Developmental Biology 327 (2009) 590–602

Contents lists available at ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/developmentalbiology

Genomes & Developmental Control Identification of an ancient Bmp4 mesoderm enhancer located 46 kb from the promoter

Kelly J. Chandler, Ronald L. Chandler, Douglas P. Mortlock ⁎

Department of Molecular Physiology and Biophysics, Center for Human Genetics Research, Vanderbilt University School of Medicine, 1175 MRBIV, 2215 Garland Avenue, Nashville, TN 37232, USA article info abstract

Article history: Bone morphogenetic protein 4 (Bmp4) is a multi-functional, developmentally regulated gene that is essential Received for publication 1 August 2008 for mouse development, as most Bmp4-null mouse embyros die at the onset of gastrulation and fail to Revised 19 December 2008 develop mesoderm. Little is known about the transcriptional regulation of Bmp4. To identify potential long- Accepted 22 December 2008 range cis-regulatory elements that direct its complex spatiotemporal expression patterns, we surveyed the Available online 3 January 2009 mouse Bmp4 locus using two overlapping bacterial artificial chromosome (BAC) reporter transgenes. Our findings indicate that tissue-specific cis-regulatory elements reside greater than 28 kb 5′ or 3′ to the mouse Keywords: fi Bmp4 Bmp4 transcription unit. In addition, comparative analyses identi ed three noncoding evolutionarily Mesoderm conserved regions (ECRs), spaced around the gene and conserved from mammals to fish, that are maintained Enhancer in a syntenic group across vertebrates. Deletion of one of these conserved sequences (ECR2) from a BAC Bacterial artificial chromosome transgene revealed a tissue-specific requirement for ECR2 in driving Bmp4 expression in extraembryonic and Cis-regulation embryonic mesoderm. Furthermore, a 467 bp mouse sequence containing ECR2 reproducibly directed lacZ minigene expression in mesoderm. Taken together, this shows that an ancient, mesoderm-specific cis- regulatory element resides nearly 50 kb 5′ to mouse Bmp4. © 2008 Elsevier Inc. All rights reserved.

Introduction dpp locus, with some elements clearly residing greater than 30 kb from the promoter (Blackman et al., 1991; Huang et al., 1993; Jackson Bone morphogenetic protein 4 (Bmp4) is a member of the and Hoffmann, 1994; Masucci et al., 1990; Spencer et al., 1982; St transforming growth factor-beta (Tgfβ) superfamily of secreted Johnston et al., 1990). Several vertebrate BMP family genes, including signaling ligands. The vertebrate Bmp4 and Bmp2 genes are close Bmp5, Gdf6 and Bmp2, contain similar arrangements of modular paralogs that are highly similar to the fly dpp gene (Wozney et al., enhancers spread over large distances (Chandler et al., 2007a; DiLeone 1988). Given the high amino acid identity between the mature et al., 2000; DiLeone et al., 1998; Mortlock et al., 2003). peptides of human Bmp4 and Bmp2 (92%) and Bmp4 and Dpp (76%) Bmp4 regulates multiple developmental processes, including (Kingsley, 1994), it has been proposed that these proteins could dorsoventral patterning, gastrulation, and organogenesis (Hogan, function interchangeably. In fact, Dpp protein can induce subcuta- 1996; Kingsley, 1994) and it displays numerous precise spatiotemporal neous bone formation in rats similarly to Bmp4 and Bmp2 (Sampath expression patterns throughout development (Jones et al., 1991). The et al., 1993). Likewise, expression of the human Bmp4 mature majority of Bmp4-null mouse embryos die early in development, signaling peptide in fly embryos, in place of Dpp, is sufficient to mostly at the onset of gastrulation. Interestingly, these embryos fail to rescue dorsal–ventral patterning defects of dpp null embryos (Padgett form mesoderm (Winnier et al., 1995). Some Bmp4−/− embryos that et al., 1993). Therefore, despite approximately 990 million years of persist beyond this stage exhibit defects in mesoderm development, cumulative evolution (Ureta-Vidal et al., 2003) the signaling functions including abnormalities in extraembryonic and embryonic mesoderm of the mature Bmp4 and Dpp ligands appear strongly maintained. tissues such as blood islands, allantois, ventral–lateral mesoderm, and Due to the evolutionary history of dpp and Bmp4 and the ability of primordial germ cells (Lawson et al., 1999; Winnier et al., 1995). their protein products to function interchangeably, their transcrip- Further evidence for the importance of BMP signaling in mesoderm tional regulation may also share similarities. The fly dpp gene is was shown by germline deletion of the BMP receptors, Bmpr1a or expressed in distinct embryonic regions and imaginal discs. Muta- Bmpr2, or deletion of several downstream Smad factors, which generally tional and transgenic reporter analysis of dpp has revealed multiple result in gastrulation failure, lack of mesoderm, and/or profound defects tissue-specific transcriptional enhancers distributed throughout the in mesoderm tissues (Beppu et al., 2000; Chang et al., 1999; Lechleider et al., 2001; Mishina et al., 1995; Nomura and Li, 1998; Tremblay et al., ⁎ Corresponding author. Fax: +1 615 343 8619. 2001; Waldrip et al., 1998; Weinstein et al., 1998). Taken together, these E-mail address: [email protected] (D.P. Mortlock). data clearly demonstrate that BMP signaling is critical for formation and

0012-1606/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2008.12.033 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 591 development of extraembryonic and embryonic mesoderm and that were obtained from the UCSC Genome Browser (http://genome.ucsc. Bmp4 is a key ligand driving these events. Bmp4 is also important for edu)(Kent et al., 2002) May 2004 (hg17) human assembly and many aspects of organogenesis. For example, homozygous knockout October 2004 pufferfish assembly. Genomic sequences corresponding embryos that survive beyond gastrulation have delayed liver bud to mouse Bmp4 BACs RP23-26C16 and RP23-145J23 were obtained morphogenesis (Rossi et al., 2001). Bmp4 haploinsufficiency can result from the UCSC Genome Browser May 2004 mouse (mm5) assembly. in abnormalities in skeletal structures, kidney, seminiferous tubules, To detect conserved elements, we first used PipMaker (Schwartz the urogenital system, eyes, craniofacial tissues, and pulmonary et al., 2000) to generate BLASTZ alignments with the mouse BAC vascular smooth muscle (Dunn et al., 1997; Frank et al., 2005; Miyazaki sequences and human and pufferfish genomic sequences. Repetitive et al., 2003). Conditional inactivation of Bmp4 in the developing heart elements were pre-masked using RepeatMasker (Smit et al., 1996– revealed its requirement for atrioventricular septation (Jiao et al., 2003). 2004). VISTA analysis (Mayor et al., 2000) was also used to confirm Likewise, conditional gene inactivation studies demonstrated roles for that the identified ECRs were in the same order and orientation in Bmp4 in outflow tract septation and branchial arch artery remodeling each species. ECR coordinates were defined from the BLASTZ (Liu et al., 2004), digit patterning (Selever et al., 2004) and distal lung alignments, as generated by PipMaker. epithelium (Eblaghie et al., 2006). Since Bmp4 is expressed in a dynamic, spatiotemporal-specific Multi-sequence alignment and binding motif identification manner throughout development, it is necessary to assay Bmp4 cis- regulation in vivo to obtain a complete view of these events. A 2.4 kb The orthologous sequences to mouse ECR2 in the pufferfish, fragment encompassing the major Bmp4 promoter has been tested in zebrafish, chicken and human genomes were identified using transgenic mice (Feng et al., 2002; Zhang et al., 2002) and its activity the UCSC Genome Browser BLAT homology search tool (Kent, 2002). compared to expression of the Bmp4lacZneo knock-in reporter mouse 1–1.5 kb of sequence spanning the ECR2 homology were obtained (Lawson et al., 1999). While this fragment drove expression similar to from each species. Coordinates of the sequences were: pufferfish (T. endogenous Bmp4 in tooth ameloblasts and developing hair follicle rubripes), chrUn:37920604–37921683, Oct. 2004 (fr2) assembly; shafts and matrix, it failed to drive expression in many sites of normal zebrafish, chr17:46094888–46096397, July 2007 (danRer5) assembly; Bmp4 expression such as bone, nasal cartilage, limb buds, ear, and chicken, chr5:61171046–61171964, May 2006 (galGal3) assembly; brain (Feng et al., 2002). This suggests most regulatory elements human, chr14:53534849–53536267, Mar. 2006 (hg18) assembly. The critical for Bmp4 expression may be located in more distant 5′,3′ or MULAN multiple-sequence alignment tool (http://mulan.dcode.org/) intronic regions. This hypothesis is strengthened by the increasing (Ovcharenko et al., 2005a) was used to align these to a 668-nucleotide evidence that developmentally regulated genes, including BMP genes, mouse genomic sequence containing ECR2 (corresponding to the often maintain complex, widespread cis-regulatory landscapes longest sequence tested for enhancer activity; chr14:47056018– (Chandler et al., 2007a; DiLeone et al., 1998; Lettice et al., 2003; 47056685, July 2007 (mm9) assembly). To find predicted transcription Mortlock et al., 2003; Nobrega et al., 2003; Wunderle et al., 1998). factor binding sites, the weight matrix-based MATCH tool and the To further explore the cis-regulatory landscape of Bmp4,weassayed TRANSFAC® Professional database (release 11.4) of transcription the transcriptional activity of large, partially overlapping segments of factors were utilized (Kel et al., 2003; Matys et al., 2003) via the DNA in mice using BAC reporter transgenes. We focused our efforts on BIOBASE online portal (https://portal.biobase-international.com). The analyzing the sufficiency of Bmp4 BAC reporter transgenes to direct lacZ matrix profile used was “vertebrate non-redundant minSUM” and the expression during prenatal mouse development. By utilizing two Bmp4 cutoff selection for the profile used was “minimize false positives” BACs that extend far 5′ or 3′ while still containing the transcription unit, (minFP). we show Bmp4 maintains a complex cis-regulatory landscape, with numerous enhancers located over 28 kb 5′ or 3′ to Bmp4. BAC reporter transgenes Recent studies indicate that comparative sequence analysis between divergent species can be a powerful way to detect ancient Mouse Bmp4 BACs RPCI23-26C16 (227,097 bp) and RPCI23-145J23 cis-regulatory elements. However, inter-mammal genomic compar- (227,220 bp) were obtained from Children's Hospital Oakland Research isons tend to detect large numbers of conserved noncoding elements. Institute (CHORI) (http://bacpac.chori.org/) and verified using PCR and In contrast, mammal-fish genome comparisons identify many fewer restriction enzyme digestion using standard procedures. conserved noncoding elements, but these are enriched near genes involved in developmental control (Woolfe et al., 2005) and have high Insertion of GFP-IRES-β-geo cassette into Bmp4 BACs likelihood to function as embryonically regulated enhancers in transgenic assays (Ahituv et al., 2004; Boffelli et al., 2004; Nobrega BAC vectors were modified using homologous recombination in et al., 2003; Pennacchio et al., 2006; Woolfe et al., 2005). Such E. coli EL250 cells essentially as described (Lee et al., 2001; Mortlock enhancers may be likely to control critical aspects of developmentally et al., 2003) to contain a GFP-IRES-β-geo-SV40pA cassette inserted into patterned gene expression that are shared across vertebrates. For the ATG start codon of the Bmp4 transcription unit (IRES = internal example, in one screen, approximately 1/3 of mammal/fish conserved ribosome entry site; β-geo = lacZ:Neo fusion cassette). To generate the elements had enhancer activity in e11.5 mouse embryos (Pennacchio GFP-IRES-β-geo cassette, a PacI site was inserted was inserted et al., 2006). We therefore used mammal/fish comparisons to identify upstream of the Kozak consensus of EGFP in pEGFP-C1 (kind gift of several ancient conserved DNA elements flanking Bmp4. Tests of these David Piston) and a PacI/XhoI fragment containing the EGFP open elements revealed a functional enhancer located 46 kb upstream of reading frame was inserted into pIBG-FTET (Chandler et al., 2007b)to Bmp4. This element controls Bmp4 expression in early mesoderm, create pGIBGFTET. For simplicity, BAC RP23-145J23 and BAC RP23- which is likely related to the mesodermal defects of Bmp4 null mice. 26C16 were renamed 5′ BAC and 3′ BAC respectively. To generate the recombination cassette, 50 bp homology arms were designed to flank Materials and methods the Bmp4 start codon. Homology arm sequences (relative to Bmp4 coding strand) were as follows: for the 5′ arm, 5′-GTGTTTATTTATTCTT- Bmp4 genomic sequences from human, mouse and pufferfish TAACCTTCCACCCCAACCCCCTCCCCAGAGACACC-3′; for the 3′ arm, 5′- (Takifugu rubripes) and comparative sequence analysis ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCT- 3′. Homology arm oligos were inserted into pGIBGFTET, and the final To perform comparative analyses, genomic sequences containing targeting cassette was gel purified. 250 ng of cassette were used for human or pufferfish BMP4 and extending to adjacent 5′ and 3′ genes electroporation into recombination-competent EL250 cells containing 592 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602

Table 1 Oligos used for BAC engineering galK deletion oligos DelmECR1-F GGTTTGCCCATTTGGCCAAAGTCACATTCCTTTCGGTGCAAATGCCACCTGTTGACAATTAATCATCGGCA DelmECR1-R GGCTTGGTTTCCCTTGCAAGGCTCTTGCCAGCACCTGTGAGCCCTCACCCTCAGCACTGTCCTGCTCCTT DelmECR2-F CAGCCCTGAGTAACAGAGAGAGGGAAGGCAGGAGGTTAAACCAAACTGTTCCTGTTGACAATTAATCATCGGCA DelmECR2-R GAGAAGCTCTGCTTCCCAAAGTTCCCTACATAATCCTTACCGTGAAGAGCTCAGCACTGTCCTGCTCCTT DelmECR3-F TAAAGCAAAGACCTGTGCTGTGAGCCAGAGCTGATCACAAGATCAAAGCCCCTGTTGACAATTAATCATCGGCA DelmECR3-R ACATTATTCAACAAACAAAACACTCTCATTCTAAAAGAGAAAGAAAAAAATCAGCACTGTCCTGCTCCTT galK replacement oligos RepmECR1-F GGTTTGCCCATTTGGCCAAAGTCACATTCCTTTCGGTGCAAATGCTGCCAGGGTGAGGGCTCACAGGTGCTGGCAAGAGCCTTGCAAGGGAAACCAAGCC RepmECR1-R GGCTTGGTTTCCCTTGCAAGGCTCTTGCCAGCACCTGTGAGCCCTCACCCTGGCAGCATTTGCACCGAAAGGAATGTGACTTTGGCCAAATGGGCAAACC RepmECR2-F CAGCCCTGAGTAACAGAGAGAGGGAAGGCAGGAGGTTAAACCAAACTGTTGCTCTTCACGGTAAGGATTATGTAGGGAACTTTGGGAAGCAGAGCTTCTC RepmECR2-R GAGAAGCTCTGCTTCCCAAAGTTCCCTACATAATCCTTACCGTGAAGAGCAACAGTTTGGTTTAACCTCCTGCCTTCCCTCTCTCTGTTACTCAGGGCTG RepmECR3-F TAAAGCAAAGACCTGTGCTGTGAGCCAGAGCTGATCACAAGATCAAAGCCTTTTTTTCTTTCTCTTTTAGAATGAGAGTGTTTTGTTTGTTGAATAATGT RepmECR3-R ACATTATTCAACAAACAAAACACTCTCATTCTAAAAGAGAAAGAAAAAAAGGCTTTGATCTTGTGATCAGCTCTGGCTCACAGCACAGGTCTTTGCTTTA

either the 5′ or 3′ BAC. BAC recombination and removal of the cing. ECR-βglobinlacZ plasmids were digested with XhoI, XmnI, and tetracycline resistance gene by FLPe excision were performed as SacII or XhoI and NgoMIV to isolate the insert from the vector. ECR- previously described (Chandler et al., 2007b). Finally, pulsed-field and Hsp68lacZ plasmids were digested with XhoI and NgoMIV to isolate fingerprint gel analysis and sequencing across the recombination sites the inserts. Insert fragments were purified for pronuclear injection were performed to verify the final BACs were intact and the GFP-IRES- using standard techniques. β-geo-SV40pA cassette was inserted correctly. Generation of transgenic mice Creation of ECR-deletion BACs BAC DNA constructs were used for pronuclear injections as The 5′ and 3′ Bmp4 GFPlacZ-BACs were modified to generate previously described in detail (Chandler et al., 2007a). Briefly, BAC three deletion BACs using galK counterselection methods (Chandler DNA was purified using cesium chloride density centrifugation and et al., 2007b; Warming et al., 2005). Primers were designed to quantified by comparisons to DNA mass standards on pulsed field gels. include homology arms to target each ECR and annealing ends to Purified uncut BACs or ECR-βglobinlacZ and ECR-Hsp68lacZ cassettes amplify the galK cassette from pGalK (Warming et al., 2005)as were used for pronuclear injections of C57BL/6J×DBA/2J F1 hybrid shown in Table 1. This allowed seamless deletion of each ECR by embryos. DNA samples from yolk sacs or tail biopsies were used to replacement and subsequent removal of galK. The galK targeting verify transgenic embryos or weanlings by PCR. cassettes were amplified by PCR and 250 ng of each were transformed into SW102 cells containing either the 5′ or 3′ Bmp4 Bmp4lacZneo mice GFPlacZ-BAC. Recombinant colonies were selected on M63 minimal media galactose plates at 32 °C for 3–4 days and restreaked onto Bmp4lacZneo mice (Lawson et al., 1999) were generously provided MacConkey agar indicator plates with 1% galactose to verify galK- by Dr. Mark de Caestecker. positive clones. Correct ECR replacement was verified by restriction digest with MluI, which cuts the galK cassette. To delete galK Mouse genotyping cassettes, 100-mer “replacement” oligos were used that contain the two 50-bp homology arms flanking the ECR. These were transformed Bmp4 BAC transgenic mice were identified by PCR. A triplex PCR into recombination-competent galK-positive BAC cells and the cells was performed on tail DNA samples using primers to detect Neo (β- were plated onto M63 minimal media plates containing 0.2% 2- geo cassette), CamR (BAC vector), and Gdf5 (as genomic DNA control, deoxy-galactose (2-DOG) at 32 °C for 3 days to select for loss of galK present in both transgenic and non-transgenic mice). Primer (Warming et al., 2005). Surviving clones were verified to have sequences are as follows: for Neo,5′-TTTCCATGTTGCCACTCGC-3′ and deleted galK as described above. 5′-AACGGCTTGCCGTTCAGCA-3′;forCamR,5′-GGAAATCGTCGTGG- TATTCACTC-3′ and 5′-TCCCAATGGCATCGTAAAGAAC-3′; for Gdf5,5′- ECR-βglobinlacZ and ECR2-Hsp68lacZ constructs TGGCACATCCAGAGACTAC-3′ and 5′-TGGAGAGAAATGAAGAGGC-3′. PCR cycling conditions were: 94 °C 5 min+98 °C 5 s initial denature ECR minigene constructs were made as follows. Mouse ECR step; 94 °C 30 s/60 °C 1 min/72 °C 40 s (10 cycles); 94 °C 30 s/56 °C sequences were amplified using Expand High Fidelity Plus PCR kit 1 min/72 °C 40 s (25 cycles); 72 °C 5 min final step. Bmp4 BAC (Roche). ECR1 and ECR2 were amplified using 5′ GFPlacZ-BAC DNA as transgene copy numbers and integrity in founder animals and template, while ECR3 was amplified using 3′ GFPlacZ-BAC DNA. progeny were analyzed as previously described in detail (Chandler Primers for ECR1 and ECR3 were: ECR1, 5′-TTAATGGGCCACAT- et al., 2007a). Bmp4lacZneo mice were genotyped by visualizing lacZ CATCCT-3′ and 5′-CCAGAGACGGATGGCTAATG-3′;ECR3,5′- expression in hair follicles of X-gal stained tail snips (see below). CCGGGCCACTTACAAATAAAA-3′ and 5′-GGAGGAACACAAAGA- TAAGGTCA-3′. For ECR2, the following primers were used: for ECR2-220 bp, 5′-AACTGTGTCTCTTCAAAACTGACATT-3′ and Table 2 5′-CCTCTTCTCCCAGCCCTCT-3′; for ECR2-467 bp, 5′-GAGTCTCCTTT- Identity and mouse genome coordinates of noncoding evolutionarily conserved regions ′ ′ ′ CAGCCTTGC-3 and 5 -CCCTTCTGGGGATGAAAGTA-3 ;forECR2- Length Mouse/Fugu Coordinates 668 bp, 5′-TTCCACTTTGCTTCCCAAAC-3′ and 5′-GGGGATGAAAGTAG- (bp) % Identity (UCSC Genome Browser, CATCCTG-3′. PCR fragments were first subcloned into pGEM-Teasy Mouse, May 2004 Assembly) (Promega) then transferred into pBGZ40 (βglobinlacZ)(Maconochie ECR1 184 72% chr14: 47111379–47111562 et al., 1997)orpSfi-Hsp68lacZ (Chandler et al., 2007b). Clones having ECR2 134 81% chr14: 47056413–47056546 – inserts in the forward orientation were identified by direct sequen- ECR3 100 75% chr14: 46928837 46928936 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 593

Fig. 1. Ancient noncoding Bmp4 ECRs exhibit conserved arrangement in human, mouse and pufferfish. Shown are the positions and distances of each ECR relative to the Bmp4 5′ end in mouse, human and the pufferfish Fugu (Takifugu rubripes) (maps are not to scale). The order and orientation of each ECR relative to Bmp4 in mouse, human and Fugu are identical which suggests they have been maintained in a syntenic block. In contrast, the orientation of flanking genes shows their distinct arrangement in Fugu versus mammals.

Transgene expression, embryo processing and imaging pufferfish ECRs ranged from 75–81%, with ECR2 being the most highly conserved of the three. ECR1 and ECR2 are located 101 and 46 kb 5′ to X-gal staining of Bmp4 BAC transgenics and Bmp4lacZneo embryos Bmp4, while ECR3 is approximately 80 kb 3′ (Fig. 1). These sequences was performed exactly as described previously (Chandler et al., do not overlap known RNA transcripts, nor do they contain obvious 2007a). X-Gal stained embryos were cleared by staging through intact reading frames or homology to any known proteins or mRNAs increasing glycerol (15%, 30%, 50%, 70%, 90% glycerol with 1X (data not shown). phosphate-buffered saline (PBS) pH 7.4, then twice with 100% By using the UCSC Genome Browser BLAT search tool (Kent, 2002), glycerol). Each wash was performed at room temperature with we confirmed that each ECR is located in the same order and agitation until embryos sank. Digital images for whole mount orientation relative to Bmp4 in all three species (Fig. 1). The relative embryos and sections were recorded using an Olympus SZX-ILLD2- spacing was compressed in Fugu, consistent with its compact genome. 100 stereomicroscope and Olympus BX51 microscope. In both human and mouse, Bmp4 lies in a “gene desert” such that the adjacent protein-coding genes (Cdkn3 and Ddhd on 5′ and 3′ sides, Histology respectively) are separated from Bmp4 by several hundred kilobases. In the Fugu genome assembly, however, the orthologous Ddhd gene is X-Gal-stained embryos in 100% glycerol were staged through a located 5′ and the 3′ gene is Lbh, suggesting that rearrangement in series of glycerol/ethanol mixtures with increasing ethanol then flanking genes has occurred during vertebrate evolution. The repeated 30 min incubations in fresh 100% Citrisolv (Fisherbrand) arrangement of ECRs within the Bmp4 locus is therefore an ancient until embryos become very clear. Embryos were then incubated at 60 °C vertebrate feature. for 1 h in 50% paraffin (Paraplast Plus, McCormick Scientific)/50% Citrisolv, then in 100% paraffin overnight, then transferred to fresh 100% Expression of Bmp4-GFPlacZ-BAC transgenes suggests that multiple paraffin prior to embedding. 10 μm paraffin sections were counter- long-range enhancers are present within the BAC interval stained with either eosin or nuclear fast red (Vector Laboratories). We then employed a BAC-based strategy to test large segments Results of DNA containing Bmp4 for regulatory activity. Two overlapping BACs (referred to here as 5′ BAC and 3′ BAC for convenience) were Multiple noncoding evolutionarily conserved regions (ECRs) are selected such that both contained the Bmp4 transcription unit and present in a gene desert encompassing Bmp4 together spanned a 398 kb segment of mouse chromosome 14 (Fig. 2a). Homologous recombination was used to insert a GFP-IRESβgeo- We hypothesized that Bmp4 is controlled by numerous cis- SV40pA cassette into the Bmp4 ATG start codon in each BAC. This regulatory elements, many of which are distant from the promoter. cassette was designed to allow independent co-expression of the Comparative analysis can be an effective way to identify such GFP and lacZ (βgeo) reporters, while precluding expression of the elements, although inter-mammal sequence comparisons across mature Bmp4 peptide. The dual reporter cassette is functional as hundreds of kilobases tend to identify large numbers of ECRs of demonstrated by coexpression of both GFP and lacZ (Supplemental unknown significance (Nobrega et al., 2003). In contrast, mammal/fish Fig. 1). genome comparisons have proven highly sensitive at detecting Multiple founder mice were identified for both the 5′ and 3′ developmentally functional enhancers (Nobrega et al., 2003; Woolfe Bmp4 GFPlacZ-BAC transgenes, and used to establish breeding et al., 2005). We therefore utilized comparisons between mammals lines. When evaluating BAC transgenic mice for cis-regulatory and a fish genome, T. rubripes (Fugu pufferfish), to identify noncoding analyses, it is critical to confirm structural integrity of the transgene Bmp4 ECRs that are likely to be functional regulatory elements. For in the lines analyzed. We have previously reported a detailed convenience we focused on a region of approximately 398 kb centered analysis of transgene integrity and copy number analyses in the on mouse Bmp4. This region is spanned by various BAC clones that Bmp4 GFPlacZ-BAC transgenic lines described here (Chandler et al., contain no other known protein-coding genes. 2007a). This allowed us to identify multiple lines for each BAC that Using PipMaker (Schwartz et al., 2000), we identified three (1) expressed lacZ robustly, (2) were PCR-positive for a complete set noncoding ECRs in this region that are conserved in mouse and of transgene-specific markers across the BAC, and (3) carried pufferfish (Table 2.) The percent identity between the mouse and multiple copies of the BAC transgene, a characteristic that is highly 594 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 correlated with BAC integrity (Chandler et al., 2007a; Gong et al., each line, we collected transgenic embryos at three stages that largely 2003). span the onset and the completion of organogenesis (9.5, 12.5, Two and five lines meeting these criteria were generated for 5′ 15.5 dpc), and assayed them for lacZ activity. (For the 5′ Bmp4 GFP- Bmp4 GFP-lacZ-BAC and 3′ Bmp4 GFP-lacZ-BAC, respectively. From lacZ-BAC, a third founder transmitted the transgene only to a single K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 595

12.5 dpc embryo, data from which is included in Fig. 2a). X-gal staining At 15.5 dpc, lacZ expression was seen in the vertebral column, dura patterns were documented and compared to those of Bmp4lacZneo mater, ventral ribs, roof plate mesenchyme, umbilical artery, and embryos. While strength of lacZ expression varied among lines, we pulmonary arteries (Fig. 2c). These expression patterns were also have shown this was largely related to transgene copy number present in Bmp4lacZneo but not 5′ BAC transgenics (data not shown). (Chandler et al., 2007a). Therefore, several regulatory elements for expression patterns seen Since each BAC shared a common overlapping region of in 3′, but not 5′, BAC embryos are likely located in the ∼171 kb approximately 56 kb (Fig. 2a), we expected to see some patterns interval 3′ to Bmp4. of expression that were common to both BAC transgenes, indicative Interestingly, several sites where Bmp4 is endogenously expressed of enhancer elements in the overlapping domain. In addition, each were not recapitulated by either BAC. For example, neither BAC BAC contained approximately 171 kb of unique genomic sequence transgene drove expression in extraembryonic ectoderm (Lawson (Fig. 2a). Therefore, we expected each BAC transgene would also et al., 1999), eye, trachea (not shown), or anterior limb bud (Fig. 2b). direct an additional unique set of expression patterns, indicating These findings suggest additional Bmp4 regulatory elements exist long-range enhancers 5′ or 3′ to Bmp4. Indeed, each BAC drove a beyond the confines of the BAC intervals tested. distinct subset of endogenous Bmp4 expression patterns (listed in Fig. 2a) each of which was observed in at least two lines for each ECR2 is critical for expression of Bmp4 in posterior lateral BAC. Significantly, no patterns of ectopic BAC expression were plate mesoderm observed that clearly did not overlap an obvious Bmp4 domain. This suggested there were little or no position effect(s) impacting The conserved nature and synteny of the mammal/fish ECRs expression. The transgene-driven patterns at 9.5, 12.5, and 15.5 suggested they could be cis-regulatory elements controlling devel- were identical across multiple lines for each BAC. We therefore opmentally patterned Bmp4 expression. To test this, three separate analyzed expression in one representative line for each BAC (5′ GFP- deletion BAC constructs were engineered. Bacterial recombination IRESlacZ BAC line L1a and 3′ GFP-IRESlacZ BAC line L45a) at each and galK counterselection (Warming et al. 2005) were used to delete gestation day from 6.5–15.5 dpc to gain more detailed data. the core region of mouse/fish homology for each ECR without leaving Each Bmp4 BAC clearly directed some shared expression patterns. any exogenous sequence in place of the deletion. ECR1 and ECR2 were For example, each BAC directed lacZ expression in the genital tubercle, deleted separately from 5′ GFPlacZ-BAC to create individual deletion digit tips, dorsal root ganglia and whisker hair shafts (Figs. 2b, c). In constructs for each, while ECR3 was deleted from 3′ GFPlacZ-BAC. contrast, sometimes each BAC directed expression in the same organ, Breeding lines for each deletion BAC were established and transgenic but in different patterns; for example, both BACs directed expression embryos were generated and stained with X-Gal at 9.5, 12.5 and in the kidney at 15.5 dpc. However, the 5′ BAC directed expression in 15.5 dpc for comparison to full-length BAC reporter data. Analysis of both kidney mesenchyme and epithelial cells while the 3′ BAC multiple lines for ECR1 and ECR3 deletion BACs failed to reveal any directed expression solely in epithelium (Fig. 2c). This suggests that alterations in staining patterns as compared to undeleted BACs, nor separate cis-regulatory elements exist that control cell-type-specific was ectopic expression observed (data not shown), suggesting these kidney expression. are not obviously required for activating or repressing Bmp4 The 5′ Bmp4 BAC directed numerous sites of expression never seen expression at these stages. To test these for enhancer potential, we in any of the 3′ Bmp4 BAC lines, but were recapitulated by the Bmp4 lacZ also generated and analyzed transgenic lines carrying either ECR1 or knock-in. These include expression in posterior lateral plate mesoderm, ECR3 in the context of a βglobin promoter-LacZ minigene cassette foregut, and outflow tract of the developing heart at 9.5 dpc (Figs. 2b, c). (N=6 and N=4 lines, respectively). Neither of these constructs By 10.5 dpc in 5′ BAC line 1a, lacZ expression was detected in the showed any reproducible LacZ expression in mouse embryos from forebrain and in limb bud, both in the apical ectodermal ridge (AER) and 9.5–15.5 dpc. zone of polarizing activity (ZPA) (Fig. 2b). However, 3′ BAC age-matched For the ECR2 deletion BAC (Deletion 2), two lines (L7 and L8a) were embryos were devoid of these patterns. Later in development, the 5′ established. Both lines L7 and L8a had transgene insertions of more Bmp4 BAC drove expression in the distal epithelium of the branching than 20 copies as estimated by quantitative PCR (not shown), and each lung from 12.5 (data not shown) to 15.5 dpc (Fig. 2c), as well as in the also were positive for a set of BAC-specific markers as previously pelage hair follicles in a dramatic spotted pattern (Fig. 2b). In addition, described (Chandler et al., 2007a). Expression in heart and foregut the 5′ BAC alone directed expression in tooth, bladder, ventral pawpads, remained similar in 9.5 dpc 5′ GFPlacZ-BAC and Deletion 2 BAC L7 forebrain, bone, kidney mesenchyme, thymus, stomach and gut at embryos (Fig. 3a). However, Deletion 2 BAC L7 embryos showed no 15.5 dpc (Fig. 2c and Supplemental material). Taken together, these lacZ activity in 9.5 dpc posterior lateral plate mesoderm, whereas results suggest multiple cis-regulatory elements in the region between age-matched 5′ GFPlacZ-BAC and Bmp4lacZneo embryos clearly had −28 and −199 kb 5′ to Bmp4. reporter expression in this region (Fig. 3a). The selective loss of lateral Likewise, multiple lacZ expression patterns were found in the 3′ plate mesoderm expression in Deletion 2 embryos was more clear at GFPlacZ-BAC embryos that were never observed in 5′ GFPlacZ-BAC 10.5 dpc, when they retained expression in developing limbs and embryos. Reporter expression in 3′ BAC embryos was first noted at forebrain (Fig. 3a, arrowheads). Therefore, ECR2 seems critical for 10.5 dpc as thin stripes in a segmental pattern along the dorsal Bmp4 expression in lateral plate mesoderm at 9.5–10.5 dpc. region (Fig. 2b). By 12.5 dpc, expression was detected in the Although heart outflow tract expression was observed at craniofacial mesenchyme and proximal limb mesenchyme (Fig. 2b). 9.5 dpc in Deletion 2 BAC line L7, no expression in the heart

Fig. 2. Separate Bmp4 BAC transgenes direct multiple shared and unique sites of expression during embryonic development. (a) Diagram of the Bmp4 BAC clones in this study and lists of expression patterns specific to either clone or shared by both. Top: Schematic map of the two BACs used for lacZ reporter studies. Bmp4 is depicted on the minus strand (3′ end on left, 5′ on right) as per its UCSC genome browser orientation. GFP (green box) and lacZ (blue box) are inserted in exon 3. Below each BAC transgene are the anatomical sites where lacZ was expressed during selected timepoints (9.5, 12.5, or 15.5 dpc). A total of five and three lines were examined for the 3′ BAC and 5′ BAC, respectively. Listed below each anatomical site is the number of lines that exhibited lacZ expression. (b) Examples of X-gal stained embryos from the representative BAC lines 5′ BAC L1a and 3′ BAC L45a, as well as age-matched embryos from the Bmp4 lacZ knock-in line. Insets in 5′ BAC 9.5 and 10.5 dpc embryos show close ups of heart outflow tract and forelimb bud. (c) Localization of selected lacZ expression sites in 5′ and 3′ BAC lines. Panels g′,o′,p′ and q′ are whole mount images while the rest are sections. All are 15.5 dpc except g′ and h′, which are 9.5 dpc. Arrowheads indicate localized X-gal stain. (a′–h′): X-gal-stained embryos from 5′ BAC line L1a reveal expression in (a′) lung epithelia, (b′) kidney epithelia and mesenchyme, (c′) whisker hair shaft (hs) and dermal papilla (dp), (d′) gut mesenchyme, (e′) upper tooth dermal papilla (left), lower tooth dermal papilla (right), (f′) rib bones (rb), and (g′,h′) lateral plate mesoderm. (i′–q′): X-gal-stained embryos at 15.5 dpc from the 3′ BAC line L45a reveal expression in (i′) pulmonary artery in lung, (j′) kidney epithelium but not mesenchyme, (k′) whisker hair shaft but not dermal papilla, (l′) dura mater (dm), (m′) craniofacial mesenchyme (cm) and whisker hair shaft (wh), (n) roof palate mesenchyme (rp mes), (o′) vertebral column, where it is expressed in a segmented pattern along the vertebra (vc), (p′) ventral ribs (vr), and the (q′) umbilical artery (ua). br = brain; sc = spinal cord. 596 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602

Fig. 3. ECR2 is required for BAC-directed expression of lacZ in mesoderm. (a) X-gal stained 9.5 dpc 5′ GFPlacZ-BAC and Bmp4lacZneo embryos show expression in lateral plate mesoderm (arrowheads). In Deletion 2 BAC line L7 embryos the lateral plate mesoderm is ablated (middle panel). Both 5′ GFPlacZ-BAC and Deletion 2 BAC embryos show expression in outflow tract similar in pattern to that of Bmp4lacZneo embryos (arrows). (b) X-gal stained 10.5 dpc embryos from Deletion 2 BAC lines L7 and L8a dpc show a loss of lacZ expression in posterior mesoderm (arrows) and in outflow tract as compared to 5′ GFPlacZ-BAC embryos. Expression in forebrain, limb buds and inner ear is similar in Deletion 2 BAC and 5′ GFPlacZ-BAC embryos.

was observed at 10.5 dpc in lines L7 or L8a (Fig. 3b) despite 7.5 dpc. Similar to the 5′ GFPlacZ-BAC, the 467 bp ECR2-βglobinlacZ maintenance of this staining in 5′ GFPlacZ-BAC embryos. Therefore, transgene was sufficient to direct reporter expression in extraem- ECR2 may also be required for maintaining Bmp4 expression in bryonic mesoderm in 5/5 transgenic embryos at 7.5 dpc (Fig. 4c). heart beyond 9.5 dpc. However, 9/9 breeding transgenic lines generated from a 220 bp At earlier stages, Bmp4 is dynamically expressed in chorionic, ECR2-βglobinlacZ transgene failed to drive reporter expression in amnionic and allantoic bud portions of the extraembryonic mesoderm either extraembryonic mesoderm or lateral plate mesoderm at 7.5– and these were recapitulated by 5′ GFPlacZ-BAC and Bmp4lacZneo 8.5 dpc (data not shown). Therefore, although deletion of the embryos (not shown). At 7.5 dpc, Deletion 2 BAC embryos from both 220 bp sequence containing ECR2 from the BAC context resulted in lines were lacking lacZ expression in chorionic and amnionic partial ablation of extraembryonic mesoderm and complete loss of mesoderm, while expression in the allantoic bud was maintained lateral plate mesoderm expression, this sequence alone is not (not shown). sufficient to direct mesoderm expression. Other sequences con- tained in the 467 bp segment are therefore critical for full ECR2-containing sequences are sufficient to direct mesoderm expression mesodermal enhancer activity. in mouse Putative binding motifs for mesodermal factors in ECR2 We then tested ECR2-containing sequences for ability to direct mesoderm expression. Three ECR2-containing sequences of varying Enhancer elements often contain multiple binding sites that allow length (220, 467, and 668 bp; see Fig. 4a) were cloned into a lacZ a combination of transcription factors to bind the DNA and elicit or minigene vector containing a minimal βglobin promoter (Maconochie repress transcription of the target gene (Carey and Smale, 2000). To et al., 1997), and these constructs were used to generate transgenic search in the ECR2 region for putative factor binding motifs in mouse embryos or lines (Fig. 4b). Five and three transiently-generated TRANSFAC, the weight matrix-based MATCH tool was utilized (Kel transgenic 8.5 dpc embryos were obtained with the 668 bp and 467 bp et al., 2003; Matys et al., 2003). This analysis revealed numerous ECR2-βglobinlacZ constructs, respectively. Of these, 5/5 and 3/3 had potential binding motifs for vertebrate factors within the mouse lacZ expression in lateral plate mesoderm (Fig. 4b). This closely ECR2-containing sequences tested by deletion or minigene assays. To recapitulated expression directed by the 5′ GFPlacZ-BAC transgene filter these for factors of highest relevance to mesodermal regulation, (Fig. 4b). A separate construct containing the 668 bp sequence linked a gene expression data query was performed using the Mouse to an Hsp68 promoter-lacZ minigene also drove expression in lateral Genome Informatics database (http://www.informatics.jax.org/) plate mesoderm, showing that the ECR2 enhancer can function in the (Eppig et al., 2005; Hill et al., 2004) for transcription factor genes context of a different promoter (N=2/2 transgenic embryos, although expressed in embryonic or extraembryonic mesoderm during the one embryo was highly mosaic; Supplemental Fig. 2 and data not developmental window when these structures first appear (6.25– shown). To examine an earlier stage when Bmp4 is expressed in 8.0 dpc). The resulting list of genes (n=215) was compared to the extraembryonic mesoderm, we collected transgenic embryos at potential binding motifs identified as described above. Five K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 597

Fig. 4. ECR2 is sufficient to direct lacZ minigene expression in mesoderm. (a) Custom tracks on the UCSC Genome Browser (July 2007/mm8 assembly) illustrate the location of each ECR2-containing sequence that was tested for enhancer function in vivo. Shown is a segment of mouse chromosome 14 located approximately 46 kb 5′ to Bmp4 where ECR2 resides. Three fragments were PCR amplified and tested in vivo for enhancer activity: 220 bp (green bar), 467 bp (blue), and 668 bp (black). The 30-way MultiZ Alignment and Conservation track shows alignments from selected species to demonstrate extent of conservation across vertebrate groups. The 220 bp fragment contains most of a block of strong multi- vertebrate conservation (lod score=1296) as depicted by the PhastCons track, which denotes segments having statistically significant conservation based on the 30-way species alignment (Siepel et al., 2005). The 220 bp sequence was specifically deleted in the Deletion 2 BAC lines. The 467 bp fragment spans the main block of conservation and extends partly into flanking regions. The 668 bp fragment also includes an adjacent smaller block of conservation (PhastCons lod score of 22). (c, d) ECR2-containing fragments exhibit mesoderm enhancer activity in transient transgenic mouse embryos. (b) X-Gal-stained ECR2-βglobinlacZ transgenic embryos carrying either the 668 bp or the 467 bp construct exhibit lateral plate mesoderm expression (arrowheads) similar to that seen in 5′ GFPlacZ-BAC embryos at 8.5 dpc. (c) X-Gal-stained 467 bp-ECR2-βglobinlacZ transient transgenic embryos at 7.25–7.75 dpc show lacZ expression in extraembryonic mesoderm similar to that seen in 5′ GFPlacZ-BAC embryos. Anterior is to the left for all embryos in panel c. (d) Numbers of lacZ-positive embryos for the 220, 467 and 668 bp constructs are indicated, relative to the total number of transgenic embryos obtained. EEM: expression in extra-embryonic mesoderm at ∼7.5 dpc. LPM: expression in lateral plate mesoderm at 8.5 dpc. N.D.: not determined. mesodermal factors (Nfe2l1, Hand1, Zic3, Gata4, and Cdx1) had pre- Interestingly, this analysis predicted several multiple binding dicted binding motifs in the ECR2 region. Several of these factors are motifs for mesodermally-expressed factors in the core conserved known to be critical for mesodermal development (see Discussion). 220 bp element we originally identified by mouse/fish comparisons, 598 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 599 as well as motifs in the extended regions shared by both larger “molecular toolkit” players that have been co-opted during evolution fragments (467 bp, 668 bp). To visualize the extent of conservation in to have many context-dependent functions. mesoderm-specific binding motifs, binding sites were annotated on Comparative analyses were instrumental in our identification of the MULAN-generated alignment of the mouse 668 bp sequence to the ECR synteny amongst vertebrates. This finding substantiates the other vertebrates (Fig. 5). A total of 18, 11 and 6 predicted binding hypothesis that Bmp4 resides in a “stable gene desert” (Ovcharenko motifs for the mesodermal factors were found in the 668 bp, 467 bp, et al., 2005a). The rearrangement of adjacent genes in pufferfish and 220 bp segments respectively. The core 220 bp region of mammal/ further supports the conservation of the Bmp4 linkage to the ECRs fish homology contains a cluster of binding motifs for Nfe2l1, Zic3, described here and lends weight to their suggested functional Gata4, and Cdx1, several of which span highly conserved bases (Fig. 5). significance. Examination of Bmp4 flanking genes in the chick genome Interestingly, several predicted Hand1/e47 heterodimer motifs were assembly also suggests that Ddhd is the 3′ neighbor as in mammals, found in the region outside the 220 bp core but within the 467 bp while the 5′ genes are clearly different but still separated from Bmp4 sequence, suggesting these may be critical for enhancer activity. by a large intergenic region (not shown). Our transgenic evidence suggests that numerous cis-regulatory Discussion elements are located within either BAC clone. However, some sites of Bmp4 expression were not recapitulated by either the 5′ or 3′ BAC Here we have for the first time begun dissecting the greater cis- (see Results). This could in theory be due to the separation of regulatory landscape surrounding Bmp4. Bmp4 has been implicated in cooperative elements that must work together to induce Bmp4 many developmental processes that hinge on its patterned expres- transcription in that particular cell type. Alternatively, since the BAC sion. Our findings will provide a valuable framework for further efforts interval we tested only spans a portion of the gene desert surrounding to identify individual enhancers controlling a wide variety of Bmp4 Bmp4, elements required for Bmp4 expression in the eye or other expression domains, in teeth, lung, bone, and other organs and tissues. structures may simply be located beyond the interval tested. In support Since global deletion of Bmp4 causes early lethality, targeted deletion of this, significant noncoding conservation is present in the desert of regulatory elements at the endogenous Bmp4 locus may be an outside these BACs (data not shown). These regions would be elegant alternate approach to Cre-based strategies for selectively interesting to test in future studies. removing Bmp4 expression in certain tissues/sites. Furthermore, we tested the hypothesis that sequence comparisons between mouse and Potential impact of modular Bmp4 cis-regulation on discrete fish would fine-tune the detection of cis-regulatory elements that target tissues might be critical for developmentally patterned Bmp4 expression. Using this approach, we were able to use a focused set of transgenes to While global Bmp4 deletion causes embryonic lethality, tissue- pinpoint a key regulatory element that is likely directly related to its specific variation in Bmp4 expression might have biological effects on fundamental roles in mesodermal development. Specifically, Bmp4 any of the organs or tissues where Bmp4 is functional by altering BMP expression within early mesoderm is critical for supporting primordial signaling output. Many cell types indicate exquisite sensitivity to BMP germ cells and establishment of the embryo/placental vascular signaling levels, often with context-specific effects. Bmp4 haploinsuffi- connection through the allantois (Fujiwara et al., 2001; Lawson ciency causes a spectrum of sub-lethal developmental abnormalities in et al., 1999). Bmp4 expression in lateral plate mesoderm is also mice and/or humans including microphthalmia, digital defects and important for supporting the left/right asymmetry cascade by brain anomalies (Bakrania et al., 2008; Dunn et al., 1997). If genetic regulating Nodal (Fujiwara et al., 2002; Mine et al., 2008). ECR2 variants within Bmp4 cis-regulatory elements affected their function(s), seems to coordinate Bmp4 expression in mesoderm during these the ensuing signaling effects would likely be restricted to certain organs events. or cell types that could predispose to specific birth defects or pathologies. Given the function of mesodermal Bmp4 in regulating The Bmp4 cis-regulatory landscape left–right asymmetry, we speculate that ECR2 mutations may be involved in some human cases of situs inversus. The diverse roles of Bmp4 are consistent with a model that it is embedded in a large “regulatory landscape” of noncoding control Role of ECR2 in coordinating Bmp4 in mesoderm elements spread around the flanking gene desert. Thus, prior studies that have focused on the proximal promoter region have only In early post-implantation mouse embryogenesis, Bmp4 is examined a very small portion of the regulatory elements needed expressed in extraembryonic ectoderm followed closely by expression for its diverse roles. Minimal Bmp4 promoter fragments have been in extraembryonic and embryonic mesoderm (Lawson et al., 1999; previously tested in mouse, but failed to direct many known patterns Winnier et al., 1995). Interestingly, Bmp4 transcription in extraem- of Bmp4 expression (Feng et al., 2002; Zhang et al., 2002) suggesting bryonic mesoderm may be induced by Bmp4 itself, produced by the cis-regulatory elements reside beyond the minimal promoter. Our adjacent extraembryonic ectoderm. Our results show that transcrip- data strongly confirm that distant 5′ and 3′ intervals flanking Bmp4 tional activation of Bmp4 in extraembryonic mesoderm and ectoderm harbor many unique cis-regulatory elements most of which are is controlled by distinct cis-regulatory sequences: ECR2, and a separate distant from the promoter. Remarkably, a territory of 56 kb around the ectodermal element probably located outside the BACs we tested. promoter (shared by both BACs in this study) is insufficient to drive Comparative analysis of genomic sequence surrounding Bmp4 in Bmp4 transcription in most of its normal expression sites during fish and mouse found three ancient noncoding sequences present in embryogenesis. Our results are in keeping with similar findings of the BAC clones we tested (Fig. 1). Therefore, we hypothesized these large cis-regulatory domains for other BMP genes. Such domains are functioned as tissue-specific enhancers. To test this, we deleted each often associated with developmental regulator genes like transcrip- ECR from its respective GFPlacZ-BAC and tested the Deletion BACs in tion factors (Nobrega et al., 2003; Ovcharenko et al., 2005b). Several vivo. Deletion of ECR2 resulted in partial ablation of expression in BMPs are now clearly in the category of genes embedded within large extraembryonic mesoderm, and complete failure to express and/or cis-regulatory landscapes. Like other regulatory genes, BMPs are maintain expression in lateral plate mesoderm. Further minigene

Fig. 5. Multiple sequence alignment of ECR2-containing sequences as tested in Fig. 4. (220, 467, 668 bp), annotated with predicted binding motifs of mesodermally-expressed transcription factors according to expression data from the Mouse Genome Informatics database. Predicated motifs identified by MATCH analysis are underlined. Light grey and dashed bars respectively indicate the 467 bp and 220 bp mouse sequences. 600 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 analysis of ECR2 showed its enhancer function in these sites. Thus, combination of factors bind ECR2 to enable Bmp4 transcription. We ECR2 seems at least partly necessary, and sufficient, for expression in hypothesize that ECR2 is essential for Bmp4 expression in early both extraembryonic and embryonic mesoderm. That the ECR2 BAC mesoderm, and thus is probably critical for normal mouse develop- deletion only resulted in partial ablation of extraembryonic mesoderm ment. Targeted mutagenesis and/or deletion of the endogenous expression might be due to the deletion design (see below). ECR2 element will be required to conclusively test whether it functions Alternatively, extraembryonic mesoderm is subdivided into distinctly non-redundantly. specified tissues (amnionic, chorionic, and allantoic mesoderm) (Hogan et al., 1994) that may allow ECR2 to direct expression in the Transgenic approaches for defining Bmp4 cis-elements chorionic and amnionic portion of extraembryonic mesoderm, but not the allantoic portion. This suggests differential regulation of Bmp4 in Interestingly, ECR2 can drive mesodermal expression in the distinct extraembryonic mesoderm compartments. In the future it context of either the minimal βglobin or Hsp68 promoter fragments may be useful to test larger segments spanning ECR2 by deletion (although only two transgenic embryos were generated with the analysis to rule out a requirement for the mammal-specific conserved latter). While both promoters are frequently used in enhancer assays, sequences in regulating extraembryonic mesoderm expression. they are rarely tested in parallel and are rather different structurally. Modular elements in and around ECR2 may be required for controlling The βglobin promoter fragment is merely 51 base pairs spanning the separate extraembryonic mesoderm domains (e.g. chorionic, amnio- TATA-like box and transcript start site (−40/+11 relative to the major nic, allantoic). Some elements may be partly redundant, as is the case start site). In contrast, the Hsp68 (official name: Hspa1a) promoter for redundant cis-elements described in genes such as Shh (Jeong fragment is 878 bp (−652/+226 relative to its RefSeq annotated et al., 2006). transcript; DPM, unpublished). Our results suggest that ECR2 contains The 467 bp ECR2-βglobinlacZ transgene was able to direct sufficient regulatory motifs to activate either promoter with tissue and extraembryonic mesoderm expression at ∼7.5 dpc as well as lateral temporal specificity. plate mesoderm expression at ∼8.5 dpc. In contrast, a shorter 220 bp Deletion of ECR1 and 3 failed to reveal requirements for Bmp4 ECR2-βglobinlacZ transgene failed to direct any mesoderm expres- expression at 9.5–15.5 dpc. Minigene constructs also failed to detect sion. However, the same 220 bp deletion from the 5′ GFPlacZ-BAC enhancer activity for either ECR1 or ECR3 at 9.5–15.5 dpc, although transgene (Deletion BAC 2) abolished lateral plate mesoderm earlier time points were not analyzed. Although each ECR is highly expression (Fig. 3). Taken together, this suggests there are critical conserved, it is possible that they only function postnatally, or at binding sites needed for enhancer activity that reside in the additional prenatal time points not analyzed in this study, or they only function sequence provided by the 467 bp fragment. We cannot rule out the in context with other unknown Bmp4 enhancers (or each other) not possibility that the 467 bp fragment may actually represent two tested in our assay, or they are not Bmp4 cis-regulatory elements. distinct enhancer modules for extraembryonic mesoderm and lateral Because we tested only the minimally-defined ECR1 and ECR3 plate mesoderm regulation. Although the 220 bp deletion resulted in sequences (Table 2) in minigene transgenics, it is also possible that complete loss of lateral plate mesoderm expression, partial expression in each case additionally flanking sequence might be required for in extraembryonic mesoderm (allantoic bud) was retained. This may enhancer function, as seen for ECR2. While our deletion and mini- be due to remaining functional enhancer-like sequences flanking the gene analyses could not test all potential hypotheses for ECR function, 220 bp element. This element was originally defined based on they successfully identified ECR2 as a critical Bmp4 cis-element active conservation between mouse and pufferfish, and did not include in development. flanking sequences that contain inter-mammal conservation (Figs. 3 and 4). Therefore, some critical sequences necessary for ECR2 Evolution of the Bmp2/4 gene pair and their mesodermal functions enhancer function in mouse reside beyond the confines of the pufferfish/mouse conservation. Although mammal/fish conservation Bmp2 and Bmp4 are close paralogs that arose by duplication from has proven to be a beacon for identifying many noncoding enhancer an ancestral BMP gene early in vertebrate evolution. Bmp2 is also elements, our results strongly suggest it can be advantageous to test expressed in early extraembryonic mesoderm where it is required for large fragments containing the ECR in enhancer assays. closure of the proamniotic canal (Zhang and Bradley, 1996). Do Bmp2 Motif analysis predicted Nfe2l1 (also known as Lcrf1/Tcf11) and Bmp4 share an ancestral mesodermal enhancer? For a few other binding sites in the sequence shared by the ECR2 fragments tested vertebrate gene pairs or clusters (e.g. Hox), paralogous enhancers have in vivo. Interestingly, both embryonic and extraembryonic mesoderm been found that duplicated along with the ancestral gene, probably formation is ablated in Lcrf1-null embryos, suggesting Nfe2l1/Lcrf1 is early during vertebrate evolution (Lehoczky et al., 2004). It is possible absolutely essential for mesoderm development (Farmer et al., 1997). that ECR2 indicates a mesoderm enhancer that evolved before In addition to Nfe2l1/Lcrf1, all three ECR2-containing sequences duplication of the ancestral Bmp2/4 gene. We could not detect contained binding motifs for Cdx1, Zic3, Gata4 and Hand1. Cdx1 is noncoding conservation between vertebrate Bmp2 and Bmp4 loci expressed in mesoderm (Meyer and Gruss, 1993) although it is not using BLASTZ-based alignments (not shown). In vertebrates, Bmp2 required for early mesoderm development in mouse (Subramanian may have evolved (or re-evolved) mesoderm regulation indepen- et al., 1995). Zic3 is expressed in embryonic mesoderm and primitive dently. Alternatively, a paralogous ECR2 enhancer may remain in the streak, but not in extraembryonic mesoderm (Elms et al., 2004). Zic3- Bmp2 locus but has diverged too much at the sequence level to be null embryos exhibit variable phenotypes, including gastrulation alignable to Bmp4 ECR2. If so, this enhancer might be located in a defects, failure to develop mesoderm and defects in primitive streak similar position in the 5′ region of the Bmp2 locus as compared to patterning (Ware et al., 2006). Gata4 is expressed in mesoderm at Bmp4. Further insight into these questions could be gained by 7.5 dpc (Saga et al., 1999) and approximately 33% of Gata4-null identification of Bmp2 mesoderm regulatory elements and determina- embryos fail to gastrulate (Molkentin et al., 1997). Finally, Hand1 is tion of the signals directly controlling Bmp4 and Bmp2 in mesoderm. expressed in extraembryonic mesoderm and, later in development, in lateral plate mesoderm (Cserjesi et al., 1995). Hand1-null embryos Conclusions also exhibit defects in extraembryonic mesoderm (Firulli et al., 1998). Given these results, we hypothesize a combination of sites present in Taken together, our results indicate that Bmp4 cis-regulatory the ECR2 element work cooperatively to elicit Bmp4 transcription in elements are spread over a large genomic region. Among these mesoderm. Future studies testing the functional significance of elements a 467 bp noncoding DNA sequence is sufficient to function in putative binding sites will allow researchers to understand what a context-independent manner as a mesodermal enhancer and is K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602 601 likely a critical Bmp4 cis-regulatory element. To our knowledge, this is DiLeone, R.J., Russell, L.B., Kingsley, D.M., 1998. An extensive 3′ regulatory region fi fi fi fi controls expression of Bmp5 in speci c anatomical structures of the mouse embryo. the rst tissue-speci c Bmp4 enhancer identi ed far from the Genetics 148, 401–408. transcription start site (46 kb 5′ to the promoter). The significance DiLeone, R.J., Marcus, G.A., Johnson, M.D., Kingsley, D.M., 2000. Efficient studies of long- of this ancient, long-range Bmp4 mesoderm enhancer is increased by distance Bmp5 gene regulation using bacterial artificial chromosomes. Proc. Natl. Acad. Sci. U. S. A. 97, 1612–1617. the knowledge that Bmp4-null mice fail to develop mesoderm and, as Dunn, N.R., Winnier, G.E., Hargett, L.K., Schrick, J.J., Fogo, A.B., Hogan, B.L., 1997. a result, fail to complete embryogenesis (Winnier et al., 1995). ECR2 is Haploinsufficient phenotypes in Bmp4 heterozygous null mice and modification by probably a critical genomic circuit that, through Bmp4, coordinates mutations in Gli3 and Alx4. Dev. Biol. 188, 235–247. BMP signaling at several steps during mesoderm development. In Eblaghie, M.C., Reedy, M., Oliver, T., Mishina, Y., Hogan, B.L., 2006. Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and addition to roles in mesoderm, Bmp4 has clearly been redeployed in morphogenetic behavior of distal lung epithelial cells. Dev. Biol. 291, 67–82. different ways to drive evolution of various organs, structures and Elms, P., Scurry, A., Davies, J., Willoughby, C., Hacker, T., Bogani, D., Arkell, R., 2004. morphology. Indeed, the modification of craniofacial Bmp4 expression Overlapping and distinct expression domains of Zic2 and Zic3 during mouse gastrulation. Gene Expr. Patterns 4, 505–511. probably shaped evolution of beak morphology in a subset of Darwin's Eppig, J.T., Bult, C.J., Kadin, J.A., Richardson, J.E., Blake, J.A., Anagnostopoulos, A., finches (Abzhanov et al., 2004). Our studies provide a first framework Baldarelli, R.M., Baya, M., Beal, J.S., Bello, S.M., Boddy, W.J., Bradt, D.W., Burkart, D.L., for teasing apart the cis-regulatory landscape of this critical gene. Butler, N.E., Campbell, J., Cassell, M.A., Corbani, L.E., Cousins, S.L., Dahmen, D.J., Dene, H., Diehl, A.D., Drabkin, H.J., Frazer, K.S., Frost, P., Glass, L.H., Goldsmith, C.W., Grant, P.L., Lennon-Pierce, M., Lewis, J., Lu, I., Maltais, L.J., McAndrews-Hill, M., Acknowledgments McClellan, L., Miers, D.B., Miller, L.A., Ni, L., Ormsby, J.E., Qi, D., Reddy, T.B., Reed, D.J., Richards-Smith, B., Shaw, D.R., Sinclair, R., Smith, C.L., Szauter, P., Walker, M.B., We thank Yue Hou for technical assistance and members of the Walton, D.O., Washburn, L.L., Witham, I.T., Zhu, Y., 2005. The Mouse Genome Database (MGD): from genes to mice—a community resource for mouse biology. Mortlock Lab for discussions regarding this work. We kindly acknowl- Nucleic Acids Res. 33, D471–475. edge Brigid Hogan for permission to use the Bmp4 knock-in mice and Farmer, S.C., Sun, C.W., Winnier, G.E., Hogan, B.L., Townes, T.M., 1997. The bZIP Mark de Caestecker for providing a breeding pair. We thank Trish transcription factor LCR-F1 is essential for mesoderm formation in mouse development. Genes Dev. 11, 786–798. Labosky and Ray Dunn for advice regarding early embryo dissections. Feng, J.Q., Zhang, J., Tan, X., Lu, Y., Guo, D., Harris, S.E., 2002. Identification of cis-DNA We thank Maureen Gannon, Brigid Hogan, Trish Labosky, Kristina regions controlling Bmp4 expression during tooth morphogenesis in vivo. J. Dent. Roberts and Michelle Southard-Smith for helpful comments on the Res. 81, 6–10. Firulli, A.B., McFadden, D.G., Lin, Q., Srivastava, D., Olson, E.N., 1998. Heart and extra- manuscript. Kelly J. Chandler was supported by NIH Genetics Training embryonic mesodermal defects in mouse embryos lacking the bHLH transcription Grant 1T32GM62758 and by NIH Grant 1R01HD47880. Ronald L. factor Hand1. Nat. Genet. 18, 266–270. Chandler was supported by NIH Developmental Biology Training Frank, D.B., Abtahi, A., Yamaguchi, D.J., Manning, S., Shyr, Y.,Pozzi, A., Baldwin, H.S., Johnson, J.E., de Caestecker, M.P., 2005. Bone morphogenetic protein 4 promotes pulmonary Grant 5T32HD07502. Douglas P. Mortlock was supported by NIH Grant vascular remodeling in hypoxic pulmonary hypertension. Circ. Res. 97, 496–504. 1R01HD47880. Transgenic mice were generated by the Vanderbilt Fujiwara, T., Dunn, N.R., Hogan, B.L., 2001. Bone morphogenetic protein 4 in the University Transgenic and ES Cell Shared Resource, which is supported extraembryonic mesoderm is required for allantois development and the localiza- tion and survival of primordial germ cells in the mouse. Proc. Natl. Acad. Sci. U. S. A. by the Vanderbilt Cancer, Diabetes, Kennedy and Vision Centers. We 98, 13739–13744. acknowledge the use of the VUMC CHGR DNA Resources Core Facility. Fujiwara, T., Dehart, D.B., Sulik, K.K., Hogan, B.L., 2002. Distinct requirements for extra- embryonic and embryonic bone morphogenetic protein 4 in the formation of the Appendix A. Supplementary data node and primitive streak and coordination of left–right asymmetry in the mouse. Development 129, 4685–4696. Gong, S., Zheng, C., Doughty, M.L., Losos, K., Didkovsky, N., Schambra, U.B., Nowak, N.J., Supplementary data associated with this article can be found, in Joyner, A., Leblanc, G., Hatten, M.E., Heintz, N., 2003. A gene expression atlas of the the online version, at doi:10.1016/j.ydbio.2008.12.033. central nervous system based on bacterial artificial chromosomes. Nature 425, 917–925. Hill, D.P., Begley, D.A., Finger, J.H., Hayamizu, T.F., McCright, I.J., Smith, C.M., Beal, J.S., Corbani, L.E., Blake, J.A., Eppig, J.T., Kadin, J.A., Richardson, J.E., Ringwald, M., 2004. References The mouse Gene Expression Database (GXD): updates and enhancements. Nucleic Acids Res. 32, D568–571. Abzhanov, A., Protas, M., Grant, B.R., Grant, P.R., Tabin, C.J., 2004. Bmp4 and Hogan, B.L., 1996. Bone morphogenetic proteins: multifunctional regulators of morphological variation of beaks in Darwin's finches. Science 305, 1462–1465. vertebrate development. Genes Dev. 10, 1580–1594. Ahituv,N.,Rubin,E.M.,Nobrega,M.A.,2004.Exploitinghuman—fish genome Hogan, B., Beddington, R., Costantini, F., Lacy, E., 1994. Summary of mouse development. comparisons for deciphering gene regulation. Hum. Mol. Genet. 13, R261–266 Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Plainview, Spec No 2. pp. 19–114. Bakrania, P., Efthymiou, M., Klein, J.C., Salt, A., Bunyan, D.J., Wyatt, A., Ponting, C.P., Huang, J.D., Schwyter, D.H., Shirokawa, J.M., Courey, A.J., 1993. The interplay between Martin, A., Williams, S., Lindley, V., Gilmore, J., Restori, M., Robson, A.G., Neveu, M.M., multiple enhancer and silencer elements defines the pattern of decapentaplegic Holder, G.E., Collin, J.R., Robinson, D.O., Farndon, P., Johansen-Berg, H., Gerrelli, D., expression. Genes Dev. 7, 694–704. Ragge, N.K., 2008. Mutations in BMP4 cause eye, brain, and digit developmental Jackson, P.D., Hoffmann, F.M., 1994. Embryonic expression patterns of the Drosophila anomalies: overlap between the BMP4 and hedgehog signaling pathways. Am. J. decapentaplegic gene: separate regulatory elements control blastoderm expression Hum. Genet. 82, 304–319. and lateral ectodermal expression. Dev. Dyn. 199, 28–44. Beppu, H., Kawabata, M., Hamamoto, T., Chytil, A., Minowa, O., Noda, T., Miyazono, K., Jeong, Y., El-Jaick, K., Roessler, E., Muenke, M., Epstein, D.J., 2006. A functional screen for 2000. BMP type II receptor is required for gastrulation and early development of sonic hedgehog regulatory elements across a 1 Mb interval identifies long-range mouse embryos. Dev. Biol. 221, 249–258. ventral forebrain enhancers. Development 133, 761–772. Blackman, R.K., Sanicola, M., Raftery, L.A., Gillevet, T., Gelbart, W.M., 1991. An extensive Jiao, K., Kulessa, H., Tompkins, K., Zhou, Y., Batts, L., Baldwin, H.S., Hogan, B.L., 2003. An 3′ cis-regulatory region directs the imaginal disk expression of decapentaplegic, a essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes member of the TGF-beta family in Drosophila. Development 111, 657–666. Dev. 17, 2362–2367. Boffelli, D., Nobrega, M.A., Rubin, E.M., 2004. Comparative genomics at the vertebrate Jones, C.M., Lyons, K.M., Hogan, B.L., 1991. Involvement of bone morphogenetic protein- extremes. Nat. Rev. Genet. 5, 456–465. 4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse. Carey, M., Smale, S.T., 2000. Transcriptional Regulation in Eukaryotes. Cold Spring Development 111, 531–542. Harbor Laboratory Press, Cold Spring Harbor. Kel, A.E., Gossling, E., Reuter, I., Cheremushkin, E., Kel-Margoulis, O.V., Wingender, E., Chandler, K.J., Chandler, R.L., Broeckelmann, E.M., Hou, Y., Southard-Smith, E.M., 2003. MATCH: a tool for searching transcription factor binding sites in DNA Mortlock, D.P., 2007a. Relevance of BAC transgene copy number in mice: transgene sequences. Nucleic Acids Res. 31, 3576–3579. copy number variation across multiple transgenic lines and correlations with Kent, W.J., 2002. BLAT—the BLAST-like alignment tool. Genome Res. 12, 656–664. transgene integrity and expression. Mamm. Genome 18, 693–708. Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., Haussler, D., Chandler, R.L., Chandler, K.J., McFarland, K.A., Mortlock, D.P., 2007b. Bmp2 transcription 2002. The human genome browser at UCSC. Genome Res. 12, 996–1006. in osteoblast progenitors is regulated by a distant 3′ enhancer located 156.3 Kingsley, D.M., 1994. The TGF-beta superfamily: new members, new receptors, and new kilobases from the promoter. Mol. Cell. Biol. 27, 2934–2951. genetic tests of function in different organisms. Genes Dev. 8, 133–146. Chang, H., Huylebroeck, D., Verschueren, K., Guo, Q., Matzuk, M.M., Zwijsen, A., 1999. Lawson, K.A., Dunn, N.R., Roelen, B.A., Zeinstra, L.M., Davis, A.M., Wright, C.V., Korving, J.P., Smad5 knockout mice die at mid-gestation due to multiple embryonic and Hogan, B.L., 1999. Bmp4 is required for the generation of primordial germ cells in the extraembryonic defects. Development 126, 1631–1642. mouse embryo. Genes Dev. 13, 424–436. Cserjesi, P., Brown, D., Lyons, G.E., Olson, E.N., 1995. Expression of the novel basic helix– Lechleider, R.J., Ryan, J.L., Garrett, L., Eng, C., Deng, C., Wynshaw-Boris, A., Roberts, A.B., loop–helix gene eHAND in neural crest derivatives and extraembryonic membranes 2001. Targeted mutagenesis of Smad1 reveals an essential role in chorioallantoic during mouse development. Dev. Biol. 170, 664–678. fusion. Dev. Biol. 240, 157–167. 602 K.J. Chandler et al. / Developmental Biology 327 (2009) 590–602

Lee, E.C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D.A., Court, D.L., Jenkins, N.A., Rossi, J.M., Dunn, N.R., Hogan, B.L., Zaret, K.S., 2001. Distinct mesodermal signals, Copeland, N.G., 2001. A highly efficient Escherichia coli-based chromosome including BMPs from the septum transversum mesenchyme, are required in engineering system adapted for recombinogenic targeting and subcloning of BAC combination for hepatogenesis from the endoderm. Genes Dev. 15, 1998–2009. DNA. Genomics 73, 56–65. Saga, Y., Miyagawa-Tomita, S., Takagi, A., Kitajima, S., Miyazaki, J., Inoue, T., 1999. MesP1 Lehoczky, J.A., Williams, M.E., Innis, J.W., 2004. Conserved expression domains for genes is expressed in the heart precursor cells and required for the formation of a single upstream and within the HoxA and HoxD clusters suggests a long-range enhancer heart tube. Development 126, 3437–3447. existed before cluster duplication. Evol. Dev. 6, 423–430. Sampath, T.K., Rashka, K.E., Doctor, J.S., Tucker, R.F., Hoffmann, F.M., 1993. Drosophila Lettice, L.A., Heaney, S.J., Purdie, L.A., Li, L., de Beer, P., Oostra, B.A., Goode, D., Elgar, G., transforming growth factor beta superfamily proteins induce endochondral bone Hill, R.E., de Graaff, E., 2003. A long-range Shh enhancer regulates expression in the formation in mammals. Proc. Natl. Acad. Sci. U. S. A. 90, 6004–6008. developing limb and fin and is associated with preaxial polydactyly. Hum. Mol. Schwartz, S., Zhang, Z., Frazer, K.A., Smit, A., Riemer, C., Bouck, J., Gibbs, R., Hardison, R., Genet. 12, 1725–1735. Miller, W., 2000. PipMaker—a web server for aligning two genomic DNA sequences. Liu, W., Selever, J., Wang, D., Lu, M.F., Moses, K.A., Schwartz, R.J., Martin, J.F., 2004. Bmp4 Genome Res. 10, 577–586. signaling is required for outflow-tract septation and branchial-arch artery Selever, J., Liu, W., Lu, M.F., Behringer, R.R., Martin, J.F., 2004. Bmp4 in limb bud remodeling. Proc. Natl. Acad. Sci. U. S. A. 101, 4489–4494. mesoderm regulates digit pattern by controlling AER development. Dev. Biol. 276, Maconochie, M.K., Nonchev, S., Studer, M., Chan, S.K., Popperl, H., Sham, M.H., Mann, R.S., 268–279. Krumlauf, R., 1997. Cross-regulation in the mouse HoxB complex: the expression of Siepel, A., Bejerano, G., Pedersen, J.S., Hinrichs, A.S., Hou, M., Rosenbloom, K., Clawson, Hoxb2 in rhombomere 4 is regulated by Hoxb1. Genes Dev. 11, 1885–1895. H., Spieth, J., Hillier, L.W., Richards, S., Weinstock, G.M., Wilson, R.K., Gibbs, R.A., Masucci, J.D., Miltenberger, R.J., Hoffmann, F.M., 1990. Pattern-specific expression of the Kent, W.J., Miller, W., Haussler, D., 2005. Evolutionarily conserved elements in Drosophila decapentaplegic gene in imaginal disks is regulated by 3′ cis-regulatory vertebrate, insect, worm, and yeast genomes. Genome Res. 15, 1034–1050. elements. Genes Dev. 4, 2011–2023. Smit, A., Hubley, R., and Green, P., (1996–2004). RepeatMasker Open-3.0. Matys, V., Fricke, E., Geffers, R., Gossling, E., Haubrock, M., Hehl, R., Hornischer, K., Karas, Spencer, F.A., Hoffmann, F.M., Gelbart, W.M., 1982. Decapentaplegic: a gene complex D., Kel, A.E., Kel-Margoulis, O.V., Kloos, D.U., Land, S., Lewicki-Potapov, B., Michael, affecting morphogenesis in Drosophila melanogaster. Cell 28, 451–461. H., Munch, R., Reuter, I., Rotert, S., Saxel, H., Scheer, M., Thiele, S., Wingender, E., St Johnston, R.D., Hoffmann, F.M., Blackman, R.K., Segal, D., Grimaila, R., Padgett, R.W., 2003. TRANSFAC: transcriptional regulation, from patterns to profiles. Nucleic Acids Irick, H.A., Gelbart, W.M., 1990. Molecular organization of the decapentaplegic gene Res. 31, 374–378. in Drosophila melanogaster. Genes Dev. 4, 1114–1127. Mayor, C., Brudno, M., Schwartz, J.R., Poliakov, A., Rubin, E.M., Frazer, K.A., Pachter, L.S., Subramanian, V., Meyer, B.I., Gruss, P., 1995. Disruption of the murine homeobox gene Dubchak, I., 2000. VISTA: visualizing global DNA sequence alignments of arbitrary Cdx1 affects axial skeletal identities by altering the mesodermal expression length. Bioinformatics 16, 1046–1047. domains of Hox genes. Cell 83, 641–653. Meyer, B.I., Gruss, P., 1993. Mouse Cdx-1 expression during gastrulation. Development Tremblay, K.D., Dunn, N.R., Robertson, E.J., 2001. Mouse embryos lacking Smad1 signals 117, 191–203. display defects in extra-embryonic tissues and germ cell formation. Development Mine, N., Anderson, R.M., Klingensmith, J., 2008. BMP antagonism is required in both the 128, 3609–3621. node and lateral plate mesoderm for mammalian left–right axis establishment. Ureta-Vidal, A., Ettwiller, L., Birney, E., 2003. Comparative genomics: genome-wide Development 135, 2425–2434. analysis in metazoan eukaryotes. Nat. Rev. Genet. 4, 251–262. Mishina, Y., Suzuki, A., Ueno, N., Behringer, R.R., 1995. Bmpr encodes a type I bone Waldrip, W.R., Bikoff, E.K., Hoodless, P.A., Wrana, J.L., Robertson, E.J., 1998. Smad2 morphogenetic protein receptor that is essential for gastrulation during mouse signaling in extraembryonic tissues determines anterior–posterior polarity of the embryogenesis. Genes Dev. 9, 3027–3037. early mouse embryo. Cell 92, 797–808. Miyazaki, Y., Oshima, K., Fogo, A., Ichikawa, I., 2003. Evidence that bone morphogenetic Ware, S.M., Harutyunyan, K.G., Belmont, J.W., 2006. Zic3 is critical for early embryonic protein 4 has multiple biological functions during kidney and urinary tract patterning during gastrulation. Dev. Dyn. 235, 776–785. development. Kidney Int. 63, 835–844. Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., Copeland, N.G., 2005. Simple and Molkentin, J.D., Lin, Q., Duncan, S.A., Olson, E.N., 1997. Requirement of the transcription highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 33, e36. factor GATA4 for heart tube formation and ventral morphogenesis. Genes Dev. 11, Weinstein, M., Yang, X., Li, C., Xu, X., Gotay, J., Deng, C.X., 1998. Failure of egg cylinder 1061–1072. elongation and mesoderm induction in mouse embryos lacking the tumor Mortlock, D.P., Guenther, C., Kingsley, D.M., 2003. A general approach for identifying suppressor smad2. Proc. Natl. Acad. Sci. U. S. A. 95, 9378–9383. distant regulatory elements applied to the Gdf6 gene. Genome Res. 13, 2069–2081. Winnier, G., Blessing, M., Labosky, P.A., Hogan, B.L., 1995. Bone morphogenetic protein-4 Nobrega, M.A., Ovcharenko, I., Afzal, V., Rubin, E.M., 2003. Scanning human gene deserts is required for mesoderm formation and patterning in the mouse. Genes Dev. 9, for long-range enhancers. Science 302, 413. 2105–2116. Nomura, M., Li, E., 1998. Smad2 role in mesoderm formation, left–right patterning and Woolfe, A., Goodson, M., Goode, D.K., Snell, P., McEwen, G.K., Vavouri, T., Smith, S.F., craniofacial development. Nature 393, 786–790. North, P., Callaway, H., Kelly, K., Walter, K., Abnizova, I., Gilks, W., Edwards, Y.J., Ovcharenko, I., Loots, G.G., Giardine, B.M., Hou, M., Ma, J., Hardison, R.C., Stubbs, L., Cooke, J.E., Elgar, G., 2005. Highly conserved non-coding sequences are associated Miller, W., 2005a. Mulan: multiple-sequence local alignment and visualization for with vertebrate development. PLoS Biol. 3, e7. studying function and evolution. Genome Res. 15, 184–194. Wozney, J.M., Rosen, V., Celeste, A.J., Mitsock, L.M., Whitters, M.J., Kriz, R.W., Hewick, R.M., Ovcharenko, I., Loots, G.G., Nobrega, M.A., Hardison, R.C., Miller, W., Stubbs, L., 2005b. Wang, E.A.,1988. Novel regulators of bone formation: molecular clones and activities. Evolution and functional classification of vertebrate gene deserts. Genome Res. 15, Science 242, 1528–1534. 137–145. Wunderle, V.M., Critcher, R., Hastie, N., Goodfellow, P.N., Schedl, A., 1998. Deletion of Padgett, R.W., Wozney, J.M., Gelbart, W.M., 1993. Human BMP sequences can confer long-range regulatory elements upstream of SOX9 causes campomelic dysplasia. normal dorsal–ventral patterning in the Drosophila embryo. Proc. Natl. Acad. Sci. Proc. Natl. Acad. Sci. U. S. A. 95, 10649–10654. U. S. A. 90, 2905–2909. Zhang, H., Bradley, A., 1996. Mice deficient for BMP2 are nonviable and have defects in Pennacchio, L.A., Ahituv, N., Moses, A.M., Prabhakar, S., Nobrega, M.A., Shoukry, M., amnion/chorion and cardiac development. Development 122, 2977–2986. Minovitsky, S., Dubchak, I., Holt, A., Lewis, K.D., Plajzer-Frick, I., Akiyama, J., De Val, Zhang, J., Tan, X., Contag, C.H., Lu, Y., Guo, D., Harris, S.E., Feng, J.Q., 2002. Dissection S., Afzal, V., Black, B.L., Couronne, O., Eisen, M.B., Visel, A., Rubin, E.M., 2006. In vivo of promoter control modules that direct Bmp4 expression in the epithelium- enhancer analysis of human conserved non-coding sequences. Nature 444, derived components of hair follicles. Biochem. Biophys. Res. Commun. 293, 499–502. 1412–1419.