DOCSLIB.ORG

Microsatellite Instability in Drosophila Spellchecker1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microsatellite Instability in Drosophila Spellchecker1 Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2964–2969, March 1999 Genetics Microsatellite instability in Drosophila spellchecker1 (MutS homolog) mutants (mismatch repairydouble-strand break repairyhomologous recombinationygene conversionyhereditary nonpolyopsis colon cancer) CARLOS FLORES AND WILLIAM ENGELS* Laboratory of Genetics, University of Wisconsin, Madison, WI 53706 Communicated by William F. Dove, University of Wisconsin, Madison, WI, January 19, 1999 (received for review September 29, 1998) ABSTRACT We have cloned a mutS homolog from Dro- This mismatch repair system has been conserved throughout sophila melanogaster called spellchecker1 (spel1) and have con- evolution. At present, MSHs have been found in 14 species of structed spel1 mutant flies. MutS proteins promote the cor- bacteria and 10 species of eukaryotes ranging from fungi to rection of DNA mismatches and serve important roles in DNA humans. In some species, e.g., Saccharomyces cerevisiae,as replication, recombination, and repair. The spel1 gene belongs many as six MSH genes have been found. In general, when to a subfamily of mutS first characterized by the MSH2 gene multiple MSH genes are found in a species, they each have a of yeast and which also includes hMSH2, one of the two major distinct function. Of the six genes in yeast, MSH1 caries out the hereditary nonpolyposis colon cancer loci of humans. Like repair of mitochondrial DNA (24), while MSH3 and MSH6 act msh2 mutants in other species, we find that flies lacking the as specificity subunits for nuclear mismatch repair. They both spel1 gene suffer a highly increased rate of instability in long form heteromers with MSH2, and as alternative partners they runs of dinucleotide repeats when analyzed after 10–12 fly determine the affinity of the complex toward base–base 1 y generations. Using a new assay, we have also discovered that mismatches (MSH2 MSH3) (25) or insertion deletion mis- 1 mutations in spel1 decrease the stability of a dinucleotide matches (MSH2 MSH6) (26). MSH4 and MSH5 are ex- repeat when it is copied into the site of a double-strand break pressed exclusively during meiosis and are required for normal during gene conversion. Contrary to the case in mammalian levels of meiotic exchange and chromosome disjunction (7). cells, spel1 deficiency does not affect tolerance of flies to a MSH4 and MSH5 form a heteromeric complex with each methylating agent nor does it affect resistance to g-irradia- other, and both are required for function. tion. The MSH2 gene limits the rate of spontaneous mutation (24). MSH2 mutants also have an increased rate of postmeiotic segregation, indicating the presence of unrepaired mismatches Escherichia coli The MutS protein of recognizes base-pair in heteroduplex DNA (24). Mutations in MSH2 as well as the mismatches in DNA as well as mismatches formed by small mutL homologs, MLH1 and PMS1, lead to a dramatic increase insertions or deletions. It binds to these structures and recruits in the instability of simple DNA repeats (3, 27). other proteins, including MutL, needed to resolve the contra- In humans, similar repeat instability is known to occur in diction. This protein complex can identify which strand to tumors from patients with hereditary nonpolyposis colon repair by sensing the methylation state of the two strands or by cancer (28). This form of cancer, as well as some sporadic the presence of single-strand breaks. A region of up to a few cancers that also show repeat instability, were found to be kilobases is removed from the ‘‘mutant’’ strand by exonuclease induced by mutations in the human mutS and mutL homologs: activity; DNA polymerase then replaces the sequence, thereby hMSH2, hMLH1, hPMS1, and hPMS2 (29–31). These muta- resolving the mismatch (reviewed in ref. 1). The fidelity of tions are inherited as if dominant, resulting in a predisposition replication is severely compromised in mutS and mutL mu- to hereditary nonpolyposis colon cancer in heterozygous in- tants, leading to an increased frequency of point mutations and dividuals, but they act recessively at the level of the cell because to instability of simple DNA repeats (2, 3). expression of the functional copy is absent in the cancers. In addition to promoting faithful replication, MutS, the Cell extracts from Drosophila have very high levels of MutS homologs (MSHs) and associated mismatch repair pro- mismatch-repair activity (32), so studying mismatch-repair teins also are involved in processing intermediates of homo- genes in flies with the powerful genetic approaches that they logous recombination, promoting meiotic crossing over and offer should illuminate the complex interactions that have double-strand break repair, and repairing oxidative and UV- been hinted at in other organisms. To begin this study, we induced DNA lesions (4–17). For example, heteroduplex DNA cloned a mutS homolog from Drosophila called spellchecker1 formed during gene conversion at the MAT locus in yeast is (spel1) and found that it is adjacent to a gene known as processed by mismatch repair at an early stage (10). Msh2 of lethal(2)35Aa. We have constructed lines of Drosophila that yeast appears to regulate the forward movement of Holliday have deletions of spel1. Although spel1-null mutants are viable junctions (4). In vitro, MutS can regulate the extent of hetero- and relatively fertile, they suffer a highly increased rate of duplex formation by blocking RecA-catalyzed branch migra- instability in dinucleotide repeats when these repeats are tion through regions with mismatches (18, 19). This may be the transmitted normally through the germ line or when copied basis for the inhibition of recombination between diverged into the site of a double-strand break during gene conversion. sequences that is absent in mismatch repair-deficient mutants However, these mutants are not significantly altered in their (6, 20–23). This activity may safeguard genome stability by sensitivity to the methylating agent methyl methanesulfonate preventing recombination between related genes within an (MMS) or to g-irradiation. organism and homologous genes between species. Abbreviations: MSH, MutS homolog; MMS, methyl methanesulfo- The publication costs of this article were defrayed in part by page charge nate; GalNAc-T, N-acetylglucosamine transferase. Data Deposition: The sequence reported in this paper has been payment. This article must therefore be hereby marked ‘‘advertisement’’ in deposited in the GenBank database (accession no. U17893). accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. e-mail: wrengels@ PNAS is available online at www.pnas.org. facstaff.wisc.edu. 2964 Downloaded by guest on September 29, 2021 Genetics: Flores and Engels Proc. Natl. Acad. Sci. USA 96 (1999) 2965 MATERIALS AND METHODS same manner using an alternative deficiency [Df(2L)A400 in place of Df(2L)GW7] to produce spel12y1 heterozygotes. All Nucleic Acid Techniques. DNA fragment isolation, ligation, of these stocks were then maintained by transferring adults to subcloning, and blotting were performed by using standard fresh vials every 21 days. This resulted in populations averag- methods (33). The sequences of the degenerate primers used ing '5–50 flies per line. for the initial PCR are ATCACNGGNCCNAAYATGGG and After 10–12 generations, DNA was prepared from one male GTCATYTCNACCATRAANGT. The enhanced chemilumi- from each line and analyzed by PCR. New alleles were nescence (ECL) direct-labeling system (Amersham Pharma- detected as novel-sized PCR fragments not present in either cia) was used to label gel-purified DNAs for screening the ancestor from the progenitor pair. cDNA library. The cDNA library was constructed in the The primers used to amplify microsatellite regions are as Thomas Schwarz laboratory (Stanford University) from a follows: acagcaacaacggagcaac (elf1-f); tctgcaacctgggagtctgg mixture of random primed and oligo(dT)-primed mRNA from (elf1-r); cgtcgatctcaagcgtctgc (mam-Dc); ggaagttggccgccgcattg Drosophila heads. Other cDNAs were obtained from the y (mam-Gc); aagatacatccgtgcgcgtat (sev-f); cccaactgaaaag- Berkeley Drosophila Genome Project HHMI EST Project caactcc (sev-r); ccaccttagggcgtggctgt (35F-f); gacatatccaaacac- (unpublished data) and from Jeff Sekelsky in the Scott Hawley caatgcac (35F-r); cttcctgtgacaatggctgg (white-f); acacacacttt- laboratory (University of California, Davis). tatactctctccgc (white-r); gggtctttctgcttcagttacc (U1a-f); ggaata- DNA Sequence Determination and Analysis. The sequence cacgaatccccctt (U1a-r); ctcttagtgcgcagggattc (tenA-f); of cloned genomic DNA and cDNA was determined by the gagtcgctcaatggcaggc (tenA-r); ttccaagtcacacggacggg (AbdB-f); dideoxy chain-termination method (34) as modified for Se- gcacaccgacaacacaagac (AbdB-r). Amplification was per- quenase 2.0 (United States Biochemical) and for fluorescent formed with one primer of each pair fluorescently labeled with DyeDeoxy terminators (Applied Biosystems). DNA sequence either 6-carboxyfluorescein (6-FAM) or 5-hexachlorofluores- was compiled using the UWGCG software (35). The DNA cein (HEX), and the products were analyzed along with DNA sequence was assigned GenBank accession no. U17893. size standards on a GeneScan gel (Applied Biosystems). Drosophila Stocks. Fly stocks were maintained on cornmeal- molasses agar at 23°C. Mutations and abbreviations not ex- plained here are described in Lindsley and Zimm (36) and in RESULTS FlyBase (37). The chromosomes used are as follows: two ethyl Isolation of spel1 cDNA and Genomic Clones. We initially SF12 methylsulfonate-induced mutants of l(2)35Aa; b l(2)35Aa amplified a 191-bp fragment of the spel1 gene from Drosophila n4 SF32 n2 Adh , and b l(2)35Aa Adh pr cn (38) and four deficien- genomic DNA by using degenerate PCR. The primers were cies, Df(2L)TE146(Z)GW7 al dp b l(2)pwn cn [abbreviated designed to hybridize to highly conserved regions of the MutS GW7 (39)], Df(2L)b84h1 [abbreviated b84h1 (40)], coding sequence based on an alignment of MutS members Df(2L)b80e3, pr bw (abbreviated b80e3), and Df(2L)A400, b from bacteria, yeast, mouse, and human. This fragment was cn bw; T(2;3;4)CA4 [abbreviated A400 (41)].
Load more

Recommended publications
  • Genetic Effects on Microsatellite Diversity in Wild Emmer Wheat (Triticum Dicoccoides) at the Yehudiyya Microsite, Israel
    Heredity (2003) 90, 150–156 & 2003 Nature Publishing Group All rights reserved 0018-067X/03 $25.00 www.nature.com/hdy Genetic effects on microsatellite diversity in wild emmer wheat (Triticum dicoccoides) at the Yehudiyya microsite, Israel Y-C Li1,3, T Fahima1,MSRo¨der2, VM Kirzhner1, A Beiles1, AB Korol1 and E Nevo1 1Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel; 2Institute for Plant Genetics and Crop Plant Research, Corrensstrasse 3, 06466 Gatersleben, Germany This study investigated allele size constraints and clustering, diversity. Genome B appeared to have a larger average and genetic effects on microsatellite (simple sequence repeat number (ARN), but lower variance in repeat number 2 repeat, SSR) diversity at 28 loci comprising seven types of (sARN), and smaller number of alleles per locus than genome tandem repeated dinucleotide motifs in a natural population A. SSRs with compound motifs showed larger ARN than of wild emmer wheat, Triticum dicoccoides, from a shade vs those with perfect motifs. The effects of replication slippage sun microsite in Yehudiyya, northeast of the Sea of Galilee, and recombinational effects (eg, unequal crossing over) on Israel. It was found that allele distribution at SSR loci is SSR diversity varied with SSR motifs. Ecological stresses clustered and constrained with lower or higher boundary. (sun vs shade) may affect mutational mechanisms, influen- This may imply that SSR have functional significance and cing the level of SSR diversity by both processes. natural constraints.
    [Show full text]
  • Copy Number of P Elements, KP/Full-Sized P Element Ratio and Their Relationships with Environmental Factors in Brazilian Drosophila Melanogaster Populations
    Heredity (2003) 91, 570–576 & 2003 Nature Publishing Group All rights reserved 0018-067X/03 $25.00 www.nature.com/hdy Copy number of P elements, KP/full-sized P element ratio and their relationships with environmental factors in Brazilian Drosophila melanogaster populations MT Ruiz and CMA Carareto Departamento de Biologia, IBILCE, Universidade Estadual Paulista, Rua Cristo´va˜o Colombo, 2265, Jardim Nazare´,Sa˜o Jose´ do Rio Preto 15054-000, SP, Brazil The P transposable element copy numbers and the KP/full- and the strains from less extreme latitudes had many sized P element ratios were determined in eight Brazilian more full-sized P than KP elements. However, no clinal strains of Drosophila melanogaster. Strains from tropical variation was observed. Strains from different localities, regions showed lower overall P element copy numbers previously classified as having P cytotype, displayed a higher than did strains from temperate regions. Variable numbers of or a lower proportion of KP elements than of full-sized full-sized and defective elements were detected, but the P elements, as well as an equal number of the two element full-sized P and KP elements were the predominant classes types, showing that the same phenotype may be produced of elements in all strains. The full-sized P and KP element by different underlying genomic components of the P–M ratios were calculated and compared with latitude. The system. northernmost and southernmost Brazilian strains showed Heredity (2003) 91, 570–576, advance online publication, fewer full-sized elements than KP elements per genome, 17 September 2003; doi:10.1038/sj.hdy.6800360 Keywords: P transposable elements; KP elements; KP/full-sized P elements; P–M systems; Drosophila melanogaster Introduction elements, allows P element transposition (Engels, 1983).
    [Show full text]
  • Interspecific DNA Transformation in Drosophila (Drosophila Melanogaster/Drosophila Simulans/Rosy Gene/P Element/Transposable Element) NANCY J
    Proc. Nati. Acad. Sci. USA Vol. 81, pp. 7515-7519, December 1984 Genetics Interspecific DNA transformation in Drosophila (Drosophila melanogaster/Drosophila simulans/rosy gene/P element/transposable element) NANCY J. SCAVARDA AND DANIEL L. HARTL Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110 Communicated by Peter H. Raven, August 7, 1984 ABSTRACT A DNA fragment that includes the wild-type (4). Use of an average rate of synonymous substitutions in rosy (ry+) gene of Drosophila melanogaster has been intro- coding regions of 5.1 + 0.3 x 10-9 per nucleotide site per yr duced by microinjection into the germ line of the reproductive- (9, 10) results in an estimated time since separation of 4.1 + ly isolated species Drosophila simulans and incorporated into 0.2 million yr, but analogous estimates based on rates of nu- the D. simulans genome. Transformation was mediated by the cleotide substitution in intervening sequences range from 3.8 transposable element P, which occurs in the genome of most to 6.8 million yr. These estimates are uncertain because av- natural populations ofD. melanogaster but not in D. simulans. erage rates of substitution in other organisms may have little Rubin and Spradling [Rubin, G. M. & Spradling, A. C. relevance to insects, and because evolutionary change in the (1982) Science 218, 348-353] have previously shown that the gene coding for alcohol dehydrogenase may be atypical. ry' DNA fragment, which is flanked by recognition sequences Although D. melanogaster and D. simulans are reproduc- of P element, can transform the germ line ofD.
    [Show full text]
  • Evolution of Pogo, a Separate Superfamily of IS630-Tc1-Mariner
    Gao et al. Mobile DNA (2020) 11:25 https://doi.org/10.1186/s13100-020-00220-0 RESEARCH Open Access Evolution of pogo, a separate superfamily of IS630-Tc1-mariner transposons, revealing recurrent domestication events in vertebrates Bo Gao, Yali Wang, Mohamed Diaby, Wencheng Zong, Dan Shen, Saisai Wang, Cai Chen, Xiaoyan Wang and Chengyi Song* Abstracts Background: Tc1/mariner and Zator, as two superfamilies of IS630-Tc1-mariner (ITm) group, have been well-defined. However, the molecular evolution and domestication of pogo transposons, once designated as an important family of the Tc1/mariner superfamily, are still poorly understood. Results: Here, phylogenetic analysis show that pogo transposases, together with Tc1/mariner,DD34E/Gambol,and Zator transposases form four distinct monophyletic clades with high bootstrap supports (> = 74%), suggesting that they are separate superfamilies of ITm group. The pogo superfamily represents high diversity with six distinct families (Passer, Tigger, pogoR, Lemi, Mover,andFot/Fot-like) and wide distribution with an expansion spanning across all the kingdoms of eukaryotes. It shows widespread occurrences in animals and fungi, but restricted taxonomic distribution in land plants. It has invaded almost all lineages of animals—even mammals—and has been domesticated repeatedly in vertebrates, with 12 genes, including centromere-associated protein B (CENPB), CENPB DNA-binding domain containing 1 (CENPBD1), Jrk helix–turn–helix protein (JRK), JRK like (JRKL), pogo transposable element derived with KRAB domain (POGK), and with ZNF domain (POGZ), and Tigger transposable element-derived 2 to 7 (TIGD2–7), deduced as originating from this superfamily. Two of them (JRKL and TIGD2) seem to have been co-domesticated, and the others represent independent domestication events.
    [Show full text]
  • Genome of Drosophila Guanche WOLFGANG J
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 4018-4022, May 1992 Genetics P-element homologous sequences are tandemly repeated in the genome of Drosophila guanche WOLFGANG J. MILLER*, SYLVIA HAGEMANNt, ELEONORE REITERt, AND WILHELM PINSKERtt *Institut fur Botanik, Abteilung Cytologie und Genetik, Rennweg 14, A-1030 Vienna, Austria; and tInstitut fur Allgemeine Biologie, Abteilung Genetik, Wahringerstrasse 17, A-1090 Vienna, Austria Communicated by Bruce Wallace, December 23, 1991 ABSTRACT In Drosophila guanche, P-homologous se- In germ-line cells, the copy number of P elements is quences were found to be located in a tandem repetitive array genetically regulated by a complex mixture of chromosomal (copy number: 20-50) at a single genomic site. The cytological and cytoplasmic factors (11). At least two mechanisms can be position on the polytene chromosomes was determined by in situ distinguished: the maternally transmitted cytotype (12) and a hybridization (chromosome 0: 85C). Sequencing of one com- chromosomally inherited control system (13). In the P cyto- plete repeat unit (3.25 kilobases) revealed high sequence simi- type, the cytoplasmic state of P-strain individuals, transpo- larity between the central coding region comprising exons 0 to sition is repressed in somatic cells and in the germ line. In 2 and the corresponding section of the Drosophila melanogaster general the P cytotype develops gradually as a result of the P element. The rest of the sequence has diverged considerably. increasing number of P-element copies. M-strains, on the Exon 3 has no coding function and the inverted repeats have other hand, have genomes devoid of P elements.
    [Show full text]
  • Capture of a Recombination Activating Sequence from Mammalian Cells
    Gene Therapy (1999) 6, 1819–1825 1999 Stockton Press All rights reserved 0969-7128/99 $15.00 http://www.stockton-press.co.uk/gt Capture of a recombination activating sequence from mammalian cells P Olson and R Dornburg The Dorrance H Hamilton Laboratories, Center for Human Virology, Division of Infectious Diseases, Jefferson Medical College, Thomas Jefferson University, Jefferson Alumni Hall, 1020 Locust Street, Rm 329, Philadelphia, PA 19107, USA We have developed a genetic trap for identifying revealed a putative recombination signal (CCCACCC). sequences that promote homologous DNA recombination. When this heptamer or an abbreviated form (CCCACC) The trap employs a retroviral vector that normally disables were reinserted into the vector, they stimulated vector itself after one round of replication. Insertion of defined repair and other DNA rearrangements. Mutant forms of DNA sequences into the vector induced the repair of a 300 these oligomers (eg CCCAACC or CCWACWS) did not. base pair deletion, which restored its ability to replicate. Our data suggest that the recombination events occurred Tests of random sequence libraries made in the vector within 48 h after transfection. Keywords: recombination; retroviral vector; vector stability; gene conversion; gene therapy Introduction scripts are still made from the intact left LTR, but reverse transcription copies the deletion to both LTRs, disabling Recognition of cis-acting DNA signals occupies a central the daughter provirus.15–17 We found that the SIN vectors role in both site-specific and general recombination path- that could escape this programmed disablement did so 1–6 ways. Signals in site-specific pathways define the by recombinationally repairing the U3-deleted LTR.
    [Show full text]
  • History to the Rescue Pseudogenes Get Some Respect Flyin' Pain Free
    RESEARCH NOTES Pseudogenes get some respect adenoviral entry is mediated by interaction between RGD motifs and integrins, they went on to engineer a virus with an RGD peptide. This Pseudogenes are the non-functional remnants of genes that have version of the modified virus specifically infected tumor cells and repli- been thought to do nothing more than take up space. A new cated more effectively than Delta-24. When injected directly into report by Shinji Hirotsune and colleagues provides evidence that human gliomas xenografted into mice, Delta-24-RGD allowed signifi- at least one such pseudogene has an essential role as a regulator of cantly longer survival than did Delta-24 or an inactivated virus control. gene expression (Nature 423, 91–96; 2003). A fortuitous insertion More impressively, 60% of mice treated with Delta-24-RGD were long- of a transgene into the Makorin1-p1 locus generated a mouse term survivors (compared with 15% of those treated with Delta-24 with a bone deformity and polycystic kidneys. Makorin1-p1 is a characterized by complete tumor regression). MH pseudogene that is normally transcribed, although no functional protein product can be produced. Strikingly, the transgene insertion reduced not only the transcription of Makorin1-p1, but RNAi on or off target? that of its functional homolog, Makorin1, as well. In vitro Two new reports examine the specificity of RNA interference (RNAi) in experiments show that an intact Makorin1-p1 locus stabilizes the human cells using genome-wide expression profiling. Targeting exoge- Makorin1 mRNA, and a rescue of the original transgenic mouse nous GFP in human embryonic kidney cells, Jen-Tsan Chi and col- with Makorin1-p1 proves that the pseudogene is required for leagues report efficient and specific knockdown using two different normal expression of Makorin1.
    [Show full text]
  • Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using White Co-Conversion
    G3: Genes|Genomes|Genetics Early Online, published on August 26, 2016 as doi:10.1534/g3.116.032557 Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-Conversion Daniel Tianfang Ge*,†,1, Cindy Tipping*,‡,1, Michael H. Brodsky§, Phillip D. Zamore*,‡,**,2 *RNA Therapeutics Institute, †Interdisciplinary Graduate Program, ‡Howard Hughes Medical Institute, §Department of Molecular, Cell and Cancer Biology, **Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, MA 01605, USA 1These authors contributed equally to this work. 2To whom correspondence should be addressed. 1 © The Author(s) 2013. Published by the Genetics Society of America. Running title: Rapid Screening for CRISPR Editing Keywords: Cas9; Co-Conversion; Genetic Screen; Microhomology-Mediated End Joining; Homologous Recombination Corresponding author: Phillip D. Zamore Address: 368 Plantation Street, AS4-2053, Worcester, MA 01605 Tel.: 508-856-2191 E-mail: [email protected] 2 1 ABSTRACT 2 Adoption of a streamlined version of the bacterial CRISPR/Cas9 defense system has 3 accelerated targeted genome engineering. The Streptococcus pyogenes Cas9 protein, 4 directed by a simplified, CRISPR-like single guide RNA, catalyzes a double-stranded 5 DNA break at a specific genomic site; subsequent repair by end joining can introduce 6 mutagenic insertions or deletions, while repair by homologous recombination using an 7 exogenous DNA template can incorporate new sequence at the target locus. However, 8 the efficiency of Cas9-directed mutagenesis is low in Drosophila melanogaster. Here, we 9 describe a strategy that reduces the time and effort required to identify flies with 10 targeted genomic changes.
    [Show full text]
  • Evaluating the Probability of CRISPR-Based Gene Drive Contaminating Another Species
    bioRxiv preprint doi: https://doi.org/10.1101/776609; this version posted September 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Evaluating the Probability of CRISPR-based Gene Drive Contaminating Another Species 1 2 3 4 Virginie Courtier-Orgogozo ,​ Antoine Danchin ,​ Pierre-Henri Gouyon ​ and Christophe Boëte ​ ​ ​ ​ 1 I​ nstitut Jacques Monod, CNRS, UMR 7592, Université de Paris, Paris, France 2 I​ nstitut Cochin INSERM U1016 – CNRS UMR8104 – Université Paris Descartes, Paris, France 3 I​ nstitut de Systématique, Évolution, Biodiversité, Muséum National d'Histoire Naturelle, CNRS, Sorbonne Université, EPHE, UA, Paris, France 4 I​ SEM, Université de Montpellier, CNRS, IRD, EPHE, Montpellier, France Abstract The probability D that a given CRISPR-based gene drive element contaminates another, non-target species can be estimated by the following Drive Risk Assessment Quantitative Estimate (DRAQUE) Equation: D = (hyb+transf).express.cut.flank.immune.nonextinct with ​ ​ hyb = probability of hybridization between the target species and a non-target species ​ transf = probability of horizontal transfer of a piece of DNA containing the gene drive ​ cassette from the target species to a non-target species (with no hybridization) express = probability that the Cas9 and guide RNA genes are expressed ​ ​ ​ cut = probability that the CRISPR-guide RNA recognizes and cuts at a DNA site in the ​ new host flank = probability that the gene drive cassette inserts at the cut site ​ immune = probability that the immune system does not reject Cas9-expressing cells ​ ​ ​ nonextinct = probability of invasion of the drive within the population ​ We discuss and estimate each of the seven parameters of the equation, with particular emphasis on possible transfers within insects, and between rodents and humans.
    [Show full text]
  • A Review on the Population Genomics of Transposable Elements
    G C A T T A C G G C A T genes Review On the Population Dynamics of Junk: A Review on the Population Genomics of Transposable Elements Yann Bourgeois and Stéphane Boissinot * New York University Abu Dhabi, P.O. 129188 Saadiyat Island, Abu Dhabi, UAE; [email protected] * Correspondence: [email protected] Received: 4 April 2019; Accepted: 21 May 2019; Published: 30 May 2019 Abstract: Transposable elements (TEs) play an important role in shaping genomic organization and structure, and may cause dramatic changes in phenotypes. Despite the genetic load they may impose on their host and their importance in microevolutionary processes such as adaptation and speciation, the number of population genetics studies focused on TEs has been rather limited so far compared to single nucleotide polymorphisms (SNPs). Here, we review the current knowledge about the dynamics of transposable elements at recent evolutionary time scales, and discuss the mechanisms that condition their abundance and frequency. We first discuss non-adaptive mechanisms such as purifying selection and the variable rates of transposition and elimination, and then focus on positive and balancing selection, to finally conclude on the potential role of TEs in causing genomic incompatibilities and eventually speciation. We also suggest possible ways to better model TEs dynamics in a population genomics context by incorporating recent advances in TEs into the rich information provided by SNPs about the demography, selection, and intrinsic properties of genomes. Keywords: transposable elements; population genetics; selection; drift; coevolution 1. Introduction Transposable elements (TEs) are repetitive DNA sequences that are ubiquitous in the living world and have the ability to replicate and multiply within genomes.
    [Show full text]
  • Conversion Between 100-Million-Year-Old Duplicated Genes Contributes to Rice Subspecies Divergence
    Wei et al. BMC Genomics (2021) 22:460 https://doi.org/10.1186/s12864-021-07776-y RESEARCH Open Access Conversion between 100-million-year-old duplicated genes contributes to rice subspecies divergence Chendan Wei1†, Zhenyi Wang1†, Jianyu Wang1†, Jia Teng1, Shaoqi Shen1, Qimeng Xiao1, Shoutong Bao1, Yishan Feng1, Yan Zhang1, Yuxian Li1, Sangrong Sun1, Yuanshuai Yue1, Chunyang Wu1, Yanli Wang1, Tianning Zhou1, Wenbo Xu1, Jigao Yu2,3, Li Wang1* and Jinpeng Wang1,2,3* Abstract Background: Duplicated gene pairs produced by ancient polyploidy maintain high sequence similarity over a long period of time and may result from illegitimate recombination between homeologous chromosomes. The genomes of Asian cultivated rice Oryza sativa ssp. indica (XI) and Oryza sativa ssp. japonica (GJ) have recently been updated, providing new opportunities for investigating ongoing gene conversion events and their impact on genome evolution. Results: Using comparative genomics and phylogenetic analyses, we evaluated gene conversion rates between duplicated genes produced by polyploidization 100 million years ago (mya) in GJ and XI. At least 5.19–5.77% of genes duplicated across the three rice genomes were affected by whole-gene conversion after the divergence of GJ and XI at ~ 0.4 mya, with more (7.77–9.53%) showing conversion of only portions of genes. Independently converted duplicates surviving in the genomes of different subspecies often use the same donor genes. The ongoing gene conversion frequency was higher near chromosome termini, with a single pair of homoeologous chromosomes, 11 and 12, in each rice genome being most affected. Notably, ongoing gene conversion has maintained similarity between very ancient duplicates, provided opportunities for further gene conversion, and accelerated rice divergence.
    [Show full text]
  • The Evolutionary Life History of P Transposons: from Horizontal Invaders to Domesticated Neogenes
    Chromosoma (2001) 110:148–158 DOI 10.1007/s004120100144 CHROMOSOMA FOCUS Wilhelm Pinsker · Elisabeth Haring Sylvia Hagemann · Wolfgang J. Miller The evolutionary life history of P transposons: from horizontal invaders to domesticated neogenes Received: 5 February 2001 / In revised form: 15 March 2001 / Accepted: 15 March 2001 / Published online: 3 May 2001 © Springer-Verlag 2001 Abstract P elements, a family of DNA transposons, are uct of their self-propagating lifestyle. One of the most known as aggressive intruders into the hitherto uninfected intensively studied examples is the P element of Dro- gene pool of Drosophila melanogaster. Invading through sophila, a family of DNA transposons that has proved horizontal transmission from an external source they useful not only as a genetic tool (e.g., transposon tag- managed to spread rapidly through natural populations ging, germline transformation vector), but also as a model within a few decades. Owing to their propensity for rapid system for investigating general features of the evolu- propagation within genomes as well as within popula- tionary behavior of mobile DNA (Kidwell 1994). P ele- tions, they are considered as the classic example of self- ments were first discovered as the causative agent of hy- ish DNA, causing havoc in a genomic environment per- brid dysgenesis in Drosophila melanogaster (Kidwell et missive for transpositional activity. Tracing the fate of P al. 1977) and were later characterized as a family of transposons on an evolutionary scale we describe differ- DNA transposons
    [Show full text]