Information ...............................................................................................................................................7 Mobile App ....................................................................................................................................................7 Registration, Badges, and Pre-ordered T-shirts .............................................................................................7 Oral Presenters: Speaker Ready Room - Camellia 4.......................................................................................7 Poster Sessions and Exhibits - Prince George’s Exhibition Hall ......................................................................7 GSA Central - Booth 520 ................................................................................................................................8 Internet Access ..............................................................................................................................................8
    [Show full text]
  • A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M
    Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context.
    [Show full text]
  • Signature Redacted Thesis Supervisor Certified By
    Single-Cell Transcriptomics of the Mouse Thalamic Reticular Nucleus by Taibo Li S.B., Massachusetts Institute of Technology (2015) Submitted to the Department of Electrical Engineering and Computer Science in partial fulfillment of the requirements for the degree of Master of Engineering in Electrical Engineering and Computer Science at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY June 2017 @ Massachusetts Institute of Technology 2017. All rights reserved. A uthor ... ..................... Department of Electrical Engineering and Computer Science May 25, 2017 Certified by. 3ignature redacted Guoping Feng Poitras Professor of Neuroscience, MIT Signature redacted Thesis Supervisor Certified by... Kasper Lage Assistant Professor, Harvard Medical School Thesis Supervisor Accepted by . Signature redacted Christopher Terman Chairman, Masters of Engineering Thesis Committee MASSACHUSETTS INSTITUTE 0) OF TECHNOLOGY w AUG 14 2017 LIBRARIES 2 Single-Cell Transcriptomics of the Mouse Thalamic Reticular Nucleus by Taibo Li Submitted to the Department of Electrical Engineering and Computer Science on May 25, 2017, in partial fulfillment of the requirements for the degree of Master of Engineering in Electrical Engineering and Computer Science Abstract The thalamic reticular nucleus (TRN) is strategically located at the interface between the cortex and the thalamus, and plays a key role in regulating thalamo-cortical in- teractions. Current understanding of TRN neurobiology has been limited due to the lack of a comprehensive survey of TRN heterogeneity. In this thesis, I developed an integrative computational framework to analyze the single-nucleus RNA sequencing data of mouse TRN in a data-driven manner. By combining transcriptomic, genetic, and functional proteomic data, I discovered novel insights into the molecular mecha- nisms through which TRN regulates sensory gating, and suggested targeted follow-up experiments to validate these findings.
    [Show full text]
  • Translation Termination and Ribosome Recycling in Eukaryotes
    Downloaded from http://cshperspectives.cshlp.org/ on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Translation Termination and Ribosome Recycling in Eukaryotes Christopher U.T. Hellen Department of Cell Biology, State University of New York, Downstate Medical Center, New York, New York 11203 Correspondence: [email protected] Termination of mRNA translation occurs when a stop codon enters the A site of the ribosome, and in eukaryotes is mediated by release factors eRF1 and eRF3, which form a ternary eRF1/ eRF3–guanosine triphosphate (GTP) complex. eRF1 recognizes the stop codon, and after hydrolysis of GTP by eRF3, mediates release of the nascent peptide. The post-termination complex is then disassembled, enabling its constituents to participate in further rounds of translation. Ribosome recycling involves splitting of the 80S ribosome by the ATP-binding cassette protein ABCE1 to release the 60S subunit. Subsequent dissociation of deacylated transfer RNA (tRNA) and messenger RNA (mRNA) from the 40S subunit may be mediated by initiation factors (priming the 40S subunit for initiation), by ligatin (eIF2D) or by density- regulated protein (DENR) and multiple copies in T-cell lymphoma-1 (MCT1). These events may be subverted by suppression of termination (yielding carboxy-terminally extended read- through polypeptides) or by interruption of recycling, leading to reinitiation of translation near the stop codon. OVERVIEW OF TRANSLATION post-termination complex (post-TC) is recycled TERMINATION AND RECYCLING bysplittingoftheribosome,whichismediatedby ABCE1. This step is followed by release of de- ranslation is a cyclical process that comprises acylated tRNA and messenger RNA (mRNA) Tinitiation, elongation, termination, and ribo- from the 40S subunit via redundant pathways some recycling stages (Jackson et al.
    [Show full text]
  • The Genetics of Bipolar Disorder
    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
    [Show full text]
  • Research Article Sex Difference of Ribosome in Stroke-Induced Peripheral Immunosuppression by Integrated Bioinformatics Analysis
    Hindawi BioMed Research International Volume 2020, Article ID 3650935, 15 pages https://doi.org/10.1155/2020/3650935 Research Article Sex Difference of Ribosome in Stroke-Induced Peripheral Immunosuppression by Integrated Bioinformatics Analysis Jian-Qin Xie ,1,2,3 Ya-Peng Lu ,1,3 Hong-Li Sun ,1,3 Li-Na Gao ,2,3 Pei-Pei Song ,2,3 Zhi-Jun Feng ,3 and Chong-Ge You 2,3 1Department of Anesthesiology, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China 2Laboratory Medicine Center, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China 3The Second Clinical Medical College of Lanzhou University, Lanzhou, Gansu 730030, China Correspondence should be addressed to Chong-Ge You; [email protected] Received 13 April 2020; Revised 8 October 2020; Accepted 18 November 2020; Published 3 December 2020 Academic Editor: Rudolf K. Braun Copyright © 2020 Jian-Qin Xie et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ischemic stroke (IS) greatly threatens human health resulting in high mortality and substantial loss of function. Recent studies have shown that the outcome of IS has sex specific, but its mechanism is still unclear. This study is aimed at identifying the sexually dimorphic to peripheral immune response in IS progression, predicting potential prognostic biomarkers that can lead to sex- specific outcome, and revealing potential treatment targets. Gene expression dataset GSE37587, including 68 peripheral whole blood samples which were collected within 24 hours from known onset of symptom and again at 24-48 hours after onset (20 women and 14 men), was downloaded from the Gene Expression Omnibus (GEO) datasets.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • MCT-1 Protein Interacts with the Cap Complex and Modulates Messenger RNA Translational Profiles Line S
    Research Article MCT-1 Protein Interacts with the Cap Complex and Modulates Messenger RNA Translational Profiles Line S. Reinert,1 Bo Shi,3 Suvobroto Nandi,1 Krystyna Mazan-Mamczarz,2 Michele Vitolo,1 Kurtis E. Bachman,1 Huili He,1 and Ronald B. Gartenhaus1 1University of Maryland, Marlene and Stewart Greenebaum Cancer Center; 2Laboratory of Cellular and Molecular Biology, National Institute on Aging, Intramural Research Program, NIH, Baltimore, Maryland; and 3Division of Rheumatology, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois Abstract In the past several years, it has become increasingly evident MCT-1 is an oncogene that was initially identified in a human that mRNA translation is also an important control point, and T cell lymphoma and has been shown to induce cell this is particularly the case in embryonic development and proliferation as well as activate survival-related pathways. during the regulation of cell growth and differentiation (11, 12). MCT-1 contains the PUA domain, a recently described RNA- The efficiency of expression of key proteins involved in cell binding domain that is found in several tRNA and rRNA growth regulation, proliferation, or cell death may be controlled modification enzymes. Here, we established that MCT-1 at the translational level by changes in the activity of protein interacts with the cap complex through its PUA components of the protein synthesis machinery. Experimentally, domain and recruits the density-regulated protein (DENR/ aberrant expression of translation factors has been shown to induce the malignant transformation of cells. The eIF4E protein DRP), containing the SUI1 translation initiation domain.
    [Show full text]
  • (NF1) As a Breast Cancer Driver
    INVESTIGATION Comparative Oncogenomics Implicates the Neurofibromin 1 Gene (NF1) as a Breast Cancer Driver Marsha D. Wallace,*,† Adam D. Pfefferle,‡,§,1 Lishuang Shen,*,1 Adrian J. McNairn,* Ethan G. Cerami,** Barbara L. Fallon,* Vera D. Rinaldi,* Teresa L. Southard,*,†† Charles M. Perou,‡,§,‡‡ and John C. Schimenti*,†,§§,2 *Department of Biomedical Sciences, †Department of Molecular Biology and Genetics, ††Section of Anatomic Pathology, and §§Center for Vertebrate Genomics, Cornell University, Ithaca, New York 14853, ‡Department of Pathology and Laboratory Medicine, §Lineberger Comprehensive Cancer Center, and ‡‡Department of Genetics, University of North Carolina, Chapel Hill, North Carolina 27514, and **Memorial Sloan-Kettering Cancer Center, New York, New York 10065 ABSTRACT Identifying genomic alterations driving breast cancer is complicated by tumor diversity and genetic heterogeneity. Relevant mouse models are powerful for untangling this problem because such heterogeneity can be controlled. Inbred Chaos3 mice exhibit high levels of genomic instability leading to mammary tumors that have tumor gene expression profiles closely resembling mature human mammary luminal cell signatures. We genomically characterized mammary adenocarcinomas from these mice to identify cancer-causing genomic events that overlap common alterations in human breast cancer. Chaos3 tumors underwent recurrent copy number alterations (CNAs), particularly deletion of the RAS inhibitor Neurofibromin 1 (Nf1) in nearly all cases. These overlap with human CNAs including NF1, which is deleted or mutated in 27.7% of all breast carcinomas. Chaos3 mammary tumor cells exhibit RAS hyperactivation and increased sensitivity to RAS pathway inhibitors. These results indicate that spontaneous NF1 loss can drive breast cancer. This should be informative for treatment of the significant fraction of patients whose tumors bear NF1 mutations.
    [Show full text]