Type I Collagen Is a Molecular Target for Inhibition of Angiogenesis by Endogenous Thrombospondin-1

Oncogene (2006) 25, 536–545 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Type I collagen is a molecular target for inhibition of angiogenesis by endogenous thrombospondin-1

L Zhou1, JS Isenberg1, Z Cao and DD Roberts

Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA

Three-dimensional explant cultures of muscle tissue were stat-Saslow et al., 1994; Tenan et al., 2000; Streit et al., used to characterize secreted proteins regulated by 2002).TSP1 gene expression is lost during progression endogenous levels of the angiogenesis modulator thrombo- of a number of cancer types, but TSP1 levels in some spondin (TSP)-1. Explants from TSP1 null mice exhibit tumor types remain high due to induced expression of enhanced neovascularization associated with increased TSP1 by stromal cells (reviewed in Lawler and Detmar, endothelial outgrowth but decreased outgrowth of peri- (2004)).Studies using transgenic mice confirmed that vascular smooth muscle cells . The absence of endogenous host endogenous TSP1 plays an important role in TSP1 did not diminish activation of latent transforming limiting neovascularization of tumors (Lawler et al., growth factor-b and moderately decreased matrixmetal- 2001; Hamano et al., 2004). loproteinase levels. However, significant changes in other Antiangiogenic fragments and peptides derived from secreted proteins were observed. Endogenous TSP1 TSP1 can inhibit angiogenesis and tumor growth in decreased mRNA levels for collagens Ia1, Ia2, and IIIa1 animals (Tolsma et al., 1993; Guo et al., 1997b; and laminin a4 and increased collagen IVa1 mRNA Bogdanov Jr et al., 1999; Iruela-Arispe et al., 1999; expression. Endogenous TSP1 also decreased the level of Westphal, 2004; Yee et al., 2004). However, adverse type I collagen protein produced by the vascular out- tumor responses to other TSP1 constructs have been growths. Collagens Ia1, Ia2, and IIIa1 are known tumor observed (de Fraipont et al., 2004), and some TSP1 endothelial markers, suggesting that TSP1 coordinately fragments have clear proangiogenic activities (Chandra- regulates a set of extracellular matrix genes that reverse sekaran et al., 2000; Calzada et al., 2004). Furthermore, the angiogenic switch. Suppression of collagen Ia1orIa2 some tumors become resistant to TSP1 (Filleur et al., mRNAs using antisense morpholinos inhibited outgrowth 2001), so successful use of TSP1-derived drugs will in TSP1 null explants and proliferation of TSP1 null require a deeper understanding of the mechanisms by endothelial cells, indicating that type I collagen synthesis which TSP1 regulates angiogenesis. is limiting for this neovascularization response. At least eight TSP1 receptors mediate its effects on Oncogene (2006) 25, 536–545. doi:10.1038/sj.onc.1209069; endothelial cells, and of these CD36 (Jimenez et al., published online 10 October 2005 2000; Jimenez et al., 2001), heparan sulfate proteogly- cans (Guo et al., 1997a; Iruela-Arispe et al., 1999), Keywords: 3D culture; endothelial cells; angiogenesis CD47 (Kanda et al., 1999), and a3b1 (Chandrasekaran inhibitors; collagens et al., 2000) and a4b1 integrins modulate angiogenesis (Calzada et al., 2004). TSP1 induces expression of matrix metalloproteinase (MMP)-2 and MMP-9 in endothelial cells (Qian et al., 1997; Taraboletti et al., Introduction 2000), but direct interactions of TSP1 with MMPs may counteract this by inhibiting MMP activities or Thrombospondins (TSPs) are a family of five secreted mediating their degradation (Bein and Simons, 2000; proteins that are transiently or constitutively expressed Rodriguez-Manzaneque et al., 2001). Activation of in the extracellular matrices of various tissues (Born- latent TGFb also mediates some effects of TSP1 on stein, 2001; Adams and Lawler, 2004).Two members of endothelial cell proliferation (reviewed in Murphy- this family, TSP1 and TSP2, are potent inhibitors of Ullrich and Poczatek, (2000)) and tumor growth (Yee angiogenesis and have antitumor activities in several et al., 2004). Signaling through the CD36 receptor tumor xenograft models (Dameron et al., 1994; Wein- results in phosphorylation of c-Jun N-terminal kinase, which is required for inhibition of angiogenesis in vivo Correspondence: Dr DD Roberts, Biochemical Pathology Section, (Jimenez et al., 2001). A cascade involving phosphoryla- National Cancer Institute, National Institutes of Health, Building 10 tion of p59fyn, caspase-3 like proteases, and p38 Room 2A33, 10 Center Dr MSC 1500, Bethesda, MD 20892-1500, mitogen-activated protein kinases is also stimulated by USA. TSP1 through CD36 and mediates induction of Fas- E-mail: [email protected] 1These two authors contributed equally to this work. dependent endothelial cell apoptosis (Jimenez et al., Received 24 March 2005; revised 1 July 2005; accepted 1 August 2005; 2000; Volpert et al., 2002). TSP1 also regulates published online 10 October 2005 cytoskeletal actin in endothelial cells and inhibits Thrombospondin-1 targets in angiogenesis L Zhou et al 537 formation of lamellipodia associated with increased response to serum and growth factors in the lower phosphorylation of hsp27 and cofilin (Keezer et al., chamber was counted (Figure 1a).More vascular cells 2003). from the TSP1 null explants migrated through the In addition to endothelial cells, angiogenesis involves membrane than did those from WT explants.Therefore, pericytes, fibroblasts, immune cells, and mast cells. expression of endogenous TSP1 in the WT explants These cells express cytokines and growth factors that inhibits migration of vascular outgrowth cells. regulate endothelial cell proliferation, migration, inva- Invasive activity of outgrowth cells from muscle sion, tube formation, and vessel stabilization (Eliceiri explants was evaluated using 8 mm inserts precoated and Cheresh, 2001).Many of these cell types also with a barrier of polymerized type I collagen respond directly to TSP1 in vitro (Majack et al., 1986; (Figure 1b).The inserts were placed into wells contain- Sunderkotter et al., 1994; Chen et al., 1999; Isenberg ing MDA-MB-435 breast cancer cells to supply angio- et al., 2005). Therefore, interactions of TSP1 with genic factors, and the muscle explants were placed into several receptors and with several cell types probably the upper compartments.After 6 days, more cells from contribute to its modulation of angiogenesis.Specific the TSP1 null mice muscle explants invaded through the TSP1 receptors may also be differentially expressed or collagen barrier than did those cells from WT explants. utilized in specific types of developmental and patho- MDA-MB-435 cells do not express significant TSP1 logical angiogenesis. (Zabrenetzky et al., 1994). Therefore, endogenous TSP1 Given this complexity in cellular responses to TSP1, produced by the explants also suppresses the invasive we must first establish experimental systems wherein the functions of multiple receptors and vascular cell types in responding to TSPs can be quantified simultaneously to understand how TSP1 influences tumor angiogenesis. We recently established an ex vivo model for this purpose that can be used to identify the cellular and molecular targets of endogenous TSP1 in angiogenic responses (Calzada et al., 2004; Isenberg et al., 2005). Muscle explants from TSP1 null mice grown in three- dimensional (3D) cultures showed the predicted increase in endothelial outgrowth, whereas vascular smooth muscle cell outgrowth was deficient in the absence of endogenous TSP1 (Isenberg et al., 2005). Using the same explant model, we defined a role for its receptor a4b1 integrin in mediating effects of endogenous TSP1 on vascular outgrowth and showed that an antagonist of a4b1 selectively inhibited outgrowth of wild-type (WT) explants (Calzada et al., 2004). We have now used the 3D explant assay to identify secreted molecular targets of TSP1 in neovascularization and to test the function of secreted proteins that are known targets of TSP1.By this approach, we found type I collagen expression to be dependent on endogenous TSP1.Levels of mRNA for several other collagen genes and laminin a4 differed between vascular outgrowths from null and WT explants.Using antisense morpholinos, we found that collagen Ia1orIa2 are limiting for angiogenic responses of TSP1 null explants in a 3D matrix.As these changes mirror those recently identified for the same collagen Figure 1 Endogenous TSP1 inhibits random migration and genes in human tumor endothelium (St Croix et al., directed invasion of outgrowth cells from murine muscle explants. 2000; Madden et al., 2004) and metastatic tumors (a) Outgrowth cell migration was examined by culturing muscle explants to the upper compartments of 8 mm polycarbonate (Ramaswamy et al., 2003), the muscle explant assay membrane tissue culture inserts in EBM medium.After 6 days, may facilitate study of the angiogenic switch in cancer. cells that migrated to the underside of the filters were counted in five randomly chosen microscope fields.( b) The invasion of vascular cells from muscle was evaluated.Polycarbonate inserts (8 mm) were precoated with 50 mg collagen I and placed in the upper compartments of 24-well plate to which 5000 MDA-MB-435 Results human breast cancer cells/well were plated in RPMI 1640 medium containing 10% FBS to supply angiogenic factors.Muscle explants Endogenous TSP1 inhibits invasion of outgrowth cells were placed into the upper compartments and cultured in EBM To better quantify migratory activity of the vascular medium supplemented with 20% FBS.After 6 days, the filters were fixed and stained.Cells that invaded to the underside of the filters outgrowths, muscle explants were cultured in EGM were counted in five random microscopic fields.The values were medium on top of 8-mm-pore membranes, and the the average of triplicates. Error bars represent s.e.m., * indicates number of cells that migrated through the membrane in results that differed significantly from WT, Pp0.05.

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 538 activity of outgrowth cells stimulated by these tumor levels of MMP-9 in the medium of explants expressing cells. TSP1 is consistent with reports that TSP1 induces An immunoassay was used to deﬁne the levels of expression of MMP-2 and MMP-9 in endothelial cells TSP1 that accumulate during vascular outgrowth in the (Qian et al., 1997; Donnini et al., 2004) and T cells (Li 3D explant cultures (Table 1).Modest levels of TSP1 et al., 2002) but not consistent with their decreased were detected in conditioned medium from WT explants invasive activity.Therefore, the observed regulation of (0.2170.04 mg/ml), and the collagen matrix contained a these secreted proteases does not explain the enhanced nearly 100-fold higher level of TSP1 (18.571.2 mg/ml). invasive phenotype of the null explants. As expected, both medium and matrix from TSP1 null explants demonstrated minimal amounts of TSP1 (0.001570.0006 and 0.0570.008 mg/ml, respectively) Endogenous TSP1 modulates expression of several that presumably represent TSP1 derived from the collagen genes growth medium or collagen matrix in which the explants As neither TGFb nor MMP regulation could account were incubated. for the observed differences in vascular outgrowth from

Endogenous TSP1 does not alter latent TGFb activation in muscle explants The ability of TSP1 to activate latent TGFb1 is well documented in vitro, but the physiological role of TSP1 in TGFb1 activation in vivo remains controversial (Abdelouahed et al., 2000; Murphy-Ullrich and Pocza- tek, 2000; Bornstein, 2001).To determine whether latent TGFb activation in the muscle explants is dependent on endogenous TSP1, we used the NRK fibroblast bioassay to measure active TGFb1 in the conditioned medium from WT and TSP1 null muscle explants.Serial dilutions of the media were assessed to assure that the amount of TGFb was not saturating.Remarkably, WT and TSP1 null explants showed no difference in latent TGFb activation (Figure 2).Therefore, inhibition of neovessel formation by endogenous TSP1 is not Figure 2 Endogenous TSP1 does not influence latent TGFb correlated with increased latent TGFb activation. activation by vascular cells from muscle explants in 3D cultures. NRK fibroblasts were embedded in 0.3% soft agar containing 10 ng/ml of epidermal growth factor, and cultured in conditioned Regulation of MMPs byendogenous TSP1 medium derived from 14-day cultures of vascular cells from either Since TSP1 inhibits MMP-3-mediated activation of pro- WT or TSP1-null muscle explants in Vitrogen gel for 8 days.The MMP-2 and pro-MMP-9 (Bein and Simons, 2000), the negative control was conditioned medium without explants in 3D Vitrogen matrix; the positive control was conditioned medium increased invasive activity of TSP1 null vascular cells from HUVECs, in which latent TGFb was activated by heating at could result from increased extracellular MMP activ- 851C for 5 min.NRK colonies greater than 60 mm in diameter were ities.We used gelatin zymography to measure cell counted.Data are representative of three independent experiments. associated and secreted levels of proteases in conditioned medium from WT and TSP1 null muscle explants in 3D cultures.Endogenous TSP1 had no effect on cell- associated gelatinase activities, but TSP1-expressing explants had somewhat higher proMMP-2 levels in the medium (Figure 3).Upregulation of MMP-2 and similar

Table 1 Secretion of TSP1 into conditioned medium and matrix of muscle explants TSP1 (mg/ml)

Medium Matrix Figure 3 Cell associated and secreted MMPs in vascular cells of murine muscle explants.WT and TSP1 null explants were cultured Wild type 0.2170.04 18.571.2 in EBM medium for 10 days.The medium was changed to EBM TSP1À/À 0.001570.0006 0.0570.008 medium without FBS and conditioned for 24 h.Vascular cells and conditioned medium were collected, and gelatinase activities were Explants of WT and TSP1 null muscle were established and incubated assessed using gelatin zymography: lane 1, endothelial-conditioned under conditions identical to those utilized to assess vascular cell medium positive control; lane 2, medium negative control; lane 3, outgrowth for 2 weeks.Medium and matrix were then collected and cell-associated activity from WT explants; lane 4, cell associated assayed for TSP1 using an enzyme-linked immunoassay as described from TSP1 null; lane 5, conditioned medium from WT explants, (Isenberg et al., 2005). and lane 6, conditioned medium from TSP1 null explants.

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 539 the muscle explants, we undertook to identify additional and a major labeled protein with the same migration as secreted proteins that are regulated by TSP1.Vascular the a1 subunit was specifically depleted from the total cells of muscle explants were metabolically labeled in extract (Figure 4d). explant cultures for 48 h.Analysis of the 35S-labeled secreted proteins (Figure 4a, b) and cellular proteins from vascular cells (results not shown) by 2D gel Modulation of collagen and laminin mRNA expression by electrophoresis indicated that several secreted proteins TSP1 are differentially regulated by endogenous TSP1 during As the high protein content of the 3D matrix limited our the process of angiogenesis. ability to directly identify additional proteins secreted by The high concentration of collagen in the 3D cultures the explants, we examined mRNA levels for several precluded mass spectrometric identification of the matrix components that had molecular weights and differentially secreted proteins, but three of them had predicted pI values consistent with the observed changes predicted or measured masses and isoelectric points in metabolically labeled secreted proteins.In the absence consistent with those of murine type I collagen a1 of endogenous TSP1, mRNAs for type I collagen a1and (predicted pI ¼ 9.3, 95 kDa) and a2 subunits (predicted a2, laminin a4, and type III collagen a1 (predicted pI ¼ 10, 92 kDa) (Figure 4b, spot 2) or laminin a3 pI ¼ 9.4, 94 kDa) were reproducibly upregulated (Figure (predicted pI ¼ 8.4, 187 kDa) or a4 chains (200 kDa 5a, b).In contrast, mRNA levels for type IV collagen a1 (Iivanainen et al., 1997)) (Figure 4b, spot 1). Spot 2 was (predicted pI ¼ 8.3, 144 kDa) were reproducibly down- identified as type I collagen by immunoprecipitation regulated in the absence of TSP1, and laminin a3 using a murine type I collagen antibody.Consistent with mRNA was unchanged. the altered abundance of spot 2, immunoprecipitation of To confirm that the collagen I genes are directly the secreted proteins showed a marked increase in the a1 regulated by TSP1 rather than being upregulated in the and a2 collagen chains in the null explants (Figure 4c). null as part of an indirect adaptive response, TSP1 null The lower experimental pI values for the type I collagen endothelial cells grown in a TSP1-free medium were may reflect post-translational modifications.To confirm treated for 24 h with 5 mg/ml of exogenous TSP1.Equal the specificity of the collagen antibody, immunoprecipi- amounts of RNA from treated and untreated cells were tates from null explants were digested using a highly then analysed by RT–PCR (Figure 5c).TSP1 treatment purified collagenase from Clostridium histolyticum.Most suppressed collagen Ia1 and Ia2 mRNA levels but not of the immunoreactivity was lost following treatment, that of the housekeeping gene HPRT.

Figure 4 Increased secretion of type I collagen from vascular cells of TSP1 null muscle explants in 3D culture.( a, b) Muscle explants were prepared as described above. 35S-labeled secreted proteins of vascular cells were desalted and analysed on 2D gels.Equal amounts of radioactive proteins were applied to 13 cm IPG strips (pH 3–10 gradient) for the first dimension and 8% NuPage SDS gels for the second dimension.Labeled proteins were visualized by fluorography.( c) Muscle explants were 35S-labeled, and secreted proteins of vascular cells were immunoprecipitated with rabbit anti-mouse type I collagen antibody.(1:100), resolved on a 10% SDS–PAGE gel, and visualized by fluorography.The arrows indicate the type I collagen chains.( d) 35S-labeled total extracts and extracts immunoprecipitated using anti-mouse type I collagen were treated with 1000 U/ml of C. histolyticum collagenase.

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 540

Figure 6 Morpholino suppression of collagen Ia1 and Ia2 abrogates vascular cell invasion of and migration through Figure 5 Collagen I, collagen IV, and laminin a4 mRNA extracellular matrix in the absence of endogenous TSP1.( a) expression are altered in vascular outgrowths from TSP1 null Lung-derived endothelial cells from TSP-1 null mice were cultured mice.( a) Specific primer pairs for murine collagen I a1, collagen I in growth medium with or without morpholino antisense oligonu- a2, collagen III a1, collagen IV a1, laminin a3, and laminin a4 were cleotides to collagen Ia1, Ia2, or a 5-missense control for Ia1 (all at used to amplify cDNAs prepared from outgrowth cells recovered 3 mM), starved, pulsed with 35S-methionine and chased with from the indicated explants.1 mg of total RNA, quantified by complete medium containing the indicated morpholinos.Condi- spectrophotometry and agarose gel analysis, was used for reverse tioned media were immunoprecipitated, and protein complexes transcription in all cases.Primers for hypoxanthine-guanine were separated on SDS–PAGE gels and visualized by fluorogra- phosphoribosyl transferase (HPRT) were used as an internal phy.( b) WT and TSP1 null muscle explants were cultured in control in each reaction.( b) Band intensities were quantified using endothelial culture medium with 20% FCS in the absence (control) ImageQuant 5.0 software (Molecular Dynamics). The results or presence of morpholino antisense oligonucleotides to collagen represent the mean 7s.e.m. of triplicate analyses. * Indicates Ia1 (12.5 mM), Ia2 (12.5 mM) or a 5-missense control for Ia1 results that differed significantly from WT, Pp0.05. **Pp0.01. (c) (12.5 mM).Vascular outgrowth was evaluated by measuring the TSP1 null lung endothelial cells were grown in TSP1-free medium maximum cell migration distance in each of four quadrants from as described (Isenberg et al., 2005) and treated for 24 h with 5 mg/ml each explant at day 14.Means 7s.e.m. were calculated from six of TSP1.Equal amounts of RNA from treated and untreated cells explants at each time point and represent data from at least three were analysed by RT–PCR using the indicated primer sets. separate experiments.

Suppressing type I collagen expression inhibits the (Figure 6a).The morpholinos were next added to 3D increased neovascularization of TSP1 null explants Vitrogen gels used for explant cultures.The collagen I a1 Previous studies have implicated collagen expression in and Ia2 morpholinos significantly inhibited vascular tubular morphogenesis of postconfluent endothelial outgrowth of muscle explants from TSP1 null mice but monolayers in 2D cultures (Fouser et al., 1991) and in not of explants from WT mice (Figure 6b).The tumor angiogenesis in vivo (St Croix et al., 2000; inhibition was specific in that a missense control Madden et al., 2004). To determine whether type I morpholino for collagen Ia1 had no effect (Figure 6b). collagen expression is limiting for vascular cell outgrowth from muscle explants in the 3D culture, Suppression of type I collagen expression selectively antisense morpholinos were designed for murine col- inhibits proliferation but not migration of TSP1 null lagen Ia1andIa2.Both of these decreased type I lung-derived endothelial cells collagen expression when added to 2D cultures of lung- Vascular cell outgrowth in the explant model involves derived endothelial cells from TSP1 null mice both cell proliferation and migration.To determine

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 541 the known inhibitory activity of endogenous TSP1 for tumor angiogenesis (reviewed in Lawler and Detmar, (2004)).The antiangiogenic activity of overexpressing TSP1 in breast carcinoma cells (Weinstat-Saslow et al., 1994) could also be replicated in cocultures with the explants (Isenberg et al., 2005), suggesting that this model will be useful to further examine the mechanisms by which TSP1 regulates tumor-induced neovascularization. We have shown that genes encoding several secreted proteins are differentially regulated by endogenous TSP1 expression.Among these, collagen I a1 and Ia2 are upregulated in the absence of endogenous TSP1 and appear to be limiting for the enhanced vascular outgrowth of null explants.Suppressing the mRNA for collagen Ia1 and to a lesser extent for Ia2 reversed the enhanced outgrowth of explants from the TSP1 null mice.Suppressing collagen I a1andIa2 also normalizes the increased proliferation rate of lung endothelial cells from TSP1 null mice. The apparent regulation of collagen gene expression by TSP1 is notable, because similar changes in collagen gene expression were reported in angiogenic endothelium isolated from human tumor vasculature (St Croix et al., 2000; Madden et al., 2004). Based on SAGE analysis of colon tumor endothelium, collagen type I a1 and a2 and collagen type III a1 mRNAs are strongly Figure 7 Collagen Ia1 is limiting for TSP1 null lung-derived upregulated in tumor endothelial cells (St Croix et al., endothelial cell proliferation but not migration.( a) Lung-derived 2000).Similar induction of collagen type I a1 and III a1 endothelial cells from WT and TSP1 null mice were plated in EGM supplemented with 2% FCS at 5000 cells/well in 96-well plates and mRNAs was recently found in endothelium from incubated for 72 h in the presence of 1.25 mM of the indicated gliomas (Madden et al., 2004). Gene expression profiling morpholinos.Proliferation was quantified using an MTT assay.( b) has shown many similarities between tumor and wound TSP1 null lung-derived endothelial cells were cultured as described, microenvironments (Pedersen et al., 2003; Chang et al., treated with Ia1, Ia2, or missense morpholinos (1.25 mM), and added to the upper wells of modified Boyden chambers at 5 Â 104 2004).Thus, tumor angiogenic signals may be approxi- cells/well.Migration to EGM þ 20% FCS was then assessed after mated by the angiogenic factors included in our explant 5.5 h of incubation by fixing and staining the membrane and medium, and under these conditions endogenous TSP1 counting the number of cells adherent to the under surface. expression specifically inhibits expression of the same collagen mRNAs that are upregulated in human tumor which of these is sensitive to morpholino suppression of endothelium, but not those for type IV collagen a1or collagen Ia1 and Ia2 expression, TSP1 null lung laminin a3.Endogenous TSP1 expression in a normal endothelial cells were analysed for each response mouse tissue, therefore, specifically antagonizes the following pretreatment with morpholinos (Figure 7). induction of at least three known human tumor Lung-derived endothelial cells demonstrated increased angiogenesis markers.Thus, the murine 3D explants proliferation in the absence of endogenous TSP1 reliably model some molecular phenotypes of angiogen- compared to WT cells, and enhanced growth of the esis in human tumors. null cells was significantly inhibited by morpholino Expression of the same collagen genes was not suppression of collagen Ia1orIa2 but not by the detected in two types of human endothelial cells grown missense morpholino (Figure 7a).In contrast, serum- in 2D cultures (St Croix et al., 2000). Therefore, the 3D stimulated chemotaxis in modified Boyden chambers of explant cultures provide access to endothelial cells that TSP1 null endothelial cells pretreated with collagen Ia1 better replicate in vivo angiogenesis than do conven- or Ia2 morpholinos did not differ from the response of tional monolayer cultures.However, transcription of cells treated with the missense control (Figure 7b). collagen I a1 was specifically induced in a cloned bovine Likewise, morpholino treatment did not alter migration aortic endothelial cell line that undergoes spontaneous rates of WT cells (data not shown). tube formation in postconfluent 2D cultures and was thereby associated with switching to an angiogenic state (Fouser et al., 1991). TSP1 expression was lost during Discussion the same morphological transition (Iruela-Arispe et al., 1991), consistent with the reciprocal relationship we Endogenous TSP1 levels released into the matrix and observe here for expression of TSP1 and collagen I in medium of muscle explant cultures are sufficient to the mouse explant assays.Although we have verified significantly inhibit vascular outgrowth, consistent with type I collagen expression by cultured endothelial cells

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 542 from the null mice and its suppression by exogenous account for the differences we observe in cell behavior or TSP1, this protein is also expressed by vascular smooth gene expression between WT and TSP1 null explants. muscle cells in monolayer culture and may contribute to Identifying vascular cell genes that are regulated by the differential expression in the TSP1 nulls (results not TSP1 may contribute to a molecular definition of the shown). angiogenic switch.In cancers, several genetic alterations In addition to regulation of angiogenesis, regulation simultaneously induce angiogenic factors and repress of type I collagen gene expression by TSP1 may play a inhibitors, including TSP1 (Hanahan and Folkman, broader role in tumor metastasis.Collagen I a1 and Ia2 1996; Volpert et al., 1997). Global expression analyses were the two matrix genes upregulated in a 17 gene have identified overlapping sets of molecular markers signature of metastatic tumors (Ramaswamy et al., that change during angiogenic responses (Kahn et al., 2003).TSP1 is downregulated in some metastatic 2000; St Croix et al., 2000; Bell et al., 2001; Madden tumors (Zabrenetzky et al., 1994; Maeda et al., 2001; et al., 2004). The angiogenic switch, therefore, may Urquidi et al., 2002), and overexpressing TSP1 inhibits involve a concerted program of gene expression.Our spontaneous metastasis (Weinstat-Saslow et al., 1994). results suggest that angiogenesis inhibitors may act by Therefore, TSP1 may regulate both metastasis and reversing this program.We have also begun to globally angiogenesis through this pathway. define molecular targets altered by angiogenesis inhibi- Additional matrix proteins associated with basement tors using proteomics and microarrays (Keezer et al., membranes may play important roles in the angiogenic 2003; Mazzanti et al., 2004). Although the known switch.Collagen IV a1 and laminin a4 are upregulated angiogenesis inhibitors utilize different receptors, they at 1–2 days in human umbilical vein endothelial cells have similar effects on some endothelial cell responses, undergoing capillary morphogenesis in 3D collagen gels such as inhibiting motility.As TSP1 reverses several of (Bell et al., 2001), and maturation of microvessels is the changes in extracellular matrix gene expression defective in laminin a4-null mice (Thyboll et al., 2002). induced by angiogenic factors, reprogramming of We found that endogenous TSP1 induced collagen IV a1 extracellular matrix biosynthesis may be one end point but inhibited laminin a4 expression.Upregulation of for a concerted reversal of angiogenic signaling by this type IV collagen expression by endogenous TSP1 may angiogenesis inhibitor. be significant, because degradation of type IV collagen releases the potent angiogenesis inhibitor tumstatin (Petitclerc et al., 2000; Maeshima et al., 2002). Upregu- Materials and methods lation of laminin-a4 in the absence of TSP1 could provide a prosurvival signal through b1 integrin Materials (Gonzalez et al., 2002; DeHahn et al., 2004) and thereby Pepsin-solubilized bovine dermal collagen containing 95–98% contribute to the increased angiogenic response of the type I collagen (Vitrogen) was obtained from Cohesion nulls.Therefore, modulation of basement membrane Technologies Inc.(Palo Alto, CA, USA).EBM medium with collagen and laminin genes by endogenous TSP1 may EGM-MV supplements and SmBLM medium with labelquots were obtained from Clonetics BioWhittaker (Walkersville, also mediate some of its effects on neovascularization of ´ muscle explants.The mechanism by which endogenous MD, USA).Collagenase type E was purchased from Invitro- gen Corporation (Carlsbad, CA, USA). TSP1 regulates the expression of these genes and their significance remain to be defined. We also examined the roles of two known molecular Cell culture targets of TSP1 in its antiangiogenic activity using the Primary lung endothelial cells were grown in pure culture. Briefly, lungs from WT and TSP1 null mice were harvested in explant assay.MMP activity is required for angiogenesis sterile conditions, cut into 1 mm fragments and incubated with of a Vitrogen matrix in a chick chorioallantoic collagenase in endothelial growth medium (EBM with 10% membrane assay (Seandel et al., 2001), but we observed FCS, 1.0 mg/ml hydrocortisone, 10 ng/ml EGF, 12 mg/ml no significant upregulation of cell associated or secreted bovine brain extract, 30 mg/ml gentamicin sulfate, and 50 ng/ gelatinase activities in TSP1 null explants.TGF b1 ml amphotericin-B), (Cambrex, San Diego, CA, USA) for 1 h directly stimulates angiogenesis either by inducing and the solution plated in 25 mm culture flasks containing expression of VEGF, which stimulates endothelial cell endothelial growth medium with 300 mM rotterlin (protein proliferation and migration (Pertovaara et al., 1994), or kinase C d inhibitor) (Calbiochem, San Diego, CA, USA). by inducing capillary structure formation of endothelial Medium was changed every third day.Purity of the primary cells cultured on collagen matrix (Madri et al., 1988; endothelial cultures was checked periodically via immunohis- tochemistry using a commercial kit (Vector Labs MOM Choi and Ballermann, 1995).However, type 1 repeats of Immunodetection Kit, Burlington, CA, USA) with primary TSP1 can also inhibit angiogenesis independent of their monoclonal antibody to CD31 (PECAM-1, BD Biosciences, latent TGFb-activating sequence (Tolsma et al., 1993; San Jose, CA, USA) or a-smooth muscle actin (Sigma, St Iruela-Arispe et al., 1999). In the explant cultures from Louis, MO, USA). WT and TSP1 null mice, we detected no differences in latent TGFb activation.Furthermore, TGF b stimulates Migration assay synthesis of type I collagen (Roberts et al., 1986), but the Polycarbonate membrane inserts with 8-mm pores (Nalge null explants, where latent TGFb activation should be Nunc, Naperville, IL, USA) were placed into a 24-well plate impaired, had elevated type I collagen gene expression. that was filled with 0.4 ml of RPMI 1640 medium supplemen- Therefore, differences in latent TGFb activation cannot ted with 10% FBS.1.5mm muscle explants were placed on the

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 543 upper compartment of the inserts following the addition of analysed using 10% SDS–PAGE gels, which were then fixed 0.5 ml EBM medium and incubated at 371C with 5% CO2. and visualized by fluorography. After 6 days, membranes were fixed and stained, and five random fields were counted and averaged.Six chambers were used for each assay and each experiment done in triplicate. Invasion assay In a separate series of experiments lung-derived endothelial Invasion assays were performed using a modification of cells from WT and TSP1 null mice were grown for 2 weeks previously described procedures (Albini et al., 1987). A 50 ml before use.Modified Boyden chambers containing gelatin- volume of neutralized Vitrogen solution at 1 mg/ml was coated 8-mm pore polycarbonate membranes (Neuro Probe, applied to the upper compartment of inserts with 8 mm pore Gaithersburg, MD, USA) were used as described (Calzada polycarbonate membranes and allowed to gel at 371C. et al., 2004). The murine cells were treated with morpholinos to Explants were then applied as described for the migration collagen Ia1, Ia2 or missense in serum free medium for 3 h as assay. recommended by the manufacturer, harvested and resus- pended at 0.8–1 Â 106 cells/ml in assay medium (EGM þ 0.1% BSA) and added to the upper chamber.Migration to 20% Latent TGFb activation FCS was assesses microscopically after 5.5 h. Normal rat kidney (NRK) fibroblast cells were maintained in M199 medium containing 10% calf serum, 2 mM glutamine, penicillin, and streptomycin.Muscle explants from WT or Proliferation assay TSP1 null mice were embedded in Vitrogen matrices and Proliferation of lung-derived endothelial cells from WT and cultured for 14 days.Following serum starvation conditioned TSP1 null mice was measured with a nonradioactive colori- medium was collected and active TGFb quantified using the metric assay (CellTiter 96, Promega, Madison, WI, USA). NRK colony formation assay as previously described (Guo Briefly, to each well of a 96-well culture plate (Nunc, et al., 1997b). The assay was scored after incubation for 8 days. Denmark) 5 Â 103 cells were suspended in 100 ml of culture Colonies greater than 60 mm in diameter were counted in five medium7morpholinos at the indicated concentrations and random fields. incubated for 72 h.Appropriate zero time controls were run for all assays and the optical density readings obtained then subtracted from those obtained at 72 h. Gelatin zymography Muscle explants embedded in 3D collagen gel were cultured in TSP1 immunoassay EGM medium for 10 days.The medium was then changed to Levels of TSP1 in conditioned media and digested collagen serum-free medium overnight, changed again, and harvested matrix from WT and TSP1 null explants were determined by after 24 h.The resulting conditioned medium was analysed immunoassay as described (Isenberg et al., 2005). using 10% polyacrylamide, 0.1% gelatin SDS gels without reduction.The gels were washed and developed as described (Yakubenko et al., 2000). Morpholino suppression of vascular cell outgrowth To assess cell-associated MMPs, the gels were digested with Muscle explants from WT TSP-1 null mice were prepared as 0.2% collagenase I and the collected cell fraction washed, lysed previously described (Calzada et al., 2004; Isenberg et al., with RIPA buffer and the lysate cleared by centrifugation. 2005) and incubated in endothelial growth medium (Cambrex Equal amounts of protein samples were analysed on 10% Biosciences, Walkersville, MD, USA) with 20% heparin- acrylamide, 0.1% gelatin SDS gels without reduction. stripped FCS.Morpholino antisense oligonucleotides to col- lagentypeIa1 (CCGGAGGTCCACAAAGCTGAACATG), collagen type Ia2 (GCGTATCCACAAAGCTGAGCATGTC) Metabolic labeling of ex vivo explants and 2D gel and a 5-missense control for collagen Ia1(CCcGAaGTCCA electrophoresis gAAAGCTcAAgATG) were obtained from GeneTools (Philo- Explants were prepared as described.On day 14 medium was math, OR, USA).Explants were treated with morpholinos replaced with 1% dialysed FBS for 12 h and changed again for (5.6 ml of a 500 mM stock solution) prepared as recommended by another 8 h.The medium was then replaced with 150 mlof the manufacturer.Vascular outgrowth was evaluated by smBLM medium (without methionine or cysteine) containing measuring the maximum cell migration distance in each of four 62.5 mCi/ml 35S-Translabel and incubated for 48 h.The super- quadrants at day 14.Means 7s.e.m. were calculated from six natant was collected and radiolabeled proteins separated using explants at each time point. PD-10 columns equilibrated with 50 mM ammonium bicarbo- To validate functional activity of morpholinos in endothelial nate buffer containing 10 mg/ml of SDS.Eluted proteins were cells, lung-derived endothelial cells from TSP1 null mice were lyophilized and dissolved in 100 ml of distilled water. isolated as described (Isenberg et al., 2005). At 80% Protein samples were reduced and processed for 2D confluence, cells were treated with antisense oligonucleotides electrophoresis using the IPGphor isoelectric focusing system to collagen Ia1, Ia2, and a 5-missense morpholino to Ia1 for (Amersham Pharmacia Biotech) as described by the manu- 24 h, then incubated in the presence of medium deficient in facturer.Equal amounts of proteins were mixed with rehydra- methionine and cysteine for 1 h followed by incubation with tion solution (8 M urea, 2% NP-40, 2% IPG buffer, and medium containing 100 mCi/ml TRAN 35S-Label with 70% bromphenol blue) and incubated with the IPG strip (pH 3–10 L-methionine (MP Biomedicals, Irvine, CA, USA) for 4 h. gradient) overnight, then focused at 500 V for 1 h, 1000 V for Cultures were then incubated in the presence of morpholino 1 h, and 8000 V for 10.5 h. The strips were equilibrated and containing medium for 24 h.Medium was collected, centri- processed for the second dimension on 8% NuPage gels with fuged, and the supernatant incubated with rabbit anti-mouse MOPS/SDS running buffer.The gels were fixed and visualized type I collagen antibody clone AB765P 1:100 (Chemicon by fluorography.Potential identities for spots exhibiting International, Temecula, CA, USA) for 1 h at 41C.Immune differential intensities were predicted based on their apparent complexes were precipitated with protein A-argarose (Roche molecular weight and isoelectric points using TagIdent (http:// Diagnostics, Mannheim, Germany).The protein samples were ca.expasy.org/tools/tagident.html).

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 544 Immunoprecipitation/Western blotting ACGCC; Collagen IIIa1, forward TGATGGACGCAATG Protein samples from each group of labeled explant cultures GAGAAAAG, reverse TCACCTGAAGGACCTCGTGTTC; were incubated with rabbit anti-mouse type I collagen Collagen IVa1, forward AAGGACAAATCGGACCCACTG, polyclonal antibody (1:100, Chemicon) for 1 h with rocking reverse GGAATCCCAATGCCAGGTAGAC; Lam-a3, for- at 41C.In all, 20 ml of protein A/G-agarose (Pierce) was added ward TATTCCCGTATCGTGCCTCTGG, reverse ACTCAT to each sample, and incubated overnight at 41C.Where TGTGCTGCTCCTGACC; Lam-a4 forward, AAGGCCTTC indicated, the immunoprecipitates were pretreated for 5 h at ACATCCCATCAGA, reverse CACCCCACCAACGTAAAA 371 with 1000 U/ml of C. histolyticum collagenase (Sigma). CACAGT; HPRT, forward TAAAGCTTGCCCCAAAATG Samples were analysed using 10% SDS gels, fixed, and GTTAAGGTTG, reverse-TAGCGGCCGCTTGCGCTCAT visualized by fluorography. CTTAGGCTTTG.PCR products were analysed on 1.5% agarose gels and visualized with ethidium bromide.Band Reverse transcriptase (RT)–PCR intensities were quantified using ImageQuant 5.0 software Total RNA was extracted from outgrowth cells recovered from (Molecular Dynamics).Each PCR reaction was performed in muscle explants using TRIzol Reagent (Invitrogen).cDNAs triplicate on three individual preparations of reverse-tran- were synthesized using 1 mg of total RNA primed with oligo- scribed cDNA. d(T) in 50 ml reactions.Total cDNAs were analysed using PCR to measure the mRNA levels using the following primers Acknowledgements purchased from Invitrogen: Collagen Ia1, forward-50-GGAG We thank Dr Jack Lawler for providing TSP1 null mice.This CAATGGAATCTTGGATGG-3’, reverse-AACTCAGTGTG work was supported by the Intramural Research Program of TGGCAGAAACTTG; Collagen Ia2, forward GGTCTTACT the NIH, National Cancer Institute, Center for Cancer GGGAACTTTGCTGC, reverse TACCACTGTGTCCTTTC Research.

References

Abdelouahed M, Ludlow A, Brunner G, Lawler J.(2000). J Gonzalez AM, Gonzales M, Herron GS, Nagavarapu U, Biol Chem 275: 17933–17936. Hopkinson SB, Tsuruta D et al. (2002). Proc Natl Acad Sci Adams JC, Lawler J.(2004). Int J Biochem Cell Biol 36: USA 26: 26. 961–968. Guo N, Krutzsch HC, Inman JK, Roberts DD.(1997a). Albini A, Iwamoto Y, Kleinman HK, Martin GR, Cancer Res 57: 1735–1742. Aaronson SA, Kozlowski JM et al. (1987). Cancer Res 47: Guo NH, Krutzsch HC, Inman JK, Shannon CS, Roberts 3239–3245. DD.(1997b). J Pept Res 50: 210–221. Bein K, Simons M.(2000). J Biol Chem 275: 32167–32173. Hamano Y, Sugimoto H, Soubasakos MA, Kieran M, Olsen Bell SE, Mavila A, Salazar R, Bayless KJ, Kanagala S, BR, Lawler J et al. (2004). Cancer Res 64: 1570–1574. Maxwell SA et al. (2001). J Cell Sci 114: 2755–2773. Hanahan D, Folkman J.(1996). Cell 86: 353–364. Bogdanov Jr A, Marecos E, Cheng H-C, Chandrasekaran L, Iivanainen A, Kortesmaa J, Sahlberg C, Morita T, Bergmann Krutzsch HC, Roberts DD et al. (1999). Neoplasia 1: U, Thesleff I et al. (1997). J Biol Chem 272: 27862–27868. 438–445. Iruela-Arispe ML, Bornstein P, Sage H.(1991). Proc Natl Bornstein P.(2001). J Clin Invest 107: 929–934. Acad Sci USA 88: 5026–5030. Calzada MJ, Zhou L, Sipes JM, Zhang J, Krutzsch HC, Iruela-Arispe ML, Lombardo M, Krutzsch HC, Lawler J, Iruela-Arispe ML et al. (2004). Circ Res 94: 462–470. Roberts DD.(1999). Circulation 100: 1423–1431. Chandrasekaran L, He C-Z, Al-Barazi HO, Krutzsch HC, Isenberg J, Calzada M, Zhou L, Guo N, Lawler J, Wang X Iruela-Arispe ML, Roberts DD.(2000). Mol Biol Cell 11: et al. (2005). Matrix Biol 24: 110–123. 2885–2900. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein Chang HY, Sneddon JB, Alizadeh AA, Sood R, West RB, RL, Bouck N.(2000). Nat Med 6: 41–48. Montgomery K et al. (2004). PLoS Biol 2: E7. Jimenez B, Volpert OV, Reiher F, Chang L, Munoz A, Karin Chen D, Guo K, Yang J, Frazier WA, Isner JM, Andres V. M et al. (2001). Oncogene 20: 3443–3448. (1999). Am J Physiol 277: H1100–6. Kahn J, Mehraban F, Ingle G, Xin X, Bryant JE, Vehar G Choi ME, Ballermann BJ.(1995). J Biol Chem 270: 21144– et al. (2000). Am J Pathol 156: 1887–1900. 21150. Kanda S, Shono T, Tomasini-Johansson B, Klint P, Saito Y. Dameron KM, Volpert OV, Tainsky MA, Bouck N.(1994). (1999). Exp Cell Res 252: 262–272. Science 265: 1582–1584. Keezer SM, Ivie SE, Krutzsch HC, Tandle A, Libutti SK, de Fraipont F, Keramidas M, El Atiﬁ M, Chambaz EM, Roberts DD.(2003). Cancer Res 63: 6405–6412. Berger F, Feige JJ.(2004). Oncogene 23: 3642–3649. Lawler J, Detmar M.(2004). Int J Biochem Cell Biol 36: 1038– DeHahn KC, Gonzales M, Gonzalez AM, Hopkinson SB, 1045. Chandel NS, Brunelle JK et al. (2004). Exp Cell Res 294: Lawler J, Miao WM, Duquette M, Bouck N, Bronson RT, 281–289. Hynes RO.(2001). Am J Pathol 159: 1949–1956. Donnini S, Morbidelli L, Taraboletti G, Ziche M.(2004). Life Li Z, Calzada MJ, Sipes JM, Cashel JA, Krutzsch HC, Annis Sci 74: 2975–2985. D et al. (2002). J Cell Biol 157: 509–519. Eliceiri BP, Cheresh DA.(2001). Curr Opin Cell Biol 13: Madden SL, Cook BP, Nacht M, Weber WD, Callahan MR, 563–568. Jiang Y et al. (2004). Am J Pathol 165: 601–608. Filleur S, Volpert OV, Degeorges A, Voland C, Reiher F, Madri JA, Pratt BM, Tucker AM.(1988). J Cell Biol 106: Clezardin P et al. (2001). Genes Dev 15: 1373–1382. 1375–1384. Fouser L, Iruela-Arispe L, Bornstein P, Sage EH.(1991). J Maeda K, Nishiguchi Y, Kang SM, Yashiro M, Onoda N, Biol Chem 266: 18345–18351. Sawada T et al. (2001). Oncol Rep 8: 763–766.

Oncogene Thrombospondin-1 targets in angiogenesis L Zhou et al 545 Maeshima Y, Sudhakar A, Lively JC, Ueki K, Kharbanda S, Streit M, Stephen AE, Hawighorst T, Matsuda K, Lange- Kahn CR et al. (2002). Science 295: 140–143. Asschenfeldt B, Brown LF et al. (2002). Cancer Res 62: Majack RA, Cook SC, Bornstein P.(1986). Proc Natl Acad Sci 2004–2012. USA 83: 9050–9054. Sunderkotter C, Steinbrink K, Goebeler M, Bhardwaj R, Sorg Mazzanti CM, Tandle A, Lorang D, Costouros N, Roberts D, C.(1994). J Leukoc 55: 410–422. Bevilacqua G et al. (2004). Genome Res 14: 1585–1593. Taraboletti G, Morbidelli L, Donnini S, Parenti A, Granger Murphy-Ullrich JE, Poczatek M.(2000). Cytokine Growth HJ, Giavazzi R et al. (2000). FASEB J 14: 1674–1676. Factor Rev 11: 59–69. Tenan M, Fulci G, Albertoni M, Diserens AC, Hamou MF, El Pedersen TX, Leethanakul C, Patel V, Mitola D, Lund LR, Atiﬁ-Borel M et al. (2000). J Exp Med 191: 1789–1798. Dano K et al. (2003). Oncogene 22: 3964–3976. Thyboll J, Kortesmaa J, Cao R, Soininen R, Wang L, Pertovaara L, Kaipainen A, Mustonen T, Orpana A, Iivanainen A et al. (2002). Mol Cell Biol 22: 1194–1202. Ferrara N, Saksela O et al. (1994). J Biol Chem 269: Tolsma SS, Volpert OV, Good DJ, Frazier WA, Polverini PJ, 6271–6274. Bouck N.(1993). J Cell Biol 122: 497–511. Petitclerc E, Boutaud A, Prestayko A, Xu J, Sado Y, Urquidi V, Sloan D, Kawai K, Agarwal D, Woodman AC, Ninomiya Y et al. (2000). J Biol Chem 275: 8051–8061. Tarin D et al. (2002). Clin Cancer Res 8: 61–74. Qian X, Wang TN, Rothman VL, Nicosia RF, Tuszynski GP. Volpert OV, Dameron KM, Bouck N.(1997). Oncogene 14: (1997). Exp Cell Res 235: 403–412. 1495–1502. Ramaswamy S, Ross KN, Lander ES, Golub TR.(2003). Nat Volpert OV, Zaichuk T, Zhou W, Reiher F, Ferguson TA, Genet 33: 49–54. Stuart PM et al. (2002). Nat Med 8: 349–357. Roberts AB, Sporn MB, Assoian RK, Smith JM, Roche NS, Weinstat-Saslow DL, Zabrenetzky VS, VanHoutte K, Frazier Wakeﬁeld LM et al. (1986). Proc Natl Acad Sci USA 83: WA, Roberts DD, Steeg PS.(1994). Cancer Res 54: 6504– 4167–4171. 6511. Rodriguez-Manzaneque JC, Lane TF, Ortega MA, Hynes RO, Westphal JR.(2004). Curr Opin Mol Ther 6: 451–457. Lawler J, Iruela-Arispe ML.(2001). Proc Natl Acad Sci Yakubenko VP, Lobb RR, Plow EF, Ugarova TP.(2000). Exp USA 98: 12485–12490. Cell Res 260: 73–84. Seandel M, Noack-Kunnmann K, Zhu D, Aimes RT, Quigley Yee KO, Streit M, Hawighorst T, Detmar M, Lawler J.(2004). JP.(2001). Blood 97: 2323–2332. Am J Pathol 165: 541–552. St Croix B, Rago C, Velculescu V, Traverso G, Romans KE, Zabrenetzky V, Harris CC, Steeg PS, Roberts DD.(1994). Int Montgomery E et al. (2000). Science 289: 1197–1202. J Cancer 59: 191–195.

Oncogene