DOCSLIB.ORG

Quantitative Proteomic Analysis of Low Linolenic Acid Transgenic Soybean Reveals Perturbations of Fatty Acid Metabolic Pathways

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantitative Proteomic Analysis of Low Linolenic Acid Transgenic Soybean Reveals Perturbations of Fatty Acid Metabolic Pathways RESEARCH ARTICLE Mass Spectrometry www.proteomics-journal.com Quantitative Proteomic Analysis of Low Linolenic Acid Transgenic Soybean Reveals Perturbations of Fatty Acid Metabolic Pathways Nazrul Islam, Philip D. Bates, K. M. Maria John, Hari B. Krishnan, Zhanyuan J. Zhang, Devanand L. Luthria, and Savithiry S. Natarajan* modifications, gene manipulations To understand the effect of fatty acid desaturase gene (GmFAD3) silencing on for oil composition were intensively perturbation of fatty acid (FA) metabolic pathways, the changes are compared investigated[1,2] due to consumer health in protein profiling in control and low linolenic acid transgenic soybeans using awareness and increased demand for tandem mass tag based mass spectrometry. Protein profiling of the transgenic vegetable oil. Soybean oil constitutes about 60% of total world seed oil (http:// line unveiled changes in several key enzymes of FA metabolism. This includes www.soystats.com) and most of it is used enzymes of lower abundance; fabH, fabF, and thioestrase associated with FA for human consumption. initiation, elongation, and desaturation processes and LOX1 5, ACOX, The fatty acid composition of the ACAA1, MFP2 associated with β-oxidation of α-linolenic acids pathways. In soybean oil is approximately 13% of addition, the GmFAD3 silencing results in a significant reduction in one of the palmitic acid (16:0), 4% stearic acid (18:0), 20% oleic acid (18:1), 55% linoleic major allergens, Gly m 4 (C6T3L5). These results are important for exploring acid (18:2), and 7–10% linolenic acid how plants adjust in their biological processes when certain changes are (18:3).[3] The palmitic and stearic acids induced in the genetic makeup. A complete understanding of these processes are saturated fatty acids, and the re- will aid researchers to alter genes for developing value-added soybeans. maining are unsaturated fatty acids. The lower concentration of polyunsaturated fatty acids (18:3) is always desirable as it reduces the shelf life due to oxidation, 1. Introduction which causes an unpleasant odor. Because of the demand from the end users, “The Better Bean Initiative” (BBI) was launched in Soybean has multifarious usages for human and animal 2000 by the United Soybean Board (USB) to improve the compo- consumption that has made it a prime target for genetic ma- sition of soybean.[4] As per BBI, the targeted composition of fatty nipulation. Such manipulations have been more prominent acids in soybean oil includes a higher level of oleic and lower lev- since the inception of genome sequences in 2010. Among these els of linolenic and saturated fatty acids.[2] To improve better shelf life and stability of soybean oil at higher temperatures, we targeted on fatty acid desaturase (FAD3) gene, Dr. N. Islam, Dr. S. S. Natarajan α Soybean Genomics and Improvement Laboratory responsible for -linolenic acid synthesis controlled by the three USDA-ARS active members: GmFAD3A, GmFAD3B,andGmFAD3C.[5] To Beltsville, MD 20705, USA reduce the linolenic acid level in soybean, the enzymes that cat- E-mail: [email protected] alyze the conversion of linoleic acids (18:2) to α-linolenic acids Dr.P.D.Bates (18:3) during fatty acid biosynthesis needed to be repressed. Us- Institute of Biological Chemistry Washington State University ing RNAi, we silenced the omega-3 FAD gene family in soybean Pullman, WA 99164, USA genome and found a lower amount of the α-linolenic acids in Dr.K.M.M.John,Dr.D.L.Luthria the seeds as compared to the control. We also confirmed that the Food Composition and Methods Development Laboratory silencing of these genes is inheritable.[5] BHNRC, USDA-ARS Transgenic approach is frequently targeted on single class Beltsville, MD 20705, USA of component/s. However, this targeted approach may result Dr. H. B. Krishnan Plant Genetics Research Unit in an increase or decrease of other traits, which may be desir- USDA-ARS, University of Missouri able/undesirable for end users. In addition, the expression of a Columbia, MO 65211, USA gene specifically in a polyploidy like soybean and wheat is not to- Dr. H. B. Krishnan, Dr. Z. J. Zhang tally independent; rather it is the product of interactions among Division of Plant Sciences the genes or diploid genomes in the polyploidy constitutions, as University of Missouri was reported in the case of wheat.[6] Krishnan et al.[7] successfully Columbia, MO 65211, USA introduced a leginsulin gene (cysteine-rich protein) in soybean. DOI: 10.1002/pmic.201800379 However, the total amount of sulfur-containing amino acids did Proteomics 2019, 19, 1800379 1800379 (1 of 11) C 2019 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.advancedsciencenews.com www.proteomics-journal.com not change as compared to the control. Similarly, efforts have been made to improve rice grain protein quality by inserting a Significance Statement [8] sunflower seed albumin gene encoding a sulfur-rich protein. Soybean has been a vital source of human food and animal A proteomic analysis demonstrated the total amount of sulfur feed due to its protein and oil content. Recently, there has content in the transgenic seeds did not improve because of the been a significant interest in modifying the fatty acid com- [9] competition of sulfur with the endogenous sulfur-rich proteins. position of the soybean oil due to its nutritional, health, and Therefore, any disruption in the constituents of a genome either processing significance. Classical breeding and genetic ma- by gene silencing or introducing a foreign gene needs to be in- nipulation using biotechnical approaches have been used to vestigated thoroughly to elucidate and understand the underlying improve the quantity and quality of soybean oil. In the present metabolomic mechanism. study, we investigated the impact of silencing FAD3 gene in Several successful attempts have been made to improve soy- soybean using mass spectrometry approaches to identify bean seed oil compositions by silencing genes that are responsi- changes in protein profile. Because of the complexity of the α ble for encoding fatty acids such as GmFAD3 which encodes - seed proteome, we adopted a high-throughput and sensitive [5,10] linolenic acid content in soybean seed oil. In addition, in pre- tandem mass tag (TMT) technique that can quantify more vious studies, limited information is available on how silencing proteins to understand the mechanism of genetic manipula- of GmFAD3 disrupts the metabolic pathways of FA biosynthe- tion. The results demonstrated that the fatty acid desaturase sis. In the present study, we investigated the impact of silencing gene (GmFAD3) silencing affected the key enzymes in FA FAD3 gene in soybean using mass spectrometry approaches to metabolism. A complete understanding of these processes identify changes in protein and fatty acid profiles in transgenic will aid researchers to alter genes for developing value-added soybeans. Because of the complexity of the seed proteome, we soybeans and help address potential biosafety issue of geneti- adopted a high-throughput and sensitive tandem mass tag (TMT) cally modified soybean. technique that can quantify more proteins as compared to classi- cal gel separation techniques. extracted twice with hexane (5 mL). The extraction was performed under an ultrasonic bath (power 600 W) for a period of 15 min. 2. Experimental Section The extracts were centrifuged at 5000 rpm for 10 min and the su- 2.1. Chemicals pernatant was collected and evaporated to dryness under a slow stream of nitrogen gas. The concentrated soybean oil was resus- The TMT 6plex was purchased from Thermo Scientific pended with 2 mL hexane and from that 1 mL was separated (https://www.thermofisher.com). For fatty acid methyl esters and evaporated to dryness for the preparation of FAMEs deriva- (FAMEs) analyses, the HPLC-grade chemicals (methanol, tives by transesterification of extracted soybean oil. The derivati- and acetonitrile) were purchased from Burdick and Jackson zation was performed using 5 mL of acidified methanol (10 mL (Muskegon, MI, USA). FAMEs standards were purchased from of acetyl chloride to 90 mL of cold methanol). The mixture kept NcChek prep (www.nu-chekprep.com/). All extracts were filtered at ambient temperature overnight with continuous stirring, and through PVDF (0.4 μmfilter). then 3 mL of water was added. The FAMEs were extracted with 2 mL of hexane. The hexane layer was separated and analyzed with GC.[11] 2.2. Plant Materials Soybean cultivar, Jack (control), and four independent FAD3- 2.4. Protein Extraction silenced transgenic lines (FAD-A, FAD-B, FAD-C,andFAD- E) derived from the Jack were grown in 13 L pots. The Protein extraction from soybean was performed using a phe- [12] plants were grown in PRO-MIX (Premier Horticulture, Que- nol extraction protocol as described by Hurkman. Initially, bec, Canada) medium and fertilized with Osmocot 14-14- 200 mg of the ground soybean from each line were defatted us- [13] 14 (Hummert International, Earth City, USA) in a green- ing hexane. The residue was extracted with approximately 1 house (University of Missouri, MO) with supplemental light mL of the buffer containing sucrose (0.7 m), tris (0.5 m), EDTA (intensity 50–90 klux). Greenhouse settings were 16-h day (50 mm), KCl (0.1 m), DTT (25 mm), and PMSF (2 mm). The mix- length with 30/18 °C day/night temperatures. Dry seeds ture was incubated for 30 min at room temperature with shaking. were harvested by hand and stored in cold seed storage The mixture was centrifuged at 8000 g for 30 min and the su- room. pernatant was separated and an equal amount of water saturated phenol was added to it and the mixture was mixed well for 10 min. The phenol phase which contains the proteins were collected af- ter centrifugation at 4 °C for 30 min. The proteins (phenol phase) 2.3.
Load more

Recommended publications
  • ACOX3 Antibody
    Product Datasheet ACOX3 antibody Catalog No: #22136 Orders: [email protected] Description Support: [email protected] Product Name ACOX3 antibody Host Species Rabbit Clonality Polyclonal Purification Purified by antigen-affinity chromatography. Applications WB IHC Species Reactivity Hu Immunogen Type Recombinant protein Immunogen Description Recombinant protein fragment contain a sequence corresponding to a region within amino acids 408 and 613 of ACOX3 Target Name ACOX3 Accession No. Swiss-Prot:O15254Gene ID:8310 Concentration 1mg/ml Formulation Supplied in 0.1M Tris-buffered saline with 20% Glycerol (pH7.0). 0.01% Thimerosal was added as a preservative. Storage Store at -20°C for long term preservation (recommended). Store at 4°C for short term use. Application Details Predicted MW: 70kd Western blotting: 1:500-1:3000 Immunohistochemistry: 1:100-1:500 Images Sample (30 ug of whole cell lysate) A: A549 7.5% SDS PAGE Primary antibody diluted at 1: 1000 Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 1 Immunohistochemical analysis of paraffin-embedded H441 xenograft, using ACOX3 antibody at 1: 500 dilution. Background Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined.
    [Show full text]
  • ACOX3 Human Shrna Plasmid Kit (Locus ID 8310) Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TL314988 ACOX3 Human shRNA Plasmid Kit (Locus ID 8310) Product data: Product Type: shRNA Plasmids Product Name: ACOX3 Human shRNA Plasmid Kit (Locus ID 8310) Locus ID: 8310 Vector: pGFP-C-shLenti (TR30023) Format: Lentiviral plasmids Components: ACOX3 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 8310). 5µg purified plasmid DNA per construct Non-effective 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free. RefSeq: NM_001101667, NM_003501, NM_003501.1, NM_003501.2, NM_001101667.1, BC017053, NM_003501.3, NM_001101667.2 Summary: Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008] shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact [email protected].
    [Show full text]
  • ACOX3 (H-1): Sc-390624
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . ACOX3 (H-1): sc-390624 BACKGROUND APPLICATIONS ACOX3 (acyl-Coenzyme A oxidase 3), also known as BRCOX or PRCOX, is a ACOX3 (H-1) is recommended for detection of ACOX3 of mouse, rat and 700 amino acid protein that localizes to peroxisomes and belongs to the acyl- human origin by Western Blotting (starting dilution 1:100, dilution range CoA oxidase family. Using FAD as a cofactor, ACOX3 catalyzes the desatura - 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein tion of 2-methyl branched fatty acids in peroxisomes, thereby playing an impor - (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution tant role in peroxisomal fatty acid β-oxidation. Human ACOX3 shares 75% range 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution sequence identity with its rat counterpart, suggesting a conserved role range 1:30-1:3000). between species. Multiple isoforms of ACOX3 exist due to alternative splic - Suitable for use as control antibody for ACOX3 siRNA (h): sc-89236, ACOX3 ing events. The gene encoding ACOX3 maps to human chromosome 4, which siRNA (m): sc-140819, ACOX3 shRNA Plasmid (h): sc-89236-SH, ACOX3 encodes nearly 6% of the human genome and has the largest gene deserts shRNA Plasmid (m): sc-140819-SH, ACOX3 shRNA (h) Lentiviral Particles: (regions of the genome with no protein encoding genes) of all of the human sc-89236-V and ACOX3 shRNA (m) Lentiviral Particles: sc-140819-V. chromosomes. Defects in some of the genes located on chromosome 4 are associated with Huntington’s disease, Ellis-van Creveld syndrome, methyl - Molecular Weight of ACOX3: 78 kDa.
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]
  • Regions of Homozygosity Identified by SNP Microarray Analysis Aid in The
    ORIGINAL RESEARCH ARTICLE ©American College of Medical Genetics and Genomics Regions of homozygosity identified bySN P microarray analysis aid in the diagnosis of autosomal recessive disease and incidentally detect parental blood relationships Kristen Lipscomb Sund, PhD, MS1, Sarah L. Zimmerman, PhD1, Cameron Thomas, MD2, Anna L. Mitchell, MD, PhD3, Carlos E. Prada, MD1, Lauren Grote, BS1, Liming Bao, MD, PhD1, Lisa J. Martin, PhD1 and Teresa A. Smolarek, PhD1 Purpose: The purpose of this study was to document the ability of was suspected in the parents of at least 11 patients with regions of single-nucleotide polymorphism microarray to identify copy-neutral homozygosity covering >21.3% of their autosome. In four patients regions of homozygosity, demonstrate clinical utility of regions of from two families, homozygosity mapping discovered a candidate homozygosity, and discuss ethical/legal implications when regions of gene that was sequenced to identify a clinically significant mutation. homozygosity are associated with a parental blood relationship. Conclusion: This study demonstrates clinical utility in the identifica- Methods: Study data were compiled from consecutive samples tion of regions of homozygosity, as these regions may aid in diagnosis sent to our clinical laboratory over a 3-year period. A cytogenetics of the patient. This study establishes the need for careful reporting, database identified patients with at least two regions of homozygosity thorough pretest counseling, and careful electronic documentation, >10 Mb on two separate chromosomes. A chart review was conduct- as microarray has the capability of detecting previously unknown/ ed on patients who met the criteria. unreported relationships. Results: Of 3,217 single-nucleotide polymorphism microarrays, Genet Med 2013:15(1):70–78 59 (1.8%) patients met inclusion criteria.
    [Show full text]
  • Downloaded from Ftp://Ftp.Uniprot.Org/ on July 3, 2019) Using Maxquant (V1.6.10.43) Search Algorithm
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.17.385096; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The proteomic landscape of resting and activated CD4+ T cells reveal insights into cell differentiation and function Yashwanth Subbannayya1, Markus Haug1, Sneha M. Pinto1, Varshasnata Mohanty2, Hany Zakaria Meås1, Trude Helen Flo1, T.S. Keshava Prasad2 and Richard K. Kandasamy1,* 1Centre of Molecular Inflammation Research (CEMIR), and Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology, N-7491 Trondheim, Norway 2Center for Systems Biology and Molecular Medicine, Yenepoya (Deemed to be University), Mangalore, India *Correspondence to: Professor Richard Kumaran Kandasamy Norwegian University of Science and Technology (NTNU) Centre of Molecular Inflammation Research (CEMIR) PO Box 8905 MTFS Trondheim 7491 Norway E-mail: [email protected] (Kandasamy R K) Tel.: +47-7282-4511 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.17.385096; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract CD4+ T cells (T helper cells) are cytokine-producing adaptive immune cells that activate or regulate the responses of various immune cells.
    [Show full text]
  • Peroxisomal Lactate Dehydrogenase Is Generated by Translational Readthrough in Mammals
    1 Peroxisomal lactate dehydrogenase is generated 2 by translational readthrough in mammals 3 4 Fabian Schueren1†, Thomas Lingner2†, Rosemol George1†, Julia Hofhuis1, 5 Corinna Dickel1, Jutta Gärtner1*, Sven Thoms1* 6 7 1Department of Pediatrics and Adolescent Medicine, University Medical Center, 8 Georg-August-University Göttingen, Germany 9 2Department of Bioinformatics, Institute for Microbiology and Genetics, 10 Georg-August-University Göttingen, Germany 11 † Co-first author 12 13 * Correpondence: [email protected] (J.G.); [email protected] 14 (S.T.) 15 16 Competing interest statement: The authors declare no competing interest. 17 18 ABSTRACT 19 Translational readthrough gives rise to low abundance proteins with C-terminal 20 extensions beyond the stop codon. To identify functional translational readthrough, we 21 estimated the readthrough propensity (RTP) of all stop codon contexts of the human 22 genome by a new regression model in silico, identified a nucleotide consensus motif for 23 high RTP by using this model, and analyzed all readthrough extensions in silico with a 24 new predictor for peroxisomal targeting signal type 1 (PTS1). Lactate dehydrogenase B 25 (LDHB) showed the highest combined RTP and PTS1 probability. Experimentally we 26 show that at least 1.6% of the total cellular LDHB getting targeted to the peroxisome by 27 a conserved hidden PTS1. The readthrough-extended lactate dehydrogenase subunit 28 LDHBx can also co-import LDHA, the other LDH subunit into peroxisomes. Peroxisomal 29 LDH is conserved in mammals and likely contributes to redox equivalent regeneration in 30 peroxisomes. 31 1 32 33 INTRODUCTION 34 Translation of genetic information encoded in mRNAs into proteins is carried out by ribosomes.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name acyl-CoA oxidase 3, pristanoyl Gene Symbol ACOX3 Organism Human Gene Summary Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. Gene Aliases Not Available RefSeq Accession No. NC_000004.11, NT_006051.18 UniGene ID Hs.479122 Ensembl Gene ID ENSG00000087008 Entrez Gene ID 8310 Assay Information Unique Assay ID qHsaCED0004211 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000413009, ENST00000356406, ENST00000503233, ENST00000514423 Amplicon Context Sequence CTGAGGAAGTCATACTCGAAGATCCGCTTGCATCGAAGGAAGTTCAGCTCGCGA TACTTCTCCAAGGACAGATCGGCTCCAGGGGAACGAGCGAAAAGAGGGTCATTC TCAAGAGCTGAGAAGAT Amplicon Length (bp) 95 Chromosome Location 4:8417596-8417720 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 22 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 83.5 gDNA Cq 23.36 Specificity (%) 100 Information to assist with data
    [Show full text]
  • Summer Presentation Week
    NIH SUMMER INTERNSHIP PROGRAM PRESENTATION WEEK 2021 • AUGUST 3-5 AGENDA AUGUST 3, 2021 POSTER AM 11:00 AM – 12:30 PM (ET) POSTER PM 1:00 PM – 2:30 PM (ET) LIGHTNING TALK 3:00 PM – 4:30 PM (ET) AUGUST 4, 2021 POSTER AM 11:00 AM – 12:30 PM (ET) POSTER PM 1:00 PM – 2:30 PM (ET) LIGHTNING TALK 3:00 PM – 4:30 PM (ET) AUGUST 5, 2021 POSTER AM 11:00 AM – 12:30 PM (ET) POSTER PM 1:00 PM – 2:30 PM (ET) LIGHTNING TALK 3:00 PM – 4:30 PM (ET) PRESENTATION NUMBERS LIGHTNING DATE INSTITUTE OR CENTER POSTER TALK 8/3 National Cancer Institute (NCI) 1-91 144-184 8/3 National Cancer Institute – Division of Cancer Epidemiology and Genetics (NCI – DCEG) 92-110 185-187 8/3 National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) 111-113 188 8/3 National Institute of Environmental Health Sciences (NIEHS) 114-141 189-192 8/3 Office of Director (OD) 142-143 193-216 8/4 Clinical Center (CC) 217-237 362-364 8/4 National Institute on Aging (NIA) 238-247 365-396 8/4 National Institute on Alcohol Abuse and Alcoholism (NIAAA) 248-256 8/4 National Institute of Biomedical Imaging and Bioengineering (NIBIB) 257-261 397-399 8/4 National Institute on Drug Abuse (NIDA) 262-279 400-402 8/4 National Institute of Mental Health (NIMH) 280-315 403-411 8/4 National Institute of Neurological Disorders and Stroke (NINDS) 316-351 412-423 8/4 National Library of Medicine (NLM) 352-361 424-426 8/5 National Center for Advancing Translational Sciences (NCATS) 427-433 570 8/5 National Center for Complementary and Integrative Health (NCCIH) 434 8/5 National Eye Institute
    [Show full text]
  • Protein Lysine Crotonylation: Past, Present, Perspective ✉ ✉ Gaoyue Jiang1,3, Chunxia Li2,3, Meng Lu2,3, Kefeng Lu 2 and Huihui Li 1
    www.nature.com/cddis REVIEW ARTICLE OPEN Protein lysine crotonylation: past, present, perspective ✉ ✉ Gaoyue Jiang1,3, Chunxia Li2,3, Meng Lu2,3, Kefeng Lu 2 and Huihui Li 1 © The Author(s) 2021 Lysine crotonylation has been discovered in histone and non-histone proteins and found to be involved in diverse diseases and biological processes, such as neuropsychiatric disease, carcinogenesis, spermatogenesis, tissue injury, and inflammation. The unique carbon–carbon π-bond structure indicates that lysine crotonylation may use distinct regulatory mechanisms from the widely studied other types of lysine acylation. In this review, we discussed the regulation of lysine crotonylation by enzymatic and non-enzymatic mechanisms, the recognition of substrate proteins, the physiological functions of lysine crotonylation and its cross- talk with other types of modification. The tools and methods for prediction and detection of lysine crotonylation were also described. Cell Death and Disease (2021) 12:703 ; https://doi.org/10.1038/s41419-021-03987-z INTRODUCTION transcriptional activation [10]. Structurally, Kcr is four-carbon in Protein posttranslational modifications (PTMs) are important length and the crotonyl modification contains a carbon–carbon epigenetic regulatory mechanisms involved in diverse biological (C–C) π-bond that results in a unique rigid planar conformation [1]. processes, such as DNA replication, transcription, cell differentia- In this review, we will discuss the enzymatic and non-enzymatic tion, and organismal development. Dysregulation of PTMs is regulation of crotonylation, the cellular and physiological func- associated with a number of diseases, e.g., neuropsychiatric tions of Kcr, the cross-talk between Kcr with other PTMs, and the disease, carcinogenesis, and tissue injury [1].
    [Show full text]
  • Restores the Expression of Down-Regulated Fatty Acid
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Kumar et al. Nutrition & Metabolism (2015) 12:8 DOI 10.1186/s12986-015-0003-8 RESEARCH Open Access The beta-3 adrenergic agonist (CL-316,243) restores the expression of down-regulated fatty acid oxidation genes in type 2 diabetic mice Amit Kumar1,2, Joseph Shiloach1, Michael J Betenbaugh2 and Emily J Gallagher3* Abstract Background: The hallmark of Type 2 diabetes (T2D) is hyperglycemia, although there are multiple other metabolic abnormalities that occur with T2D, including insulin resistance and dyslipidemia. To advance T2D prevention and develop targeted therapies for its treatment, a greater understanding of the alterations in metabolic tissues associated with T2D is necessary. The aim of this study was to use microarray analysis of gene expression in metabolic tissues from a mouse model of pre-diabetes and T2D to further understand the metabolic abnormalities that may contribute to T2D. We also aimed to uncover the novel genes and pathways regulated by the insulin sensitizing agent (CL-316,243) to identify key pathways and target genes in metabolic tissues that can reverse the diabetic phenotype. Methods: Male MKR mice on an FVB/n background and age matched wild-type (WT) FVB/n mice were used in all experiments. Skeletal muscle, liver and fat were isolated from prediabetic (3 week old) and diabetic (8 week old) MKR mice. Male MKR mice were treated with CL-316,243. Skeletal muscle, liver and fat were isolated after the treatment period. RNA was isolated from the metabolic tissues and subjected to microarray and KEGG database analysis.
    [Show full text]