Lactams in Combination with -Lactamase Inhibitors Against
Total Page：16
File Type：pdf, Size：1020Kb
Hindawi BioMed Research International Volume 2018, Article ID 3579832, 8 pages https://doi.org/10.1155/2018/3579832 Research Article In Vitro Activity of �-Lactams in Combination with �-Lactamase Inhibitors against Mycobacterium tuberculosis Clinical Isolates Fu Li ,1 Li Wan,2 Tongyang Xiao ,1 Haican Liu ,1 Yi Jiang,1 Xiuqin Zhao ,1 Ruibai Wang ,1 and Kanglin Wan 1 1 State Key Laboratory for Infectious Diseases Prevention and Control, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China 2Department of Physiology, Xiangya School of Medicine, Central South University, Changsha, Hunan 410078, China Correspondence should be addressed to Ruibai Wang; [email protected] and Kanglin Wan; [email protected] Received 19 February 2018; Accepted 4 June 2018; Published 2 July 2018 Academic Editor: Isabel Portugal Copyright © 2018 Fu Li et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objectives. Evaluating the activity of nineteen �-lactams in combination with diferent �-lactamase inhibitors to determine the most potent combination against Mycobacterium tuberculosis (MTB) in vitro. Methods. Drug activity was examined by drug susceptibility test with 122 clinical isolates from China. Mutations of blaC and drug targets ldtMt1, ldtMt2, dacB2, and crfA were analyzed by nucleotide sequencing. Results. Tebipenem (TBM) in combination with clavulanate (CLA) exhibited the highest anti-TB activity. Te MIC of �-lactam antibiotics was reduced most evidently in the presence of CLA, compared to avibactam (AVI) and sulbactam (SUB). Eight polymorphism sites were identifed in blaC, which were not associated with �-lactams resistance. Interestingly, one strain carrying G514A mutation in blaC was highly susceptible to �-lactams regardless of the presence of inhibitors. Te transpeptidase encoding genes, ldtMt1, ldtMt2,anddacB2, harboured three mutations, two mutations, and one mutation, respectively, but no correlation was found between these mutations and drug resistance. Conclusion.Teactivityof�-lactams against MTB and diferent synergetic efect of �-lactamase inhibitors were indicated. TBM/CLA exhibited the most activity and has a great prospect in developing novel anti-TB regimen; however, further clinical research is warranted. Moreover, the resistance to the �-lactam antibiotics might not be conferred by single target mutation in MTB and requires further studies. 1. Introduction pretomanid, which are in phase II or III trials [5, 6], long duration and high expenses lead to slow development of Tuberculosis (TB) is a great threat to the global public health new drugs. Repurposing the currently used antibiotics may that caused an estimated 1.3 million deaths in 2016 [1]. Drug contribute to the development of novel anti-TB regimens. resistance has been a major obstacle in the progress of elim- �-lactams disrupt the cell wall biosynthesis of bacteria inating TB, especially due to the emergence of multidrug- by preventing the formation of peptide cross-links between resistant (MDR) and extensively drug-resistant (XDR) MTB theadjacentpolysaccharidechainsinthepeptidoglycanlayer worldwide [2–4]. With the rising incidence of drug-resistant [7]. In Mycobacterium tuberculosis (MTB), two kinds of TB, the traditional frst-line and second-line anti-TB drugs transpeptidase, the L,D-transpeptidase (mainly encoded by fail to fulfll the current needs of TB treatments. In such ldtMt1 and ldtMt2) and the D,D-transpeptidase (encoded by cases, developing novel drugs or drug regimens is urgent and dacB2), catalyze the cell wall biosynthesis [8, 9]. Te L,D- necessary for efective control of TB. Although signifcant transpeptidase, which is responsible for the formation of over progress has been made in identifcation of several new 80% transpeptide linkages (3�→ 3 linkages) in MTB, is the anti-TB compounds, such as bedaquiline, delamanid, and target of carbapenems [10–12]. Te D,D-transpeptidase that 2 BioMed Research International mainly catalyzes the formation of 4�→ 3linkagesisakindof Table 1: Te �-lactams and �-lactamase inhibitors for drug suscep- penicillin-binding proteins (PBPs), which can be inhibited by tibility tests. meropenem (MEM) [13]. Classifcation Agent Generation Te resistance to �-lactam antibiotics encompasses the activity of �-lactamases. Tousands of diferent �- Carbapenem Tebipenem lactamases have been identifed in various environmental Meropenem and pathogenic species of bacteria [14]. MTB is intrinsically Doripenem resistant to �-lactams due to the expression of endogenous Biapenem �-lactamase BlaC active against a broad spectrum of �- Ertapenem lactams. CLA, AVI, and SUB are �-lactamase inhibitors Penicillin Amoxicillin � that inhibit the hydrolysis of -lactams. Recent studies Ampicillin � � have reported that a combination of the -lactams and - Methicillin lactamase inhibitors is efective against MTB in vitro and Oxacillin in vivo [15–17]. Te efcacy, safety, and tolerability of car- Cloxacillin bapenems,suchasMEM,imipenem,andertapenem(ETP), against MTB have been evaluated in several clinical studies Nafcillin [18]. Amoxicillin/clavulanate (AMX/CLA) combination has Dicloxacillin beenevaluatedtobeefcientagainstMTBin vitro and is Piperacillin thuscategorizedintoGroup5anti-TBdrugsbyWHO[19, Cephalosporin Cephalexin First generation 20]. Tis suggests that combinations of �-lactams and �- Cefuroxime Second generation lactamase inhibitors are prospective candidates in developing Cefxime Tird generation more efective treatment against TB. Cefpirome Fourth generation In this study, to determine the most active and applicable Monobactam Aztreonam � � combination of -lactam and -lactamase inhibitors, the in Oxacephem Moxalactam vitro anti-TB activity of nineteen �-lactams belonging to dif- �-lactamase inhibitor Clavulanate ferent subclasses either alone or in combination with diferent �-lactamase inhibitors was tested using drug susceptibility Avibactam tests. A total of 122 MTB clinical isolates collected from China Sulbactam were used. Mutations in blaC and three main �-lactams targets, ldtMt1, ldtMt2,anddacB2, were analyzed to determine the relationship between drug target mutations and �-lactam was fully ground and adjusted with saline to a cell density × 8 resistance. In addition, T184A mutation in an unannotated of 3 10 cells/mL (1 McFarland standard). Te suspension gene, crfA, reported to confer carbapenem resistance in MTB was diluted 1 : 20 with 7H9 broth (Difco, Detroit, MI, USA) was also detected. containing 10% OADC (BD, Franklin Lakes, NJ, USA). Six groups of serial twofold drug dilutions were prepared 2. Materials and Methods in the 7H9 broth containing either fve diferent constant concentrations of each �-lactamase inhibitor or no inhibitor � 2.1. Strains. A total of 122 identifed clinical MTB isolates, at all. Te fnal reaction mix contained 100 lofdrugsolution and equal volume of bacterial suspension in each well. Te including 47 susceptible (S), 64 MDR, and 11 XDR isolates, ∘ used in this study were collected from seven provincial TB plates were sealed and incubated at 37 Cfor7days.Tenthe � � hospitals of China in Beijing, Anhui, Fujian, Guizhou, Henan, indicator (20 lAlamarBluemixedwith50 l5%Tween- Xinjiang, and Sichuan. All the strains were preserved in the 80) was added to the drug-containing group when the drug- strain bank of National Institute for Communicable Disease free control showed color change (blue to pink). Te lowest Control and Prevention, Chinese Center for Disease Control drug concentration that inhibited the strain growth and and Prevention. prevented color change was recorded as the MIC value. Drug susceptibility tests for each strain were repeated twice. 2.2. �-Lactams and �-Lactamase Inhibitors. MEM was pur- Te fnal concentrations of tebipenem ranged from 0.125 � chased from Sigma-Aldrich Co. (St Louis, MO, USA). Tebi- to 16 g/ml, and for the other carbapenems, 0.25 to 32 � penem, doripenem, biapenem, ertapenem, amoxicillin, g/ml concentrations were tested in drug susceptibility tests. ampicillin, methicillin, oxacillin, cloxacillin, nafcillin, diclox- Ampicillin (AMP) and cefuroxime (CXM) were used at � acillin, piperacillin, cephalexin, cefuroxime, cefxime, cef- concentrations ranging from 0.5 to 64 g/ml and the other pirome, aztreonam, and moxalactam and three �-lactamase chemicals were tested at concentrations ranging from 1 to 128 � � inhibitors, CLA, AVI, and SUB, used in this study were g/ml. Te fnal concentration of each -lactamase inhibitor � � � � � purchased from MCE Co. (Monmouth Junction, NJ, USA) was 0.625 g/ml, 1.25 g/ml, 2.5 g/ml, 5 g/ml, and 10 g/ml, (Table 1). respectively. 2.3. Drug Susceptibility Test. Drug susceptibility test was 2.4. Polymerase Chain Reaction (PCR) and Sequencing. Ge- performedbybrothmicrodilutionmethodusing96-well nomic DNA was isolated from mycobacterial cultures by microplate. Briefy, a loop of MTB culture in the late log phase boiling method and was used for amplifcation of blaC, BioMed Research International 3 Table 2: Primers and conditions used for amplifcation and sequencing. � � PCR conditions Primers Sequence (5 -3 ) a ∘ b Product length (bp) Denaturation (s) Annealing ( C, s) Elongation (s) BlaC-F ATGCGCAACAGAGGATTCGGTC 30 61, 30 65