Transcriptome Profiling of the Cardiac Neural Crest Reveals a Critical Role for Mafb
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. - 
												
												RBP-J Signaling − Cells Through Notch Novel IRF8-Controlled
Sca-1+Lin−CD117− Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch −RBP-J Signaling This information is current as of September 25, 2021. Xingxia Liu, Shaoda Ren, Chaozhuo Ge, Kai Cheng, Martin Zenke, Armand Keating and Robert C. H. Zhao J Immunol 2015; 194:4298-4308; Prepublished online 30 March 2015; doi: 10.4049/jimmunol.1402641 Downloaded from http://www.jimmunol.org/content/194/9/4298 Supplementary http://www.jimmunol.org/content/suppl/2015/03/28/jimmunol.140264 http://www.jimmunol.org/ Material 1.DCSupplemental References This article cites 59 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/194/9/4298.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Sca-1+Lin2CD1172 Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch–RBP-J Signaling Xingxia Liu,*,1 Shaoda Ren,*,1 Chaozhuo Ge,* Kai Cheng,* Martin Zenke,† Armand Keating,‡,x and Robert C. - 
												
												Activated Peripheral-Blood-Derived Mononuclear Cells
Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays. - 
												
												Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L. - 
												
												Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. - 
												
												A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. - 
												
												¬LACZ-REPORTER MAPPING of Dlx5/6 EXPRESSION AND
Received: 26 December 2019 Revised: 10 May 2020 Accepted: 11 May 2020 DOI: 10.1002/cne.24952 RESEARCH ARTICLE LacZ-reporter mapping of Dlx5/6 expression and genoarchitectural analysis of the postnatal mouse prethalamus Luis Puelles1 | Carmen Diaz2 | Thorsten Stühmer3 | José L. Ferran1 | Margaret Martínez-de la Torre1 | John L. R. Rubenstein3 1Department of Human Anatomy and Psychobiology and IMIB-Arrixaca Institute, Abstract University of Murcia, Murcia, Spain We present here a thorough and complete analysis of mouse P0-P140 prethalamic 2 Department of Medical Sciences, School of histogenetic subdivisions and corresponding nuclear derivatives, in the context of Medicine and Institute for Research in Neurological Disabilities, University of Castilla- local tract landmarks. The study used as fundamental material brains from a transgenic La Mancha, Albacete, Spain mouse line that expresses LacZ under the control of an intragenic enhancer of Dlx5 3Nina Ireland Laboratory of Developmental Neurobiology, Department of Psychiatry, and Dlx6 (Dlx5/6-LacZ). Subtle shadings of LacZ signal, jointly with pan-DLX immu- UCSF Medical School, San Francisco, noreaction, and several other ancillary protein or RNA markers, including Calb2 and California Nkx2.2 ISH (for the prethalamic eminence, and derivatives of the rostral zona limitans Correspondence shell domain, respectively) were mapped across the prethalamus. The resulting model Luis Puelles, Department of Human Anatomy and Psychobiology, School of Medicine, of the prethalamic region postulates tetrapartite rostrocaudal and dorsoventral subdi- University of Murcia, Murcia 30071, Spain. visions, as well as a tripartite radial stratification, each cell population showing a char- Email: [email protected] acteristic molecular profile. Some novel nuclei are proposed, and some instances of Carmen Díaz, Department of Medical potential tangential cell migration were noted. - 
												
												Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). - 
												
												Clinical Utility of Recently Identified Diagnostic, Prognostic, And
Modern Pathology (2017) 30, 1338–1366 1338 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 Clinical utility of recently identified diagnostic, prognostic, and predictive molecular biomarkers in mature B-cell neoplasms Arantza Onaindia1, L Jeffrey Medeiros2 and Keyur P Patel2 1Instituto de Investigacion Marques de Valdecilla (IDIVAL)/Hospital Universitario Marques de Valdecilla, Santander, Spain and 2Department of Hematopathology, MD Anderson Cancer Center, Houston, TX, USA Genomic profiling studies have provided new insights into the pathogenesis of mature B-cell neoplasms and have identified markers with prognostic impact. Recurrent mutations in tumor-suppressor genes (TP53, BIRC3, ATM), and common signaling pathways, such as the B-cell receptor (CD79A, CD79B, CARD11, TCF3, ID3), Toll- like receptor (MYD88), NOTCH (NOTCH1/2), nuclear factor-κB, and mitogen activated kinase signaling, have been identified in B-cell neoplasms. Chronic lymphocytic leukemia/small lymphocytic lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Burkitt lymphoma, Waldenström macroglobulinemia, hairy cell leukemia, and marginal zone lymphomas of splenic, nodal, and extranodal types represent examples of B-cell neoplasms in which novel molecular biomarkers have been discovered in recent years. In addition, ongoing retrospective correlative and prospective outcome studies have resulted in an enhanced understanding of the clinical utility of novel biomarkers. This progress is reflected in the 2016 update of the World Health Organization classification of lymphoid neoplasms, which lists as many as 41 mature B-cell neoplasms (including provisional categories). Consequently, molecular genetic studies are increasingly being applied for the clinical workup of many of these neoplasms. In this review, we focus on the diagnostic, prognostic, and/or therapeutic utility of molecular biomarkers in mature B-cell neoplasms. - 
												
												The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells. - 
												
												SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line - 
												
												The YAP/HIF-1Α/Mir-182/EGR2 Axis Is Implicated in Asthma Severity
Zhou et al. Cell Biosci (2021) 11:84 https://doi.org/10.1186/s13578-021-00560-1 Cell & Bioscience RESEARCH Open Access The YAP/HIF-1α/miR-182/EGR2 axis is implicated in asthma severity through the control of Th17 cell diferentiation Jing Zhou1, Ning Zhang2, Wei Zhang1, Caiju Lu1 and Fei Xu1* Abstract Background: Asthma is a heterogeneous chronic infammatory disease of the airway, involving reversible airfow limitation and airway remodeling. T helper 17 (Th17) cells play an important role in the pathogenesis of allergic asthma. However, there is limited understanding of the signaling pathways controlling Th17 cell diferentiation in asthma. The aim of this study was to investigate if the Yes-associated protein (YAP)/hypoxia inducible factor-1α (HIF-1α)/microRNA-182 (miR-182)/early growth response 2 (EGR2) axis is involved in mediating Th17 cell diferentia- tion and disease severity in asthma. Methods: The study included 29 pediatric patients with asthma, 22 healthy volunteers, ovalbumin-induced murine asthma models, and mouse naive CD4+ T cells. The subpopulation of Th17 cells was examined by fow cytometry. The levels of interleukin-17A were determined by enzyme linked immunosorbent assay. Chromatin immunoprecipitation- quantitative polymerase chain reaction assays and dual-luciferase reporter gene assays were performed to examine interactions between HIF-1α and miR-182, and between miR-182 and EGR2. Results: YAP, HIF-1α, and miR-182 were upregulated but EGR2 was downregulated in human and mouse peripheral blood mononuclear cells from the asthma group. Abundant expression of YAP and HIF-1α promoted miR-182 expres- sion and then inhibited EGR2, a target of miR-182, thus enhancing Th17 diferentiation and deteriorating asthma and lipid metabolism dysfunction.