Marshall University Marshall Digital Scholar
Theses, Dissertations and Capstones
1-1-2005 Mechanisms of Growth Hormone Enhancement of Excitatory Synaptic Transmission in Hippocampus Ghada Saad Zaglool Ahmed Mahmoud
Follow this and additional works at: http://mds.marshall.edu/etd Part of the Biochemical Phenomena, Metabolism, and Nutrition Commons, and the Biological Phenomena, Cell Phenomena, and Immunity Commons
Recommended Citation Mahmoud, Ghada Saad Zaglool Ahmed, "Mechanisms of Growth Hormone Enhancement of Excitatory Synaptic Transmission in Hippocampus" (2005). Theses, Dissertations and Capstones. Paper 718.
This Dissertation is brought to you for free and open access by Marshall Digital Scholar. It has been accepted for inclusion in Theses, Dissertations and Capstones by an authorized administrator of Marshall Digital Scholar. For more information, please contact [email protected].
MECHANISMS OF GROWTH HORMONE ENHANCEMENT OF EXCITATORY SYNAPTIC TRANSMISSION IN HIPPOCAMPUS
By Ghada Saad Zaglool Ahmed Mahmoud
Dissertation submitted to The Graduate College Of Marshall University In partial fulfillment of the requirements For the degree of
Doctor of Philosophy In Biomedical Sciences
Approved by Lawrence M. Grover, Ph.D., Committee Chairperson Beverly C. Delidow, Ph.D. Todd L. Green, Ph.D. William D. McCumbee, Ph.D. Gary L. Wright, Ph.D.
Department of Physiology, Marshall University, Joan C. Edwards School of Medicine Huntington, West Virginia, USA Spring 2005
ABSTRACT
Growth hormone (GH) deficiency is associated with impaired learning and memory. One possible target for GH effects on memory is the hippocampus, a brain region containing GH receptors (GHRs). To determine if GH acutely alters hippocampal function, recombinant human GH (rhGH) was applied to in vitro rat hippocampal brain slices. Extracellular recordings were used to assess effects of
GH on the field EPSP (fEPSP) and long-term potentiation (LTP) of the fEPSP.
GHR expression was measured in GH-treated and control rat hippocampal slices using RT-PCR. The GH signaling pathway was investigated by studying the effect of GH on the fEPSP after block of Janus kinase (JAK) by tyrphostin AG
490, phosphoinositide-3-kinase (PI3-kinase) by wortmanin, and mitogen- activated/extracellular response protein kinase kinase (MEK) by U0126. To determine if protein synthesis is required, hippocampal slices were perfused with cycloheximide, a protein synthesis inhibitor. I examined the effects of GH on pharmacologically isolated N-methyl-D-aspartate receptor (NMDAR)-and α- amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (AMPAR)-mediated fEPSPs. Using western blotting, total and phosphorylated STAT5A/B, and
NMDAR subunits NR1, NR2A, and NR2B were measured in GH-treated and control slices.
GH caused a gradual (2 hr) increase in fEPSP amplitude during application that was maintained for more than 4 hours. Prior GH treatment (3hr) prevented additional potentiation by tetanus (100Hz, 1s), indicating that similar mechanisms contribute to both. GH caused equivalent enhancement of isolated
ii
NMDAR-fEPSPs and dual component fEPSP, indicating that GH effects are mediated in part by NMDARs. GH enhancement of fEPSPs was blocked by inhibitors of protein synthesis, JAK, PI3-kinase, and MEK, implicating all of these signaling mechanisms in GH enhancement of synaptic transmission. In vitro GH treatment of hippocampal brain slices for 15-30 min failed to alter either total or phosphorylated STAT 5a/b. In vitro GH treatment of hippocampal brain slices
(3 hr) increased GHR mRNA, decreased NR2B protein, and increased
NR2A/NR2B ratio. My results clearly demonstrate a previously unknown role for
GH as a short-term modulator of hippocampal synaptic function.
iii
DEDICATION
To my loving dearest Husband and kids for their constant
encouragement and support
In memory of my loving dearest father
Mr. Saad Zaglool A. Mahmoud
To my loving dearest mother
To my loving dearest brother Mr. Ahmed and his family
To my loving dearest sisters and their families
iv
ACKNOWLEDGEMENTS
First and foremost, I want to thank ALLAH, the God, for giving me the
ability and fortitude over the course of this work.
I would like to express my sincere gratitude to Dr. Lawrence M. Grover,
my advisor, who taught me not only how to do scientific research, but also how to
develop independent analytical thinking. His guidance and encouragement constantly helped me to achieve my goals throughout my doctoral work. I would like also to show my great thanks to the members of my committee: Dr Gary
Wright, Dr. Todd Green, Dr. William McCumbee and Dr. Beverly Delidow for their continual support, encouragement, and valuable input during my doctoral studies. Special thanks are to Dr. Green who kindly taught me and supervised me in conducting the Western blotting and PCR techniques in his laboratory. I am very thankful to Dr. Grover for teaching me all the electrophysiology techniques and for his advice in preparing the electrophysiological protocols. I would like to extend my thanks to all the faculty and staff in the Department of
Physiology at Marshall University – Joan C. Edwards School of Medicine for their kind assistance.
v
TABLE OF CONTENTS
ABSTRACT....…………………………………………..…………..………………... ii
DEDICATION …………………………………………………………………...……. iv
ACKNOWLEDGEMENTS.………...…………...………………….…………...……..v
LIST OF FIGURES.…...………………………………..……………………....…... viii
LIST OF ABBREVIATIONS/SYMBOLS …….…………….………….…………… x
INTRODUCTION.…...….………………………………………………..……………. 1
Neural growth hormone………………………………...... 2
Therapeutic applications of growth hormone ...... 6
Growth hormone and memory function ……………...... 9
LTP is a model system for mechanisms of memory …………...... 10
Glutamate receptors ……………………………..…...... 11
GluRs, LTP, and memory …………………………..…...... 12
SECTION 1
GH Enhances Excitatory Synaptic Transmission in Area CA1 of Rat
Hippocampus ..….. 15
INTRODUCTION …………………………………………………………………….. 16
MATERIALS AND METHODS..…..………………………………………………… 21
RESULTS ………..…………………………………………………………………… 29
DISCUSSION..…..…………………………………………………………………… 38
vi
SECTION 2
Growth Hormone Signaling Pathways in Area CA1 of Rat Hippocampus . 42
INTRODUCTION .……………………………………………….……………………43
MATERIALS AND METHODS .……….………………….………………………….54
RESULTS …………..………………………………………………………………… 58
DISCUSSION .…….……………………….………………………………………… 77
CHAPTER 3
NMDA Receptor-Mediated Effects of Growth Hormone…..…………………. 89
INTRODUCTION ….……………………………………………….………… 90
MATERIALS AND METHODS ….…………………………..……………… 98
RESULTS…...…………………………………………………………..……101
DISCUSSION…...………………………………………………………...... 108
CONCLUSIONS …………….……………………………………………..………. 115
REFERENCES ……………………………………………………………...... 118
vii
LIST OF FIGURES
FIGURE 1. Control of GH secretion…………………………………………...…. …2
FIGURE 2. Variations in human GH secretion throughout the day…………...…..3
FIGURE 3. Preparation of rat hippocampal slices………………………….....…..22
FIGURE 4. The interface holding chamber….……..…….…….…....…..……….. 23
FIGURE 5. The recording chamber……..…………...….……...…………………..25
FIGURE 6. Schematic illustration of hippocampal synaptic organization…...... 26
FIGURE 7. GH Enhanced Excitatory Synaptic Transmission in Area CA1 of Rat
Hippocampus……………………………..…….…………………….. 31
FIGURE 8. GH did not alter the paired-pulse facilitation (PPF) ratio…..…..….. 34
FIGURE 9. GH pretreatment prevented LTP in area CA1 of rat hippocampus.. 36
FIGURE 10. GH treatment of in vitro hippocampal brain slices increased the
expression of GHR mRNA…..…………………………….………....61
FIGURE 11. GH treatment of in vitro hippocampal brain slices did not affect
protein levels of either total or phospho-STAT5a/b………………..63
FIGURE 12. GH-induced potentiation of the fEPSP was blocked by inhibition of
PI3 kinase, MAPK kinase and JAK2 tyrosine kinase…………...... 65
FIGURE 13. PI3-kinase and MAPK kinase inhibitors had no effect on the
maintained expression of GH enhancement of fEPSPs ……….....68
FIGURE 14. Protein synthesis was required for the induction of GH
enhancement of synaptic transmission …...…………………..…....71
FIGURE 15. Protein synthesis was not required for maintained enhancement of
EPSPs by GH…………..……..…………………………….………....74
viii
FIGURE 16. Diagrammatic illustration of the proposed signaling pathway for GH
in the hippocampus……………...……………………...………….....85
FIGURE 17. GH enhanced isolated NMDAR-mediated fEPSPs (fEPSPNs)...103
FIGURE 18. GH enhanced isolated AMPAR-mediated fEPSPs (fEPSPAs).…104
FIGURE 19. Summary comparison of effects of GH alone, GH+DNQX+BMI,
GH+AP5 and control ACSF………………………...…………...... 105
FIGURE 20. GH decreased NR2B, but not NR1 or NR2A protein ……….……106
FIGURE 21. Diagrammatic illustration of the proposed mechanism of interaction
between GH, PI3-kinase, MAPK, and NMDARs ……….………...110
FIGURE 22. Model representing the relative contribution of AMPARs and
NMDARs to LTP as function of degree of NMDARs activation....113
ix
LIST OF ABBREVIATION/SYMBOLS
AIDS Acquired immune deficiency syndrome
Akt Protein kinase activated by PDK
AMPAR Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor
APV or AP5 5-Amino-phosphovaleric acid or 5-amino-phosphopentanoic acid
BA Bone age
BDNF Brain derived neurotrophic factor
BMI Bicuculline methiodide
CA1 Cornu Ammonis 1 of the hippocampus
CaMKII Ca2+- calmodulin-dependent protein kinase II cAMP Cyclic adenosine monophosphate
CSF Cerebro-spinal fluid
DNQX 6,7-Dinitroquinoxalline-2,3-dione dNTPs Deoxy-nucleotide-triphophate
DTT Dithiothreitol
ECL Enhanced chemiluminescnce
Elk-1 Transcription factor that recognizes serum response element (SRE)
E-LTP Early long term potentiation
EPSC Excitatory post synaptic current
EPSP Excitatory post synaptic potential
x
ERK Extra-cellular signal regulated kinase
ERP Event related potential fEPSP Field excitatory postsynaptic potential fEPSPAs AMPAR-mediated fEPSPs fEPSPNs NMDAR-mediated fEPSPs
GH Growth hormone
GHBP Growth hormone binding protein
GHD Growth hormone deficiency
GHRs Growth hormone receptors
GHRH Growth Hormone releasing hormone
GHRP-2 Growth hormone-releasing peptide-2
GluRs Glutamate receptors
GHRT Growth hormone replacement therapy
Grb2 Growth factor receptor binding protein-2 (Src Homology-2-containing protein associated with SOS)
HD Head circumference
HFS High frequency stimulation
HIV Human-Immunodeficiency-Virus
HRP Horseradish peroxidase
5-HT 5 Hydroxy tryptamine
IGF-I Insulin-like growth factor-I
IRS Insulin receptor substrate
xi
ISS Idiopathic short stature
JAK-2 Janus kinase-2 non-receptor protein tyrosine kinase
KP-102 D-alanyl-3-(2-naphthyl)-D-alanyl-L-alanyl-L-tryptophyl-D-phenylalany-
L-lysinamide dihydrochloride
LFS Low frequency stimulation
L-LTP Long-lasting long term potentiation
LTP Long term potentiation
LTD Long term depression
MAPK Mitogen activated protein kinase
MEK Mitogen activated protein kinase kinase
MEK-I Mitogen activated protein kinase-kinase inhibitor
NF1 Neurofibromin-1
NMDARs N-methyl-D-aspartate receptors
NT-3 Neurotrophic factor-3
NSE Neuron specific enolase
PCR Polymerase chain reaction
P300 ERP P300 event-related potential
PDK-1 Phosphoinositide-3-kinase-dependent kinase-1
PKCζ Atypical protein kinase C isoform ζ
PI3-K Phosphoinositide-3-kinase
PPF Paired pulse facilitation
PSD 95 Post synaptic density protein of 95 kD
xii
PWS Prader-Willi syndrome
QoL Quality of life
Raf Protein serine/ threonine kinase that activates MEK
Ras Rat sarcoma virus oncogene, member of GTP binding protein family activated by SOS rhGH Recombinant human growth hormone
SBS Short bowel syndrome
SGA Small for gestational age
SH2 Src homology 2 domain
SOCS Suppressors of cytokine signaling
SOS Son-of-sevenless, guanine nucleotide exchange factor leading to activation of Ras
Sp-cAMPS Membrane-permeable analog of cyclic AMP
STAT Signal transducer and activator of transcription
TGM Transgenic mice over-expressing growth hormone
TPS Theta pulse stimulation
TS Turner syndrome
TTS Tris Tween Saline
Tyr AG490 [Tyrphostin B42] [N-Benzyl-3,4-dihydroxy- benzylidenecyanoacetamide]
U-0126 [1, 4-Diamino-2,3-dicyano-1,4-bis(2-aminopheylthyo)-butadiene]
WORT Wortmanin
xiii
INTRODUCTION
1 1
Neural growth hormone
Growth hormone (GH) is a polypeptide hormone formed of 191 amino acids in a single chain (Corpas et al., 1993). It is secreted mainly by the somatotropic cells of the anterior pituitary gland under the control of two main factors secreted from the hypothalamus, GH releasing hormone (GHRH) and GH inhibiting hormone or somatostatin (Corpas et al., 1993; Tannenbaum, 1990;
Vance et al., 1985; Reichlin, 1983). GH secretion is pulsatile (Wajnrajch, 2005;
Vance et al., 1985). GH secretion is increased during deep sleep ((Wajnrajch,
2005), by exercise (Berg and Bang, 2004), during starvation (Tanaka et al.,
2004). GH secretion is decreased during aging, and by obesity (Iranmanesh et al., 1991).
Figure 1. Control of GH secretion. GH is secreted under the control of GHRH and GH inhibiting hormone or somatostatin. GH secretion has a feed back regulatory effect on the hypothalamus, inhibiting the secretion of GHRH and increasing the secretion of somatostatin. The main stimuli increasing GH secretion are deep sleep and exercise.
2 2
30 Sleep
l Strenuous m /
g exercise n
H 20 ma G s a pl 10 man u H
0
8am 12 4pm 8pm 12 4am 8am Noon Midnight
Figure 2. Variations in human GH secretion throughout the day.
Major pulses of GH secretion occur in response to strenuous exercise and deep sleep. The secretory profile for GH in rats is also pulsatile, ranging up to several hundred ng/ml.
3 3
It has recently become well established that GH gene expression is not restricted to the pituitary gland but also occurs in many extra-pituitary tissues including both the central and peripheral nervous system (Harvey and Hull,
2003). GH immunoreactivity is detected in the brains of human embryos at 8 weeks of development, before its appearance in the pituitary at the end of the first trimester (Costa et al., 1993). On the tenth day of the 22 days gestational period, GH starts to appear in rat brain: two days before its appearance in the pituitary gland (Hojvat et al., 1982). GH is found in the midbrain, hippocampus, cortex, striatum, olfactory bulb and cerebellum, at higher concentration in female rats compared to male rats (Mustafa et al., 1994b). In the chicken high GH levels are detected in the spinal cord as early as the second day of embryonic development, before its appearance in the pituitary at mid-late incubation
(Harvey and Hull, 2003).
GH is present in hypothalamic as well as extra-hypothalamic areas of chicken brain (Render et al., 1995). GH immunoreactivity has been detected in the spinal cord, hippocampus, hypothalamus, otic and optic vesicles of chicken embryonic brain (Murphy and Harvey, 2001). GH immunoreactivity has been detected in the peripheral nervous system of chick embryos, particularly in the trigeminal and vagal nerves (Murphy and Harvey, 2001). GH immunoreactivity has also been detected in the hippocampus, periventricular, paraventricular, inferior and infundibular hypothalamic nuclei, in the medial and lateral septal
4 4
area, and in the median eminence of turkey brain and ringdove brain (Ramesh et al., 2000).
Cerebrospinal GH could reflect either GH synthesized in the CNS or sequestration of GH from systemic circulation (Harvey and Hull, 2003). In support of the first hypothesis, trace amounts of GH have been detected in serum following hypophysectomy (Lazarus and Scanes, 1988). Also the presence of higher concentration of GH in the hypothalamic hypophyseal blood compared to the peripheral blood indicates central secretion of GH into the systemic circulation (Paradisi et al., 1993).
The abundance and wide spread presence of GHRs in the brain supports the possibility that neural tissues are target sites for GH action (Harvey et al.,
1993). Hippocampal GHRs have been identified in both humans and rats (Lai et al., 1993; Zhai et al., 1994). Recently the GHR cDNA nucleotide sequence has been described in rat hippocampus (Thornwall et al., 2001).
Cerebrospinal fluid (CSF) levels of GH are much lower compared to that of the systemic circulation, reflecting the poor permeability of cerebral microvessels (Prahalada et al., 1999). Cerebrovascular permeability is greatest during fetal development and decreases with age (Mustafa et al., 1995).
Increased cerebrovascular permeability after CNS injury leads to rapid upregulation of GHRs in the endothelium of cerebral blood vessels (Scheepens et al., 1999), suggesting the possibility of receptor mediated sequestration of GH
5 5
from the systemic circulation (Harvey and Hull, 2003). GHRs are also abundant in choroid plexus, supporting the peripheral origin of CSF GH (Harvey and Hull,
2003). CSF GH level is increased following its peripheral administration in humans (Nyberg and Burman, 1996), with a dose-dependent increase in CSF
GH concentration in patients who received s.c. injections of GH (Burman et al.,
1996). Peripheral origin of central GH is also supported by the higher CSF level of GH in patients suffering from acromegaly (Schaub et al., 1977). Additional support for the peripheral origin of central GH is seen in the correlated decline in
CSF and plasma GH levels with age (Heinze et al., 1998).
Therapeutic applications of growth hormone
Growth hormone (GH) is considered a successful therapeutic drug for children and adults with GH deficiency, as well as for growth retardation due to chronic renal disease, Turner syndrome, and in children born small for gestational age (Kappelgaard et al., 2004). Short children born small for gestational age (SGA) have reduced serum leptin levels which are inversely correlated with their chronological age (Boguszewski et al., 1997). Serum leptin levels correlate with the growth response to GH treatment and may be used as a marker for predicting the growth response to GH treatment (Boguszewski et al.,
1997). Hyperlipidemia, diabetes mellitus type 2, and coronary heart disease are commonly associated with being born SGA (Pareren et al., 2003). GH treatment has a positive effect for up to 6 years on body composition, blood pressure (BP), and lipid metabolism (Sas et al., 2000). Therefore, GH treatment might
6 6
counteract the reported higher risk of cardiovascular diseases in later life for children born SGA (Sas et al., 2000).
It is well established that GH therapy has beneficial effects on statural growth in children (Darendeliler et al., 2005). High dose GH therapy starting before puberty accelerates bone age and induces an earlier onset of puberty
(Kamp et al., 2002). In short children born SGA, three years of GH treatment normalized their height during childhood and increased bone maturation proportionately to the height gain (Arends et al., 2003). Thus, it is better to start
GH treatment at an early age in order to achieve a normal height before puberty starts (Arends et al., 2003). Serious GH deficiency and short stature can be treated by KP-102 (D-alanyl-3-(2-naphthyl)-D-alanyl-L-alanyl-L-tryptophyl-D- phenylalanyl-L-lysinamide dihydrochloride, growth hormone-releasing peptide-2,
GHRP-2), which potently promotes growth hormone (GH) release by acting at both hypothalamic and pituitary sites (Furuta et al., 2004). There are dose- dependent increases in final height in children with idiopathic short stature treated with GH (Wit et al., 2005).
One year of GH treatment in pre-pubertal children with idiopathic GH deficiency (GHD), Turner syndrome (TS) or idiopathic short stature (ISS), and short pre-pubertal children born SGA, normalized progression of bone age (BA)
(Darendeliler et al., 2005). GH treatment for three years induced proportionate growth resulting in a normalization of height and other anthropometric
7 7
measurements, including head circumference, in contrast to untreated SGA control subjects (Arends et al., 2004). Lowered intelligence, poor academic performance, low social competence, and behavioral problems are also associated with being born SGA (Pareren et al., 2003). In adolescents born SGA,
GH therapy produced marked improvement over time in behavior and self- perception parallel to GH-induced catch-up growth (Pareren et al., 2004).
Prader-Willi syndrome (PWS) is a genetic disease that is caused by an alteration in the molecular composition of a critical region of chromosome 15
(Whitman et al., 2002). PWS is characterized by obesity, hyperphagia, hypotonia, short stature, hypogonadism, and a neurobehavioral profile that includes cognitive deficits, learning problems, and behavioral difficulties that increase in both quantity and severity over time (Whitman et al., 2002). In addition to hyperphagia, which has proven refractory to all psychopharmocologic intervention, decreased energy expenditure and reduced physical activity often lead to morbid obesity in patients with PWS (Whitman et al., 2002). GH treatment produced significant reduction of depressive symptoms and improvements in physical parameters in children over 11 years old with PWS (Whitman et al.,
2002).
Human growth hormone has become a popular ergogenic aid, improving exercise performance among athletes (Stacy et al., 2004). GH has supraphysiologic effects leading to lipolysis, with increased muscle volume
8 8
(Stacy et al., 2004). In addition, GH is considered an anti-aging drug and has improved athletic performance in isolated studies (reviewed in Stacy et al., 2004).
Both recombinant human growth hormone (rhGH) and insulin-like growth factor-I (IGF-I), have been considered beneficial for diseases associated with increased catabolism such as acquired immune deficiency syndrome (AIDS)
(Laurence, 1995). It has now been confirmed that GH as well as IGF-I produce increases in body weight, lean body mass, and sense of well-being among HIV+ individuals because of their ability to promote nitrogen retention, protein synthesis, and lipolysis (Laurence, 1995). GH also augments cellular immune function and modulates T lymphocyte trafficking in animal models of immune suppression, suggesting benefit for any immune suppressive disorders, including
HIV infection (Laurence, 1995).
Growth hormone and memory function
Recent studies have shown that GH affects many functions of the central nervous system, with beneficial effects on memory, alertness and motivation
(Fargo et al., 2002). GH deficiency (GHD) has well known detrimental effects on cognition and memory in humans. General fatigue, lack of concentration, memory disabilities and a diminished subjective sense of wellbeing are all problems detected in untreated adult GHD patients (Bjork et al., 1989; McGauley et al., 1990). Sleep disturbances and psychologically immaturity are problems of young GHD patients (Hayashi et al., 1992). Animal studies support these human
9 9
observations. In a passive avoidance task in young rats (3 months old), GH administration facilitated long-term memory and delayed extinction (Schneider-
Rivas et al., 1995). In this study, old rats (24 months old) did not benefit from GH treatment. However, in other studies using a different learning task, the Morris water maze, learning in old rats was improved by treatment with GHRH
(Thornton et al., 2000) or GH itself (Ramsey et al., 2004).
Long Term Potentiation (LTP) is a Model System for Mechanisms of
Memory
Physiologically, memories are caused by changes in the strength of synaptic transmission between neurons resulting in the formation of new pathways or facilitated pathways for transmission of nerve signals following previous neural activity (Guyton and Hall, 2000). Long term potentiation (LTP) is a long-lasting increase in the strength of synaptic transmission between nerve cells, induced in response to high frequency afferent stimulation (Bliss and Lomo,
1973). LTP has been most extensively studied in the hippocampus, a brain region known to be involved in memory functions (Bliss and Collingridge, 1993).
LTP is considered the best available model for studying the synaptic modifications that underlie memory formation and storage (Bliss and
Collingridge, 1993), and for this reason interest in LTP has steadily increased.
A novel form of synaptic plasticity, homosynaptic long-term depression
(LTD), has also recently been documented. LTD, like LTP, requires Ca2+ entry
1010
through NMDARs (Bear and Malenka, 1994). Recent studies suggest that LTD and LTP are functionally inverse processes, and that the mechanisms of LTP and LTD may converge at the level of specific phosphoproteins (Bear and
Malenka, 1994). Although the induction of both LTD and LTP require Ca2+ influx,
2+ a stronger depolarization and a greater increase in [Ca ]i are required to induce
LTP than to initiate LTD (Artola and Singer, 1993).
Glutamate receptors (GluRs)
Glutamate is the major excitatory neurotransmitter in the central nervous system, and GluRs are widely expressed throughout all major division of the central nervous system (McBain and Mayer, 1994). Ionotropic GluRs are classified into three major classes: alpha-amino-3-hydroxy-5-methyl-4-isoxazole proprionate (AMPA), kainate and N-methyl-D-aspartate (NMDA), based on their electrophysiological and pharmacological properties (McBain and Mayer, 1994).
Although the first recognized glutamate receptors were ligand-gated ion channels, a large number of G protein-coupled GluRs are also expressed throughout the CNS (Nakanishi, 1992).
N-methyl-D-aspartate receptors (NMDARs) are selectively activated by
NMDA, a synthetic analogue of aspartic acid, which does not occur naturally in the brain (Watkins and Evans, 1981). The NMDAR response to NMDA is potently blocked by aminophosphovalerate (AP5) (McBain and Mayer, 1994). Responses at NMDARs are strongly voltage-dependent and show high Ca2+ permeability
1111
(McBain and Mayer, 1994). The AMPA/ kainate subtypes of GluRs are also ligand-gated ion channels for which AMPA and kainate act, respectively, as preferential agonists. Both AMPA and kainate responses are blocked by a related set of quinoxaline diones (CNQX, DNQX, NBQX), but not by AP5
(McBain and Mayer, 1994). Non NMDARs (AMPA and kainate receptors) in general have only weak voltage dependence and low Ca2+ permeability (McBain and Mayer, 1994).
Four genes (GluR A-D/GluR1-4) code for the AMPA glutamate receptor subunits (Schoepfer et al., 1994). NMDARs are formed by coexpression of the
NR1 and one or more members of the NR2 family (NR2A-D) of genes (Schoepfer et al., 1994). The NR1 subunit is expressed throughout the brain and serves as a general partner for association with NR2 subunits (Monyer et al., 1992). The kinetic and pharmacological properties of NMDARs are dependent on the specific NR2 subunit expressed (Schoepfer et al., 1994).
GluRs, LTP, and memory
GH affects expression of NMDARs, which are required for normal memory function (Le Greves et al., 2002). Insertion of new GluRs into the postsynaptic membrane (Nayak et al., 1998; Shi et al., 1999) and the phosphorylation of the existing GluRs (Soderling and Derkach, 2000) are putative mechanisms underlying memory formation. NMDARs have an important role in synaptic plasticity, synaptogenesis, and excitotoxicity (Mallon et al., 2004). In cultured
1212
neurons, insertion of GluR1-containing AMPARs into neuron membranes was
induced by NMDAR activation, highlighting the role of NMDARs in synaptic
plasticity (Passafaro et al., 2001).
These findings demonstrate a mechanistic long-term relationship between
GH, memory function, NMDARs and LTP. Although the beneficial therapeutic
effects of GH on memory and cognition are well known, the underlying synaptic
mechanisms and their relation to GluRs in general and NMDARs in particular, as
well as the GH signaling pathway, have not been well investigated in the
hippocampus, or for that matter, any other brain region. The purpose of my
dissertation is to investigate possible short term effects of GH on synaptic
transmission in the CA1 area of rat hippocampus, and the mechanisms
underlying those effects. In assessing the potential role of GH as a short-term regulator of hippocampal function, I addressed three related questions.
First, does GH alter synaptic function in hippocampal area CA1, and if so, how?
To answer this question I applied GH to rat hippocampal brain slices and examined excitatory synaptic transmission for any GH-induced changes. A paired-pulse stimulation protocol was used to determine whether any change in synaptic strength was accompanied by an alteration in the presynaptic release of glutamate. I also examined the effect of brief tetanization (100 Hz, 1 s) following
3 hr of GH pretreatment, to determine if both GH and brief tetanus act through common mechamisms to regulate hippocampal synaptic transmission. The first section of my dissertation includes these experiments.
1313
Second, what signaling pathway(s) are responsible for short-term effects of GH on hippocampal synaptic function, and is synthesis of new proteins required for these effects? I hypothesized that GHR signaling in hippocampus would use signaling pathways previously described in other tissues. This hypothesis was tested by examining the effects of pharmacological inhibition of specific components of the hypothesized hippocampal GHR signaling pathway. These experiments form the basis of the second section of my dissertation.
Third, I asked whether GH effects on hippocampal synaptic function are mediated by NMDARs or AMPARs. I also asked if short-term treatment with GH has similar consequences on NMDAR expression as long-term, chronic treatment with GH. To answer the first of these questions, I used specific neurotransmitter receptor antagonists to pharmacologically isolate NMDAR and
AMPAR components of synaptic transmission, tested GH for effect on these isolated, components and compared the isolated NMDAR-mediated fEPSPs
(fEPSPNs) and isolated AMPAR-mediated fEPSPs (fEPSPAs) to the dual component fEPSPs. To answer the second question I used western blotting to measure NMDA-NR1, NR2A, and NR2B expression levels in GH treated and control rat hippocampal slices. The third section of my dissertation contains the results of these experiments.
1414
Section I
GH Enhances Excitatory Synaptic Transmission in Area CA1 of
Rat Hippocampus
1515
Introduction
Growth hormone and cognitive function
Age-related reductions in growth hormone secretion and cognitive impairments associated with aging are well documented. Carlson et al. (1972) reported a loss of nocturnal surges of GH in elderly individuals.
In adult hypopituitary patients with GH deficiency, rhGH treatment for 3 months had a beneficial effect on attentional performance (Oertel et al., 2004).
The P300 event-related potential (ERP) is a positive deflection in the EEG which occurs with a 300 ms latency following a novel or surprising event. The P300
ERP is thought to reflect cognitive and memory processing in frontal and temporal lobes, and it is altered in neurological patients with various cognitive impairments (Golgeli et al., 2004). P300 ERP latencies were prolonged in GHD patients with Sheehan's syndrome, indicating cognitive impairment. Six months of GH replacement therapy (GHRT) significantly elevated serum IGF-I levels, and improved P300 latencies, indicating normalization of cognitive function by GHRT
(Golgeli et al., 2004).
Aging is associated with both declining activity of the growth hormone- insulin-like growth factor-I (GH-IGF-I) axis and with a decrease in cognitive function (Arwert et al., 2003). An oral mixture of glycine, glutamine and niacin can enhance GH secretion and improve mood and cognition in healthy middle-
1616
aged and elderly subjects (Arwert et al., 2003). In a two year study, Stouthart et al (2003) examined psychological and cognitive consequences of discontinuation and restoration of GH treatment in young adults with childhood-onset growth hormone deficiency. Discontinuation of GH treatment led to a decrease in quality of life (QoL) within 6 months, and this effect was counteracted within 6 months after restarting GH treatment (Stouthart et al., 2003). A significant decrease in
IGF-I level and an increase in the number of psychological complaints and depression were observed in the first 6 months of the GH discontinuation period
(Stouthart et al., 2003). Increased IGF-I level, decreased anxiety and improved
QoL were observed in the first 6 months of GH restoration (Stouthart et al.,
2003). Depression scores tended to decrease across the 12 month treatment period. The intra-subject IGF-I level was negatively correlated with depression, fatigue, tension and anxiety, and was positively correlated with vigor and memory during the 2-year discontinuation and treatment period (Stouthart et al., 2003).
Both GH and IGF-1 affect the hippocampus. Hippocampal IGF-1 mRNA levels were increased by 1 week of treatment with either GH or GH-releasing peptide-6 (Fargo et al., 2002). The same effect was seen in the hypothalamus and cerebellum, but not the cerebral cortex (Fargo et al., 2002). Trace conditioning, a variant of Pavlovian conditioning, requires a learned association between two stimuli that are discontiguous in time, and the correct differentiation between the interstimulus interval, which is stable, and the intertrial interval, which is variable. Hippocampal GH mRNA, assessed by microarray, real-time
1717
PCR and in situ hybridization, was dramatically up-regulated following 200 trials of trace conditioning (Donahue et al., 2002). In addition, somatostatin mRNA which encodes a direct antagonist of GH secretion was reduced during trace conditioning (Donahue et al., 2002).
Lemon et al. (2003) examined learning on an 8 arm radial maze in transgenic mice which over-expressed growth hormone (TGM). TGM had elevated and progressively increasing free radicals (reactive oxygen and nitrogen species) in brain that strongly correlated with reduced survivorship. Compared to controls, TGM mice showed enhanced learning during early adulthood, but accelerated decline of learning during aging. The cognitive decline of TGM was abolished by a complex "anti-aging" dietary supplement formulated to promote membrane and mitochondrial integrity, increase insulin sensitivity, reduce free radicals, and ameliorate inflammation.
Long Term Potentiation (LTP) is a Model System for Mechanisms of
Memory
Long term potentiation (LTP), a long lasting enhancement of synaptic transmission in response to high frequency stimulation (HFS) (Bliss and Lomo,
1973), represents a good model for studying the synaptic modifications that underlie memory formation and storage (Bliss and Collingridge, 1993). In the
CA1 area of the hippocampus, LTP is triggered by calcium influx into postsynaptic neurons. NMDARs are a major route for this calcium entry (Bliss
1818
and Collingridge, 1993). Under some circumstances, metabotropic GluRs and
voltage-gated calcium channels also contribute to postsynaptic calcium increase.
The postsynaptic Ca2+ signal triggering LTP is transient; sustained enhancement
of synaptic transmission depends on Ca2+-activated, postsynaptic signaling pathways. These pathways lead to the insertion of new GluRs into the postsynaptic membrane (Nayak et al., 1998; Shi et al., 1999) and the phosphorylation of existing GluRs (Soderling and Derkach, 2000). Enhanced glutamate release from the presynaptic terminals also contributes to the maintenance of LTP (Bekkers and Stevens. 1990; Schulz et al., 1994; Kullman et al., 1996). These mechanisms support LTP during the first few hours Longer lasting synaptic enhancement requires gene expression and synthesis of new proteins (Stanton and Sarvey, 1984; Huang and Kandel, 1994; Nguyen et al.,
1994; Frey et al., 1996), and is accompanied by structural alterations of the synapse (Desmond and Levy, 1988; Trommald et al., 1996; Toni et al., 1999).
The use of LTP as a model for studying memory is supported by the importance of hippocampus in memory (Squire and Zola-Morgan, 1992). In addition, behavioral experiments in animals have shown that pharmacological and genetic manipulations which prevent normal NMDAR function cause parallel disruption of LTP and memory (Morris et al., 1986; Davis et al., 1992; Tsien et al., 1996). Although most experiments have been conducted on rats, mice and nonhuman primates, normal human memory performance is also dependent on hippocampal NMDARs (Grunwald et al., 1999). In addition to NMDARs, other
1919
components of the signaling pathways responsible for LTP have been implicated in learning and memory, including metabotropic GluRs (Riedel et al., 1994; Kaba et al., 1994) and protein kinases (Mathis et al., 1992; Silva et al 1992). These findings demonstrate that a common set of cellular mechanisms underlies both
LTP and memory.
The purpose of this study was to determine if short-term treatment with
GH would alter synaptic transmission in the CA1 area of rat hippocampus. To achieve this goal, I examined the effects of GH application on excitatory synaptic transmission and on paired-pulse facilitation of excitatory synaptic transmission
(a presynaptic, very short-duration form of plasticity). In addition I examined the effect of brief high frequency stimulation (HFS, 100 Hz, 1 s) following 3 hr of GH pretreatment, to determine if both LTP and GH act through common regulatory mechanisms. Electrophysiological recordings from area CA1 of rat hippocampal brain slices were used in these experiments.
2020
Materials and Methods
Slice preparation
Hippocampal slices were prepared from 1.5 to 3 month old male Sprague-
Dawley rats (Hilltop Laboratory Animals). Animals were sedated by inhalation of a CO2/air mixture and decapitated. The skull was opened and the brain was
2+ removed and submerged in chilled, oxygenated (95% O2/5% CO2), low Ca /high
Mg2+ artificial cerebrospinal fluid (ACSF), pH 7.35 and composed of: 124 mM
NaCl, 26 mM NaHCO3, 1.2 mM NaH2Po4, 3 mM KCl, 0.5 mM CaCl2, 5 mM
MgSO4 and 10 mM glucose.
While submerged in chilled low Ca2+/high Mg2+ ACSF the brain was
trimmed to a block containing both hippocampi. The block was glued to the
stage of a vibrating microtome (Campden Instruments), immersed in a bath of
chilled, oxygenated, low Ca2+/high Mg2+ ACSF, and 400 µm coronal sections
were cut. Sections containing the hippocampus in transverse profile were
selected and transferred to a small petri dish, where they were further dissected
to free the hippocampus from surrounding tissue (Figure 3). After dissection,
hippocampal slices were transferred to a holding chamber, where they were
stored for later use (Figure 4).
2121
Figure 3. Preparation of rat hippocampal slices. Rat brains were blocked and
glued to the stage of a microtome (top, left to right). Sections were cut, collected
and dissected to isolate individual hippocamal slices (bottom, left to right).
Slices were maintained in a holding chamber at room temperature (20-22
ºC) at the ACSF/atmosphere (95% O2/5% CO2) interface. The holding chamber was filled with standard ACSF, pH 7.35 and composed of 124mM NaCl, 26mM
NaHCO3, 3.4 mM KCl, 1.2 mM NaH2PO4, 2.0 mM CaCl2, 2.0 mM MgSO4, and 10 mM glucose. Slices were incubated in the holding chamber for a minimum of one hr prior to use.
2222
Figure 4. The interface holding chamber used for preincubation of individual hippocampal brain slices. The chamber was composed of a small glass beaker with nylon netting stretched over the opening and covered with a piece of lancet paper. The small beaker was placed inside larger beaker and both beakers were filled with ACSF up to a level matching the height of the smaller beaker. A line supplying a gas mixture (95% O2/ 5% CO2) was placed inside the holding chamber. The chamber was covered and kept at room tempreture. Hippocampal slices were incubated for at least an hour before being transferred to the recording chamber.
2323
Slices were withdrawn from the holding chamber as needed and placed in
a low volume (approximately 200 µl) interface recording chamber, where they
were continuously perfused at a rate of 1-1.5 ml/min with standard ACSF. The
recording chamber was kept at a temperature of 25±0.5 °C. A minimum 30 min
period was allowed for recovery after transferring slices from the holding to the
recording chamber.
Field potential recording
Extracellular potentials were recorded through low impedance (3-4 MΩ) glass micropipettes filled with ACSF and placed into the stratum radiatum of area
CA1 (Figure 5 and 6). Signals were amplified (gain 1000) and filtered (0.1 -
3,000 Hz) using a WPI DAM50 amplifier, then digitized (10 kHz; National
Instruments) and stored on a personal computer.
Synaptic stimulation
Postsynaptic potentials were evoked by delivery of constant voltage
stimuli through a bipolar stimulating electrode placed into stratum radiatum.
Stimuli were delivered at a 15 sec interval. In some field potential recordings,
paired stimuli (50 ms interstimulus interval) were delivered in order to measure
paired-pulse facilitation. Paired-pulse facilitation was quantified as the ratio of
the second response divided by first response.
2424
Postsynaptic potentials evoked in standard ACSF were quantified by measuring the slope of the linear portion of the initial response. Changes in synaptic response caused by GH treatment or LTP induction were expressed as percentage of baseline prior to treatment or tetanization.
Figure 5. The recording chamber (left) and typical placement of recording and stimulating electrodes (right). The recording chamber used in the study was Stoelting company model 51430 tissue chamber (left). A bipolar metal stimulating electrode and a glass recording electrode were placed into hippocampal area CA1.
2525
Figure 6. Schematic illustration of hippocampal synaptic organization.
Transverse section of rat hippocampus showing the three major afferent pathways that form the trisynaptic circuit in hippocampus and the typical placement of recording and stimulating electrodes in stratum radiatum of area
CA1. The arrows indicate the direction of information flow through the trisynaptic circuit.
2626
LTP induction
LTP was examined in standard ACSF. LTP was induced by a single high frequency stimulus train (100 Hz, 1 s). The stimulus intensity used for tetanic stimulation was set at the population spike threshold. LTP was assessed in slices pretreated with GH (22 ng/ml, dissolved in standard ACSF) for 3 hr and in control slices exposed to standard ACSF only for an equivalent time period.
Slices were pretreated in the interface holding chamber, then transferred to the recording chamber where they were perfused with standard ACSF for recording and assessment of LTP.
Reagents
I used rhGH (Bachem). The doses used in these recordings ranged from
0.5 to 1 nM or (11-22 ng/ml) which is within the physiological range; GH serum level ranged between few ng/ml and several hundred ng/ml in rats (Kimura and
Tsai 1984; Everson and Crowley, 2004). Human GH is a potent, relatively selective agonist of GHRs in male rats. Mustafa et al. (1994a) reported the presence of specific binding sites for hGH in rat brain which were moderately high in hippocampus, hypothalamus and striatum. Moreover, those binding sites for hGH were almost exclusively somatogenic in male rat brains (Mustafa et al.,
1994b). However in female rat brain these sites display somatogenic and lactogenic characteristics (Mustafa et al., 1994b). This is also supported by the finding of Ranke et al. (1973) who studied the sex differences in binding of hGH to isolated rat hepatocytes. They reported that hGH binds only to somatogenic
2727
receptor in hepatocytes of male rats. However in female rats and estrogen treated males hGH has both somatogenic and lactogenic properties (Ranke et al., 1973). In summary, in male rats (used in this study) hGH has less potential to bind non specifically to lactogenic receptors.
Data analysis
Field potentials were collected and analyzed using The WinWCP program
(John Dempster, University of Strathclyde). Additional analysis was completed using Excel (Microsoft) and Origin (OriginLab). All statistics are presented as mean ± one standard error of the mean. Statistical significance was assessed using paired and unpaired t-test, as appropriate, with p<0.05 considered significant.
2828
Results
Growth hormone enhanced excitatory synaptic transmission
I used field potential recordings (fEPSP) to determine if GH application
affects excitatory synaptic transmission. Application of GH (11-22 ng/ml) caused a slow increase in fEPSP slope (Figure 7). Although fEPSPs began to increase within minutes of starting GH application, the maximal increase required 60-120
min. GH enhancement of fEPSP persisted for more than 4 hours Control slices,
exposed to ACSF for the same duration, did not show any increase in fEPSP
slope (p<0.01, control vs GH after 60 min of application).
Growth hormone did not affect paired pulse facilitation
The GH-induced increase in fEPSP slope could be due to enhanced
postsynaptic response to glutamate, or increased presynaptic release of
glutamate. Increased probability of transmitter release is accompanied by
decreased paired-pulse facilitation (PPF) (Dobrunz and Stevens, 1997).
Therefore, to determine if increased probability of glutamate release might
underlie the GH enhancement, I examined PPF during GH application. Neither
GH treated nor control slices showed a change in PPF ratio (Figure 8). This lack
of change in PPF argues against an increase in glutamate release as a
mechanism for the GH enhancement of excitatory synaptic transmission.
2929
Growth hormone inhibits LTP in area CA1 of rat hippocampus
A single train of high frequency stimuli (HFS, 100 Hz, 1 s) failed to potentiate synaptic responses in slices pretreated with GH (22 ng/ml; p > 0.4).
However, HFS with the same 100 Hz protocol caused significant enhancement of fEPSPs in control slices pretreated with standard ACSF (p < 0.02; Figure 9).
3030
Figure 7.
A
3131
B
3232
Figure 7. GH Enhanced Excitatory Synaptic Transmission in Area CA1 of
Rat Hippocampus.
A. GH application (11-22 ng/ml) caused a slow enhancement of fEPSPs
(squares) in comparison to control slices treated with ACSF only (diamonds). GH application began after 15 min of recording and continued for >5 hours The inset at top shows fEPSPs changes during the baseline and after 3 hr of GH and control treatment.
B. Summary of GH effects on fEPSPs. fEPSPs were averaged over 15 min baseline period and 1 hr period during GH application. fEPSPs from GH treated slices were significantly enhanced compared to controls at all time points:
*P<0.05, **P<0.01, ***P<0.005. These data represent the average of 10 slices treated with GH and 4 control slices.
3333
Figure 8.
A
3434
B
2.5
2
o i 1.5 Rat F 1 PP
0.5
0 baseline GH 1st hr GH 2nd hr
Figure 8. GH did not alter the paired-pulse facilitation (PPF) ratio.
A. Paired stimuli (50 ms interstimulus interval) were delivered at 15 sec intervals.
There was no change in PPF ratio during GH application. The inset at top shows fEPSPs during baseline and the second hr of GH application. Substantial paired- pulse facilitation is seen at all times (the second response is bigger than the first response), but the application of GH did not alter the PPF ratio.
B. Summary of all recordings in which PPF was examined during GH application. PPF was not significantly different during either the first or the second hr of GH treatment compared to the baseline (p < 0.2, n = 9)
3535
Figure 9.
A
3636
B
350 *
ine) 300 el
bas 250 % 200
150 SP slope ( 100 fEP 50
0 control GH pretreated
Figure 9. GH pretreatment prevented LTP in area CA1 of rat hippocampus.
A. Stable baseline responses were recoded for a 15 min period preceding tetanic stimulation (100 Hz 1s). Control slices showed enhancement of fEPSPs after tetanus (diamonds), but LTP was completely prevented in GH pretreated slices
(squares). The inset at top shows baseline responses and responses after tetanus (control upper left and GH treated upper right).
B. Summary of LTP results in GH pretreated and control slices. Control slices (n
= 8) showed significant potentiation of the fEPSP (*p<0.02), but GH pretreated slices (n=8) failed to show any significant change in fEPSP (ns p<0.44).
3737
Discussion
Short term, minutes to hours, application of GH to in vitro rat hippocampal brain slices enhanced excitatory synaptic transmission and also inhibited further potentiation by tetanus. In a recent study Fargo et al. (2002) have shown that GH affects many functions of the central nervous system, with beneficial effects on memory, alertness and motivation. Le Greves et al. (2002) observed dose dependent improvement in memory and learning after 1 week of daily injections of rhGH in hypophysectomized male rats. Memory deficiency including both short and long term memory is a well known syndrome in GHD patients (Deijen et al.,
1996; Aleman et al., 2000). In addition, adult patients suffering from hypopituitarism with GH deficiency showed improvement of attentional performance when treated with GH for at least 3 months (Oertel et al., 2004). An age-related decrease of GH is associated with defects in spatial memory in animals (van Dam et al., 2000), and it is well established that the decline in the cognitive function with aging is paralleled with decreased circulating levels of GH
(Le Greves et al., 2002).
This raises the question, how does GH treatment improve memory, alertness, and cognition? The process of memory storage in the brain certainly involves some form of synaptic modification (Rosenzwing and Barnes, 2003).
Recent investigations have suggested a role for GH in memory, which may be mediated by the influence of GH on neuronal plasticity in the hippocampus. Since
3838
the hippocampus is critically important in memory and learning processes (Le
Greves et al., 2002), I applied GH to in vitro hippocampal brain slices of rats to determine if it affects synaptic transmission. GH substantially enhanced synaptic transmission in area CA1 of rat hippocampal slices, exerting a maximum effect within 2 hr (Figure 7). Taken together, this suggests that GH may improve memory by enhancement of synaptic transmission between hippocampal neurons. However, prior treatment with GH for 3 hr also blocked synaptic enhancement induced by brief tetanus (100 Hz, 1 s), (Figure 9). How can this dual effect of GH be explained?
Although LTP was originally described as synaptic enhancement resulting from high frequency electrical stimulation (Bliss and Collingridge, 1993), similar synaptic potentiaton may result from application of several different chemical compounds, including neutrophins, second messenger analogs, and conventional neurotransmitters. Although the term LTP typically refers to electrically-induced synaptic enhancement, we could say that LTP is of 2 types: drug-induced and electrically-induced. Drug-induced LTP has been demonstrated following treatment with the neurotrophins, BDNF and NT-3, forskolin and the membrane-permeable cAMP analog Sp-cAMPS, and also dopamine receptor agonists (D1 and D2) (Frey et al., 1993; Huang et al., 1994.,
Huang and Kandel, 1995; Kang and Schuman, 1995).
3939
Previous studies in hippocampal slice preparations have distinguished two
major temporal phases of LTP, early and late, based on their sensitivities to
inhibitors of mRNA and protein synthesis (Krug et al., 1984; Huang and Kandel,
1994). In contrast to the early phase of LTP (E-LTP), the late phase of LTP (L-
LTP) is of greater amplitude and longer duration, lasting more than 3 hr (Kelleher et al., 2004a). In contrast to the L-LTP produced by repeated tetanization, L-LTP produced by drugs develops gradually, requiring 1 to 2 hr to reach its maximal level. Both drug- and electrically-induced L-LTP are abolished completely by protein synthesis inhibitors (Kelleher et al., 2004a). Previous studies indicated that L-LTP produced by repeated tetanization and L-LTP produced by elevation of intracellular cAMP share a common protein synthesis-dependent mechanism
(Kelleher et al., 2004a). Establishment of cAMP-induced LTP prior to repeated tetanization blocks L-LTP (Frey et al., 1993; Huang and Kandel, 1994). The idea that drug-induced L-LTP can block electrically-induced L-LTP is also supported by the finding of Martin et al. (1997) that MAPK may be a general mechanism for long-term plasticity in all kinds of LTP. They found that MAPK translocates into the nucleus of the presynaptic but not the postsynaptic cell during 5-HT-induced long-term facilitation, suggesting that MAPK may play a similar role in hippocampal long-term potentiation. PKCζ may also play essential roles in both drug-induced and electrically-induced LTP, since treatment of hippocampal CA1 pyramidal neurons with PKC ζ activators produces robust potentiation of synaptic transmission that occludes subsequent electrically-induced LTP (Ling et al.,
2002).
4040
I found that a brief tetanus (100 Hz, 1 s), which normally induces LTP had no effect in slices pretreated with GH for 3 hours This effect of GH on hippocampal synaptic function raises another question; does GH act through a similar signaling pathway to that of LTP? If so, then prior saturation of this pathway by pretreatment with GH should prevent subsequent electrically-induced
LTP. In order to answer the questions raised by my first set of experiments, the
GH signaling pathway in hippocampus must first be defined. It will then be possible to compare the GH signaling pathway with the LTP signaling pathway which is already well described in the literature.
4141
Section II
Growth Hormone Signaling Pathways in Area CA1 of Rat
Hippocampus
4242
Introduction
Pretreatment with GH blocked the effect of a brief tetanus (100 Hz, 1 s) which normally induces LTP. This effect of GH on hippocampal synaptic function raises another question; does GH act through a similar signaling pathway to that of LTP? If so, then prior saturation of this pathway by pretreatment with GH should prevent subsequent electrically-induced LTP. In order to answer this question tetanization-induced-LTP signaling pathway(s) and GH signaling pathway(s) in other tisssues which are already well described in the experimental literature will be reviewed.
Tetanization-induced L-LTP signaling pathway
LTP induction is disrupted by pharmacological inhibitors of the Ras effectors PI3-kinase (Kelly and Lynch, 2000; Lin et al., 2001; Kelleher et al.,
2004a; Sanna et al., 2002) and p44/42 MAPK (Sweatt, 2001; Adams and Sweatt,
2002). LTP is also inhibited in hippocampal pyramidal cells expressing a dominant negative form of Ras (Zhu et al., 2002). Furthermore, MEK inhibitors strongly reduce the induction of LTP by theta pulse stimulation (TPS) (Winder et al., 1999; Watabe et al., 2000). There are at least two possible roles for ERK activation in LTP. First, MAPK activation has an important role in the mRNA and protein synthesis stages of LTP maintenance (Impey et al., 1998; Davis et al.,
2000). Second, MAPK activation contributes to LTP induction through downregulation of dendritic A-type K+ channels (Sweatt, 2001). Downregulation
4343
of dendritic A-channels allows greater postsynaptic depolarization during tetanization, leading to greater voltage-dependent calcium influx, and enhanced downstream activation of calcium-dependent processes.
LTP induced by short trains of TPS is almost completely blocked by the
PI3-kinase inhibitors LY294002 and wortmannin (Opazo et al., 2003). PI3-kinase is important for the induction of LTP, but not for the maintenance of LTP, as PI3- kinase inhibitors applied after LTP induction do not block LTP (Opazo et al.,
2003). Several possible roles for PI3-kinase in LTP induction have been suggested. LTP-inducing patterns of synaptic stimulation activate the atypical
PKC isoform PKCζ (Sacktor et al., 1993), and inhibitors of PKCζ inhibit LTP in hippocampal area CA1 (Ling et al., 2002). PI3-kinase contributes to the early activation of PKCζ during LTP induction (Opazo et al., 2003), perhaps via activation of PDK-1 (Chou et al., 1998; Le Good et al., 1998). In addition, PI3- kinase is important for the trafficking and insertion of some membrane proteins during LTP induction (Corvera and Czech, 1998; Wu et al., 1998; Rameh and
Cantly, 1999; Lhuillier and Dryer, 2002). Finally, PI3-kinase might have a role in the dendritic spine changes associated with LTP and induced by either organizational changes of actin cytoskeleton (Rodgers and Theibert, 2002) or activation of synaptic NMDA receptors (Yuste and Bonhoeffer, 2001).
4444
Growth hormone signaling pathway
Tissue sensitivity to GH. Growth hormone (GH) differs from other pituitary hormones in its wide spectrum of cellular activities in several different tissues which are all mediated by a common receptor, suggesting tissue-specific differences in the post-receptor mechanisms (Hull and Harvey, 1998). One of the mechanisms that confers specificity is tissue sensitivity to GH stimulation. Tissue sensitivity depends upon the abundance of GH receptors (GHRs), the amplitude and pulsatility of GH secretion and the presence of non-signal transducing GH- binding proteins (GHBPs), which result from alternate splicing of GHR gene transcripts (Hull and Harvey, 1998). Additional diversity stems from tissue- specific autoregulation of GHRs and GHBPs. Hypophysectomy decreased both
GHR and GHBP transcripts in the hypothalamus of rats by 20%; however, neither transcript was affected in the liver, spleen, cortex/neocortex or brainstem
(Hull and Harvey, 1998). On the other hand, a single bolus GH injection increased circulating GH concentrations, GHR and GHBP mRNA content by 25-
30 % in all brain regions and in the spleen of hypophysectomized rats (Hull and
Harvey, 1998).
GH regulation of GHRs. GHR mRNA levels were increased within 1 hr of a single injection of human GH (100 µg/ rat), and maximal levels were reached between 3-12 hr after the injection (Vikman et al., 1991). The increase in GHR mRNA levels was dose dependent and also was observed after prolonged treatment (1 or 5 mg/kg/day for 6 days) with bovine GH. Furthermore, there was
4545
a rapid and GH-dependent regulation of GHR mRNA levels in adipose tissue
(Vikman et al., 1991). Using PCR, GH treatment by s.c. injection for 10 days increased expression of GHR transcripts in the hippocampus of young adult rats, reflecting the ability of the hormone to reach the brain and stimulate hippocampal cells (Le Greves et al., 2002).
Overview of GHR signaling. The receptors for GH, prolactin, erythropoietin, and interleukin 2 all belong to the same large family of single chain transmembrane receptors (Xiaowei et al., 1995), the cytokine receptor superfamily. The receptors in this family have similar extracellular domains which are rich in cysteine, a motif that has been shown to be important in protein- protein interaction as well as in cell-cell interaction (Bazan, 1989; Patty, 1990).
Activation of the GHR, like other members of the cytokine receptor family, stimulates Janus kinase 2 (JAK2) association with the GHR, followed by tyrosine phosphorylation of both proteins (Argetsinger et al., 1993; Sotiropoulos et al.,
1994). The activated GHR-JAK2 couple stimulates several signaling cascade, including the Ras/Raf/MEK1/MAPK pathway, the insulin receptor substrate-
1(IRS-1)/PI3kinase pathway and the STAT pathway (Liang et al., 2000).
MAPK pathway. Binding of GH and prolactin (PRL) to their receptors activates JAK2 tyrosine kinase, the initial step in all biological actions of GH
(Yamauchi et al., 1998). The activated GH/JAK2 complex in turn activates STATs as well as ERK/MAPKs (Winston and Hunter, 1995). The GHR/JAK2-mediated
4646
activation of ERK2/MAPK is through both Ras and Raf (Winston and Hunter,
1995). GH promoted the rapid, transient association of SHC with the Grb2-SOS complex. This correlated with the time course of Ras, Raf, and MEK activation with Ras, Raf, and MEK returning to near basal activity by 15 or 30 min despite the continuous presence of GH (Vanderkuur et al., 1997).
Phosphorylation of the JAK2-GHR complex, through activation of MAPK, leads to increased IGF-1 mRNA expression in liver (Xu et al., 1995). The
GHR/JAK2-MAPK stimulation of IGF-1 production shows an age-related decline.
In 17-month-old female C57BL/6 mice IGF-1 gene expression is decreased, but this is not directly associated with decreased GHR complex phosphorylation or
MAPK activity (Xu et al., 1995). However, by the age of 31 months the decrease in IGF-1 gene expression is associated with a marked decline in GHR and JAK2 phosphorylation and decreased MAPK activity (Xu et al., 1995).
GH stimulation leads to phosphorylation of Elk-1 and transcriptional activation (Hodge et al., 1998). Overexpression of dominant-negative Ras or the
ERK-specific phosphatase, mitogen-activated protein kinase phosphatase-1, or addition of the MEK inhibitor PD098059, blocked GH-stimulated activation of
Ras/MEK/ERK pathway and abrogated GH-induced activation of Jun N-terminal kinase and phosphorylation of Elk-1 in 3T3-F442A cells (Hodge et al., 1998). GH also activates MAPK in a less direct manner, via tyrosine phosphorylation of the epidermal growth factor receptor, stimulating its association with Grb2, and
4747
resulting in activation of the MAPK signaling pathway in liver tissue (Yamauchi et al., 1998).
PI3- kinase pathway. GH induces tyrosine phosphorylation of insulin receptor substrate (IRS)-1/IRS-2 in liver (Yamauchi et al., 1998). IRS-1, -2, and -
3 are phosphorylated by JAK2 providing docking sites for p85 PI3-kinase and activating PI3-kinase leading to downstream biological effects (Yamauchi et al.,
1998). Wortmannin, a specific PI3-kinase inhibitor completely, blocked the anti- lipolytic effect of GH in 3T3 L1 adipocytes (Yamauchi et al., 1998).
STAT pathway. GH activates JAK2 tyrosine kinase and members of the
STAT family of transcription factors, including STATs 1, 3, and 5 (Smit et al.,
1997). At least two STAT5 proteins (STAT5A and STAT5B) exist in mouse and human (Smit et al., 1997). GH activates both STAT5A and STAT5B in several cell types (Smit et al., 1997). GH-dependent tyrosyl phosphorylation of both
STAT5A and STAT5B requires the same specific regions of the GHR and activation of JAK2 kinase (Smit et al., 1997). GH plays an important role in specific gene transcription through transient activation of STAT proteins (Rico-
Bautista et al., 2004). GH activates STAT5 by a rapid but transient mechanism that involves tyrosine phosphorylation and nuclear translocation (Fernandez et al., 1998). GH-induced STAT5 DNA-binding activity was detected after 2 min, reached a maximum at 10 min, decreased rapidly up to 1 hr of GH treatment, and the remaining activity declined slowly thereafter (Fernandez et al., 1998).
4848
Termination of GH signaling at the GHR/ JAK complex occurs through
GH-induced ubiquitination/internalization of the GHR and also by the action of
SOCS (suppressor of cytokine signaling) (Rico-Bautista et al., 2004). Greenhalgh and Alexander (2004) reported that SOCS are a family of proteins that are produced in response to signals from cytokines and growth factors and which act to attenuate cytokine signal transduction. Members of the SOCS family (SOCS-1 to SOCS-7 and CIS) share a central SH2 domain and a C-terminal SOCS box and form a classical negative feedback loop that inhibit JAK/STAT signalling cascade (Larsen and Ropke, 2002). Recent studies indicated that SOCS bind to phosphotyrosines on the target protein through their SH2 domain, leading to inhibition of signal transduction by N-terminal inactivation of JAK resulting in blocking of access of STAT to the receptor sites (Larsen and Ropke, 2002). In addition, SOCS through their SOCS box-targeting bound proteins to proteasomal degradation (Larsen and Ropke, 2002).The expression of CIS, SOCS1, SOCS2 and SOCS3 proteins is induced in cells stimulated with GH and their over- expression in cell lines blocks aspects of GH signalling (Greenhalgh and
Alexander, 2004). On the other hand, mice lacking SOCS2 display gigantism accompanied by evidence of lack of regulation of GH signaling (Greenhalgh et al., 2005).
GH signaling is also affected by the integrity of cellular cytoskeleton. The
GHR/JAK2/STAT5 signaling pathway is negatively regulated by the integrity of the actin cytoskeleton network, which facilitates GHR ubiquitination and
4949
degradation (Rico-Bautista et al., 2004). Rico-Bautista et al. (2004) investigated the effects of actin cytoskeleton disruption on the kinetics of GH-activated
GHR/JAK2/STAT5 signaling pathway. They found that disruption of the actin- based cytoskeleton with cytochalasin D (CytoD) prolonged both JAK2/STAT5 tyrosine phosphorylation and STAT5 DNA binding activity. In addition, they demonstrated that although CytoD treatment did not affect the synthesis of
SOCS proteins (SOCS-1, -2, and -3), the inhibitory actions of SOCS1, 2, and -3 on GH-induced STAT5 reporter activity were partially blocked by disruption of the cytoskeleton. They also reported that the disassembly of actin filaments by
CytoD was accompanied by accumulation of ubiquitinated forms of GHR, but it did not affect GHR internalization.
Although GH-induced JAK2/STAT5 activation was independent of protein synthesis, a rapid decrease in STAT5 DNA-binding activity within 1 hour is dependent on protein synthesis (Fernandez et al., 1998). JAK2 tyrosine phosphorylation and STAT5 DNA-binding activity were prolonged for at least 4 hours in the presence of cycloheximide, a protein synthesis inhibitor, indicating that maintenance of desensitization requires ongoing protein synthesis
(Fernandez et al., 1998). Termination of GH-induced STAT5b signaling involves down-regulation of JAK2 signaling to STAT5b by phosphotyrosine phosphatase
(Gebert et al., 1999).
5050
Cellular stress may modulate transcription through the JAK/STAT pathway. Flores-Morales et al. (2001) reported that endoplasmic reticulum stress prevents the inactivation of STAT5 DNA binding activity by modulating the rate of
JAK2/STAT5 dephosphorylation. They found that endoplasmic reticulum stressors dithiothreitol, calcimycin (A23187) and 1,2-bis(o-aminophenoxy)ethane-
N,N,N,N-tetraacetic acid (acetoxymethyl) ester (BAPTA-AM) prolong GH-induced phosphorylation of JAK2 and STAT5.
STAT5 pathway versus MAPK and PI3-kinase pathways in mediating
GH action. GH induces tyrosine phosphorylation of IRS-1/IRS-2 in liver
(Yamauchi et al., 1998). IRS-1 expression augments the Ras/Raf/ MEK1
/MAPK and PI3K pathways more than the tyrosine phosphorylation of STAT5
(Liang et al., 2000). The level of GHR is rapidly reduced by short exposure to
GH, which resulted in an equal desensitization of the JAK2/STAT5 pathway and time dependent recovery in the absence of GH (Ji et al., 2002). Unlike the
JAK2/STAT5 pathway, the activating effect of GH on the MEK/ERK and PI 3- kinase/Akt pathways did not recover following prolonged incubation in the absence of GH (Ji et al., 2002). This result indicates the presence of an additional post-receptor mechanism causing the prolonged refractoriness of the
MEK/ERK and PI 3-kinase/Akt pathways in response to a second GH stimulation
(Ji et al., 2002). The JAK2/STAT5 signaling pathway is required for GH/PRL- induced pancreatic beta-cell proliferation; however, MAPK, PI3K, and PKC signaling pathways are not required (Friedrichsen et al., 2001).
5151
Protein synthesis, synaptic plasticity, and GH
GH is well known for its ability to stimulate protein synthesis through both
transcription and translation. GH/ IGF-1/insulin/ and p38 MAPK signaling
pathways have important roles in the regulation of protein synthesis. Inhibition of
the activity of these pathways plays an important role in the reduced rate of
protein synthesis in aged rodents (Hsieh and Papaconstantinou, 2004). GHD has well known detrimental effects on cognition and memory in humans. Memory formation in mammals requires protein synthesis (Flexner et al., 1963; Davis and
Squire, 1984). Studies in hippocampal slice preparations have distinguished two phases of LTP, an early phase (E-LTP) lasting for 2 hr and a late phase (L-LTP) which is greater in amplitude and longer in duration (> 3 hr) based on the differential sensitivities to mRNA and protein synthesis inhibitors (Nguyen et al.,
1994). Distinct temporal phases of memory and synaptic plasticity have been delineated in rodent hippocampus with long lasting forms distinguished by their dependence on macromolecular synthesis (Kelleher et al., 2004b). The regulation of protein synthesis underlying long-lasting synaptic plasticity might occur at the transcriptional or translational level (Kelleher et al., 2004b).
The effect of protein synthesis inhibition on long lasting synaptic plasticity is a specific consequence of translational blockade and not due to non-specific effects or toxicity (Kelleher et al., 2004b). Several observations support this claim. First, the action of protein synthesis inhibitors is specific to long lasting forms of synaptic plasticity with no effect on the transient forms. Second, protein
5252
synthesis inhibitors typically interfere with the maintenance, not the initial induction of long lasting synaptic plasticity. Third, both L-LTP and L-LTD are blocked by protein synthesis inhibitors (Kelleher et al., 2004b). Fourth, calcium influx induced by depolarization or metabotropic GluR activation is not affected by the widely used protein synthesis inhibitor, anisomycin (Linden, 1996).
Finally, several agonists such as BDNF and NT4, forskolin and memberane- permeable cAMP analog Sp-cAMP, and dopamine receptor type D1/D5 agonists can induce the long lasting protein-dependent forms of LTP (Kang and Schuman,
1995). The L-LTP induced by all those agents differs from L-LTP induced by repeated tetanization in that it develops gradually, requiring 1-2 hr to reach a maximum level and is abolished completely by pretreatment with protein synthesis inhibitors (Kelleher et al., 2004a).
In order to answer the following questions, what signaling pathway(s) are responsible for short-term effects of GH on hippocampal synaptic function, and is synthesis of new proteins required for these effects? I hypothesized that GHR signaling in hippocampus would use signaling pathways previously described in other tissues. This hypothesis was tested by examining the effects of pharmacological inhibition of specific components of the hypothesized hippocampal GHR signaling pathway. The following set of experiments was conducted to assess the possible contributions of JAK2, STAT5, MAPK, and PI3- kinase pathways, and protein synthesis to the GH-induced enhancement of excitatory synaptic transmission.
5353
Materials and methods
The methods used for hippocampal slice preparation, field potential
recording and data analysis were as discussed in the previous section.
To examine the effect of in vitro GH treatment on the expression of GH
receptors and STAT5a/b, hippocampal slices were prepared and allowed to
recover for 1 hr before use in experiments. For each experiment, slices obtained
from the same animal were placed into 2 separate interface holding chambers.
The slices in one chamber were exposed to ACSF alone to serve as a control,
and in the other chamber slices were exposed to ACSF + 2 nM GH. For
detection of GHR mRNA, hippocampal slices were treated with GH (2 nM) or
ACSF alone for 3 hr, then collected, rapidly frozen on dry ice, and stored at
-80 °C until used for RNA isolation. For detection of total and phosphorylated
STAT5a/b, hippocampal slices were treated with GH (2 nM) or ACSF alone for
15-30 min, then were collected and rapidly frozen on dry ice, and stored at -80 °C
until used for protein analysis.
Western Blotting
Hippocampal slices were homogenized in protein lysis buffer [1% Nonidet
P-40 (NP-40), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS),
0.15 M NaCl, 0.01 M sodium phosphate, pH 7.2, 2 mM ethylenediamine tetraacetic acid (EDTA), and 1% protease inhibitor cocktail]. Then, burst
5454
sonication was done (< 10 sec), and samples were centrifuged at 14,000 × g for
20 min. at 4 °C. The supernatant solution was obtained and total protein
estimated using the Bradford method (Bradford, 1976). Equal amounts of total
protein from GH treated slices and control slices (200 µg) were separated on 8%
polyacrylamide gels. The separated proteins were transferred to nitrocellulose
membranes (Micron Separations, Inc., Westboro, MA). The membranes were
blocked (1 hr at room temperature) in 5% nonfat dry milk in T-T-S (0.5% Tween-
20, 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.2 mM EDTA). The membranes
were then incubated with primary antibody diluted in 5% non-fat dry milk in T-T-S
either at room temperature for 1 hr or overnight at 4 °C. Next, membranes were then washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies, diluted 1:10,000 in 5% non-fat dry milk in T-T-S (1 hr at room temperature or 4 °C overnight). Blots were washed again and proteins were detected on X-ray film (Fuji Medical System USA, Inc., Stamford, CT) using the ECL system (Amersham-Pharmacia), following the manufacturer’s instructions. To correct for possible loading differences, blots were probed with an antibody to neuron-specific enolase (NSE). The following primary antibodies were used: anti-NSE (AB951, Chemicon International, 1:6000 to 1:8000), anti- total STAT5 (Clone 89, Catalog Number # 610192, BD Bioscience, 1:250), anti- phospho-STAT5 A/B (Y694/Y699) (mouse monoclonal IgG, clone 8-5-2; catalog
# 05-495, Upstate Biotechnology, 1:250).
5555
RT-PCR
Total RNA from hippocampal slices was prepared using TRI Reagent
(Sigma). cDNA was synthesized from 2.5 µg total RNA using 100µM random hexamer as primers. The mixture was heated to 65 °C for 5 min, and quickly chilled on ice. I added 4 µl of 5X First Strand Buffer (Invitrogen, Carlsbad, Ca),
0.02 M DTT, and 40 U of Ribonuclease Inhibitor (Invitrogen), the reaction was placed in a PTC-100 thermal cycler and incubated at 25 °C for 10 min and then at 37 °C for 2 min. 200 U of M-MLVRT (Invitrogen) was added, and the mixture was incubated at 37 °C for 50 min and then at 70 °C for 15 min. For the PCR reactions the following primers were used: GHR right 5´ (acttctgcggctgagcaaac)
3´ and GHR left 5´ (ccttggagcaaaggatgacg) 3´. The protocol for amplification was 95 °C for 1 min, 60 °C for 30 s and 72 °C for 1 min, for 35 cycles. Using the cDNA prepared by RT-PCR, the following reaction was prepared: 50 µl total reaction volume; 33.5 µl of H2O, 0.5 µl of the right primer and 0.5 µl of the left primer, 0.5 µl of taq polymerase, 6 µl of 25 µM MgCL2, 1 µl of 10 µM dNTPs, 5 µl of 10X PCR buffer, and 2 µl of either samples or controls.
Reagents
Reagents used in this study were rhGH (Bachem); 1,4-diamino-2,3- dicyano-1,4-bis(2-aminophenylthio)-butadiene (U-0126); tyrphostin AG 490 (LC
Labs); wortmanin (WORT) (Sigma); cycloheximide (3-[2-(3,5-Dimethyle-2- oxocyclohexyl)-2-hydrxyethyl]glutarimide) (Sigma). The last three reagents were
5656
dissolved in Dimethyle sulfoxide (DMSO). Salts and other compounds were from
Sigma or Fisher.
Data analysis
Field potentials were collected and analyzed using WinWCP program
(John Dempster, University of Strathclyde). Densitometric analysis was conducted using ImageJ (Wayne Rasband, NIMH). Additional analysis was completed using Excel (Microsoft) and Origin (OriginLab). All statistics are presented as mean ± one standard error of the mean. Statistical significance was assessed using paired and unpaired t-test, as appropriate, with p<0.05 considered significant.
5757
Results
GH treatment of in vitro hippocampal brain slices increased the expression of GHR message
To determine the effect of GH treatment on the expression pattern of GH receptors, I used RT-PCR of hippocampal brain slices treated with GH (2 nM) for
3 hours GH treatment significantly increased (p< 0.002) the expression of GHR mRNA compared to control treated with ACSF alone (Figure 10).
GH treatment of in vitro hippocampal brain slices did not alter total or phospho-STAT5A/B proteins
To examine the effect of GH treatment on the expression pattern of total and phospho-STAT5a,b, I used western blot analysis of hippocampal brain slices treated with GH (2 nM) for 15-30 min. GH treatment did not affect the protein levels of either total or phospho-STAT5a,b compared to control tissue treated with ACSF alone (Figure 11).
GH-induced potentiation of fEPSPs was blocked by inhibitors of PI3 kinase,
MAPK kinase, and JAK2 tyrosine kinase
To investigate the role JAK2, PI3-kinase and MAPK in mediating the effects of GH on hippocampal synaptic transmission, I pretreated (30 min), hippocampal brain slices with tyrphostin AG 490 (10 µM) to block JAK2 protein tyrosine kinase, wortmannin (50 nM) to block the PI3-kinase signaling pathway,
5858
and U0126 (20 µM) to block the MAPK pathway. GH (1 nM) was then applied.
Each of these three inhibitors significantly reduced the effect of GH on excitatory synaptic transmission in CA1 region of rat hippocampus. These results indicate that activation of JAK2, PI3-kinase and MAPK signaling pathways are all important for the induction of GH effect on hippocampal synapses (Figure 12).
PI3-kinase and MAPK inhibitors had no effect on the maintenance of GH enhanced excitatory synaptic transmission in the hippocampus
I conducted an additional experiment to determine if PI3-kinase and
MAPK signaling pathways are important for the maintained effects of GH on hippocampal synaptic transmission. Hippocampal slices were treated with GH (1 nM) for 30 min, to allow the initial enhancement by GH of synaptic transmission, then WORT (50 nM) or U-0126 (20 µM) were added along with GH for another
30 min. Neither WORT nor U-0126 had any effect on the maintenance of GH enhancement of hippocampal synaptic transmission (Figure 13), suggesting that while PI3-kinase and MAPK are required for the initiation of GH-induced enhancement, neither is required for the maintained expression of GH-dependent synaptic enhancement.
5959
Protein synthesis is required for the induction of GH enhancement of synaptic transmission
To investigate the role of protein synthesis in the induction of GH- dependent synaptic enhancement, I pretreated hippocampal brain slices with 60
µM cycloheximide for 30 min before GH (1 nM) treatment. Cycloheximide application was maintained during GH application for 1 hour Pretreatment with 60
µM cycloheximide for 30 min completely blocked the GH effect on excitatory synaptic transmission of rat hippocampus. This result indicates that synthesis of new proteins is required for the induction of GH-dependent synaptic enhancement (Figure 14).
Protein synthesis is not important for maintained expression of GH enhancement of synaptic transmission
To determine the possible role of continued protein synthesis in the maintained expression of GH-dependent synaptic enhancement, I applied cycloheximide (60 µM) beginning 30 min after the start of GH (1 nM) treatment.
Cycloheximide applied 30 min after initial treatment with GH had no effect on the maintained expression of GH enhancement of excitatory synaptic (Figure 15).
6060
Figure 10 A.
GH + - + -
GHR
NSE
200
*** ts)
i 175 n u y r ra t i rb 150 (a NA
125 GHR mR
100 GH treated control
6161
Figure 10. GH treatment of in vitro hippocampal brain slices increased the
expression of GHR mRNA.
A. Total RNA was prepared from hippocampal brain slices treated with GH (2
nM) for 3 hr (+) and from control slices treated with ACSF alone (-). cDNA was
prepared from total RNA as described in the materials and methods. GH
treatment increased the expression of GH receptor mRNA compared to control
treated with ACSF alone. The upper panel shows GHR mRNA for GH treated
and control slices. The lower panel shows the NSE mRNA.
B. Denistometric analysis of GHR mRNA. GH treatment caused a significant
upregulation of GHR message (***p=.002). The data represent the average of 8 pairs of GH and ACSF control slices.
6262
Figure 11
A
+ - + - (GH)
P-STAT5/A,B
Total STAT5
NSE
B
3
2.5 GHT control
2
1.5 (arbitrary units) y
1 Mean gre 0.5
0 Total STAT5 Phopho-STAT5 A/B
6363
C.
1
0.8 5 t a t
l S 0.6 a t o T
5/ 0.4 at t S P 0.2
0 GHT control
Figure 11. GH treatment of in vitro hippocampal brain slices did not affect protein levels of either total or phospho-STAT5a/b.
A. Total protein was prepared from hippocampal brain slices treated with GH (2 nM) for 15-30 min (+) and from control slices treated with ACSF alone (-). Western blot analysis was done as described in the materials and methods using antibodies directed against either total or phospho-STAT5. Upper panel shows a blot probed with anti-phospho-STAT5 A/B (1:250). The middle panel shows a blot probed with anti-STAT5 (1:250). Both the upper and middle panels are from the same hippocampal samples. The lower panel shows a blot probed with anti-NSE (1:8000), again from the same samples. GH treatment did not affect protein levels of either total or phospho-STAT5a/b, or NSE. B. Densitometric analysis of total or phospho-STAT5a/b. In vitro treatment with GH (2 nM, 15-30 min) had no significant effects on total or phospho-STAT5a/b (all p's >0.05). C. There was no significant change in the ratio of phospho-STAT5a/b to Total STAT5a/b in GH treated slices compared to control ACSF alone. Data shown represent the average of 8 pairs of slices. The bars show the mean ± SE of the mean.
6464
Figure 12.
A
6565
B
6666
Figure 12. GH-induced potentiation of the fEPSP was blocked by inhibition of PI3 kinase, MAPK kinase and JAK2 tyrosine kinase.
A. Slices were pretreated for 30 min with 50 nM WORT (up-triangle, n=8), 20 µM
U0126 (circle, n=7), or 10 µM Tyrphostin AG490 (down-triangle, n=8) before the application of GH (1 nM). The application of these inhibitors completely blocked the normal enhancing effect of GH on excitatory synaptic transmission. In the sample fEPSPs shown in the insets at the top, baseline responses are indicated by thin lines and responses after GH application by thick lines.
B. Summary of effects of GH in slices pretreated with WORT, U-0126, and,
Tyrphostin AG-490. There was no change in fEPSP following GH application in slices pretreated with WORT or U-0126 or Tyrphostin AG490 compared to baseline (p>.05). The increase in fEPSP slope following treatment with GH alone was significantly greater than slices pretreated with WORT, U-0126 and
Tyrphostin AG 490 (p<0.05). *p<.05 vs GH, **p<.01 vs GH.
6767
Figure 13.
A
6868
B
6969
Figure 13. PI3-kinase and MAPK kinase inhibitors had no effect on the maintained expression of GH enhancement of fEPSPs.
A. WORT (50 nM) or U-0126 (20 µM) was applied 30 min after the initial application of GH (1 nM). Neither of these two inhibitors affected GH-dependent enhancement of excitatory synaptic transmission when inhibitor treatment followed initial GH application by 30 min. The insets at top illustrate the effects of
GH alone or GH with WORT or with U-0126 applied 30 min after beginning GH treatment.
B. Neither WORT nor U0126 inhibited maintenance of GH-induced enhancement of EPSPs. There was no significant difference between GH application alone or
GH followed 30 min later with WORT or U0126 (p>0.1). The increases in EPSP slope following treatment with GH alone or GH followed by WORT or U0126 were all significant when compared with pre-GH baseline (**p<0.01, ***p<.001).
7070
Figure 14.
A
7171
B
7272
Figure 14. Protein synthesis was required for the induction of GH enhancement of synaptic transmission.
A. Pretreatment of hippocampal brain slices with 60 µM cycloheximide for 30 min before GH treatment (1 nM) completely blocked the normal GH enhancement of excitatory synaptic transmission. The insets at top show example recordings from individual slices (N= 6).
B. Summary comparison of the effects of GH alone, GH in slices pretreated with cycloheximide, and cycloheximide alone. There was no significant difference between GH application in slices pretreated with cycloheximide and control treated with ACSF or cycloheximide alone (p>0.1). GH alone caused a significantly greater increase in EPSP slope than GH+cycloheximide (p< 0.004).
7373
Figure 15.
A
7474
B
7575
Figure 15. Protein synthesis was not required for maintained enhancement of EPSPs by GH.
A. The application of cycloheximide (60 µM) beginning 30 min after the start of
GH treatment (1 nM) had no effect on GH-dependent EPSP enhancement. Slices were treated with GH alone (squares), or with cycloheximide beginning 30 min after initial application of GH (up-triangles). Control slices were treated with cycloheximide alone (circles). The insets at the top show fEPSPs from individual slices, (n = 7).
B. Summary comparison of the effects of GH, GH + cycloheximide, cycloheximide alone, and ACSF alone. There was no significant difference between GH alone and GH followed by cycloheximide (p>0.1). The increases in
EPSP slope following treatment with either GH or GH followed by cycloheximide were significantly greater compared to both ACSF (p<0.005) and cycloheximide
(p<0.007) controls.
7676
Discussion
In vitro GH treatment increased the expression of GH receptor message in hippocampus
One of the factors that contributes to differential tissue responsiveness to
GH is tissue-specific autoregulation of GHRs and GHBPs. I used RT-PCR to determine the effect of GH treatment on the expression of GHRs in hippocampal brain slices treated with GH for 3 hours GH treatment increased the expression of GHR mRNA compared to control treatment with ACSF alone (Figure 10). This result is consistent with the previous findings of Hull and Harvey (1998), who reported a 25-50% increase in GHR and GHBP mRNA in all brain regions of hypophysectomized rats following a single bolus GH injection.
My results are also supported by the finding of Vikman et al. (1991) that
GHR mRNA levels increased within 1 hr of a single injection of human GH (100
µg/rat), with maximal levels being reached 3-12 hr after the injection. In the
Vikman et al. (1991) study, the increase in GHR mRNA levels was dose dependent, and also was observed after prolonged treatment (1 or 5 mg/kg/day for 6 days) with bovine GH. Furthermore, there was a rapid GH-dependent upregulation of GHR mRNA in adipose tissue (Vikman et al., 1991). Also, Le
Greves et al. (2002) reported an increase in the expression of GHR gene transcripts in young adult rats following GH treatment by s.c. injection for 10 days.
7777
PI3 kinase, MAPK kinase, and JAK-2 tyrosine kinase are necessary only for the induction but not for the maintained expression of GH enhancement of excitatory synaptic transmission
GH interacts with cell-surface GHRs resulting in activation of the GHR- associated tyrosine kinase, JAK2, and triggering signaling cascades involving
STAT, Ras/Raf/MEK1/MAPK, and IRS-1/PI3-kinase pathways (Liang et al.,
2000). To investigate the role of JAK2, PI3-kinase and MAPK in mediating the effects of GH on hippocampal synaptic transmission, I pretreated hippocampal brain slices with tyrphostin AG 490 to block JAK2 protein tyrosine kinase, wortmannin to block the PI3-kinase signaling pathway, and U-0126 to block the
MAPK pathway. Pretreatment of slices for 1 hr with these inhibitors completely blocked the normal enhancing effect of GH on excitatory synaptic transmission
(Figure12). These data indicate that activation of JAK2, PI3-kinase and MAPK signaling pathways are required for the induction of GH effects on hippocampal synapses.
My results are consistent with the earlier work of Argetsinger et al. (1993) and Sotiropoulos et al. (1994), who reported that activation of GHR stimulates
JAK2 kinase and facilitates the association of GHR with JAK2 into a complex with subsequent phosphorylation of both proteins. Many intracellular proteins are subsequently phosphorylated in a cascade, including MAPK. Kim et al. (1998) also reported the requirement for GHR and JAK2 activation in GH signaling.
They also found that JAK2 activation by GH triggered various pathways including
7878
the Ras/MAPK, STAT, and IRS/PI3-kinase systems. Yamauchi et al. (1998) also reported that the PI3-kinase signaling pathway is important in mediating GH effect on 3T3 L1 adipocytes. They reported that wortmannin, a specific PI3- kinase inhibitor, completely blocked the anti-lipolytic effect of GH on 3T3 L1 adipocytes. Yamauchi et al. (1998) reported that GH induced tyrosine phosphorylation of IRS-1/IRS-2 in liver, with JAK2-phosphorylated IRS-1, -2, and
-3 providing docking sites for p85 PI3-kinase and activating PI3-kinase for downstream biological effects.
To determine if the PI3-kinase and MAPK signaling pathways are required for the maintained expression of GH effects I treated hippocampal slices with
WORT or U0126 beginning 30 min after initiation of GH treatment. Neither
WORT nor U0126 had any inhibitory effect on already established GH enhancement of hippocampal synaptic transmission (Figure 13), suggesting that there is no role for PI3-kinase or MAPK in the maintenance of GH-dependent
EPSP enhancement. My findings are consistent with the observation of Opazo et al. (2003) that PI-3 kinase is specifically involved in the induction of tetanus- induced LTP, but is not required for maintenance of LTP.
How might PI-3 kinase lead to enhanced synaptic transmission? Opazo et al. (2003) argued that PI3-kinase leads to downstream activation of the ERK pathway in tetanus-induced LTP. Other possibilities were suggested by Impey et al. (1998) and Davis et al. (2000), who reported that ERK activation contributed
7979
to LTP induction by facilitating transcriptional events, mRNA synthesis and protein synthesis. The effective blockade of L-LTP requires treatment with a translational inhibitor around the time of L-LTP induction, whereas treatment after
L-LTP induction produces no effect (Otani et al., 1989; Frey and Morris, 1997).
Alltogether, there is considerable evidence that both protein synthesis and PI3- kinase activation are important for the induction but not the maintenance of LTP.
Based on the roles of protein synthesis and PI3-kinase, it seems possible that MAPK and ERK activation are also important for the induction of LTP but not for the maintenance of LTP. Both PI3-kinase and MAPK signaling pathways are important for LTP induced by repeated tetanization; MEK inhibitors strongly reduce the induction of LTP by TPS (Winder et al., 1999; Watabe et al., 2000).
Furthermore, LTP induced by short trains of TPS is almost completely blocked by the PI3-kinase inhibitors LY294002 and wortmannin (Opazo et al., 2003). The marked similarity in pathways required for GH enhancement of excitatory synaptic transmission and for tetanization induced L-LTP suggests that competition within a common set of pathways may be the underlying cause of my finding that GH pretreatment of rat hippocampal brain slices blocks subsequent synaptic potentiation by tetanus.
8080
GH treatment of in vitro hippocampal brain slices does not affect total or phospho-STAT5A/B protein levels.
GH activates JAK2 tyrosine kinase and members of the STAT family of transcription factors, including STATs 1, 3, and 5 (Smit et al., 1997). GH plays an important role in specific gene transcription through transient phosphorylational activation of STAT proteins (Rico-Bautista et al., 2004). GH-induced STAT5
DNA-binding activity was detected after 2 min, reached a maximum at 10 min, decreased rapidly with up to 1 hr of GH treatment, and declined slowly with even longer GH treatment (Fernandez et al., 1998). At least two STAT5 proteins
(STAT5A and STAT5B) exist in mouse and human (Smit et al., 1997). GH activates both STAT5A and STAT5B in several cell types (Smit et al., 1997).
GH-dependent tyrosyl phosphorylation of both STAT5A and STAT5B requires the same specific regions of GHR and activation of JAK2 kinase (Smit et al.,
1997). To determine the effect of GH treatment on the expression of total and phospho-STAT5a,b, I used western blot analysis of hippocampal brain slices treated with GH (2 nM) for 15-30 min. GH treatment did not affect protein expression of total or phospho-STAT5a/b compared to ACSF alone control
(Figure 11).
Although GH has well known stimulating effects on three major signaling pathways, there is considerable variability in the level of activation of these different pathways among different tissues, and a corresponding variability in the importance of these three pathways in mediating specific effects of GH. For
8181
example, Yamauchi et al. (1998) found that GH induced tyrosine phosphorylation of IRS-1/IRS-2 in liver, and the IRS-1 augmentation of Ras/Raf/MEK1/MAPK and
PI3K pathways was greater than the tyrosine phosphorylation of STAT5 (Liang et al., 2000). Also, Ji et al. (2002) reported that unlike the JAK2/STAT5 pathway, the effect of GH on activation of the MEK/ERK and PI3-kinase/Akt pathways did not recover following prolonged incubation in the absence of GH. Finally,
Friedrichsen et al. (2001) found that JAK2/STAT5 signaling pathway was required for GH/PRL-induced pancreatic beta-cell proliferation; however, MAPK,
PI3K, and PKC signaling pathways were not required.
I also found that GH action on excitatory synaptic transmission was blocked by pretreatment with cycloheximide, a protein synthesis inhibitor (Figure
16). In contrast, Fernandez et al. (1998) observed that JAK2 tyrosine phosphorylation and STAT5 DNA-binding activity were prolonged for at least 4 hr in the presence of cycloheximide. These discrepant observations can be explained by Gebert et al. (1999), who found that termination of GH-induced
STAT5b signaling is a complex process involving down-regulation of JAK2 signaling to STAT5b via dephosphorylation by phospho-tyrosine phosphatase.
Because JAK2/STAT5 signaling is enhanced by protein synthesis inhibitors, whereas GH enhancement of excitatory synaptic transmission was prevented by protein synthesis inhibition, it seems even more unlikely that JAK2/STAT5 is required for GH effects on hippocampal excitatory synaptic transmission.
8282
Protein synthesis is necessary for the induction but not the maintenance of
GH enhancement of synaptic transmission
Protein synthesis in mammals is required for memory formation (Flexner et al., 1963; Davis and Squire, 1984). Studies in hippocampal slice preparations have distinguished two phases of LTP, an early phase (E-LTP) lasting for 2 hr and a late phase (L-LTP) greater in amplitude and longer in duration more than 3 hr, based on different sensitivities to mRNA and protein synthesis inhibitors
(Nguyen et al., 1994). In my experiments, GH enhanced excitatory synaptic transmission in CA1 area of rat hippocampus, and this effect lasted for more than
3 hours Because of the similar nature of the enhancement, and the similarity in signaling pathways, we may consider the GH effect on hippocampal synapses as a form of L-LTP. Kelleher et al. (2004a) reported the dependence on macromolecular synthesis for long lasting forms of memory and synaptic plasticity in rodent hippocampus that might reflect regulation at the transcriptional or translational level. To investigate the role of protein synthesis in the induction of GH-dependent L-LTP, I pretreated hippocampal brain slices with 60 µM cycloheximide for 30 min before GH treatment. This pretreatment completely blocked the normal effect of GH on excitatory synaptic transmission (Figure 14), emphasizing the importance of protein synthesis in the induction of GH- dependent L-LTP. The validity of this interpretation of my data is supported by the finding of Kelleher et al. (2004a) who showed that the effects of protein synthesis inhibitors on long lasting synaptic plasticity are the specific consequence of their translational blockade.
8383
Several agonists can induce long-lasting protein synthesis-dependent
forms of LTP, including the neurotrophins BDNF and NT4, forskolin and the
memberane–permeable cAMP analog Sp-cAMP, and D1/D5 dopamine receptor
agonists (Kang and Schuman, 1995). It is well known that L-LTP induced by
repeated tetanization is dependent on protein synthesis. However, there are
differences between L-LTP induced by pharmacological agents and L-LTP
induced by repeated tetanization. Kelleher et al. (2004a) reported that chemically
induced L-LTP differs from tetanization induced L-LTP in that it develops
gradually, requires 1-2 hr to reach a maximum level, and is nullified completely
by pretreatment with protein synthesis inhibitors (Kelleher et al., 2004a).
To test the role of protein synthesis in the maintenance of GH-dependent
L-LTP, I applied cycloheximide beginning 30 min after initiation of GH treatment.
Cycloheximide applied 30 min after GH had no effect on the maintenance of GH
enhanced excitatory synaptic transmission (Figure 15). Studies on L-LTP have
indicated that effective inhibition requires treatment with a translational inhibitor
around the time of L-LTP induction, whereas delayed treatment after L-LTP
induction has no effect (Otani et al., 1989; Frey and Morris, 1997). Kelleher et al.
(2004a) reported that rates of protein synthesis increased rapidly following L-LTP
induction. They added that failure of translational inhibitors to affect already established L-LTP argues against the simple requirement of ongoing protein synthesis to maintain steady-state protein level.
8484
Previous studies indicate that repeated tetanization induces rapid enhancement of protein synthesis, which is necessary for full L-LTP expression
(Kelleher et al., 2004a). Also, increased rates of protein synthesis can be detected rapidly after L-LTP induction (Kelleher et al., 2004b). Taken together, if both kinds of L-LTP, drug-induced and tetanization-induced, require protein synthesis for their induction, then we might expect competitive inhibition of tetanus-induced L-LTP by previous GH-induced L-LTP.
Figure 16. Diagrammatic illustration of the proposed signaling pathway for
GH in the hippocampus. GHR dimerization and activation of JAK2 leads to stimulation of the MAPK pathway, stimulation of the PI-3 kinase pathway and protein synthesis. Solid lines indicate direct effects and dashed lines indicate indirect effects.
8585
How might growth hormone contribute to enhanced excitatory synaptic
transmission in rat hippocampus?
GH activates GHRs leading to receptor dimerization and activation of the
non-receptor tyrosine kinase, JAK2. JAK2 activation by GH triggers the activation
of various pathways including Pl3-kinase and the Ras/MAPK systems. Both PI3- kinase and MAPK mediate GH-dependent enhancement of excitatory synaptic transmission in rat hippocampus through phosphorylation of substrate proteins or stimulation of protein translation. The GH activation of PI3-kinase and MAPK pathways begins with GH-induced JAK2 phosphorylation, since GH effects on
EPSPs were blocked by the JAK2 inhibitor. In support of the requirement for
JAK2, Kim et al. (1998) found that GHR and JAK2 activation are required for GH signaling, and Yamauchi et al. (1998) reported that activation of JAK2 by GH binding to its receptor mediates the biological actions of GH.
Although JAK2, PI-3 kinase and MAPK are required, the specific interactions leading from JAK2 to PI-3 kinase and MAPK are not certain. Liang et al. (2000) reported that IRS-1 expression augments both the
Ras/Raf/MEK1/MAPK and the PI3K pathways. So there is a possibility that GH activates JAK2, which in turn activates IRS-1, which then mediates GH- dependent activation of both PI3-kinase and MAPK. To test this possibility, we would need to be able to assay IRS activation by phosphorylation, and the causal relationship of IRS phosphorylation with respect to both PI-3 kinase and MAPK activation.
8686
The second possibility is that activated GHR-JAK2 in turn activates the
MAPK signaling pathway without a requirement for IRS or PI-3 kinase.
Yamauchi et al. (1998) reported that GH stimulates tyrosine phosphorylation of the epidermal growth factor receptor and causes its association with Grb2, resulting in stimulation of the MAPK signaling pathway in liver. In addition,
Vanderkuur et al. (1997) reported that GH promoted the rapid, transient association of SHC with the Grb2-SOS complex, which correlated with the time course of Ras, Raf, and MEK activation. In the Vanderkurr et al. (1997) study,
Ras, Raf, and MEK returned to near basal activity after 15 to 30 min despite the continuous presence of GH. Further investigation will be required to determine the specific pathway linking GHR-JAK2 to MAPK in the hippocampus.
Synthesis of new proteins is required for the induction of GH-dependent L-
LTP of excitatory synaptic transmission in rat hippocampus. This regulation could occur at either the translational level or the transcriptional level, or both.
However, the rapid onset of GH effects favors the enhancement of translation at
the ribosomal level. This hypothesis is supported by the finding of Bodian (1965),
Autilio et al. (1968), and Morgan and Austin (1968) who reported the presence of
ribosomal assemblies in neuronal dendrites and the ability of isolated synaptic
fractions to support de novo protein synthesis. In addition, the observation of
Steward and Levy (1982) that dendritic polyribosomes preferentially localized
near postsynaptic sites, suggests that local protein synthesis may be important
for synaptic regulation.
8787
An important question, as yet unanswered, is how GH promotes local protein synthesis. As a potential mechanism, I propose that GH activation of PI3- kinase leads to activation of another mediator that promotes protein synthesis at the level of translation. This proposal is supported by Chou et al (1998) and Le
Good et al. (1998), who reported that PI3-kinase stimulates PDK-1, activating
PKCζ. Further support comes from the finding that inhibition of PKCζ prevents
LTP in the hippocampal CA1 region (Ling et al., 2002). Further investigation into
GH-dependent L-LTP, for example, with PKCζ inhibitors, may help to resolve this issue.
Although there is evidence for GH stimulation of protein synthesis via activation of PI-3 kinase, the MAPK pathway could also link GHR activation to protein synthesis. I propose that GH through stimulation of MAPK pathway enhances protein synthesis at the transcription level. In favor of this possibility is the finding of Hodge et al. (1998) that GH promotes phosphorylation of Elk-1 which in turn causes transcriptional activation. In addition, these same authors found that overexpression of dominant-negative Ras and the ERK-specific phosphatase (mitogen-activated protein kinase phosphatase-1), and the application of MEK inhibitor PD098059, blocked GH-stimulated activation of
Ras/MEK/ERK pathway and abrogated the GH-induced stimulation of the transcription factors Jun N-terminal kinase and Elk-1 in 3T3-F442A cells.
8888
Section III
NMDA Receptor-Mediated Effects of Growth Hormone
8989
Introduction
Functional roles of NMDAR subunits composition
The NMDAR is an ionotropic glutamate receptor defined by its selective
activation by the agonist N-methyl-D-aspartate. The NMDAR plays crucial roles
in synaptic plasticity and development, and also in excitotoxic injury (Grosshans
and Browning, 2001, Mallon et al., 2004). NMDARs are multimeric proteins
containing two obligatory NR1 subunits, usually paired with two NR2A or NR2B
subunits (Cull-Candy et al., 2001).
While the NR1 subunit is obligatory for channel function, the NR2
composition plays an important functional modulatory role, affecting channel kinetics and pharmacology (Yoshimura et al., 2003). Differences in NR2 subunit composition underlie age-dependent changes in NMDAR dependent excitatory postsynaptic current (EPSC) kinetics and pharmacology (Flint et al., 1997). The proportion of the cells displaying fast NMDAR EPSCs and NR2A increases during postnatal development (Flint et al., 1997). In visual cortex, NR2 subunit composition changes with visual experience, in addition to age, affecting neocortical plasticity through differential subunit regulation at inhibitory and excitatory connections (Yoshimura et al., 2003).
LTP induction depends on both NMDA receptor-mediated Ca2+ influx and
subunit-specific signaling, with the intracellular C-terminal domain of the NR2
9090
subunits directing signaling pathways with an age-dependent preference (Kohr et al., 2003). LTP induction at mature CA3-to-CA1 connections results primarily from NR2A-type signaling and NR2A-type receptors. Mutant mice lacking the intracellular C-terminal domain (NR2A∆C/∆C) were deficient in calcium signaling required for LTP induction (Kohr et al., 2003). In young (<14 day old), but not mature (>42 day old) mice, NR2B-containing receptors participated in LTP induction. Consistent with the different roles of NR2A and NR2B in immature and adult hippocampus, CA3-to-CA1 LTP in NR2A∆C/∆C was more strongly reduced in adult than young mice, but could be restored to wild-type levels by repeated tetanic stimulation (Kohr et al., 2003).
NMDARs have been implicated in both LTP and LTD for many years
(Dudek and Bear, 1992; Bliss and Collingridge, 1993). The ability of NMDARs to participate in opposite forms of synaptic plasticity may be related to the pattern of synaptic activation required to induce LTP or LTD. These different patterns of synaptic stimulation resulted in corresponding differences in calcium signaling.
Long trains of low frequency synaptic stimulation produce modest but prolonged elevation of intracellular calcium ion leading to LTD via the activation of phosphatases (Lisman, 1989). On the other hand, high frequency trains of synaptic stimulation produce a greater rise in intracellular calcium leading to LTP via stimulation of protein kinases (Lisman, 1989). An additional factor allowing
NMDARs to participate in multiple, opposing forms of plasticity is the NR2 subunit composition of the receptor, since activation of NMDARs can produce
9191
either increases or decreases in synaptic efficiency depending on subunit composition (Bliss and Schoepfer, 2004).
Ifenprodil (3 µM) and Ro25-6981 (0.5 µM), selective antagonists of the
NR2B subunit, completely blocked LTD induced by low-frequency stimulation
(Liu et al., 2004; Williams, 2001). Although LTP is more sensitive to partial block of NMDARs by low concentration of APV, neither Ifenprodil nor Ro25-6981 affected the induction of LTP by high frequency stimuli (HFS), indicating the selective blockade of LTD by NR2B specific antagonists ( Nishiyama et al., 2000;
Cummings et al., 1996). On the other hand, APV (0.5 µM) prevented HFS- induced LTP without affecting LFS-induced LTD (Liu et al., 2004). The selective effect of low dose APV on LTP was explained by a requirement for NR1-NR2A
NMDARs (Liu et al., 2004), since the NR2A containing NMDARs are more sensitive to APV blockade than NR2B containing receptors (Buller et al., 1994).
An NR2A specific antagonist NVP-AAMO77 (0.4 µM) prevented both normal LTP induced by a single episode of HFS and saturated LTP induced by multiple episodes of HFS, but had little effect on LFS-induced LTD (Liu et al., 2004).
The relative expression levels of NR2A and NR2B is regulated developmentally and may allow NMDARs to play distinct roles in long-term synaptic plasticity (Erreger et al., 2005). Recordings from outside-out patches that contain a single active channel show that NR2A-containing receptors have a higher probability of opening and a higher peak open probability than NR2B-
9292
containing receptors in response to a brief synaptic-like pulse of glutamate
(Erreger et al., 2005). At high frequency tetanic stimulation (100 Hz; >100ms), typically used to induce LTP, the charge transfer mediated by NR1/NR2A considerably exceeds that of NR1/NR2B (Erreger et al., 2005). In contrast, under low frequencies simulation typically used to induce LTD (1 Hz), NR1/NR2B makes a larger contribution to total charge transfer and therefore calcium influx than NR1/NR2A (Erreger et al., 2005).
Additional regulatory control over NMDAR function is exerted by subunit specific phosphorylation of NMDARs (Lau and Huganir, 1995). In particular, tyrosine phosphorylation of NR2 subunits is thought to be important for regulating
NMDA receptor function (Lau and Huganir, 1995). Studies using immunoaffinity chromatography of detergent extracts of rat synaptic plasma membranes on anti- phosphotyrosine antibody-agarose demonstrated that the NR2A and NR2B subunits, but not NR1 subunits, are tyrosine-phosphorylated (Lau and Huganir,
1995). The selective tyrosine phosphorylation of NR2A and NR2B, but not NR1, was confirmed by immunoprecipitation of the NR1, NR2A, and NR2B subunits with subunit specific antibodies followed by immunoblotting with anti- phosphotyrosine antibodies (Lau and Huganir, 1995). Tyrosine phosphorylation of glutamate receptors was specific to the NMDA receptor. No tyrosine phosphorylation of the AMPA (GluR1-4) or kainate (GluR6/7, KA2) receptor subunits was detected (Lau and Huganir, 1995).
9393
Protein kinase C (PKC) potentiates NMDA receptor function via activation of non-receptor tyrosine kinases leading to tyrosine phosphorylation of NR2A and/or NR2B (Grosshans and Browning, 2001). Tyrosine phosphorylation of both
NR2A and NR2B is increased following treatment of rat hippocampal CA1 mini- slices with 500 nM phorbol 12-myristate 13-acetate (PMA) for 15 min (Grosshans and Browning, 2001). Phosphorylation of serine 890 on the NR1 subunit is increased with PMA treatment for 5 min with phosphorylation returning to near basal levels by 10 min while tyrosine phosphorylation of NR2A and NR2B was sustained for up to 15 min (Grosshans and Browning, 2001). Phosphorylation of
NR2A, NR2B and NR1 was blocked by pretreatment with the selective PKC inhibitor chelerythrine, with the tyrosine kinase inhibitor Lavendustin A or with the
Src family tyrosine kinase inhibitor PP2 (Grosshans and Browning, 2001).
One additional mechanism for regulating NMDAR function is protein- protein interactions among the distinct protein components of the postsynaptic density (PSD). The three major components of the PSD are the NMDAR, the
Ca2+/ calmodulin-dependent protein kinase II (α-CaMKII), and the postsynaptic density protein of 95 kDa (PSD-95) (Gardoni et al., 2001). The dynamic and reciprocal interactions of the NMDAR, α-CaMKII, and PSD-95 have an important role in hippocampal synaptic plasticity (Gardoni et al., 2001). The association of both native and recombinant α-CaMKII and PSD-95 depends on the C-terminal
NR2A (S1389-V1464) sequence (Gardoni et al., 2001). Activation of NMDARs, by either pharmacological means or by LTP-inducing synaptic stimulation,
9494
modulated the association of α-CaMKII and PSD-95 with the NR2A C-tail
(Gardoni et al., 2001).
Correlation of GH, GluRs, MEK/ERK and Pl 3-kinase/Akt pathways
GH modulates many functions of the central nervous system, improving
memory, alertness and motivation (Fargo et al., 2002). It is well documented that
GH secretion declines slowly with age reaching 25% of the adolescent level in
very old age (Corpas et al., 1993). Magnusson et al. (2002) demonstrated a
significant drop in the protein expression of the major subunits of the NMDA
receptor occur during the aging process. They indicated that subunit alterations
may explain some of the changes that are seen in NMDA receptor functions
during aging.
Sonntag et al. (2000) studied the effects of age and chronic insulin-like growth factor-1 (IGF-1) administration on NMDA receptor density and subtype expression in frontal cortex, CA1, CA2/3 and the dentate gyrus of the hippocampus of young (10 months), middle-aged (21 months) and old (30 months) male Fisher 344xBrown Norway (F1) rats. No age-related changes in
125I-MK-801 binding or NMDAR1 protein expression were observed in
hippocampus or frontal cortex. However, they reported a significant decrease of
NR2A and NR2B protein expression in hippocampus between 21 and 30 months
of age, and administration of IGF-1 increased expression of these receptor
subtypes.
9595
In addition, GH might affect the expression of NMDA receptors in a more direct way. GH treatment by subcutaneous injection for 10 days caused up regulation of GHRs and NR2B receptor subunits, and led to a significant increase in the NR2B/NR2A ratio in the hippocampus of young adult rats (Le Greves et al.,
2002). Aging normally leads to decreased NR1 expression in rats. This age- dependent effect was antagonized by GH treatment (Le Greves et al., 2002).
Le Greves et al. (2002) found a significant positive correlation between the level of GHR mRNA and NR2B gene transcripts indicating a GHR-mediated effect on the synaptic function of the NMDAR complex.
Declining GH during aging may have other consequences for the synaptic mechanisms of memory. GH induces the activation of Raf/MEK1/MAPK and PI3- kinase pathways in several different tissues (Winston and Hunter, 1995;
Vanderkuur et al., 1997; Hodge et al., 1998; Yamauchi et al., 1998; Kim et al.,
1998; Liang et al., 2000; Ji et al., 2002). NMDA receptor-dependent LTP is inhibited by drugs that inhibit PI3-kinase and MAPK/ERK activation (Opazo et al.,
2003). Several findings indicated that the Ras signaling pathway has an important role in NMDA receptor-dependent forms of synaptic plasticity (Opazo et al., 2003). Hippocampal LTP is altered in mice with mutations affecting H-Ras
(Manabe et al., 2000), Ras GTPase-activating protein NF1 (neurofibromin)
(Costa et al., 2002) or SynGAP (a synaptic Ras-GTPase activating protein)
(Komiyama et al., 2002). PI3-kinase inhibitors also inhibt NMDAR mediated ERK activation (Opazo et al., 2003).
9696
In addition to regulating MAPK/ERK activation, PI3-kinase may contribute to LTP by controlling the trafficking of AMPA-type glutamate receptors. PI3- kinase is involved in the trafficking and insertion of GluR1 subunits of AMPA-type glutamate receptors (Passafaro et al., 2001), including activity-dependent changes in AMPA receptor trafficking-insertion that are implicated in LTP
(Malinow and Malenka, 2002). Membrane insertion of GluR1-containing AMPA receptors induced by NMDA receptor activation in cultured neurons is completely blocked by the PI3-kinase inhibitor wortmannin (Passafaro et al., 2001).
To answer the question, whether GH effects on hippocampal synaptic function are mediated by NMDARs or AMPARs? I used specific neurotransmitter receptor antagonists to pharmacologically isolate NMDAR and AMPAR components of synaptic transmission, tested GH for effect on these isolated, components and compared the isolated NMDAR-mediated fEPSPs (fEPSPNs) and isolated AMPAR-mediated fEPSPs (fEPSPAs) to the dual component fEPSPs. To address the question, does short-term treatment with GH have similar consequences on NMDAR expression as long-term, chronic treatment with GH? I used western blotting to measure NMDA-NR1, NR2A, and NR2B expression levels in GH treated and control rat hippocampal slices.
9797
Materials and Methodes
Electrophysiology
The methods used for hippocampal slice preparation, field potential recording and data analysis were as discussed in section I. To isolate AMPAR- dependent responses I treated slices with the NMDAR antagonist 5-amino- phosphovaleric acid (D-AP5 50 µM) for 30 min before GH application. To isolate
NMDAR-dependent responses, hippocampal slices were pretreated with 6-7- dinitroquinoxalline-2-3-dione (DNQX 30 µM), a specific competitive antagonist of
AMPAR, and bicuculline methiodide (BMI 10 µM), a specific competitive antagonist of the GABAA receptor, for 30 min before application of GH. This
pharmacological method of isolating AMPAR- and NMDAR-mediated synaptic
responses was originally described by Davies and Collingridge (1989), and has
been widely used since then.
Western Blotting
To examine the effect of GH on the expression of NMDAR subunits, hippocampal slices were prepared as described in earlier sections and allowed to recover for 1 hour After recovery, slices obtained from the same animal were placed into 2 separate interface chambers. The slices in one chamber were exposed to ACSF alone to serve as a control, and the slices in the other chamber were exposed to ACSF + GH (2 nM). After 3 hours of treatment, both groups of
9898
slices were rapidly frozen on dry ice and stored at -80 °C until used for protein isolation.
Hippocampal slices were homogenized in protein lysis buffer [1% Nonidet
P-40 (NP-40), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS),
0.15 M NaCl, 0.01 M sodium phosphate, pH 7.2, 2 mM ethylenediamine tetraacetic acid (EDTA), and 1% protease inhibitor cocktail]. Then, burst sonication was done (< 10 sec), and samples were centrifuged at 14,000 × g for
20 min. at 4 °C. The supernatant solution was obtained and total protein estimated using the Bradford method (Bradford, 1976). Equal amounts of total protein from GH treated slices and control slices (200 µg) were separated on 8% polyacrylamide gels. The separated proteins were transferred to nitrocellulose membranes (Micron Separations, Inc., Westboro, MA). The membranes were blocked (1 hour at room temperature) in 5% nonfat dry milk in T-T-S (0.5%
Tween-20, 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.2 mM EDTA), and then incubated with primary antibody diluted in 5% non-fat dry milk in T-T-S (at room temperature for 1 hour, or overnight at 4 °C). Membranes were then washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies, diluted 1:5000 in 5% non-fat dry milk in T-T-S (1 hour at room temperature or 4
°C overnight). Blots were washed again and proteins were detected on X-ray film (Fuji Medical System USA, Inc., Stamford, CT) using the ECL system
(Amersham-Pharmacia), following the manufacturer’s instructions. To correct for possible loading differences, blots were probed with an antibody to neuron- specific enolase (NSE). The following primary antibodies were used: anti-NSE
9999
(AB951, Chemicon International, 1:6000 to 1:8000), anti-NMDA-R1 (60021A,
PharMingen International, 1:1000), anti-NMDA-R2A (AB1555P, Chemicon, 1:500 to 1:2000), anti-NMDA-R2B (N38120, Transduction Laboratories, 1:2000 to
1:4000).
Reagents
Reagents used in this study were recombinant human GH (rhGH)
(Bachem), ranging from 1-2 nM (22-44 ng/ml); bicuculline methiodide (BMI 10
µM), 6-7-dinitroquinoxalline-2-3-dione (DNQX 30 µM) (Tocris) and 5-amino- phosphovaleric acid (D-AP5 50 µM). BMI and DNQX were dissolved in DMSO.
AP5 was dissolved in 100 mM NaOH.
100100
Results
GH-induced potentiation of NMDAR-mediated fEPSPs (fEPSPNs)
To determine if GH can enhance NMDAR-mediated excitatory synaptic
transmission, I isolated fEPSPNs by pretreating hippocampal slices with DNQX
(30 µM) to block AMPARs and BMI (10 µM) to block GABAA receptors (as shown
in figure 17 and 19). GH enhanced pharmacologically isolated NMDAR-mediated
excitatory synaptic transmission in CA1. To ensure that the response examined
in this experiment was actually due to NMDAR activation, I applied AP5 (50 µM),
to block NMDARs, at the end of the two hours period of GH application. AP5
blocked the previous GH enhancement, verifying that GH had acted through
NMDARs to enhance excitatory synaptic transmission.
GH-induced potentiation of AMPAR-mediated fEPSPs (fEPSPAs)
To determine if GH enhances AMPAR-mediated excitatory synaptic transmission in the CA1 region, I pretreated hippocampal slices with AP5 (50 µM) beginning 30 min before GH application to isolate fEPSPAs (Figure18 and 19).
GH caused significant enhancement of fEPSPAs. GH enhancement of fEPSPAs was significantly greater than the dual component fEPSPs (when GH was applied without AP5). This result suggests that GH can act through AMPARs in addition to NMDARs.
101101
GH treatment decreased the expression of NR2B protein
NMDARs have an important role in synaptic plasticity (Grosshans and
Browning, 2001; Mallon et al., 2004). Previous studies showed that NMDAR activation can produce either increases or decreases in synaptic efficiency depending on the subunit composition of NMDAR (Bliss and Schoepfer, 2004). In order to investigate the effect of GH treatment on subunit composition of
NMDARs, hippocampal brain slices were perfused in ACSF containing GH (2 nM) for 3 hours Control slices were perfused with ACSF alone for the same time period. Western blotting of hippocampal slice homogenates revealed decreased protein expression of NR2B, but no change in NR2A or NR1 (Figure 20).
102102
Figure 17. GH enhanced isolated NMDAR-mediated fEPSPs (fEPSPNs).
GH (1 nM) enhanced fEPSP in slices pretreated (beginning 30 min before GH application) with DNQX (30 µM) to block AMPA receptors and BMI (10 µM) to block GABAA receptors. Addition of the NMDAR competitive antagonist, AP5, at the end of the two hours GH application period verified that the enhanced fEPSP was mediated by NMDA receptors (see the inset top left). The inset shows the response recorded during the pre-GH baseline period (thin solid line), the response during 2nd hour of GH treatment (thick solid lines), and the response after addition of AP5 (dotted line). Significant enhancement of fEPSP slope was obtained in both GH alone (squares, n=10) and GH+DNQX (circles, n=5) compared to baseline recording and compared to ACSF alone control (diamonds), p<.05. There was no significant difference between application of GH alone and GH+DNQX+ BMI, p>.05.
103103
Figure 18. GH enhanced isolated AMPAR-mediated fEPSPs (fEPSPAs)
GH (1 nM) enhanced fEPSP slope in slices pretreated with AP5 (50 µM, beginning 30 min before GH application) to block NMDARs. The inset shows fEPSPs during the 15 min baseline recording (thin lines), and fEPSPS during the
2ndh of GH treatment (thick lines) either in the presence (n=6) or absence of AP5,
(n=10). GH significantly enhanced fEPSP in the presence of AP5 (uptriangles) compared to its absence (squares, p<.05). EPSPs slope was significantly enhanced in both the presence and absence of AP5 compared to baseline recording and compared to ACSF control (diamonds, p<.05).
104104
500 * + ne)
i 400 l e s a
b + 300 + ns ope (% 200
fEPSP sl 100
0
F H I 1st hr S G M P5 C A +B +A H 2nd hr QX G N +D H G
Figure 19. Summary comparison of effects of GH alone, GH+DNQX+BMI,
GH+AP5 and control ACSF. GH enhanced both fEPSPNs and fEPSPAs. Non significant change between the GH enhancement of fEPSPNs and dual component fEPSPs. GH enhancement of fEPSPAs was significantly higher than the dual component fEPSPs. Results represent the mean ± SE during the indicated time periods; * = significant difference at p<0.04 compared to GH treatment alone, ns = nonsignificant compared to GH application alone at p>0.3,
+ = significant difference at p<0.02 compared to pre-GH baseline and ACSF alone.
105105
Figure 20
A.
B
105 l)
o 100 r
95 ** 90
85 Mean grey (% cont
80 NR1 NR2A NR2B Type of the NMDA receptor subunit
106106
Figure 20. GH decreased NR2B, but not NR1 or NR2A protein
A. Hippocampal slices were treated with 2 nM GH or ACSF alone for 3 hours.
Western blotting of slice homogenates revealed decreased NR2B protein in GH treated tissue. NR2A and NR1 levels were unaffected by GH treatment. NSE was used as a loading control.
B. Statistical analysis of GH effects on NMDAR subunit expression. Blots were analyzed by densitometry, and normalized relative to control. GH caused a significant decrease in NR2B protein (**p<0.007, n = 12), but NR1 (p<0.2, n =12) and NR2A (p<0.2, n =12) were not altered by GH.
107107
Discussion
GH affects the expression of NMDARs, which are required for normal memory function. In tetanization-induced LTP, NMDARs play an important role in the induction of synaptic potentiation, by allowing calcium influx into postsynaptic neurons during high frequency stimulation, and the block of NMDARs, for example, by AP5, inhibits LTP (Bliss and Collingridge, 1993). It is well known that LTP is triggered by calcium influx into postsynaptic neurons in the CA1 area of the hippocampus. Although metabotropic GluRs and voltage-gated calcium channels contribute to postsynaptic calcium increase under some circumstances,
NMDARs are the major route for calcium entry (Bliss and Collingridge, 1993). To isolate NMDAR mediated synaptic responses and examine effects of GH, slices were perfused with ACSF containing DNQX and BMI beginning 30 min before and continuing during GH treatment (Figure 17). I found that GH caused an enhancement of fEPSPNs that appeared essentially identical in amplitude and time course with the GH-enhancement of dual component fEPSPs. Thus, the enhancing effect of GH on fEPSPs in area CA1 is mediated in part by NMDARs.
Previous studies indicated that over activation of NMDARs before or during tetanic train reduces the probability to generate LTP of the fEPSPAs
(Coen et al., 1989; Huang et al., 1992; Izumi et al., 1992; Neuman et al., 1987), without preventing LTP of pharmacologically isolated fEPSPNs (Bashir et al.,
108108
1991; Berretta et al., 1991; Gozlan et al., 1994; Xie et al., 1992). To determine if
GH enhancement of excitatory synaptic transmission in the CA1 region of hippocampus is also mediated by AMPARs, hippocampal slices were perfused with ACSF containing the NMDAR blocker AP5 to isolate fEPSPAs. My results indicate that pharmacological inhibition of NMDARs by AP5 and treatment with
GH produced enhancement of isolated fEPSPAs that is significantly greater than dual component fEPSPs (Figure 18 and 19). This result is supported by the finding of Aniksztejn and Ben-Ari (1995) that addition of 7-Chlorolynurenate
(7Cl¯-kyn), an antagonist of the allosteric glycine site on NMDARs, and application of strong tetanic stimulation significantly potentiated the isolated fEPSPAs. However, strong tetanus in the absence 7Cl¯-kyn did not affect fEPSPAs. In the study of Aniksztejn and Ben-Ari (1995), the authors tested the hypothesis that the expression of LTP by AMPARs and NMDARs depends on the degree of NMDAR activation during the tetanus. They found that LTP of fEPSPAs has a lower threshold than that of fEPSPNs. They suggested that tetani that generate LTP of fEPSPNs have a low probability of inducing LTP of fEPSPAs. They concluded that AMPA and NMDA components are potentiated through two different postsynaptic processes. Aniksztejn and Ben-Ari (1995) proposed a model representing the relative contribution of AMPARs & NMDARs to LTP as function of degree of NMDAR activation (Figure 21).
109109
Figure 21. Model representing the relative contribution of AMPARs and
NMDARs to LTP as function of degree of NMDARs activation. The degree of contribution of AMPARs to LTP depends on the the degree of NMDAR activation.
At the beginning of tetanization AMPAR contribution to the postsynaptic response is high. However, with progressively greater NMDAR activation, the
AMPA contribution to tetanization decreases gradually until it vanishes, resulting in the bell shaped response to tetanization (modified from Aniksztejn and Ben-
Ari, 1995).
In agreement with the results of Aniksztejn and Ben-Ari, 1995; Gozlan et al., 1994; Huang et al., 1992; Izumi et al., 1992; Xie et al., 1992; Bashir et al.,
110110
1991; Berretta et al., 1991; Coen et al., 1989; Neuman et al., 1987, I suggest that
GH produces strong activation of NMDARs that inhibits the AMPAR contribution to GH-dependent L-LTP. However, keep in mind that the GH effect was of slow onset resulting in a gradual increase in the number of NMDARs activated.
Therefore, it is wise not to rule out the possibility of an AMPAR contribution to fEPSP enhancement at least during the initial 30 min of GH treatment. It is important to understand how NMDARs could exert a negative regulatory effect on the AMPAR’s response to GH. Iwakura et al. (2001) found that NMDA treatment of cultured hippocampal neurons reduced the total number of bound
AMPARs on the neuronal surface, but not in the total membrane fraction. They also observed that NMDA-treatment caused down-regulation of AMPA-stimulated channel activity and reduced immunoreactivity for GluR1. They concluded that
NMDAR activation induced down-regulation of functional AMPARs. Further investigation is needed to clarify the mechanism by which GH-induced NMDAR activation limits the response of AMPARs.
NMDAR antagonists block the induction of both LTP and LTD (Bliss and
Collingridge, 1993; Dudec and Bear, 1992), and the NMDAR subunit composition is considered a determining factor for LTP or LTD (Bliss and Schoepfer, 2004;
Liu et al., 2004). To investigate the role of NMDAR subunit composition in mediating GH effects, hippocampal brain slices were perfused with ACSF containing GH (2 nM) for 3 hours Western blots of GH treated slices showed
111111
decreased protein expression of the NR2B subunit of NMDARs (Figure 20).
NR2A and NR1 protein level were unaffected by GH treatment for 3 hours.
Liu et al. (2004) reported the requirement of NMDARs that is lacking their
NR2B subunits for LTP induction. The use of the NR2A specific antagonist NVP-
AAMO77 (0.4 µM) prevented both normal LTP induced by a single episode of
HFS and saturated LTP induced by multiple episodes of HFS, but had little effect
on LFS-induced LTD (Liu et al., 2004). Mallon et al. (2004) reported that “LTP
induction critically involves primarily receptors containing the NR2A subunit”.
They added that “endogenous factors or drugs that modify this NR2B/NR2A
interaction could have a major influence on synaptic transmission and plasticity in
the brain”. At both presynaptic and postsynaptic sites in the rat hippocampus,
NR2B-subunit-containing receptors limit NMDAR function by inhibitory restraint
over NR2A-subunit-containing receptors, via calcineurin activation (Mallon et al.,
2004).
In my experiments, GH decreased the expression of NR2B subunits but
not the NR2A subunits. According to the findings of Mallon et al. (2004), Liu et al.
(2004), Bliss and Schoepfer (2004), Bliss and Collingridge (1993), and Dudec
and Bear (1992), this decrease in the NR2B subunit should allow enhanced
function of the NR2A-containing NMDARs.The relative loss of NR2B compared
to NR2A after GH treatment might therefore contribute to the GH-induced enhancement of fEPSPs.
112112
Figure 22. Diagrammatic illustration of the proposed mechanism of
interaction between GH, PI3-kinase, MAPK, and NMDARs. GH activates
GHR/JAK2, which activates PI3-kinase. PI3-kinase activates Fyn tyrosine kinase, which then activates NMDARs. NMDARs activate SynGAP, converting inactive ras to active ras and activating MAPK pathway.
Proposed mechanisms of interaction between GH, PI3-kinase, MAPK, and
NMDARs
My results indicate that GH-induced L-LTP was mediated at least in part by NMDARs. Also GH treatment for 3 hours decreased expression of the NR2B
113113
subunit, supporting my earlier finding that GH enhanced fEPSPNs. An important question here is: How does GH regulate NMDAR subunit expression and
NMDAR function? In addition, my finding that PI3-kinase and MAPK were important for the induction of GH effects on fEPSPs raises another question, how
GH-induced enhancement of NMDAR function is related to PI3-kinase and
MAPK signaling pathways?
Recent studies have shown that the regulatory subunit of PI3-kinase, P85, binds directly to NR2B subunits (Hisatsune et al., 1999). Also PI3-kinase stimulates a group of tyrosine kinases called Fyn tyrosine kinase (Hisatsune et al., 1999). MEK and ERK are regulated by SynGAP, a Ras GTPase-activating protein that binds PSD-95 (Kim et al., 1998). More recent studies show that
NMDARs join large multiprotein complexes that contain a number of proteins involved in Ras signaling (Husi et al., 2000). Taken together, These results suggest that GH activation of the JAK2/PI3-kinase pathway enhances NMDAR activation probably by phosphorylation, and also contributes to down-regulation of NR2B subunits allowing NR2A to become dominant mediating GH-dependent
L-LTP (Figure 22). In addition, GH might also activate the MAPK pathway through the association of NMDARs, PSD-95 and SynGAP. Further investigation is needed to know the exact molecular mechanisms that link GH stimulation of
PI3-kinase and MAPK to NMDARs.
114114
CONCLUSION
115115
Previous studies have shown that GH affects many functions of the central nervous system, with beneficial effects on memory, alertness and motivation.
Others indicated that a common set of cellular mechanisms link GH-induced improvement of memory function to NMDARs and LTP. Yet the mechanisms by which GH improves memory function of the brain or how GH-induced improvement of memory function relates to NMDARs and LTP are not well established. The purpose of this study was three-fold. First, to determine if the short term treatment with GH affects synaptic transmission in CA1 area of rat hippocampus. Second, if GH does affect synaptic transmission, to determine which GH-signaling pathway or pathways are required, and to determine whether protein synthesis is required. Third, to determine the roles of AMPARs and
NMDARs in mediating GH action.
In summary, my results showed that GH caused a long-lasting enhancement of excitatory synaptic transmission in area CA1 of rat hippocampus. This GH-induced L-LTP blocked further potentiation by tetanus.
GH did not act through an increase in probability of glutamate release from presynaptic terminals. The GH-induced potentiation of fEPSPs required JAK2,
PI3-kinase, and MAPK, and the synthesis of new protein, but only during induction of potentiation, and not during maintenance of potentiation. GH-induced potentiation of excitatory synaptic transmission was mediated through NMDARs.
Finally, GH treatment of hippocampal brain slices increased GHR message and decreased the abundance of NR2B protein.
116116
My results demonstrate that GH induced L-LTP is related to both
NMDARs channel activity and subunit composition, and there are common signaling pathways underlying GH-induced L-LTP and tetanization-induced L-
LTP. Thus, GH enhancement of synaptic transmission in the hippocampus might explain the well known finding that GH treatment improves cognition and memory. My discovery that GH is a potent short-term modulator of excitatory synaptic transmission in the hippocampus will facilitate a deeper understanding of neuroendocrine regulation of memory function. However, this discovery raises new issues that were not apparent previously. Future studies will be needed in several areas. First, to verify the exact molecular mechanisms by which GH induces activation of GHR/JAK2, PI3-kinase and MAPK, and alters NMDAR expression and protein synthesis. Second, to determine whether GH stimulates
IGF-I release and to assess whether IGF-I participates in the short term effects of
GH in hippocampus.
117117
REFERENCES
Adams JP, Sweatt JD (2002) Molecular psychology: roles for the ERK MAP kinase cascade in memory. Annu Rev Pharmacol Toxicol 42:135-163
Aleman A, de Vries WR, de Haan EH, Verhaar HJ, Samson MM, Koppeschaar
HP (2000) Age-sensitive cognitive function, growth hormone and insulin-like growth factor 1 plasma levels in healthy older men. Neuropsychobiology
41(2):73-78
Alexandros N, George M, Edward O, Anthony K, Philip W and George P (1999)
Sleep deprivation effects on the activity of the hypothalamic-pituitary-adrenal and growth axes: potential clinical implications. Clin Endocrinol 51: 205-215
Anderson NG (1992) Growth hormone activated mitogen-activated protein kinase and S6 kinase and promotes intracellular tyrosine phosphorylation in 3T3-F442A preadipocytes. Biochem J 284:649-652
Aniksztejn L, Ben-Ari Y (1995) Expression of LTP by AMPA and/or NMDA receptors is determined by the extent of NMDA receptors activation during the tetanus. J Neurophysiol 74(6):2349-57
118118
Arends NJ, Boonstra VH, Hokken-Koelega AC (2004) Head circumference and body proportions before and during growth hormone treatment in short children who were born small for gestational age. Pediatrics 114(3):683-690
Arends NJ, Boonstra VH, Mulder PG, Odink RJ, Stokvis-Brantsma WH, Rongen-
Westerlaken C, Mulder JC, Delemarre-Van de Waal H, Reeser HM, Jansen M,
Waelkens JJ, Hokken-Koelega AC (2003) GH treatment and its effect on bone mineral density, bone maturation and growth in short children born small for gestational age: 3-year results of a randomized, controlled GH trial. Clin
Endocrinol (Oxf) 59(6):779-787
Argetsinger LS, Campbell GS, Yang XJ, Witthuhn BA, Silvennoline O, Ihle JN
Carter-Su C (1993) Identification of JAK2 as a GHR-associated tyrosine kinase.
Cell 74:237-244
Artola A, Singer W (1993) Long-term depression of excitatory synaptic transmission and its relationship to long-term potentiation. Trends Neurosci.
16(11):480-7
Arwert LI, Deijen JB, Drent ML (2003) Effects of an oral mixture containing glycine, glutamine and niacin on memory, GH, and IGF-I secretion in middle- aged and elderly subjects. Nutr Neurosci 6(5):269-275
119119
Autilio LA, Appel SH, Pettis P, Gambetti PL (1968) Biochmical studies of synapses in vitro.I. Protein synthesis. Biochem 7, 2615-2622
Bashir ZI, Alford S, Davies SN, Randall AD, Collingridge GL (1991) Long-term potentiation of NMDA receptor-mediated synaptic transmission in the hippocampus Nature 10;349(6305):156-8
Bazan JF (1989) A novel family of growth factor receptors: a common binding domain in the growth hormone, prolactin, erythropoietin and IL-6 receptor, and the p75 IL-2 receptor β-chain. Biochem Biophys Res Commun 164:788-795
Bear MF, Malenka RC. (1994) Synaptic plasticity: LTP and LTD. Curr Opin
Neurobiol. 4(3):389-99
Bekkers JM, Stevens CF (1989) Presynaptic mechanism for long-term potentiation in the hippocampus. Nature 346:724-729
Bengtsson BA, Eden S, Lonn L, Kvist H, Stokland A, Lindstedt G, Bosaeus I, Tolli
J, Sjostrom L, Isaksson OG (1993) Treatment of adults with growth hormone
(GH) deficiency with recombinant human GH. J Clin Endocrinol Metab 76(2):309-
317
120120
Berg U, Bang P (2004) Exercise and circulating insulin-like growth factor I. Horm
Res 62 Suppl 1:50-8
Berretta N, Berton F, Bianchi R, Brunelli M, Capogna M, Francesconi W (1991)
Long-term Potentiation of NMDA Receptor-mediated EPSP in Guinea-pig
Hippocampal Slices Eur J Neurosci.;3(9):850-854
Bjork S, Jonsson B, Westphal O, Levin JE (1989) Quality of life of adults with growth hormone deficiency: a controlled study. Acta Paediatr Scand Suppl
356:55-59
Bliss T, Schoepfer R (2004) Controlling the ups and downs of synaptic strength.
Science 304(5673):973-974
Bliss TVP, Collingridge GL (1993) A synaptic model of memory: long-term potentiation in the hippocampus. Nature 361:31-39
Bliss TVP, Lomo T (1973) Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path. J Physiol 232:331-356
Bodian D (1965) A suggestive relationship of nerve cell RNA with specific synaptic sites. Proc Natl Acad Sci USA 53,418-425
121121
Boguszewski M, Dahlgren J, Bjarnason R, Rosberg S, Carlsson LM, Carlsson B,
Albertsson-Wikland K (1997) Serum leptin in short children born small for gestational age: relationship with the growth response to growth hormone treatment. The Swedish Study Group for Growth Hormone Treatment. Eur J
Endocrinol 137(4):387-395
Buller AL, Larson HC, Schneider BE, Beaton JA, Morrisett RA, Monaghan DT
(1994) The molecular basis of NMDA receptor subtypes: native receptor diversity is predicted by subunit composition. J Neurosci 14(9):5471-5484
Burman P, Broman JE, Hetta J, Wiklund I, Erfurth EM, Hagg E, Karlsson FA
(1995) Quality of life in adults with growth hormone (GH) deficiency: response to treatment with recombinant human GH in a placebo-controlled 21-month trial. J
Clin Endocrinol Metab 80(12):3585-3590
Burman P, Hetta J, Wide L, Mansson JE, Ekman R, Karlsson FA (1996) Growth hormone treatment affects brain neurotransmitters and thyroxine. Clin Endocrinol
(Oxf) 44(3):319-324
Burman P, Deijen JB (1998) Quality of life and cognitive function in patients with pituitary insufficiency. Psychother Psychosom 67(3):154-167
122122
Cantrell DA (2001) Phosphoinositide 3-kinase signalling pathways. J Cell Sci
114(Pt 8):1439-1445
Carlson HE, Gillin JC, Gorden P, Snyder F (1972) Abscence of sleep-related growth hormone peaks in aged normal subjects and in acromegaly. J Clin
Endocrinol Metab 34(6):1102-5
Chou MM, Hou W, Johnson J, Graham LK, Lee MH, Chen CS, Newton AC,
Schaffhausen BS, Toker A (1998) Regulation of protein kinase C zeta by PI 3- kinase and PDK-1. Curr Biol 8(19):1069-1077
Chrisoulidou A, Kousta E, Beshyah SA, Robinson S, Johnston DG (1998) How much, and by what mechanisms, does growth hormone replacement improve the quality of life in GH-deficient adults? Baillieres Clin Endocrinol Metab 12(2):261-
279
Coan EJ, Irving AJ, Collingridge GL (1989) Low-frequency activation of the
NMDA receptor system can prevent the induction of LTP. Neurosci Lett
23;105(1-2):205-10
Corpas E, Harman SM, Blackman MR (1993) Human growth hormone and human aging. Endocr Rev 14(1):20-39
123123
Corvera S, Czech MP (1998) Direct targets of phosphoinositide 3-kinase products in membrane traffic and signal transduction. Trends Cell Biol 8(11):442-
446
Costa A, Zoppetti G, Benedetto C, Bertino E, Marozio L, Fabris C, Arisio R,
Giraudi GF, Testori O, Ariano M, et al. (1993) Immunolike growth hormone substance in tissues from human embryos/fetuses and adults. J Endocrinol
Invest 16(8):625-633
Costa RM, Federov NB, Kogan JH, Murphy GG, Stern J, Ohno M, Kucherlapati
R, Jacks T, Silva AJ (2002) Mechanism for the learning deficits in a mouse model of neurofibromatosis type 1. Nature 415(6871):526-530
Cukier C, Waitzberg DL, Borges VC, Silva Mde L, Gama-Rodrigues J, Pinotti HW
(1999) Clinical use of growth hormone and glutamine in short bowel syndrome
Rev Hosp Clin Fac Med Sao Paulo 54(1):29-34
Cull-Candy S, Brickley S, Farrant M (2001) NMDA receptor subunits: diversity, development and disease. Curr Opin Neurobiol 11(3):327-335
124124
Cummings JA, Mulkey RM, Nicoll RA, Malenka RC (1996) Ca2+ signaling requirements for long-term depression in the hippocampus. Neuron 16(4):825-
833
Darendeliler F, Ranke MB, Bakker B, Lindberg A, Cowell CT, Albertsson-Wikland
K, Reiter EO, Price DA (2005) Bone Age Progression during the First Year of
Growth Hormone Therapy in Pre-Pubertal Children with Idiopathic Growth
Hormone Deficiency, Turner Syndrome or Idiopathic Short Stature, and in Short
Children Born Small for Gestational Age: Analysis of Data from KIGS (Pfizer
International Growth Database). Horm Res 63(1):40-47
Davis S, Butcher SP, Morris RGM (1992) The NMDA receptor antagonist D-2- amino-5-phosphonopentanoate (D-APV) impairs spatial learning and LTP in vivo at intracerebral concentrations comparable to those that block LTP in vitro. J
Neurosci 12:21-34
Davies SN, Collingridge GL (1989) Role of excitatory amino acid receptors in synaptic transmission in area CA1 of rat hippocampus. Proc R Soc Lond B Biol
Sci. 22;236(1285):373-84
Davis HP, Squire LR (1984) Protein synthesis and memory: a review. Psychol
Bull 96:518-559
125125
Davis S, Vanhoutte P, Pages C, Caboche J, Laroche S (2000) The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J Neurosci 20(12):4563-4572
Deijen JB, de Boer H, Blok GJ, van der Veen EA (1996) Cognitive impairments and mood disturbances in growth hormone deficient men.
Psychoneuroendocrinology 21(3):313-322
Deijen JB, de Boer H, van der Veen EA (1998) Cognitive changes during growth hormone replacement in adult men. Psychoneuroendocrinology 23(1):45-55
Desmond NL, Levy WB (1988) Synaptic interface surface area increases with long-term potentiation in the hippocampal dentate gyrus. Brain Res 453:308-314
Dobrunz LE, Stevens CF (1997) Heterogeneity of release probability, facilitation, and depletion at central synapses. Neuron 18(6):995-1008
Donahue CP, Jensen RV, Ochiishi T, Eisenstein I, Zhao M, Shors T, Kosik KS
(2002) Transcriptional profiling reveals regulated genes in the hippocampus during memory formation. Hippocampus 12:821-833
126126
Dudek SM, Bear MF (1992) Homosynaptic long-term depression in area CA1 of hippocampus and effects of N-methyl-D-aspartate receptor blockade. Proc Natl
Acad Sci USA 89(10):4363-4367
Erreger K, Dravid SM, Banke TG, Wyllie DJ, Traynelis SF (2005) Subunit-specific gating controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and synaptic signaling profiles. J Physiol. Feb 17; [Epub ahead of print]
Everson CA, Crowley WR (2004) Reductions in circulating anabolic hormones induced by sustained sleep deprivation in rats. Am J Physiol Endocrinol Metab.
286(6):E1060-70
Fargo LM, Panda C, Dickson SL, Hewson AK, Argente J, Chowen JA (2002)
Growth hormone and GH- releasing peptide-6 increase brain insulin-like growth factor-1 expression and activate intracellular signaling pathways involved in neuroprotection, Endocrinology 143(10):4113-4122
Fernandez L, Flores-Morales A, Lahuna O, Sliva D, Norstedt G, Haldosen LA,
Mode A, Gustafsson JA (1998) Desensitization of the growth hormone-induced
Janus kinase 2 (Jak 2)/signal transducer and activator of transcription 5 (STAT5)- signaling pathway requires protein synthesis and phospholipase C.
Endocrinology 139(4):1815-1824
127127
Flexner JB, Flexner LB, Stellar E (1963) Memory in mice as affected by intracerebral puromycin. Science 141:57-59
Flint AC, Maisch US, Weishaupt JH, Kriegstein AR, Moyer H (1997) NR2A subunit expression shortens NMDAR synaptic currents in developing neocortex.
J Neurosci 17(7):2469-2476
Flores-Morales A, Fernandez L, Rico-Bautista E, Umana A, Negrin C, Zhang JG,
Norstedt G (2001) Endoplasmic reticulum stress prolongs GH-induced Janus kinase (JAK2)/signal transducer and activator of transcription (STAT5) signaling pathway. Mol Endocrinol 15(9):1471-1483
Frey U, Frey S, Schollmeier F and Krug M (1996) Influence of actinomycin D, a
RNA synthesis inhibitor, on long-term potentiation in rat hippocampal neurons in vivo and in vitro. J Physiol (Lond) 490:703-711
Frey U, Huang YY, Kandel ER (1993) Effects of cAMP simulate a late stage of
LTP in hippocampal CA1 neurons. Science 260(5114):1661-1664
Frey U, Morris RG (1997) Synaptic tagging and long-term potentiation. Nature
385(6616):533-536
128128
Friedrichsen BN, Galsgaard ED, Nielsen JH, Moldrup A (2001) Growth hormone- and prolactin-induced proliferation of insulinoma cells, INS-1, depends on activation of STAT5 (signal transducer and activator of transcription 5). Mol
Endocrinol 15(1):136-148
Furuta S, Shimada O, Doi N, Ukai K, Nakagawa T, Watanabe J, Imaizumi M
(2004) General pharmacology of KP-102 (GHRP-2), a potent growth hormone- releasing peptide. Arzneimittelforschung 54(12):868-880
Gardoni F, Schrama LH, Kamal A, Gispen WH, Cattabeni F, Di Luca M (2001)
Hippocampal synaptic plasticity involves competition between Ca2+/calmodulin- dependent protein kinase II and postsynaptic density 95 for binding to the NR2A subunit of the NMDA receptor. J Neurosci 21(5):1501-1509
Gebert CA, Park SH, Waxman DJ (1999) Termination of growth hormone pulse- induced STAT5b signaling. Mol Endocrinol 13(1):38-56
Gibney J, Wallace JD, Spinks T, Schnorr L, Ranicar A, Cuneo RC, Lockhart S,
Burnand KG, Salomon F, Sonksen PH, Russell-Jones D (1999) The effects of 10 years of recombinant human growth hormone (GH) in adult GH-deficient patients. J Clin Endocrinol Metab 84(8):2596-2602
129129
Golgeli A, Tanriverdi F, Suer C, Gokce C, Ozesmi C, Bayram F, Kelestimur F
(2004) Utility of P300 auditory event related potential latency in detecting cognitive dysfunction in growth hormone (GH) deficient patients with Sheehan's syndrome and effects of GH replacement therapy. Eur J Endocrinol 150(2):153-
159
Gozlan H, Diabira D, Chinestra P, Ben-Ari Y (1994) Anoxic LTP is mediated by the redox modulatory site of the NMDA receptor J Neurophysiol 72(6):3017-22
Greenhalgh CJ, Alexander WS (2004) Suppressors of cytokine signalling and regulation of growth hormone action. Growth Horm IGF Res 14(3):200-6
Greenhalgh CJ, Rico-Bautista E, Lorentzon M, Thaus AL, Morgan PO, Willson
TA, Zervoudakis P, Metcalf D, Street I, Nicola NA, Nash AD, Fabri LJ, Norstedt
G, Ohlsson C, Flores-Morales A, Alexander WS, Hilton DJ (2005) SOCS2 negatively regulates growth hormone action in vitro and in vivo. J Clin Invest
115(2):233-6
Grosshans DR, Browning MD (2001) Protein kinase C activation induces tyrosine phosphorylation of the NR2A and NR2B subunits of the NMDA receptor. J
Neurochem 76(3):737-744
130130
Grunwald T, Beck H, Lehnertz K, Blumcke I, Pezer N, Kurthen M, Fernandez G,
Van Roost D, Heinze HJ, Kutas M and Elger CE (1999) Evidence relating human
verbal memory to hippocampal N-methyl-D-aspartate receptors. Proc Natl Acad
Sci USA 96:12085-12089
Guyton AC, Hall, JE (2000) Textbook of Medical Physiology. W.B.
Saunderscompany: Philadelphia, Pennsylvania 19106.
Harvey S, Hull K (2003) Neural growth hormone: an update. J Mol Neurosci
20(1):1-14
Harvey S, Hull KL, Fraser RA (1993) Growth hormone: neurocrine and neuroendocrine perspectives. Growth Regul 3(3):161-171
Hayashi M, Shimohira M, Saisho S, Shimozawa K, Iwakawa Y (1992) Sleep disturbance in children with growth hormone deficiency. Brain Dev 14(3):170-174
Heinze E, Boker M, Blum W, Behnisch W, Schulz A, Urban J, Mauch E (1998)
GH, IGF-I, IGFBP-3 and IGFBP-2 in cerebrospinal fluid of infants, during puberty and in adults. Exp Clin Endocrinol Diabetes 106(3):197-202
131131
Hisatsune C, Umemori H, Mishina M, Yamamoto T (1999) Phosphorylation- dependent interaction of the N-methyl-D-aspartate receptor epsilon 2 subunit with phosphatidylinositol 3-kinase. Genes Cells. Nov;4(11):657-66
Hodge C, Liao J, Stofega M, Guan K, Carter-Su C, Schwartz J (1998) Growth hormone stimulates phosphorylation and activation of elk-1 and expression of c- fos, egr-1, and junB through activation of extracellular signal-regulated kinases 1 and 2. J Biol Chem 273(47):31327-31336
Hojvat S, Emanuele N, Baker G, Connick E, Kirsteins L, Lawrence AM (1982)
Growth hormone (GH), thyroid-stimulating hormone (TSH), and luteinizing hormone (LH)-like peptides in the rodent brain: non-parallel ontogenetic development with pituitary counterparts. Brain Res 256(4):427-434
Hsieh CC, Papaconstantinou J (2004) Akt/PKB and p38 MAPK signaling, translational initiation and longevity in Snell dwarf mouse livers. Mech Ageing
Dev. 125(10-11):785-98
Huang YY, Kandel ER (1994) Recruitment of long-lasting and protein kinase A- dependent long-term potentiation in the CA1 region of hippocampus requires repeated tetanization. Learn Mem 1(1):74-82
132132
Huang YY, Kandel ER (1995) D1/D5 receptor agonists induce a protein synthesis-dependent late potentiation in the CA1 region of the hippocampus.
Proc Natl Acad Sci USA 92(7):2446-2450
Huang YY, Li XC, Kandel ER (1994) cAMP contributes to mossy fiber LTP by initiating both a covalently mediated early phase and macromolecular synthesis- dependent late phase. Cell 79(1):69-79
Huang YY, Colino A, Selig DK, Malenka RC (1992) The influence of prior synaptic activity on the induction of long-term potentiation. Science.
7;255(5045):730-3
Hull KL, Harvey S (1998) Autoregulation of growth hormone receptor and growth hormone binding protein transcripts in brain and peripheral tissues of the rat.
Growth Horm IGF Res 8(2):167-173
Husi H, Ward MA, Choudhary JS, Blackstock WP, Grant SG (2000) Proteomic analysis of NMDA receptor-adhesion protein signaling complexes. Nat Neurosci.
3(7):661-9
Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme JC,
Chan G, Storm DR (1998) Cross talk between ERK and PKA is required for Ca2+
133133
stimulation of CREB-dependent transcription and ERK nuclear translocation.
Neuron 21(4):869-883
Iranmanesh A, Lizarralde G, Veldhuis JD (1991) Age and relative adiposity are specific negative determinants of the frequency and amplitude of growth hormone (GH) secretory bursts and the half-life of endogenous GH in healthy men. J Clin Endocrinol Metab. 73(5):1081-8
Iwakura Y, Nagano T, Kawamura M, Horikawa H, Ibaraki K, Takei N, Nawa H
(2001) N-methyl-D-aspartate-induced alpha-amino-3-hydroxy-5-methyl-4- isoxazole proprionic acid (AMPA) receptor down-regulation involves interaction of the carboxyl terminus of GluR2/3 with Pick1. Ligand-binding studies using
Sindbis vectors carrying AMPA receptor decoys. J Biol Chem. 26;
276(43):40025-40032.
Izumi Y, Clifford DB, Zorumski CF (1992) Inhibition of long-term potentiation by
NMDA-mediated nitric oxide release. Science 28;257(5074):1273-6
Ji S, Frank SJ, Messina JL (2002) Growth hormone-induced differential desensitization of STAT5, ERK, and Akt phosphorylation. J Biol Chem
277(32):28384-28393
134134
Kaba H, Hayashi Y, Higuchi T, Nakanishi S (1994) Induction of an olfactory
memory by the activation of a metabotropic glutamate receptor. Science
265:262-264
Kamp GA, Waelkens JJ, de Muinck Keizer-Schrama SM, Delemarre-Van de
Waal HA, Verhoeven-Wind L, Zwinderman AH, Wit JM (2002) High dose growth
hormone treatment induces acceleration of skeletal maturation and an earlier
onset of puberty in children with idiopathic short stature. Arch Dis Child
87(3):215-220
Kang H, Schuman EM (1995) Long lasting neurotrophin-induced enhancement of synaptic transmission in adult hippocampus. Science 267:1658-1662
Kappelgaard AM, Bojesen A, Skydsgaard K, Sjogren I, Laursen T (2004) Liquid growth hormone: preservatives and buffers. Horm Res 62 Suppl 3:98-103
Kelleher III RJ, Govindarajan A, Tonegawa S (2004a) Translational Regulatory
Mechanisms in Persistent Forms of Synaptic Plasticity. Neuron 44(1):59-73
Kelleher III RJ, Govindarajan A, Jung H-Y, Kang H, Tonegawa S (2004b)
Translational control by MAPK signaling in long term synaptic plasticity and memory. Cell 116:467-469
135135
Kelly A, Lynch MA (2000) Long-term potentiation in dentate gyrus of the rat is
inhibited by the phosphoinositide 3-kinase inhibitor, wortmannin.
Neuropharmacology 39(4):643-651
Kim JH, Liao D, Lau LF, Huganir RL (1998) SynGAP: a synaptic RasGAP that
associates with the PSD-95/SAP90 protein family. Neuron 20(4):683-91
Kim SO, Jiang J, Yi W, Feng GS, Frank SJ (1998) Involvement of the Src
homology 2-containing tyrosine phosphatase SHP-2 in growth hormone
signaling. J Biol Chem. Jan 23;273(4):2344-54
Kimura F, Tsai CW (1984) Ultradian rhythm of growth hormone secretion and
sleep in the adult male rat. J Physiol. 353:305-15
Kohr G, Jensen V, Koester HJ, Mihaljevic AL, Utvik JK, Kvello A, Ottersen OP,
Seeburg PH, Sprengel R, Hvalby O (2003) Intracellular domains of NMDA
receptor subtypes are determinants for long-term potentiation induction. J
Neurosci 23(34):10791-10799
Komiyama NH, Watabe AM, Carlisle HJ, Porter K, Charlesworth P, Monti J,
Strathdee DJ, O'Carroll CM, Martin SJ, Morris RG, O'Dell TJ, Grant SG (2002)
SynGAP regulates ERK/MAPK signaling, synaptic plasticity, and learning in the
136136
complex with postsynaptic density 95 and NMDA receptor. J Neurosci
22(22):9721-9732
Krug M, Lossner B, Ott T (1984) Anisomycin blocks the late phase of long-term potentiation in the dentate gyrus of freely moving rats. Brain Res Bull. 13(1):39-
42
Kullmann DM, Erdemli G, Asztely F (1996) LTP of AMPA and NMDA receptor- mediated signals: evidence for presynaptic expression and extra synaptic glutamate spillover. Neuron 17:461-474
Lai Z, Roos P, Zhai O, Olsson Y, Fholenhag K, Larsson C, Nyberg F (1993) Age- related reduction of human growth hormone-binding sites in the human brain.
Brain Res 621(2):260-266
Larsen L, Ropke C (2002) Suppressors of cytokine signalling: SOCS. APMIS
110(12):833-44
Lau LF, Huganir RL (1995) Differential tyrosine phosphorylation of N-methyl-D- aspartate receptor subunits. J Biol Chem 270(34):20036-20041
Laurence J (1995) Growth hormone in HIV/AIDS: current uses and future prospects. Pediatr AIDS HIV Infect 6(5):281-91
137137
Lazarus DD, Scanes CG (1988) Acute effects of hypophysectomy and administration of pancreatic and thyroid hormones on circulating concentrations of somatomedin-C in young chickens: relationship between growth hormone and somatomedin-C. Domest Anim Endocrinol 5(4):283-289
Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ (1998)
Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281(5385):2042-2045
Le Greves M, Steensland P, Le Greves P, Nyberg F (2002) Growth hormone induces age-dependent alteration in the expression of hippocampal growth hormone receptor and N-methyl-D-aspartate receptor subunits gene transcripts in male rats. Proc Natl Acad Sci USA 99(10):7119-7123
Le Greves P, Huang W, Johansson P, Thornwall M, Zhou Q, Nyberg F (1997)
Effects of an anabolic-androgenic steroid on the regulation of the NMDA receptor
NR1, NR2A and NR2B subunit mRNAs in brain regions of the male rat. Neurosci
Lett 226(1):61-64
Lemon JA, Boreham DR, Rollo CD (2003) A dietary supplement abolishes age- related cognitive decline in transgenic mice expressing elevated free radical processes. Exp Biol Med (Maywood) 228(7):800-810
138138
Lhuillier L, Dryer SE (2002) Developmental regulation of neuronal KCa channels by TGF beta1: an essential role for PI3 kinase signaling and membrane insertion.
J Neurophysiol 88(2):954-964
Liang L, Jiang J, Frank SJ (2000) Insulin receptor substrate-1-mediated enhancement of growth hormone-induced mitogen-activated protein kinase activation. Endocrinology 141(9):3328-3336
Lin CH, Yeh SH, Lin CH, Lu K T, Leu TH, Chang WC, Gean PW (2001) A role for the PI-3 kinase signaling pathway in fear conditioning and synaptic plasticity in the amygdala. Neuron 31(5):841-851
Linden DJ (1996) A protein synthesis-dependent late phase of cerebellar long term depression. Neuron 17:483-490
Ling DS, Benardo LS, Serrano PA, Blace N, Kelly MT, Crary JF, Sacktor TC
(2002) Protein kinase M zeta is necessary and sufficient for LTP maintenance.
Nat Neurosci 5(4):295-296
Lisman J (1989) A mechanism for the Hebb and the anti-Hebb processes underlying learning and memory. Proc Natl Acad Sci USA 86(23):9574-9578
139139
Liu L, Wong TP, Pozza MF, Lingenhoehl K, Wang Y, Sheng M, Auberson YP,
Wang YT (2004) Role of NMDA receptor subtypes in governing the direction of hippocampal synaptic plasticity. Science 304:1021
Magnusson KR, Nelson SE, Young AB (2002) Age-related changes in the protein expression of subunits of the NMDA receptor. Brain Res Mol Brain Res. 28;99
(1):40-45
Malinow R, Malenka RC (2002) AMPA receptor trafficking and synaptic plasticity.
Annu Rev Neurosci 25:103-126
Mallon AP, Auberson YP, Stone TW (2004) Selective subunit antagonists suggest an inhibitory relationship between NR2B and NR2A-subunit containing
N-methyl-D: -aspartate receptors in hippocampal slices. Exp Brain Res; [Epub ahead of print]
Manabe T, Aiba A, Yamada A, Ichise T, Sakagami H, Kondo H, Katsuki M (2000)
Regulation of long-term potentiation by H-Ras through NMDA receptor phosphorylation. J Neurosci 20(7):2504-2511
Martin KC, Michael D, Rose JC, Barad M, Casadio A, Zhu H, Kandel ER (1997)
MAP kinase translocates into the nucleus of the presynaptic cell and is required for long-term facilitation in Aplysia. Neuron 18(6):899-912
140140
Mathis C, Lehman J, Ungerer A (1992) The selective protein kinase inhibitor,
NPC 15437, induced specific deficits in memory retention in mice. Eur J
Pharmacol 220: 107-110
McBain CJ, Mayer ML (1994) N-methyl-D-aspartic acid receptor structure and function. Physiol Rev. 74(3):723-60
McGauley GA, Cuneo RC, Salomon F, Sonksen PH (1990) Psychological well- being before and after growth hormone treatment in adults with growth hormone deficiency. Horm Res 33(Suppl 4):52-54
Monyer H, Sprengel R, Schoepfer R, Herb A, Higuchi M, Lomeli H, Burnashev N,
Sakmann B, Seeburg PH (1992) Heteromeric NMDA receptors: molecular and functional distinction of subtypes. Science 256(5060):1217-1221
Morgan IG, Austin L (1968) Synaptosomal protein synthesis in a cell-free system.
J Neurochem 15, 41-51
Morris RGM, Andersen E, Lynch GS, Baudry M (1986) Selective impairment of learning in rats and blockade of long-term potentiation in vivo by an N-methyl-D- aspartate receptor antagonist, AP5. Nature 319:774-776
141141
Murphy AE, Harvey S (2001) Extrapituitary beta TSH and GH in early chick embryos. Mol Cell Endocrinol 185(1-2):161-171
Mustafa A, Nyberg F, Bogdanovic N, Islam A, Roos P, Adem A (1994a)
Somatogenic and lactogenic binding sites in rat brain and liver: quantitative autoradiographic localization. Neurosci Res 20(3):257-63
Mustafa A, Adem A, Roos P, Nyberg F (1994b) Sex differences in binding of human growth hormone to rat brain. Neurosci Res 19(1):93-99
Mustafa A, Sharma HS, Olsson Y, Gordh T, Thoren P, Sjoquist PO, Roos P,
Adem A, Nyberg F (1995) Vascular permeability to growth hormone in the rat central nervous system after focal spinal cord injury. Influence of a new anti- oxidant H 290/51 and age. Neurosci Res 23(2):185-194
Nakanishi S (1992) Molecular diversity of glutamate receptors and implications for brain function. Science 258(5082):597-603
Nayak A, Zastrow DJ, Lickteig R, Zahniser NR, Browning MD (1998)
Maintenance of late-phase LTP is accompanied by PKA-dependent increase in
AMPA receptor synthesis. Nature 394:680-683
142142
Neuman R, Cherubini E, Ben-Ari Y (1987) Is activation of N-methyl-D-aspartate receptor gated channels sufficient to induce long term potentiation? Neurosci Lett
5;80(3):283-8
Nguyen PV, Abel T, Kandel ER (1994) Requirement of critical period of transcription for induction of late phase of LTP. Science 265:1104-1107
Nishiyama M., Hong K., Mikoshiba K., Poo M.M., Kato K (2000) Calcium stores regulate the polarity and input specificity of synaptic modification. Nature
30;408(6812):584-588
Nyberg F, Burman P (1996) Growth hormone and its receptors in the central nervous system -- location and functional significance. Horm Res 45(1-2):18-22
Nolte J (1999) The human brain an introduction to its functional anatomy. 4th edition St Louis Missouri Mosby Inc
Oertel H, Schneider HJ, Stalla GK, Holsboer F, Zihl J (2004) The effect of growth hormone substitution on cognitive performance in adult patients with hypopituitarism. Psychoneuroendocrinology 29(7):839-850
143143
Opazo P, Watabe AM, Grant SG, O'Dell TJ (2003) Phosphatidylinositol 3-kinase regulates the induction of long-term potentiation through extracellular signal- related kinase-independent mechanisms. J Neurosci 23(9):3679-3688
Otani S, Marshall CJ, Tate WP, Goddard GV, Abraham WC (1989) Maintenance of long-term potentiation in rat dentate gyrus requires protein synthesis but not messenger RNA synthesis immediately post-tetanization. Neuroscience
28(3):519-526
Paradisi R, Frank G, Magrini O, Capelli M, Venturoli S, Porcu E, Flamigni C
(1993) Adeno-pituitary hormones in human hypothalamic hypophysial blood. J
Clin Endocrinol Metab 77(2):523-527
Pareren VY, Mulder P, Houdijk M, Jansen M, Reeser M, Hokken-Koelega A
(2003) Effect of discontinuation of growth hormone treatment on risk factors for cardiovascular disease in adolescents born small for gestational age. J Clin
Endocrinol Metab 88(1):347-353
Pareren VYK, Duivenvoorden HJ, Slijper FS, Koot HM, Hokken-Koelega AC
(2004) Intelligence and psychosocial functioning during long-term growth hormone therapy in children born small for gestational age. J Clin Endocrinol
Metab 89(11):5295-5302
144144
Passafaro M, Piech V, Sheng M (2001) Subunit-specific temporal and spatial patterns of AMPA receptor exocytosis in hippocampal neurons. Nat Neurosci
4(9):917-926
Patty L (1990) Homology of a domain of the growth/ prolactin receptor family with type III modules of fibronectin. Cell 61:13-14
Prahalada S, Block G, Handt L, DeBurlet G, Cahill M, Hoe CM, van Zwieten MJ
(1999) Insulin-like growth factor-1 and growth hormone (GH) levels in canine cerebrospinal fluid are unaffected by GH or GH secretagogue (MK-0677) administration. Horm Metab Res 31(2-3):133-137
Rameh LE, Cantley LC (1999) The role of phosphoinositide 3-kinase lipid products in cell function. J Biol Chem 274(13):8347-8350
Ramesh R, Kuenzel WJ, Buntin JD, Proudman JA (2000) Identification of growth hormone and prolactin-containing neurons within the avian brain. Cell Tissue Res
299(3):371-383
Ramsey MM, Weiner JL, Moore TP, Carter CS, Sonntag WE (2004) Growth hormone treatment attenuates age-related changes in hippocampal short-term plasticity and spatial learning Neurosci. 129(1):119-27
145145
Ranke MB, Stanley CA, Rodbard D, Baker L, Bonglovanni A, Parks JS (1975)
Sex differences in binding of human growth hormone to isolated rat hepatocytes.
Proc Nat Acad Sci 73(3):847-851
Raymond CR, Redman SJ, Crouch MF (2002) The phosphoinositide 3-kinase and p70 S6 kinase regulate long-term potentiation in hippocampal neurons.
Neuroscience 109(3):531-536
Reichlin S (1983) Somatostatin (second of two parts). N Engl J Med
22;309(25):1556-63
Render CL, Hull KL, Harvey S (1995) Neural expression of the pituitary GH gene.
J Endocrinol 147(3):413-422
Rico-Bautista E, Negrin-Martinez C, Novoa-Mogollon J, Fernandez-Perez L,
Flores-Morales A (2004) Downregulation of the growth hormone-induced Janus kinase 2/signal transducer and activator of transcription 5 signaling pathway requires an intact actin cytoskeleton. Exp Cell Res 294(1):269-280
Riedel G, Wetzel W, Reymann KG (1994) (R, S)-α-Methyl-4-carboxyphenyl- glycine (MCPG) blocks spatial learning in rats and long-term potentiation in the dentate gyrus in vivo. Neurosci Lett 167:141-144
146146
Rodgers EE, Theibert AB (2002) Functions of PI 3-kinase in development of the nervous system. Int J Dev Neurosci 20(3-5):187-197
Rosenzweig ES, Barnes CA (2003) Impact of aging on hippocampal function: plasticity, network dynamics, and coginition. Progress in Neurobiology 69:143-
179
Sacktor TC, Osten P, Valsamis H, Jiang X, Naik MU, Sublette E (1993)
Persistent activation of the zeta isoform of protein kinase C in the maintenance of long-term potentiation. Proc Natl Acad Sci USA 90(18):8342-8346
Sanna PP, Cammalleri M, Berton F, Simpson C, Lutjens R, Bloom FE,
Francesconi W (2002) Phosphatidylinositol 3-kinase is required for the expression but not for the induction or the maintenance of long-term potentiation in the hippocampal CA1 region. J Neurosci 22(9):3359-3365
Sas T, Mulder P, Hokken-Koelega A (2000) Body composition, blood pressure, and lipid metabolism before and during long-term growth hormone (GH) treatment in children with short stature born small for gestational age either with or without GH deficiency. J Clin Endocrinol Metab 85(10):3786-3792
Schaub C, Bluet-Pajot MT, Szikla G, Lornet C, Talairach J (1977) Distribution of growth hormone and thyroid-stimulating hormone in cerebrospinal fluid and
147147
pathological compartments of the central nervous system. J Neurol Sci
31(1):123-131
Scheepens A, Sirimanne E, Beilharz E, Breier BH, Waters MJ, Gluckman PD,
Williams CE (1999) Alterations in the neural growth hormone axis following hypoxic-ischemic brain injury. Brain Res Mol Brain Res 68(1-2):88-100
Schneider-Rivas S, Rivas-Arancibia S, Vazquez-Pereyra F, Vazquez-Sandoval
R, Borgonio-Perez G (1995) Modulation of long-term memory and extinction responses induced by growth hormone (GH) and growth hormone releasing hormone (GHRH) in rats. Life Sci 56(22):PL433-PL441
Schoepfer R, Monyer H, Sommer B, Wisden W, Sprengel R, Kuner T, Lomeli H,
Herb A, Kohler M, Burnashev N (1994) Molecular biology of glutamate receptors.
Prog Neurobiol. 42(2):353-7
Schulz PE, Cook EP, Johnston D (1994) Changes in paired-pulse facilitation suggest presynaptic involvement in long-term potentiation. J Neurosci 14:5325-
5337
Shi SH, Hayashi Y, Petralia RS, Zaman SH, Wenthold RJ, Svoboda K, Malinow
R (1999) Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation. Science 284:1811-1816
148148
Silva AJ, Paylor R, Wehner JM, Tonegawa S (1992) Impaired Impaired spatial learning in alpha-calcium-calmodulin kinase II mutant mice. Science
10;257(5067):206-11
Smit LS, Vanderkuur JA, Stimage A, Han Y, Luo G, Yu-Lee LY, Schwartz J,
Carter-Su C (1997) Growth hormone-induced tyrosyl phosphorylation and deoxyribonucleic acid binding activity of STAT5A and STAT5B. Endocrinology
138(8):3426-3434
Soderling TR, Derkach VA (2000) Postsynaptic protein phosphorylation and LTP.
Trends Neurosci 23:75-80
Sonntag WE, Bennett SA, Khan AS, Thornton PL, Xu X, Ingram RL, Brunso-
Bechtold JK (2000) Age and insulin-like growth factor-1 modulate N-methyl-D- aspartate receptor subtype expression in rats. Brain Res Bull. 1;51(4):331-8
Sotiropoulos A, Perrot-Applanat M, Dinerstein H, Pallier A, Postel-Vinay M-C,
Finidori J, Kelly P (1994) Distinct cytoplasmic regions of growth hormone receptor are required for activation of JAK2, mitogen-activated protein kinase and transcription. Endocrinology 135:1292-1298
149149
Stacy JJ, Terrell TR, Armsey TD (2004) Ergogenic AIDS: human growth hormone. Curr Sports Med Rep 3(4):229-233
Stanton PK, Sarvey JM (1984) Blockade of long-term potentiation in rat hippocampal CA1 region by inhibitors of protein synthesis. J Neurosci 4:3080-
3088
Steward O, Levy WB (1982) Preferential localization of polyribosomes under the base of dendritic spines in granule cells of dentate gyrus. J Neurosci 2, 284-291
Stouthart PJ, Deijen JB, Roffel M, Delemarre-van de Waal HA (2003) Quality of life of growth hormone (GH) deficient young adults during discontinuation and restart of GH therapy. Psychoneuroendocrinology 28(5):612-626
Sweatt JD (2001) The neuronal MAP kinase cascade: a biochemical signal integration system subserving synaptic plasticity and memory. J Neurochem
76(1):1-10
Tanaka M, Nakahara T, Kojima S, Nakano T, Muranaga T, Nagai N, Ueno H,
Nakazato M, Nozoe S, Naruo T (2004) Effect of nutritional rehabilitation on circulating ghrelin and growth hormone levels in patients with anorexia nervosa.
Regul Pept T15;122(3):163-8
150150
Tang YP, Shimizu E, Dube GR, Rampon C, Kerchner GA, Zhuo M, Liu G, Tsien
JZ (1999) Genetic enhancement of learning and memory in mice. Nature
401(6748):63-69
Tannenbaum GS (1990) Interrelationship of somatostatin and growth hormone- releasing hormone in the genesis of the rhythmic secretion of growth hormone.
Acta Paediatr Scand Suppl 367:76-80
Thomson AM (2000) Facilitation, augmentation and potentiation at central synapses. Trends Neurosci 23(7):305-12
Thörnwall-Le Grevès M, Zhou Q, Lagerholm S, Huang W, Le Grevès P, Nyberg
F (2001) Morphine decreases the levels of the gene transcripts of growth hormone receptor and growth hormone binding protein in the male rat hippocampus and spinal cord. Neurosci Lett 304:(1-2)69-72
Thornton PL, Ingram RL, Sonntag WE (2000) Chronic [D-Ala2]-growth hormone- releasing hormone administration attenuates age-related deficits in spatial memory. J Gerontol A Biol Sci Med Sci. 55(2):B106-12
Toni N, Buchs PA, Nikonenko I, Bron CR, Muller D (1999) LTP promotes formation of multiple spine synapses between a single axon terminal and a dendrite. Nature 402:421-425
151151
Trommald M, Hulleberg G, Andersen P (1996) Long-term potentiation is associated with new excitatory spine synapses on rat dentate granule cells.
Learn Mem 3:218-228
Tsien JZ, Huerta PT, Tonegawa S (1996) The essential role of hippocampal CA1
NMDA receptor-dependent synaptic plasticity in spatial memory. Cell 87:1327-
1338
van Dam PS, Aleman A, de Vries WR, Deijen JB, van der Veen EA, de Haan EH,
Koppeschaar HP (2000) Growth hormone, insulin-like growth factor I and cognitive function in adults. Growth Horm IGF Res 10(Suppl B):S69-S73
Vance ML, Kaiser DL, Evans WS, Furlanetto R, Vale W, Rivier J, Thorner MO
(1985) Pulsatile growth hormone secretion in normal man during a continuous
24-hour infusion of human growth hormone releasing factor (1-40). Evidence for intermittent somatostatin secretion. J Clin Invest 75(5):1584-90
Vanderkuur JA, Butch ER, Waters SB, Pessin JE, Guan KL, Carter-Su C (1997)
Signaling molecules involved in coupling growth hormone receptor to mitogen- activated protein kinase activation. Endocrinology 138(10):4301-4307
152152
Vikman K, Carlsson B, Billig H, Eden S (1991) Expression and regulation of growth hormone (GH) receptor messenger ribonucleic acid (mRNA) in rat adipose tissue, adipocytes, and adipocyte precursor cells: GH regulation of GH receptor mRNA. Endocrinology 129(3):1155-1161
Wajnrajch MP (2005) Physiological and pathological growth hormone secretion.
J Pediatr Endocrinol Metab. 18(4):325-38
Watabe AM, Zaki PA, O'Dell TJ (2000) Coactivation of beta-adrenergic and cholinergic receptors enhances the induction of long-term potentiation and synergistically activates mitogen-activated protein kinase in the hippocampal
CA1 region. J Neurosci 20(16):5924-5931
Watkins JC, Evans RH (1981) Pharmacological antagonists of excitant amino acid action. Life Sci. 23;28(12):1303-8
Whitman BY, Myers S, Carrel A, Allen D (2002) The behavioral impact of growth hormone treatment for children and adolescents with Prader-Willi syndrome: a 2- year, controlled study. Pediatrics 109(2):E35
Williams K (2001) Ifenprodil, a novel NMDA receptor antagonist: site and mechanism of action. Curr Drug Targets 2(3):285-298
153153
Winder DG, Martin KC, Muzzio IA, Rohrer D, Chruscinski A, Kobilka B, Kandel
ER (1999) ERK plays a regulatory role in induction of LTP by theta frequency stimulation and its modulation by beta-adrenergic receptors. Neuron 24(3):715-
726
Winston LA, Hunter T (1995) JAK2, Ras, and Raf are required for activation of extracellular signal-regulated kinase/mitogen-activated protein kinase by growth hormone. J Biol Chem 270(52):30837-30840
Wit JM, Rekers-Mombarg LT, Cutler GB, Crowe B, Beck TJ, Roberts K, Gill A,
Chaussain JL, Frisch H, Yturriaga R, Attanasio AF (2005) Growth hormone (GH) treatment to final height in children with idiopathic short stature: Evidence for a dose effect. J Pediatr 146(1):45-53
Wu RL, Butler DM, Barish ME (1998) Potassium current development and its linkage to membrane expansion during growth of cultured embryonic mouse hippocampal neurons: sensitivity to inhibitors of phosphatidylinositol 3-kinase and other protein kinases. J Neurosci 18(16):6261-6278
Xiaowei XU, Bennett SA, Ingram RL, Sonntag WE (1995) Decreases in growth homone receptor signal transduction contribute to the decline in IGF-1 gene expression with age. Endocrinology 136:4551-4557
154154
Xie X, Berger TW, Barrionuevo G (1992) Isolated NMDA receptor-mediated synaptic responses express both LTP and LTD J Neurophysiol 67(4):1009-13
Xu X, Bennett SA, Ingram RL, Sonntag WE (1995) Decreases in growth hormone receptor signal transduction contribute to the decline in insulin-like growth factor I gene expression with age. Endocrinology 136(10):4551-4557
Yamauchi T, Kaburagi Y, Ueki K, Tsuji Y, Stark GR, Kerr IM, Tsushima T,
Akanuma Y, Komuro I, Tobe K, Yazaki Y, Kadowaki T (1998) Growth hormone and prolactin stimulate tyrosine phosphorylation of insulin receptor substrate-1, -
2, and -3, their association with p85 phosphatidylinositol 3-kinase (PI3-kinase), and concomitantly PI3-kinase activation via JAK2 kinase. J Biol Chem
273(25):15719-15726
Yoshimura Y, Ohmura T, Komatsu Y (2003) Two forms of synaptic plasticity with distinct dependence on age, experience, and NMDA receptor subtype in rat visual cortex. J Neurosci 23(16):6557-6566
Yuste R, Bonhoeffer T (2001) Morphological changes in dendritic spines associated with long-term synaptic plasticity. Annu Rev Neurosci 24:1071-1089
Zhai Q, Lai Z, Roos P, Nyberg F (1994) Characterization of growth hormone binding sites in rat brain. Acta Paediatr Suppl 406:92-95
155155
Zhu JJ, Qin Y, Zhao M, Van Aelst L, Malinow R (2002) Ras and Rap control
AMPA receptor trafficking during synaptic plasticity. Cell 110(4):443-455
156156