Deciphering Species Relationships and Evolution in Chenopodium Through

Research Article

Deciphering species relationships and evolution in Chenopodium through sequence variations in nuclear internal transcribed spacer region and amplified fragment length polymorphism in nuclear DNA

Nikhil K. Chrungooa,*, Rajkumari Jashmi Devia†, Shailendra Goelb, Kamal Dasb a Department of Botany, Centre for Advanced Studies, North-Eastern Hill University, Shillong -793022 (India) b Department of Botany, University of Delhi, Delhi – 110 007 (India)

*Corresponding author: Department of Botany, Centre for Advanced Studies, North-Eastern Hill University, Shillong – 793 022 (India), Tel: ++91 364 2722 211, email: [email protected]; [email protected]

†Present address: Institute of Bioresources and Sustainable Development, Takyelpat, Imphal, Manipur- 795 001 (India)

Abstract Evaluation of sequence variations in the ITS region of nineteen accessions, comprising of 11 accessions of C. quinoa, 8 accessions of C. album and 165 retrieved sequences of different species of Chenopodium belonging to sub-family Chenopodioideae revealed a higher intraspecific genetic diversity in Himalayan C. album than that in C. quinoa. ITS and AFLP profiles of the accessions suggest the existence of accessions of Himalayan C. album as heteromorphs of the same species rather than a heterogenous assemblage of taxa. While the evolutionary relationship reconstructed from variations in 184 sequences of ITS region from species belonging to Chenopodiaceae, Amaranthaceae, Polygonaceae and Nelumbonaceae established a paraphyletic evolution of family Chenopodiaceae, it also revealed a monophyletic evolution of Chenopodieae I. The reconstruction also established five independent lineages of the sub-family Chenopodioideae with C. album as a sister clade of C. quinoa within the tribe Chenopodieae I. The results also indicate a much younger age of Himalayan Chenopods (C. album) than the reported crown age of Chenopodieae I. Key words Chenopodium, Chenopodioideae, ITS, AFLP, time-measured phylogenetic tree, evolutionary divergence,

Running title: Species relationships and evolution in Chenopodium

Abbreviations 2

ITS, Internal transcribed spacer; AFLP, Amplified fragment length polymorphism; DAMD, Direct Amplification of Minisatellite DNA; ISSR, Inter Simple Sequence Repeats; PIC, Polymorphic information content; myr, million years; mya, million years ago. Introduction Chenopodium is one of the taxonomically most complex genus. It belongs to the subfamily Chenopodioideae within the family Chenopodeace. The highly polymorphic habit of species within this genus has caused many difficulties in their proper taxonomic identification. Taxonomic identification of Chenopodium has been controversial because of the highly polymorphic leaf shape, floral structure, and seed morphology (La Duke and Crawford, 1979; Kurashige and Agrawal, 2005). While Wilson and Manhart (1993) have described the genus Chenopodium as a “taxonomic receptacle”, Rahiminejad and Gornall (2004) have described it as a complex group which lacked good morphological characteristics to distinguish between species. Most of the work on genetic diversity and phylogeny in Chenopodium has focused on C. quinoa and C. berlandieri subsp. nuttalliae (Ruas et al. 1999; Gangopadhyay and Mukherjee 2002) and only a few studies have been carried out on its other important species including C. album. Previous studies aimed at elucidating this taxonomic complex on the basis of cytology (Mehra and Malik 1963; Mukherjee 1986), karyotypic analysis (Bhargava et al. 2006; Kolano et al. 2008), flavonoids (Rahiminejad and Gornall 2004), RAPD profiles (Ruas et al. 1999; Gangopadhyay et al. 2002; Rana et al. 2010), DAMD (Rana et al. 2010) and ISSR markers (Rana et al. 2011) clearly indicate the existence of C. album as the most polymorphic species of the genus Chenopodium. Bhargava et al. (2006) and Rana et al. (2010) have suggested it to be aggregate taxon, thereby confusing its identity vis- a- vis Linnaean C. album. C. quinoa is an allotetraploid (2n = 4× = 36) with an estimated genome size of approximately 1.5 Gbp (Palomino et al., 2008; Kolano et al., 2016). On the other hand C. album is known as a complex of diploid (2n=18), tetraploid (2n=36) or hexaploid (2n=54) cytotypes with endopolyploidy and autopolyploidy as the origin of polyploidy (Kolano et al. 2008). Limited genetic resources in quinoa have long been considered as a major factor hindering molecular marker-assisted breeding (Jarvis et al., 2008). While the subfamily Chenopodiaceae has been considered to be monophyletic on the basis of sequence data of chloroplast rbcL (Kadereit et al., 2003) and matK/trnK (Müller and Borsch, 2005) genes, Fuentes-Bazan et al. (2012b) have argued that Chenopodium, as tradtionally recognized, consists of six independent lineages. The arguement was based on sequence diversity in plastid trnL-F and nuclear ITS regions of different species of this genus. Walsh et al. (2015) have, however, identified two distinct polyploid lineages out of which one lineage comprised of American tetraploid species and the other of Eastern Hemisphere hexaploid species. Thus, phylogenetic relationships amongst major lineages within Chenopodiaceae still remains poorly understood. Materials and Methods Plant materials Seeds of nineteen accessions of Chenopodium (Table 1) were procured from National Bureau of Plant Genetic resources, NBPGR, Shimla (India). The accessions were chosen on the basis of variations in colour, shape and arrangement of their leaves; colour, shape and surface morphology of their seeds; texture and type of

pollen grains. The selection of accessions was based on Devi and Chrungoo (2015). Plants of each accession were raised to full maturity in the experimental garden of the North Eastern Hill University, Shillong. PCR amplification of ITS region Genomic DNA, to be used as a template for PCR, was isolated from 10 day old etiolated seedlings of all the accessions following the method of Murray and Thomson (1980). PCR amplification of ITS region from genomic DNA of each accession was carried out with the forward (ITS5: 5´GGAAGTAAAAGTCGTAACAAGG3´) and reverse (ITS4: 5´TCCTCCGCTTATTGATATGC3´) primers designed by White et al. (1990). The reaction mixtures for amplification were optimized with 1mM MgCl2, 0.4mM dNTPs, 0.03U Taq Polymerase, 0.2pmols primers and 50ng of the template DNA. Amplification was performed in a thermal cycler programmed to one cycle of “hot start” (94°C); 35 cycles of denaturation (94°C, 1.0 min); annealing (50°C, 1 min) and extension (72°C, 1 min) and one final step of chain elongation at 72°C, 10 min. Each reaction mixture was electrophoresed on 1.2% agarose gel. The amplicons were visualized under UV light in ChemiDoc XRS+ system (Bio-Rad) after staining the gels with 0.5µg ml-1 ethidium bromide. The amplified DNA fragments were eluted from the gel and purified with QIA quick Gel Extraction Kit (QIAGEN India Pvt. Ltd.) following the manufacturer’s protocol. The precipitated DNA was pelletted by centrifuging at 13,000 rpm for 20 minutes at 4°C, washed twice with 70% alcohol and vacuum dried. The dried samples were dissolved in sterile distilled water. Nucleotide sequencing Nucleotide sequencing of each amplified DNA was carried out by capillary gel electrophoresis in ABI 3130 automated sequencer (Applied Biosystems) using POP-7 (Performance Optimzed Polymer) as the resolving matrix. Prior to sequencing, each amplicon was subjected to cycle sequencing with individual primers using the BigDye terminator v3.1 cycle sequencing kit (Thermo Fischer Scientific) as per the manufacturer’s protocol. The cycle sequencing protocol comprised of one cycle of hot start (96°C, 1 min), 35 cycles of denaturation (96°C, 10sec), annealing (Ta, 2 min) and chain extension (60°C, 3min). DNA was precipitated from the amplified reaction mixture by adding 25µl of absolute alcohol and 1.0µl of 125mM EDTA. The precipitated DNA was pelletted by centrifugation at 13,000rpm for 20 minutes at 4°C, washed twice with cold 70% alcohol and vacuum dried. The samples were denatured by addition of 10µl of formamide and heating at 96°C for 2 minutes prior to nucleotide sequencing. Sequence analysis The nucleotide sequences were analyzed by BLAST (http://www.ncbi.nlm.nih.gov/Blast) to determine their homology with other known sequences in the Genbank databases. Statistical analyses for determining inter/intraspecific sequence diversity was carried out using SeqState v.1.21(Muller 2005). Multiple sequence alignments to determine conserved sites (CS), variable sites (VS), parsimony informative sites (PIS), singleton sites (SS), and transition/transversion ratio and nucleotide pair frequencies viz. identical pair (ip), transitional pair (Ts) and transversional pair (Tv) were generated with MEGA 6.06 (Tamura et al.2011).

Compensatory bases changes in predicted secondary structure of ITS2 The secondary structure of ITS2 was predicted using Vienna RNA web servers (Vienna RNA package, version 2.1.9) at default energy and temperature (37ºC) with no manual modification and optimization in sequences. Compensatory base changes (CBCs), which are defined as base changes in a paired region of a primary RNA transcript when both nucleotides of a paired site mutate while the pairing itself is maintained (Gutell et al., 1994), were analyzed in the predicted secondary structure of ITS2 using CBC analyzer 1.1(Wolf et al. 2005). AFLP analysis AFLP analysis of DNA from the accessions of Chenopodium was carried out with LI-COR4300 DNA analyzer following the procedure described by Vos et al. (1995). Genomic DNA from each accession was digested with MseI and EcoRI and ligated with respective adaptors at 20ºC for 18 hours. Pre-amplification of the ligated fragments was performed using adaptor primers with one selective base at 3´ end. The pre-amplification products were subsequently used as templates for selective amplification. A total of 24 random primer combinations were used in selective amplification from a set of thirteen MseI and four IR700 labeled EcoRI primers (Table 2). The amplification products were size fractionated on 6.5% polyacrylamide gel using LI-COR 4300 automated DNA analyzer and the bands were scored as 0 (absent)/1 (present). The data matrix on presence or absence of AFLP bands was subjected to cluster analysis to generate Jaccard’s similarity co- efficient using NTSYS-pc v2.1 (Rohlf 2000). The polymorphic information content (PIC) of each AFLP marker was calculated by the formula PICi = 2fi(1 − fi) where fi is the frequency of the amplified allele (band present), and 1 − fi is the frequency of the null allele (Roldan-Ruiz 2000). The marker index (MI) was calculated according to the formula MI = PIC× EMR, wherein EMR (effective multiplex ratio) = nβ, in which “n “ represents total number of loci per fragment per primer and “β” represents the fraction of polymorphic loci. The resolving power (RP) of each primer was calculated as RP = ΣIb, in which Ib represents fragment informativeness. Phylogenetic analysis and age estimation Taxon sampling The dataset for phylogenetic analysis included nucleotide sequences of nuclear ITS region of Chenopodium species belonging to Chenopodieae I (including the Rhagodia and Einadia), Chenopodieae II (Chenopodiastrum murale lineage) and Chenopodieae III (Chenopodiastrum rubrum lineage) of subfamily Chenopodioideae. Taxa included in the sampling also included representatives from various tribes of Chenopodiodeae viz. Dysphanieae, Anserineae, Atripliceae, Axyrideae and the families Amaranthaceae, Polygonaceae, Nelumbonaceae. Age calibration

The estimated age of different accessions of C. quinoa and C. album were determined from nucleotide sequences of whole ITS sequence using the calibrated ages of Amaranthaceae (87-47 mya; Kadereit et al. 2003), Polygonaceae (90.7-125 mya; Schuster et al. 2013) and Nelumbonaceae (125-137 mya; Wikstrom et al. 2001) as reference markers. Representative taxa of Nelumbonaceae viz. Nelumbo lutea, Nelumbo nucifera, Nelumbo pentapetala) were used as the out group. BEAST analyses The data set for BEAST analysis comprised of 184 sequences of the ITS region including 165 sequences retrieved from Genbank databases and 19 sequences from the accessions of Chenopodium investigated in the present study. The sequences were aligned using MEGA 6.06 software. The output file of the alignment matrix was loaded on BEAUti v1.8.0 in nexus format for setting model parameters for BEAST. The ‘HKY substitution model’ with ‘estimated’ base frequencies and ‘gamma+ invariant’ distributed rate variation among sites, ‘SRD06’ model with 2 partitions: position (1+2),3 with unlinked substitution rate parameters and unlinked rate heterogeneity across codon position and the ‘Clock’ model with log normal relaxed clock were used for data analysis. “Yule tree prior” was used to construct the tree with the ucld.mean adjusted to a uniform prior of 10-0.000001 to reflect reasonable substitution rates per site. The output file generated with BEAUti for 100 million generations was loaded in BEAST v1.8.0 for generating the time-measured phylogenetic tree. The maximum credibility tree was generated from the output file of BEAST using Tree Annotator v1.8.0 (beast.bio.ed.ac.uk/tree annotator) with a burn-in of 25%. Posterior probability values of 1.00 to 0.90, 0.89 to 0.70 and 0.69 to 0.50 indicated strong, moderate and weak clade support respectively. Results PCR amplification of ITS and its sequence analysis PCR with primer pair ITS5-ITS4 successfully amplified the nuclear ITS region from all the accessions of Chenopodium investigated in the present study. The amplicons generated with DNA template from each accession showed an apparent molecular mass of 0.7 kb. The length of ITS1, 5.8S and ITS2 ranged from 263 to 270, 169 to 172 and 229 to 248 bases, respectively. The average G+C% for ITS1, 5.8S and ITS2 regions was 54.5, 51.90 and 60.1, respectively. BLASTn analysis of the nucleotide sequences of entire internal transcribed spacer region, showed 88-99% homology with the ITS of other species of Chenopodium available in the database. All sequences have been deposited in GenBank (Table 1). A comparative analysis of the interspecific sequence divergence in ITS1, ITS2 and 5.8S regions amongst the 19 accessions of Chenopodium revealed highest sequence divergence of 10.15% in ITS2 (Table 3). The number of indels (including gaps) recorded in ITS1, 5.8S and ITS2 regions of the internal transcribed spacer region were 14, 4 and 28, respectively. Sequence analysis revealed 18.55%, 13.70% and 2.34% parsimony informative sites in ITS2, ITS1 and 5.8S regions, respectively. With an R value of 1.02, ITS1 showed a higher ratio of transition to transversion than ITS2 which had an R value of 0.55. While the ITS1, 5.8S and ITS2 regions of accessions belonging to C. album, respectively showed 7.42%, 3.45% and 14.95% intraspecific sequence diversity those accessions belonging to C. quinoa showed 5.89%, 1.05% and 3.48% sequence diversity respectively (Table 3). Clustal multiple alignment of the sequences revealed the presence of 24 SNPs in ITS1 and 18 SNPs in ITS2 which could discriminate between C. quinoa and C.

album (Table 4a, b). The 50% majority-rule consensus tree constructed from alignment matrix of ITS region of the 19 accessions of chenopods investigated in the present study as well as the sequences available in the genebank databases revealed clustering of the accessions into six broad groups (Fig. 1). Species belonging to section Blitum viz. C. bonus-henricus, C. californicum, C. capitatum, C. foliosum formed a single cluster (cluster I). While five accessions of C. album viz. EC- 359451, EC-359447, IC-341700, IC-22517, IC-447575 grouped into one cluster (cluster II) along with sequences bearing accession nos. FN561549 (C. album), HE577468 (C. iljinii), FN561556 (C. giganteum), HM005835 (C. murale) and HE577413 (C. gigantospermum), other three accessions of C. album viz. IC-341704, IC-411824 and IC-411825 clustered together with sequences from eleven accessions of C. quinoa (cluster III). Cluster IV comprised of sequences from C. leptophyllum, C. pallescens, C. standleyanum, C. nevadense, C. pallidicaule, C. cycloides, C. desertorum, C. atrovirens, C. petiolare, C. incanum, C. dessicatum, C. subglabrum, C. fremontii, C. pratericola, C. hians, C. neomaxicanum and C. watsonii. While C. coronopus, C.hybridum, C. rubrum, C. urbicum of section Pseudoblitum and C. glaucum of section Glauca formed fifth cluster, sequences from species of section Dysphania viz. C. graveolans, C. ambrosioides and C. schraderianum formed the sixth cluster (Fig. 1). RNA secondary structure prediction The predicted RNA secondary structures of ITS2 for the nineteen accessions of Chenopodium investigated in the present study showed four common helices comprising of helix III, a U–U mismatch in helix II, conserved motif AAA between helix II and III and an UGGGU/UGGU/GGU motif near the apex of helix III (Fig. 2). While the secondary structure of ITS2 of six accessions of C. quinoa viz. EC-507738, EC-507740, EC-507741, EC-507748, EC-5077391 and EC-5077401 showed additional small loops between helix II and III, helix III and IV, and helix IV and I, the additional loop between helix III and IV was not detected in four accessions viz. EC-507739, EC-507742, EC-507744 and EC-507747 of this species. Further, the secondary structure of ITS2 of two accessions of C. album viz. IC-447575 and NIC-22517 showed an additional branched loop on the 5’ side of the Y-shaped helix III (Fig. 2). While the predicted secondary structure of consensus ITS2 sequence of C. album and C. quinoa revealed additional loops between helix II-III and helix IV-I, the sequences from C. quinoa showed an additional loop between helix III-IV. Compensatory base change (CBC) analysis in the predicted RNA secondary structures of ITS2 of six accessions of Chenopodium, representing RNA secondary structures of ITS2 of C. quinoa and C. album, did not reveal any compensatory base changes between EC-507740 and EC507747and between IC-411824 and EC-359451. However, we could detect 3 compensatory base changes in the predicted RNA secondary structures of ITS2 between IC-411824 on one hand and the accessions IC-447575 and IC-341704 on the other. Amplified fragment length polymorphism Out of 24 random primer combinations used in selective amplification for AFLP analysis, eight primer combinations generated best polymorphic profiles (Fig. 3). The eight primer pairs generated a total of 373 bands out of which

291 bands (78.01%) were polymorphic and 82 bands (21.99%), were monomorphic. The highest number of polymorphic bands was generated by primer pair E- ACG+M-CAG. The highest and lowest PIC values of 0.35 and 0.23 were observed for the profiles generated with primer pairs E-ACG+ M-CTGC and E-ACT+ M-CTAG, respectively. The resolving power of the selected eight primer pairs ranged from 0.42 for the primer pair E-AGG+M-CAT to 0.52 for primer pair E- ACG+M-CTGC. The effective multiplex ratio (EMR) for the amplicons generated with different primer combinations ranged from 19.84 for the primer pair E- AGC+M-CAA to 42.67 for the primer pair E-ACG+M-CAG. For determining utility of the marker system we calculated the marker index (MI) for all primer combinations. The MI value ranged from 5.35 for the primer combination E-AGC+M-CAA to 10.67 for the primer combination E-ACG+M-CAG (Table 5). The 2 highest correlation with r value of 0.7725 at P0.01 was observed between PIC and RP. The concatenated UPGMA dendrogram generated from the combined scoring profiles of all eight primer combinations resolved the accessions into two clades. While the accessions IC-341700, IC-447575, EC-359451 and EC-359447, all of which are hexaploid C. album, formed a single clade, the accessions EC-507744, EC-507741, EC-507742, EC-507738, EC-5077402, EC-5077401, EC-507748, EC-507739, EC-507747 all of which are hexaploid C. quinoa as well as IC-411825, IC-411824,which are tetraploid and have been reported as C. album, formed the other clade. The accession IC341704, which is a hexaploid species of C. album, emerged as a separate group independent of the other two clades (Fig. 4). Phylogeny and evolutionary divergence The phylogenetic tree inferred using maximum likelihood from 184 nucleotide sequences of nuclear ITS region representing species belonging to Chenopodiaceae, Amaranthaceae, Polygonaceae and Nelumbonaceae clustered into ten broad clusters within which species of the genus Chenopodium were distributed in 5 clades viz. Chenopodieae I, Chenopodieae II, Chenopodieae III, Dysphanieae, and Anserineae (Fig. 5). While clade IV comprised of the tribe Anserineae that included Blitum californicum, B. capitatum, B. virgatum, Monolepis nuttaliana, Spinacea oleracea and Chenopodium foliosum with strong clade value of 0.91, clade V was formed by the representative taxa of tribe Axyrideae along with three species belonging to genus Krascheninnikovia viz. K. ceratoides, K. eversmanniana, K. lanata with strong clade support value of 0.98. Clade VI comprised of species belonging to the tribe Dysphanieae viz. Dysphania ambrosioides, D. multifida, D. cristata, D. pumilio, D. graveolens, D. aristata, Chenopodium ambrosioides, C. botrys and C. schraderianum with clade support value of 0.86. While species belonging to Chenopodieae II (Chenopodiastrum murale lineage) viz. C. murale, C. coronopus and C. hybridum formed clade VII, clade VIII comprised of species belonging to Chenopodieae III (Chenopodiastrum rubrum lineage) viz. C. rubrum, C. ambigum, C. glaucum and Oxybasis urbica. Clade IX comprised of the tribe Atripliceae represented by species belonging to the genus Atriplex viz. A. asiatica, A. rosea, A. suberecta, A. lentiformis, A. watsonii, A. peruviana, A. phyllostegia, A. patagonica, A. cinerea, A. amnicola and A. prostrate with clade support of 0.94. Clade X was an assemblage of species belonging to Chenopodieae I including the genera Rhagodia and Einadia with a posterior probability value of 0.53. The representative taxa of the family Amaranthaceae viz. Amaranthus blitoides, A. californicus, A. lividus, A. palmeri, A. standleyanus, A. tuberculatus along with Beta vulgaris formed clade III with clade support value of 0.91. The representative

taxa belonging to the genera Fagopyrum and Polygonum of the family Polygonaceae emerged as clade II with a clade value of 0.99. The tree was rooted to Nelumbo nucifera of nelumbonaceae (clade I). Discussion All the accessions of Chenopodium studied in the present investigation had yellow flowers, alternate leaf arrangement, obtuse leaf base, lenticular seeds positioned vertically in the flower and sunken pollen. Variations were, however, observed in leaf colour, leaf shape, leaf margins, type of pollen grains, colour and texture of seed coat and morphology of seed edges (Devi and Chrungoo 2015). While the accessions IC-411824 and IC-411825 were tetraploid with 2n=4x=36, all other accessions belonging to C. album were hexaploid with 2n=6x=54. All the accessions of C. quinoa had a chromosome number of 2n=4x=36 (unpublished data of the authors). While C. quinoa (2n =4x = 36) is reported as a tetraploid of putative allopolyploid origin (Wilson 1980), C. album is known as a complex of diploid (2n=18), tetraploid (2n=36) or hexaploid (2n=54) cytotypes with endopolyploidy and autopolyploidy as the origin of polyploidy (Kolano et al. 2008). Our results on the extent of sequence variations in the ITS region indicate ITS1 to be more conserved than ITS2. This is in contrast with the observations of Singh (2010), who has reported a higher percentage of conserved residues in ITS2 than that of ITS1. Our results are, however, in agreement with Alice and Campbell (1999), who have reported a higher mean pair-wise divergence of sequences in ITS2 than in ITS1 in Rubus and Dalibarda. The nucleotide sequences of whole ITS of different accessions of Chenopods examined in the present study revealed lesser parsimony informative sites than the previous report of Singh (2010) on 12 different species of Chenopodium and Rana et al. (2011) on Chenopodium album complex. A significant feature of ITS1 and ITS2 spacer region was the ability to discriminate accessions belonging to C. quinoa and C. album. Even though Joshi (1991) had suggested the Himalayan chenopod (C. album) to be an assemblage of more than one species, Gangopadhyay et al. (2002) and Bhargava et al. (2006) have proposed it to be an assemblage of heteromorphic and heterocytotic (2x, 4x, 6x) forms. Our results also suggest a higher intraspecific genetic diversity in C. album than that in C. quinoa. Analysis of the predicted RNA secondary structures of ITS2 of the nineteen accessions of Chenopodium investigated in the present study revealed a typical four helical structure in all accessions. A significant feature of the analysis was the similarity in the secondary structure of ITS2 between IC-341704, IC-411824, EC- 507739, EC-507742 and EC-507744 all of which had green coloured leaves. Absence of any compensatory base changes in the secondary structure of ITS2 between IC-411824 and EC-359451 indicates that the two accessions presumably belong to the same species. Existence of CBC between IC-411824 on one hand and two accessions of C. album viz. IC-447575 and IC-341704 on the other is indicative of taxonomic differences between IC-411824 on one hand and IC-447575 and IC-341704 on the other. Whereas all the accessions of C. album had rhombic shaped leaves with an acute apex and dentate margins, the accession IC-341704 had lanceolate leaves with an obtuse apex and entire margin. The morphological and genetic variations exhibited by the accession IC-341704 calls for further investigation into the taxonomic identity of this hexaploid Chenopod. Muller et al. (2007) have suggested a 93% probability of two sequences to belonging to different species if they show any compensatory base changes in the predicted secondary structures of their ITS2 but only a 76% probability of they being of the

same species if they do not show any CBC in the predicted secondary structures of their ITS2. Since the 76% probability of being the same species in case of absence of CBC is lower than the 93% probability to be different species when there is CBCs and the secondary structure of ITS2 of IC-411824 is similar to the secondary structure of ITS of other accessions belonging to C. quinoa, we suggest that the accession IC-411824 belongs to C. quinoa rather than C. album. This suggestion is also supported by the similarity in the chromosome number of IC-411824 with other accessions of C. quinoa. The phylogenetic tree generated from the combined AFLP scoring profiles of all primer combinations resolved the accessions into two clades. While four hexaploid (2n=6x=54) C. album formed a single clade, 9 tetraploid (2n=4x=36) accessions belonging to C. quinoa clustered together into a single clade with three sub- groups. The accessions IC-411825, IC-411824,which are tetraploid and have been reported as C. album, clustered together with the tetraploid C. quinoa. Similar results on clustering of different accessions of Chenopodium , on the basis of RAPD and DAMD markers have been reported by Rana et al. (2010). Here too the accessions clustered together on the basis of their ploidy level. The higher EMR and MI for primer pair E-ACG+M-CAG reveals the higher efficiency of this primer set in divulging the genetic diversity of the collection. The accessions IC-411824 and IC-411825 showed the same ITS and AFLP profiles as other accessions of C. quinoa, thereby indicating the closeness of these accessions C. quinoa. The variations exhibited by IC341704 calls for further investigation on the taxonomic identity of this hexaploid species. Our observations are also supported by the time-measured phylogenetic tree that clearly revealed IC-411824 and IC-411825 as components of the clade comprised of accessions belonging to C. quinoa. Anabalon-Rodiguez and Thomet-Isla (2009) were able to correlate geographic distribution, grain color, panicle color and phenology of C. quinoa with AFLP based marker fragments. Their results clustered the accessions into three groups wherein Group-I comprised of 8 local accessions from Northern Chile having yellow to brown grains, yellow but compact to intermediate density panicle, agglomerated form and precocity, Group-II comprised of highland accessions of later phenology, yellow to red coloured grains, compact and amarantiform panicle from precordillera sector and group III included the species C. album and C. ambrosioides which were denominated as outgroup controls. While the morphological analysis of the Andean cultivars placed them as an independent Group (Group-II), the AFLP data integrated the Andean cultivars with Group-I, indicating the existence of similarity in the genetic material of accessions collected from the region. This result is consistent with the existence of common ancestral genes in the crop. On the basis of sequence variations in ITS and chloroplast trnL-F regions, Fuentes-Bazan et al. (2012a) have reported five lineages comprising of the tribes Chenopodieae I, Chenopodieae II, Chenopodieae III, Anserineae and Dysphanieae within sub-family Chenopodioideae. The evolutionary relationship reconstructed in the present study confirms five independent well supported lineages of the sub-family Chenopodioideae. The ITS and AFLP profiles observed in the present study indicate that the accessions of C. album constitute heteromorphs of the same species rather than a heterogenous assemblage of taxa as suggested by Rana et al. (2011). The results also establish C. album as a sister clade of C. quinoa within the tribe Chenopodieae I. Even though Muller & Borsch (2005) have suggested a monophyletic evolution of Chenopodiaceae and Amaranthaceae families on the basis of variations in chloroplast matK/ trnK sequences, nesting of Amaranthaceae

within sub-family Chenopodioideae, as observed in the present study, indicates a paraphyletic evolution of family Chenopodiaceae. This observation is in conformity with many others who have also reported nesting of Amaranthaceae within Chenopodiaceae (Manhart and Rettig 1994; Downie et al. 1997) as well as Fuentes-Bazan et al. (2012a,b) who classified Chenopodium sensu lato as paraphyletic. Our results suggesting a monophyletic evolution of Chenopodieae I are in conformity with those of Fuentes-Bazan et al.(2012b) who have suggested a monophyletic evolution for Chenopodium sensu strict. Our results indicate that the Himalayan chenopods evolved 10.3-5.9 mya, which is much younger than the reported crown age of Chenopodieae I. This compares well with the age of tetraploidization in Chenopodium suggested by Jarvis et al (2017). Acknowledgments: Financial support received from Department of Biotechnology, Govt. of India vide Grant no. BT/PR-8953/BCE/08/533/2007 and Grant no BT/04/NE/2009 under the Biotech Hub programme is gratefully acknowledged. RJD gratefully acknowledges the receipt of financial support from Department of Science & Technology, Govt. of India in the form of a research fellowship under the INSPIRE Conflict of Interest: Nikhil K. Chrungoo declares that he has no conflict of interest in this manuscript. Rajkumari Jashmi Devi declares that he has no conflict of interest in this manuscript Shailendra Goel declares that he has no conflict of interest in this manuscript. Kamal Das declares that he has no conflict of interest in this manuscript. References Alice L. A. and Campbel C. S. 1999 Phylogeny of Rubus (Rosaceae) Based on nuclear ribosomal DNA internal transcribed spacer region sequences. Amer. J. Bot. 86, 81-97.

Anabalon-Rodiguez L. and Thomet-Isla M. 2009 Comparative analysis of genetic and morphologic diversity among quinoa accessions (Chenopodium quinoa Willd.) of the South of Chile and highland accessions. J. Plant Breed. & Crop. Sci. 1, 210-216.

Bhargava A., Shukla S. and Ohri D. 2006 Karyotypic studies on some cultivated and wild species of Chenopodium (Chenopodiaceae). Genet. Resour. Crop Evol. 53, 1309-1320.

Devi R. J. and Chrungoo N. K. 2015 Species relationships in Chenopodium quinoa and Chenopodium album on the basis of morphology and SDS-PAGE profiles of soluble seed proteins. J. Appl. Biol. & Biotech. 3, 29-33.

Downie S., Katz-Downie D. and Cho K. 1997 Relationships in the Caryophyllales as suggested by phylogenetic analyses of partial chloroplast DNA ORF2280 homolog sequences. Am. J. Bot. 84, 253-273. 11

Fuentes-Bazan S., Mansion G. and Borsch T. 2012a Towards a species level tree of the globally diverse genus Chenopodium (Chenopodiaceae). Mol. Phylogenet. Evol. 62, 359–374.

Fuentes-Bazan S., Uotila P. and Borsch T. 2012b A novel phylogeny-based generic classification for Chenopodium sensu lato, and a tribal rearrangement of Chenopodioideae (Chenopodiaceae). Willdenowia 42, 5-24.

Gangopadhyay G., Das S. and Mukerjee K. K. 2002 Speciation in Chenopodium in west Bengal, India. Genet. Resour. Crop Evol. 49, 503-510.

Gutell R.R., Larsen N. and Woese C.R. 1994 Lessons from an evolving ribosomal-RNA - 16S and 23S ribosomal-RNA structures from a comparative perspective. Microbiol Rev. 58, 10–26

Jarvis D. E., Yung S. H, Damien J. L., Sandra M. S., Bo L., Theo J. A. B., Hajime O., Katsuhiko M., Craig T. M., Noha S., Najeh M. K, Ryan R. R., Aaron R. S, Nadine D., Berin A. B., Yong H. W., Ge G., Elio G. W. M. S., Xiujie G., Afaque A. M, Sónia N., Al-Babili S., Christoph G., Ute R., Christian J., Kevin M., Stefan T. A., Takashi G., Linden C. G. van der, Eibertus N. L., Eric N., Peter J. M. and Mark T. 2017 The genome of Chenopodium quinoa. Nature 542, 307-312.

Jarvis D.E., Kopp O.R., Jellen E.N., Mallory M. A., Pattee J., Bonifacio A., Coleman C. E., Stevens M. R., Fairbanks D. J. and Maughan P. J. 2008 Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.). J. Genet. 87, 39–51

Joshi B. D. 1991 Genetic resources of leaf and grain Amaranthus and Chenopod. In: Biodiversity (ed. M. S. Swaminathan and S. Jana), pp. 121-134, Macmillan India Ltd, Madras.

Kadereit G., Borsch T., Weising K. and Freitag H. 2003 Phylogeny of Amaranthaceae and Chenopodiaceae and the evolution of C4 photosynthesis. Int. J. Plant Sci. 164, 959-986.

Kolano B., Plucienniczak A., Kwasniewski M. and Maluszynska J. 2008 Chromosomal localization of a novel repetitive sequence in the Chenopodium quinoa genome. J. Appl. Genet. 49, 313-320.

Kolano B., McCann J., Orzechowska M., Siwinska D., Temsch E. and Weiss-Schneeweiss H. 2016. Molecular and cytogenetic evidence for an allotetraploid origin of Chenopodium quinoa and C. berlandieri (Amaranthaceae). Mol. Phylogenet. Evol. 100:109–123.

Kurashige N. S. and Agrawal A. A. 2005. Phenotypic plasticity to light competition and herbivory in Chenopodium album(Chenopodiaceae). Am. J. Bot. 92, 21–26.

La Duke J. and Crawford D. J. 1979 Character compatibility and phyletic relationships in several closely related species of chenopodium of the Western United States. Taxon 28, 307–314.

Manhart J. R. and Rettig J. H. 1994 Gene sequence data. In: Caryophyllales, Springer Berlin Heidelberg, pp 235-246.

Mehra P. and Malik C. 1963 Cytology of some Indian Chenopodiaceae. Caryologia 16, 67-84.

Mukherjee K. K. 1986 A comparative study of two cytotypes of Chenopodium album in West Bengal, India. Can. J. Bot. 64, 754-759.

Müller K. 2005 SeqState: primer design and sequence statistics for phylogenetic DNA datasets. Appl. Bioinformatics 4, 65–69.

Müller K. and Borsch T. 2005 Phylogenetics of Amaranthaceae based on matK/trnK sequence data: evidence from parsimony, likelihood, and Bayesian analyses. Ann. Missouri Bot. Gard. 92, 66-102.

Muller T., Philippi N., Dandekar, Schltz J. and Wolf M. 2007 Distinguishing Species. RNA 13, 1469-1472.

Murray M. G. and Thompson W. F. 1980 Rapid isolation of high molecular weight plant DNA. Nucl. Acids Res. 8, 4321-4325.

Palomino G., Hernandez L.T. and Torres E.D. 2008. Nuclear genome size and chromosome analysis in Chenopodium quinoa and C-berlandieri subsp nuttalliae. Euphytica 164:221–230

Rahiminejad M. R. and Gornall R. J. 2004 Flavonoid evidence for allopolyploidy in the Chenopodium album aggregate (Amaranthaceae). Plant. Syst. Evol. 246, 77–87.

Rana T. S. Narzary D. and Ohri D. 2010 Genetic diversity and relationships among some wild and cultivated species of Chenopodium L. (Amaranthaceae) using RAPD and DAMD methods. Curr. Sci. 98, 840-846.

Rana T. S., Narzary D. and Ohri D. 2011 Molecular differentiation of Chenopodium album complex and some related species using ISSR proﬁles and ITS sequences. Gene 495, 29-35.

Risi J. and Galwey N. W. 1984 The Chenopodium grains of the Andes: Inca crops for modern agriculture, Ann. Appl. Biol. 10, 145–216.

Rohlf F. J. 2000 NTSYS-pc: numerical taxonomy and multivariate analysis system, version 2.10f. Exeter Publishing, New York.

Roldan-Ruiz I., Dendauw J., Bockstaele E. V., Depicker A. and Loose M. D. 2000 AFLP markers reveal high polymorphic rates in rye grasses (Lolium spp.). Mol. Breed. 6, 125–134.

Ruas P. M., Bonifacio A., Ruas C. F. Fairbanks D. J. and Andersen W. R. 1999 Genetic relationships among 19 accessions of six species of Chenopodium L. by random amplified polymorphic DNA fragments (RAPD). Euphytica 105, 25–32.

Schuster T. M., Setaro S. D. and Kron K. A. 2013 Age estimates for the buckwheat family Polygonaceae based on sequence data calibrated by fossils and with a focus on the Amphi-Pacific Muehlenbeckia. PloS One 8, e61261.

Singh S. 2010 Understanding the weedy Chenopodium complex in the north central states. Dissertation, University of Illinois at Urbana-Champaign.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. and Kumar S. 2011 MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 28, 2731-2739.

Vos P. Hogers R., Bleeker R., Reijans M., Van de Lee T., Hornes M., Frijters A., Pot J., Peleman J., Kuiper M. and Zabeau M. 1995 AFLP: a new technique for DNA fingerprinting. Nuc. Acids Res. 23, 4407-4414.

Walsh B. M., Adhikary D. Maughan P. J., Emshwiller E., Jellen E. N. 2015 Chenopodium polyploidy inferences from salt overly Sensitive 1 ( sos1 ) data. Am. Jour. Bot. 102, 533 – 543.

White T. J., Bruns T. D., Lee S. and Taylor J. 1990 Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes. In: PCR Protocols: a Guide to Methods and Applications (ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky, T. J. White), pp 315–322 Academic Press, New York.

Wikström, Niklas, Savolainen V. and Chase M. W. 2001 Evolution of the angiosperms: calibrating the family tree. Proc. R. Soc. Lond. Ser. B. Biol. Sci. 268, 2211- 2220.

Wilson H.D. 1980 Artificial Hybridization among Species of Chenopodium sect. Chenopodium, Sys. Bot. 5, 253-263.

Wilson H. and Manhart J. 1993 Crop/weed gene flow: Chenopodium quinoa Willd. and C. berlandieri Moq. Theor. Appl. Genet. 86, 642-648.

Wolf M., Achtziger M., Schultz J., Dandekar T.and Mueller T. 2005 Homology modeling revealed more than 20,000 rRNA internal transcribed spacer 2 (ITS2) secondary structures. RNA 11, 1616–1623.

Received 22 June 2018; revised 30 September 2018; accepted 2 November 2018

Fig. 1 50% majority-rule consensus tree based on the alignment matrix of ITS sequences for inferring relationship between thirty eight species of the genus Chenopodium. Numbers at each node represent bootstrap values. Numbers prefixed with IC/ EC/NIC at each branch indicate the accession number of Chenopodium species studied in the present investigation. Tree rooted on Fagopyrum esculentum

Fig. 2 Graphical visualization (2D-plot) of the secondary structure of ITS2 spacer region of accessions belonging to C. quinoa (1: EC-507738, 2: EC-507739, 3: EC-507740, 4: EC-507741, 5: EC-507742, 6: EC-507744, 7: EC-507747, 8: EC-507748, 9: EC-5077391, 10: EC-5077401, 11: EC-5077402) and C. album (12: EC-359451, 13: EC-359447, 14: IC-341700, 15: IC-341704, 16: IC-411824, 17: IC-411825, 18: IC-447575, and 19: NIC-22517). 20: consensus structure of C. quinoa, 21: consensus structure of C. album. The four common helices of conserved structure of ITS2 are numbered I-IV. U-U mismatched in helix II, AAA motif in between helices II-III and UGGU motif in helix III are highlighted.

Fig. 3 Amplified fragment length polymorphism (AFLP) profiles of genomic DNA from different accessions of Chenopodium studied in the present investigation using primer pairs: (1) EAGC+MCAA, (2) EACT+MGAC, (3) EAGG+MGAC, (4) EACG+MCAG, (5) EAGG+MCAT, (6) EACT+MCTG, (7) EACG+MCTGC, (8)EACT+MCGAT. For each primer combination the sequence of accessions in the lanes is IC-341704, IC-341700, IC-447575, EC-359447, EC-359451, EC- 507744, EC-507742, IC-411825, IC-411824, EC-507738, EC-5077391, EC-5077401, EC-5077402, EC-507741, EC-507747, EC-507748. Marker: IR-700 labeled 100 base pair ladder.

Fig. 4 Concatenated UPGMA dendrogram generated using NTSYS-pc v2.1 from the AFLP scoring profiles of 8 primer combinations. The numbers prefixed with EC/IC/NIC at the tip of the branch indicate the accession numbers of the plants. Figures at branch points represent bootstrap values.

Fig. 5 Maximum credibility tree generated with BEAST v1.8.0 from the nucleotide sequence data of nuclear internal transcribed spacer (ITS) region of species belonging to Nelumbonaceae (I), Polygonaceae (II), Amaranthaceae (III), Anserineae (IV), Axyrideae (V), Dysphanieae (VI), Chenopodieae II or Ch. murale lineage (VII)), Chenopodieae III or Ch. rubrum lineage (VIII), Atripliceae (IX), and Chenopodieae I (X). Branch length corresponds to age of the species. Roman figure in the tree indicates clade number.

Table 1 Accessions of Chenopodium quinoa and Chenopodium album studied in our present investigation.

Accession No. Species Source GenBank accession number of nr ITS sequence IC341704 C. album NBPGRa KC577850 NIC22517 C. album NBPGR KC577845 IC341700 C. album NBPGR KC577846 IC447575 C. album Chaura, Kinnaur, Himachal Pradesh, India KC577847 EC359447 C. album NBPGR KC577849 EC359451 C. album NBPGR KC577848 IC411825 C. album Thakma, Leh Jammu and Kashmir, India. KC577851 IC411824 C. album Thakma, Leh Jammu and Kashmir, India. KC577836 EC507744 C. quinoa NBPGR KC577834 EC507742 C. quinoa Chile KC577835 EC507738 C. quinoa Peru KC577837 EC507739 C. quinoa Ecuador KC577838 EC5077391 C. quinoa NBPGR KC577839 EC507740 C. quinoa USA KC577840 EC5077401 C. quinoa USA KC577841 EC5077402 C. quinoa USA KC577842 EC507741 C. quinoa USA KC577843 EC507747 C. quinoa USA KF709219 EC507748 C. quinoa Argentina KC577844 a National Bureau of Plant Genetic Resources, Shimla station, India.

Table 2 Primers used in selective amplification of AFLP analysis. EcoRI primers are infrared 700 dye labeled.

MseI primers (5´-3´) EcoRI primers (5´-3´) 1. GATGAGTCCTGAGTAA CAA A1. GACTGCGTACCAATTC ACG 2. GATGAGTCCTGAGTAA CAC A2. GACTGCGTACCAATTC ACT 3. GATGAGTCCTGAGTAA CAG A3. GACTGCGTACCAATTC AGC 4. GATGAGTCCTGAGTAA CAT A4. GACTGCGTACCAATTC AGG 5. GATGAGTCCTGAGTAA CTA 6. GATGAGTCCTGAGTAA CTC 7. GATGAGTCCTGAGTAA CTG 8. GATGAGTCCTGAGTAA CTT 9. GATGAGTCCTGAGTAA CAGT 10. GATGAGTCCTGAGTAA CTAG 11. GATGAGTCCTGAGTAA CTGC 12. GATGAGTCCTGAGTAA CGAT 13. GATGAGTCCTGAGTAA CACG

Table 3 Indels, sequence statistics and nucleotide pair frequencies analysis of sequences representing nuclear ITS region of different accessions belonging to C. quinoa and 8 C. album. CS: Conserved sites, VS: Variable sites, PIS: Parsimony informative sites, SS: Singleton sites

Sequence Nucleotide pair Sl.no Taxa statistics frequencies

Length Mean indels Seque G+C CS (%) VS (%) PIS (%) SS (%) CpG II Si Sv R (Si/Sv)

range length nce (%) (100 (identic (transit (transv

(nt) diverg coverage) al pairs) ional ersiona

ence pairs) l pairs)

ITS1

1 C. album 266- 268 4 7.42 54.1 223 46 31 15 (5.58) 56 248.00 9.00 10.00 0.89

269 (82.89) (17.10) (11.52)

2 C. quinoa 263- 268 11 5.89 54.8 198 72 7 (2.59) 64 60 249.00 7.00 8.00 0.84

270 (73.33) (26.67) (23.70)

3 C. album 263- 268 14 9.97 54.5 168 103 37 65 32/0 244.00 11.00 11.00 1.02

and C. 270 (62.22) (38.14) (13.70) (24.07)

quinoa 5.8 S

1 C. album 172- 172 0 3.45 51.70 149 23 1 (0.58) 22 58 166 2 4 0.69

172 (86.63) (13.37) (12.79)

2 C. quinoa 169- 171 4 1.05 52.00 164 8 (4.68) 1 (0.58) 7 (4.09) 62 169.00 1.00 0.00 3.90

172 (95.90)

3 C. album 169- 171 4 2.32 51.90 145 27 4 (2.34) 23 50 168.00 2.00 2.00 1.25

and C. 172 (84.80) (15.79) (13.45)

quinoa

ITS2

4 C. album 233- 237 15 14.95 59.1 141 97 39 58 26 200.00 13.00 23.00 0.56

248 (56.85) (39.11) (15.72) (23.39)

5 C. quinoa 229- 237 16 3.48 60.9 204 35 7 27 56 224.00 3.00 5.00 0.65

269 (75.84) (13.01) (2.60) (10.04)

6 C. album 229- 235 28 10.15 60.1 122 117 46 70 20 210.00 8.00 15.00 0.55

and C. 248 (49.19) (47.18) (18.55) (28.23)

quinoa

Table 4 SNPs discriminating between C. quinoa and C. album detected in the present investigation from the sequences of nuclear ITS1(a) and ITS2 (b) regions. (a) Accession. No. Species SNPs position

P´28 P´110,140,219 P´115,130,156, P´125 , 248 P´132 P´134, 236 P´139, 179, P´253 P´144,170 P´147,153 161, 242 212,213, 246 IC341704 C. album T A C T A C G T G T NIC22517 C. album T T T A A C A G A C IC341700 C. album T T T A A C A G A C IC447575 C. album T T T A A C A G A C EC359447 C. album T T T A A C A G A C EC359451 C. album C T T A A C A G A C IC411824 C. album C A C T C T G T G T IC411825 C. album C A C T C T G T G T EC507738 C. quinoa C A C T C T G T G T EC507739 C. quinoa C A C T C T G T G T EC507739 C. quinoa C A C T C T G T G T EC507740 C. quinoa C A C T C T G T G T EC5077401 C. quinoa C A C T C T G T G T EC5077402 C. quinoa C A C T C T G T G T EC507741 C. quinoa C A C T C T G T G T EC507742 C. quinoa C A C T C T G T G T EC507744 C. quinoa C A C T C T G T G T EC507747 C. quinoa C A C T C A G T G T EC507748 C. quinoa C A C T C T G T G T

(b) Accession. No. Species SNPs position

P´434 P´471, 483,605 P´482 P´550 P´553,626,658, P´575,671 P´576 P´578, 619,672 P´648, 663 P´611 IC341704 C. album C G C T G G T G T T NIC22517 C. album C C G C T A G T A T IC341700 C. album C C G C T A G T A T IC447575 C. album C C G C G A G T A T EC359447 C. album C C G T T A G T A C EC359451 C. album C C G C T A G T A T IC411824 C. album T G C T C G T G T C IC411825 C. album T G C T C G T G T C EC507738 C. quinoa T G C T C G T G T C EC507739 C. quinoa T G C T C G T G T C EC5077391 C. quinoa T G C T C G T G T C EC507740 C. quinoa T G C T C G T G T C EC5077401 C. quinoa T G C T C G T G T C EC5077402 C. quinoa T G C T C G T G T C EC507741 C. quinoa T G C T C G T G T C EC507742 C. quinoa T G C T C G T G T C EC507744 C. quinoa T G C T C G T G T C EC507747 C. quinoa T G C T C G T G T C EC507748 C. quinoa T G C T C G T G T C

Table 5 Band size, total number of band, monomorphic bands (%), polymorphic bands (%), PIC (Polymorphic information content), Rp (Resolving power), EMR (Effective multiplex ratio), and MI (Marker Index) scored from AFLP banding analysis in different accessions of Chenopodium investigated in the present study.

Sl. Primer Total Band size in Total Monomorphic Polymorphic PIC Rp EMR MI no combinations individua range band bands (%) bands (%) l scored

1 E-AGC+ M- 16 91.4-513.0 48 17 31 0.27 0.44 19.84 5.35 CAA (35.42) (64.58) 2 E-ACT+ M- 16 116.0-561.0 47 14 33 0.32 0.51 23.17 7.34 GAC (29.79) (70.21) 3 E-AGG+ M- 16 114.0-588.0 51 10 41 0.29 0.43 32.96 9.56 GAC (19.61) (80.39)

4 E-ACG+ M- 16 79.0-570.0 54 6 48 0.26 0.43 42.67 10.67 CAG (11.11) (88.89) 5 E-AGG+ M- 16 100.0-459.0 55 12 43 0.26 0.42 33.62 8.74 CAT (21.82) (78.18)

6 E-ACT+ M- 16 110.0-446.0 34 7 27 0.29 0.48 21.44 6.21 CTAG (20.59) (79.41)

7 E-ACT+ M- 16 85.0-576.0 43 8 35 0.23 0.43 28.49 6.55 CTAG (18.60) (81.40)

8 E-ACG+ M- 16 85.0-629.0 41 8 33 0.35 0.52 26.56 9.29 CTGC (19.51) (80.49)

TOTAL 373 82 291 (21.99%) (78.01%)