DOCSLIB.ORG

Drosophila IRBP Bzip Heterodimer Binds P-Element DNA and Affects Hybrid Dysgenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Drosophila IRBP Bzip Heterodimer Binds P-Element DNA and Affects Hybrid Dysgenesis Drosophila IRBP bZIP heterodimer binds P-element DNA and affects hybrid dysgenesis Malik Joseph Francisa, Siobhan Rochea, Michael Jeffrey Choa, Eileen Bealla, Bosun Mina, Ronaldo Paolo Panganibana, and Donald C. Rioa,b,c,1 aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; bCenter for RNA Systems Biology, University of California, Berkeley, CA 94720; and cCalifornia Institute for Quantitative Biosciences, University of California, Berkeley, CA 94720 Edited by Nancy L. Craig, Johns Hopkins University School of Medicine, Baltimore, MD, and approved October 3, 2016 (received for review August 12, 2016) In Drosophila, P-element transposition causes mutagenesis and remain tightly bound by the transposase enzyme (10, 16). The genome instability during hybrid dysgenesis. The P-element flanking donor site DNA is released after P-element cleavage 31-bp terminal inverted repeats (TIRs) contain sequences essential (16) and needs to be efficiently repaired by endogenous DNA for transposase cleavage and have been implicated in DNA repair repair mechanisms. Engineered somatic mobilization of as few via protein–DNA interactions with cellular proteins. The identity and as 15–20 small nonautonomous P elements by transposase leads function of these cellular proteins were unknown. Biochemical char- to a temperature-dependent pupal lethality due to extensive acterization of proteins that bind the TIRs identified a heterodimeric DNA damage and apoptosis (17). basic leucine zipper (bZIP) complex between an uncharacterized pro- Repair of P-element–induced DNA breaks typically occurs tein that we termed “Inverted Repeat Binding Protein (IRBP) 18” and through two distinct DSB repair pathways: nonhomologous end its partner Xrp1. The reconstituted IRBP18/Xrp1 heterodimer binds joining (NHEJ) or a variant of classical homologous recombinational sequence-specifically to its dsDNA-binding site within the P-element repair, termed “Synthesis-Dependent Strand Annealing” (SDSA) TIRs. Genetic analyses implicate both proteins as critical for repair of (18–21) The choice between these two pathways is dictated by cell- DNA breaks following transposase cleavage in vivo. These results cycle location, the availability of pathway substrates, and tissue type identify a cellular protein complex that binds an active mobile ele- (22, 23). ment and plays a more general role in maintaining genome stability. In addition to containing sequences critical for transposase- BIOCHEMISTRY mediated DNA cleavage, the 31-bp TIRs of the P element have been P-transposable elements | DNA repair | IRBP18/CG6272 | Xrp1/CG17836 | postulated to be important for DNA repair (24), perhaps through IRBP complex protein–DNA interactions. To date, the identity and functional role of endogenous Drosophila proteins bound to the 31-bp TIRs in the ransposable elements contribute significantly to the organi- regulation of P-element transposition is undetermined. Previous ge- Tzation and evolution of all eukaryotic genomes. Recent es- netic and biochemical data implicated Drosophila Ku70 as a protein timates of transposon content within the Drosophila melanogaster that bound to the P-element TIRs (25). However, recombinant genome are between 5% and 10%, and in humans over half the Drosophila Ku70 alone or as a heterodimer with Ku80 did not bind genome is composed of mobile elements (1, 2). Although many the 31-bp TIRs sequence-specifically. of these elements, including the Drosophila P-element trans- In this report, we purified a multisubunit Inverted Repeat poson, are still active (3), the cellular mechanisms used to Binding Protein (IRBP) complex that binds sequence-specifically combat the genotoxic effects of DNA double-strand breaks to the outer 16 bp of the P-element 31-bp TIRs. The core DNA- (DSBs) generated by transpositional recombination are not fully binding subunits of this complex consist of a basic leucine zipper understood. The Drosophila P-transposable element provides an (bZIP) heterodimer between Xrp1 (CG17836) and a previously excellent model for understanding the ancient mechanisms used uncharacterized 18-kDa CAAT/Enhancer Binding Protein (C/EBP) by the cell to counteract newly invading parasitic mobile DNA elements (4). The P-element transposon is a mobile DNA element that Significance spread through wild populations of D. melangaster ∼100 y ago after most common laboratory strains were isolated (5, 6). P The P-element transposon is a mobile DNA that invaded the Dro- elements were identified by studying a genetic syndrome called sophila genome approximately 100 y ago. P elements were iden- “P-M hybrid dysgenesis.” It was observed that males from wild tified by studying a genetic syndrome called “hybrid dysgenesis.” populations (P strains) crossed to females from isolated labo- The elements use their encoded transposase for mobility, but rely ratory stocks (M strains) yielded progeny that had germline on host-cell factors for essential parts of their life cycle. Here we Drosophila mutations, temperature-sensitive sterility, and atypical male demonstrate biochemically that a -encoded bZIP heter- recombination (6). Reciprocal crosses yielded phenotypically odimer binds to the P-element terminal 31-bp sequences. We used normal progeny. The P element was shown to be the causative genetics to show that these proteins play a role in repairing DNA agent of these so-called P-M hybrid dysgenesis phenotypes by breaks caused by P-element transposase activity during hybrid molecular analyses showing that P elements were present in dysgenesis and other types of DNA damage. These results provide variable locations in P strains yet totally absent from most M an example of the mechanisms that the host genome uses to strains (7, 8). combat genome instability caused by foreign DNA invasion. The Drosophila P-element transposon encodes a GTP-de- Author contributions: M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. designed research; pendent site-specific DNA transposase/integrase family enzyme M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. performed research; M.J.F., S.R., and E.B. (9, 10). At each end of the P-element transposon are perfect contributed new reagents/analytic tools; M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. 31-bp terminal inverted repeats (TIRs), 11-bp internal inverted analyzed data; and M.J.F., S.R., E.B., and D.C.R. wrote the paper. repeats that serve as enhancers of transposition, and internal The authors declare no conflict of interest. 10-bp transposase binding sites (11–13) (Fig. 1A). The P-element This article is a PNAS Direct Submission. transposase catalyzes DNA cleavage within the 31-bp TIRs to 1To whom correspondence should be addressed. Email: [email protected]. ′ create 17-nt 3 single-strand extensions at both the donor site This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. and the transposon ends (14, 15). The cleaved P-element ends 1073/pnas.1613508113/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1613508113 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 A 31 bp IR 31 bp IR B C 5’ 31bp Inverted Repeat CATGATGAAATAACATAAGGTGGTCCCGTCG CGACGGGACCACCTTATGTTATTTCATCATG Mono S Fractions WT 1 31 2877 2907 LS 4-15 Wash FT No protein Input 5678 9101112 Mono S Fractions 11 bp IR 11 bp IR ATTAACCCTTA TAAGGGTTAAT Fr 6 Fr 7 Fr 8 Fr 9 Fr 11 126 136 2763 2773 W M W M W M W M W M 116 - Exon 1 Exon 4 - 8 bp 8 bp 97 Exon 2 Exon 3 - Repeat 66 ORF 0 ORF 1 ORF 2 ORF 3 45 - target target 31bp Inverted 5’ dup dup 1 85 442 501 1168 1222 1947 2138 2706 2907 31 - 8bp IVS1 IVS2 IVS3 TSD (Intron 1) (Intron 2) (Intron 3) 5‘ CATGATGAAATAACAT 21- IRBP18 14- 12345678 9101112 1 2345678910 D Tandem Affinity Purified E F IRBP Complex Mono S Fractions -EtBr+EtBr [KCl] InputFT 75 kDa 100 α Xrp1 80 70 . 20 kDa 60 Xrp1 α IRBP18 50 Darker Exposure 30 1 23 4 5 6 7 8 } 25 DNase I . 3XFLAG IRBP18 20 Footprinting Activity 15 123 1 2 Fig. 1. IRBP18 and Xrp1 bind the P-element inverted repeats. (A) Diagram of the organization of the P-element transposon. (B) DNase I protection assay of the 5′-end of the P element with Mono S column fractions. The sequence indicates the portion of P-element TIR bound by the IRBP complex. (C) Autora- diograph of an 8–20% gradient SDS/PAGE containing UV photochemical cross-linking reactions performed with the Mono S fractions with a wild-type (lanes 1, 3, 5, 7, and 9) or LS 4–15 mutant (lanes 2, 4, 6, 8, and 10) 32P-labeled, BrdUrd-substituted 5′ inverted repeat DNA probe. (D) DNase I protection assay of the purified IRBP complex eluted from FLAG antibody resin. (E) Silver stain SDS/PAGE analysis of the 3XFLAG-eluted complex separated by 12% SDS/PAGE. FLAG immunoaffinity chromatography was performed in the presence (+) and absence (−) of ethidium bromide (EtBr) (150 μg/mL). (F) Immunoblot analysis of MonoS column fractions for the presence of IRBP18 and Xrp1 with affinity-purified antibodies (1:2,000). family member, we termed “Inverted Repeat Binding Protein mutant inverted repeat DNA probe contained several nucleotide 18 kDa” (IRBP18/CG6272). Purified recombinant IRBP18/Xrp1 substitutions within the outer half of the 31-bp TIR (Fig. 1C)(12). heterodimer reconstitutes high-affinity and sequence-specific Following UV cross-linking and nuclease treatment, samples were dsDNA binding to TIRs. In vivo analyses indicate that the fractionated by SDS/PAGE. In protein fractions with peak IRBP IRBP complex protects cleaved donor DNA ends and facili- DNase I protection, an ∼18-kDa protein was strongly cross-linked tates efficient repair of DSBs created after transposase cleav- to the wild-type inverted repeat probe (fractions 8 and 9; Fig.
Load more

Recommended publications
  • Copy Number of P Elements, KP/Full-Sized P Element Ratio and Their Relationships with Environmental Factors in Brazilian Drosophila Melanogaster Populations
    Heredity (2003) 91, 570–576 & 2003 Nature Publishing Group All rights reserved 0018-067X/03 $25.00 www.nature.com/hdy Copy number of P elements, KP/full-sized P element ratio and their relationships with environmental factors in Brazilian Drosophila melanogaster populations MT Ruiz and CMA Carareto Departamento de Biologia, IBILCE, Universidade Estadual Paulista, Rua Cristo´va˜o Colombo, 2265, Jardim Nazare´,Sa˜o Jose´ do Rio Preto 15054-000, SP, Brazil The P transposable element copy numbers and the KP/full- and the strains from less extreme latitudes had many sized P element ratios were determined in eight Brazilian more full-sized P than KP elements. However, no clinal strains of Drosophila melanogaster. Strains from tropical variation was observed. Strains from different localities, regions showed lower overall P element copy numbers previously classified as having P cytotype, displayed a higher than did strains from temperate regions. Variable numbers of or a lower proportion of KP elements than of full-sized full-sized and defective elements were detected, but the P elements, as well as an equal number of the two element full-sized P and KP elements were the predominant classes types, showing that the same phenotype may be produced of elements in all strains. The full-sized P and KP element by different underlying genomic components of the P–M ratios were calculated and compared with latitude. The system. northernmost and southernmost Brazilian strains showed Heredity (2003) 91, 570–576, advance online publication, fewer full-sized elements than KP elements per genome, 17 September 2003; doi:10.1038/sj.hdy.6800360 Keywords: P transposable elements; KP elements; KP/full-sized P elements; P–M systems; Drosophila melanogaster Introduction elements, allows P element transposition (Engels, 1983).
    [Show full text]
  • Interspecific DNA Transformation in Drosophila (Drosophila Melanogaster/Drosophila Simulans/Rosy Gene/P Element/Transposable Element) NANCY J
    Proc. Nati. Acad. Sci. USA Vol. 81, pp. 7515-7519, December 1984 Genetics Interspecific DNA transformation in Drosophila (Drosophila melanogaster/Drosophila simulans/rosy gene/P element/transposable element) NANCY J. SCAVARDA AND DANIEL L. HARTL Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110 Communicated by Peter H. Raven, August 7, 1984 ABSTRACT A DNA fragment that includes the wild-type (4). Use of an average rate of synonymous substitutions in rosy (ry+) gene of Drosophila melanogaster has been intro- coding regions of 5.1 + 0.3 x 10-9 per nucleotide site per yr duced by microinjection into the germ line of the reproductive- (9, 10) results in an estimated time since separation of 4.1 + ly isolated species Drosophila simulans and incorporated into 0.2 million yr, but analogous estimates based on rates of nu- the D. simulans genome. Transformation was mediated by the cleotide substitution in intervening sequences range from 3.8 transposable element P, which occurs in the genome of most to 6.8 million yr. These estimates are uncertain because av- natural populations ofD. melanogaster but not in D. simulans. erage rates of substitution in other organisms may have little Rubin and Spradling [Rubin, G. M. & Spradling, A. C. relevance to insects, and because evolutionary change in the (1982) Science 218, 348-353] have previously shown that the gene coding for alcohol dehydrogenase may be atypical. ry' DNA fragment, which is flanked by recognition sequences Although D. melanogaster and D. simulans are reproduc- of P element, can transform the germ line ofD.
    [Show full text]
  • Evolution of Pogo, a Separate Superfamily of IS630-Tc1-Mariner
    Gao et al. Mobile DNA (2020) 11:25 https://doi.org/10.1186/s13100-020-00220-0 RESEARCH Open Access Evolution of pogo, a separate superfamily of IS630-Tc1-mariner transposons, revealing recurrent domestication events in vertebrates Bo Gao, Yali Wang, Mohamed Diaby, Wencheng Zong, Dan Shen, Saisai Wang, Cai Chen, Xiaoyan Wang and Chengyi Song* Abstracts Background: Tc1/mariner and Zator, as two superfamilies of IS630-Tc1-mariner (ITm) group, have been well-defined. However, the molecular evolution and domestication of pogo transposons, once designated as an important family of the Tc1/mariner superfamily, are still poorly understood. Results: Here, phylogenetic analysis show that pogo transposases, together with Tc1/mariner,DD34E/Gambol,and Zator transposases form four distinct monophyletic clades with high bootstrap supports (> = 74%), suggesting that they are separate superfamilies of ITm group. The pogo superfamily represents high diversity with six distinct families (Passer, Tigger, pogoR, Lemi, Mover,andFot/Fot-like) and wide distribution with an expansion spanning across all the kingdoms of eukaryotes. It shows widespread occurrences in animals and fungi, but restricted taxonomic distribution in land plants. It has invaded almost all lineages of animals—even mammals—and has been domesticated repeatedly in vertebrates, with 12 genes, including centromere-associated protein B (CENPB), CENPB DNA-binding domain containing 1 (CENPBD1), Jrk helix–turn–helix protein (JRK), JRK like (JRKL), pogo transposable element derived with KRAB domain (POGK), and with ZNF domain (POGZ), and Tigger transposable element-derived 2 to 7 (TIGD2–7), deduced as originating from this superfamily. Two of them (JRKL and TIGD2) seem to have been co-domesticated, and the others represent independent domestication events.
    [Show full text]
  • Genome of Drosophila Guanche WOLFGANG J
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 4018-4022, May 1992 Genetics P-element homologous sequences are tandemly repeated in the genome of Drosophila guanche WOLFGANG J. MILLER*, SYLVIA HAGEMANNt, ELEONORE REITERt, AND WILHELM PINSKERtt *Institut fur Botanik, Abteilung Cytologie und Genetik, Rennweg 14, A-1030 Vienna, Austria; and tInstitut fur Allgemeine Biologie, Abteilung Genetik, Wahringerstrasse 17, A-1090 Vienna, Austria Communicated by Bruce Wallace, December 23, 1991 ABSTRACT In Drosophila guanche, P-homologous se- In germ-line cells, the copy number of P elements is quences were found to be located in a tandem repetitive array genetically regulated by a complex mixture of chromosomal (copy number: 20-50) at a single genomic site. The cytological and cytoplasmic factors (11). At least two mechanisms can be position on the polytene chromosomes was determined by in situ distinguished: the maternally transmitted cytotype (12) and a hybridization (chromosome 0: 85C). Sequencing of one com- chromosomally inherited control system (13). In the P cyto- plete repeat unit (3.25 kilobases) revealed high sequence simi- type, the cytoplasmic state of P-strain individuals, transpo- larity between the central coding region comprising exons 0 to sition is repressed in somatic cells and in the germ line. In 2 and the corresponding section of the Drosophila melanogaster general the P cytotype develops gradually as a result of the P element. The rest of the sequence has diverged considerably. increasing number of P-element copies. M-strains, on the Exon 3 has no coding function and the inverted repeats have other hand, have genomes devoid of P elements.
    [Show full text]
  • History to the Rescue Pseudogenes Get Some Respect Flyin' Pain Free
    RESEARCH NOTES Pseudogenes get some respect adenoviral entry is mediated by interaction between RGD motifs and integrins, they went on to engineer a virus with an RGD peptide. This Pseudogenes are the non-functional remnants of genes that have version of the modified virus specifically infected tumor cells and repli- been thought to do nothing more than take up space. A new cated more effectively than Delta-24. When injected directly into report by Shinji Hirotsune and colleagues provides evidence that human gliomas xenografted into mice, Delta-24-RGD allowed signifi- at least one such pseudogene has an essential role as a regulator of cantly longer survival than did Delta-24 or an inactivated virus control. gene expression (Nature 423, 91–96; 2003). A fortuitous insertion More impressively, 60% of mice treated with Delta-24-RGD were long- of a transgene into the Makorin1-p1 locus generated a mouse term survivors (compared with 15% of those treated with Delta-24 with a bone deformity and polycystic kidneys. Makorin1-p1 is a characterized by complete tumor regression). MH pseudogene that is normally transcribed, although no functional protein product can be produced. Strikingly, the transgene insertion reduced not only the transcription of Makorin1-p1, but RNAi on or off target? that of its functional homolog, Makorin1, as well. In vitro Two new reports examine the specificity of RNA interference (RNAi) in experiments show that an intact Makorin1-p1 locus stabilizes the human cells using genome-wide expression profiling. Targeting exoge- Makorin1 mRNA, and a rescue of the original transgenic mouse nous GFP in human embryonic kidney cells, Jen-Tsan Chi and col- with Makorin1-p1 proves that the pseudogene is required for leagues report efficient and specific knockdown using two different normal expression of Makorin1.
    [Show full text]
  • Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using White Co-Conversion
    G3: Genes|Genomes|Genetics Early Online, published on August 26, 2016 as doi:10.1534/g3.116.032557 Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-Conversion Daniel Tianfang Ge*,†,1, Cindy Tipping*,‡,1, Michael H. Brodsky§, Phillip D. Zamore*,‡,**,2 *RNA Therapeutics Institute, †Interdisciplinary Graduate Program, ‡Howard Hughes Medical Institute, §Department of Molecular, Cell and Cancer Biology, **Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, MA 01605, USA 1These authors contributed equally to this work. 2To whom correspondence should be addressed. 1 © The Author(s) 2013. Published by the Genetics Society of America. Running title: Rapid Screening for CRISPR Editing Keywords: Cas9; Co-Conversion; Genetic Screen; Microhomology-Mediated End Joining; Homologous Recombination Corresponding author: Phillip D. Zamore Address: 368 Plantation Street, AS4-2053, Worcester, MA 01605 Tel.: 508-856-2191 E-mail: [email protected] 2 1 ABSTRACT 2 Adoption of a streamlined version of the bacterial CRISPR/Cas9 defense system has 3 accelerated targeted genome engineering. The Streptococcus pyogenes Cas9 protein, 4 directed by a simplified, CRISPR-like single guide RNA, catalyzes a double-stranded 5 DNA break at a specific genomic site; subsequent repair by end joining can introduce 6 mutagenic insertions or deletions, while repair by homologous recombination using an 7 exogenous DNA template can incorporate new sequence at the target locus. However, 8 the efficiency of Cas9-directed mutagenesis is low in Drosophila melanogaster. Here, we 9 describe a strategy that reduces the time and effort required to identify flies with 10 targeted genomic changes.
    [Show full text]
  • Evaluating the Probability of CRISPR-Based Gene Drive Contaminating Another Species
    bioRxiv preprint doi: https://doi.org/10.1101/776609; this version posted September 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Evaluating the Probability of CRISPR-based Gene Drive Contaminating Another Species 1 2 3 4 Virginie Courtier-Orgogozo ,​ Antoine Danchin ,​ Pierre-Henri Gouyon ​ and Christophe Boëte ​ ​ ​ ​ 1 I​ nstitut Jacques Monod, CNRS, UMR 7592, Université de Paris, Paris, France 2 I​ nstitut Cochin INSERM U1016 – CNRS UMR8104 – Université Paris Descartes, Paris, France 3 I​ nstitut de Systématique, Évolution, Biodiversité, Muséum National d'Histoire Naturelle, CNRS, Sorbonne Université, EPHE, UA, Paris, France 4 I​ SEM, Université de Montpellier, CNRS, IRD, EPHE, Montpellier, France Abstract The probability D that a given CRISPR-based gene drive element contaminates another, non-target species can be estimated by the following Drive Risk Assessment Quantitative Estimate (DRAQUE) Equation: D = (hyb+transf).express.cut.flank.immune.nonextinct with ​ ​ hyb = probability of hybridization between the target species and a non-target species ​ transf = probability of horizontal transfer of a piece of DNA containing the gene drive ​ cassette from the target species to a non-target species (with no hybridization) express = probability that the Cas9 and guide RNA genes are expressed ​ ​ ​ cut = probability that the CRISPR-guide RNA recognizes and cuts at a DNA site in the ​ new host flank = probability that the gene drive cassette inserts at the cut site ​ immune = probability that the immune system does not reject Cas9-expressing cells ​ ​ ​ nonextinct = probability of invasion of the drive within the population ​ We discuss and estimate each of the seven parameters of the equation, with particular emphasis on possible transfers within insects, and between rodents and humans.
    [Show full text]
  • A Review on the Population Genomics of Transposable Elements
    G C A T T A C G G C A T genes Review On the Population Dynamics of Junk: A Review on the Population Genomics of Transposable Elements Yann Bourgeois and Stéphane Boissinot * New York University Abu Dhabi, P.O. 129188 Saadiyat Island, Abu Dhabi, UAE; [email protected] * Correspondence: [email protected] Received: 4 April 2019; Accepted: 21 May 2019; Published: 30 May 2019 Abstract: Transposable elements (TEs) play an important role in shaping genomic organization and structure, and may cause dramatic changes in phenotypes. Despite the genetic load they may impose on their host and their importance in microevolutionary processes such as adaptation and speciation, the number of population genetics studies focused on TEs has been rather limited so far compared to single nucleotide polymorphisms (SNPs). Here, we review the current knowledge about the dynamics of transposable elements at recent evolutionary time scales, and discuss the mechanisms that condition their abundance and frequency. We first discuss non-adaptive mechanisms such as purifying selection and the variable rates of transposition and elimination, and then focus on positive and balancing selection, to finally conclude on the potential role of TEs in causing genomic incompatibilities and eventually speciation. We also suggest possible ways to better model TEs dynamics in a population genomics context by incorporating recent advances in TEs into the rich information provided by SNPs about the demography, selection, and intrinsic properties of genomes. Keywords: transposable elements; population genetics; selection; drift; coevolution 1. Introduction Transposable elements (TEs) are repetitive DNA sequences that are ubiquitous in the living world and have the ability to replicate and multiply within genomes.
    [Show full text]
  • The Evolutionary Life History of P Transposons: from Horizontal Invaders to Domesticated Neogenes
    Chromosoma (2001) 110:148–158 DOI 10.1007/s004120100144 CHROMOSOMA FOCUS Wilhelm Pinsker · Elisabeth Haring Sylvia Hagemann · Wolfgang J. Miller The evolutionary life history of P transposons: from horizontal invaders to domesticated neogenes Received: 5 February 2001 / In revised form: 15 March 2001 / Accepted: 15 March 2001 / Published online: 3 May 2001 © Springer-Verlag 2001 Abstract P elements, a family of DNA transposons, are uct of their self-propagating lifestyle. One of the most known as aggressive intruders into the hitherto uninfected intensively studied examples is the P element of Dro- gene pool of Drosophila melanogaster. Invading through sophila, a family of DNA transposons that has proved horizontal transmission from an external source they useful not only as a genetic tool (e.g., transposon tag- managed to spread rapidly through natural populations ging, germline transformation vector), but also as a model within a few decades. Owing to their propensity for rapid system for investigating general features of the evolu- propagation within genomes as well as within popula- tionary behavior of mobile DNA (Kidwell 1994). P ele- tions, they are considered as the classic example of self- ments were first discovered as the causative agent of hy- ish DNA, causing havoc in a genomic environment per- brid dysgenesis in Drosophila melanogaster (Kidwell et missive for transpositional activity. Tracing the fate of P al. 1977) and were later characterized as a family of transposons on an evolutionary scale we describe differ- DNA transposons
    [Show full text]
  • CRISPR/Cas9 and Genome Editing in Drosophila*
    Available online at www.sciencedirect.com ScienceDirect JGG Journal of Genetics and Genomics 41 (2014) 7e19 REVIEW CRISPR/Cas9 and Genome Editing in Drosophila* Andrew R. Bassett*, Ji-Long Liu* MRC Functional Genomics Unit, University of Oxford, Department of Physiology, Anatomy and Genetics, South Parks Road, Oxford OX1 3QX, United Kingdom Received 25 November 2013; revised 10 December 2013; accepted 11 December 2013 Available online 18 December 2013 ABSTRACT Recent advances in our ability to design DNA binding factors with specificity for desired sequences have resulted in a revolution in genetic engineering, enabling directed changes to the genome to be made relatively easily. Traditional techniques for generating genetic mutations in most organisms have relied on selection from large pools of randomly induced mutations for those of particular interest, or time-consuming gene targeting by homologous recombination. Drosophila melanogaster has always been at the forefront of genetic analysis, and application of these new genome editing techniques to this organism will revolutionise our approach to performing analysis of gene function in the future. We discuss the recent techniques that apply the CRISPR/Cas9 system to Drosophila, highlight potential uses for this technology and speculate upon the future of genome engineering in this model organism. KEYWORDS: Drosophila melanogaster; CRISPR; Cas9; Genome engineering; Targeted mutagenesis INTRODUCTION mutagenise or alter gene function in a desired manner (Rong and Golic, 2000), the difficulty of applying these techniques The advent of genome sequencing and genome-wide on a large scale has restricted our ability to test hypotheses technologies for study of gene expression, polymorphism generated from such genome-wide analyses.
    [Show full text]
  • Genetic Evidence for Adaptation-Driven Incipient Speciation of Drosophila Melanogaster Along a Microclimatic Contrast in ‘‘Evolution Canyon,’’ Israel
    Genetic evidence for adaptation-driven incipient speciation of Drosophila melanogaster along a microclimatic contrast in ‘‘Evolution Canyon,’’ Israel Pawel Michalak*†, Irina Minkov†, Amanda Helin*, Daniel N. Lerman*, Brian R. Bettencourt*, Martin E. Feder*, Abraham B. Korol†, and Eviatar Nevo†‡ *Department of Organismal Biology and Anatomy, University of Chicago, 1027 East 57th Street, Chicago, IL 60637-1508; and †Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel Contributed by Eviatar Nevo, September 11, 2001 Substantial genetic differentiation, as great as among species, (16–18). We thus ask: Have the populations likewise diverged exists between populations of Drosophila melanogaster inhabiting genetically according to microsatellite markers and a candidate opposite slopes of a small canyon. Previous work has shown that gene strongly linked to resistance to environmental stress? Is this prezygotic sexual isolation and numerous differences in stress- divergence consistent with genetic isolation despite the conti- related phenotypes have evolved between D. melanogaster pop- guity of the D. melanogaster populations in the canyon? Finally, ulations in ‘‘Evolution Canyon,’’ Israel, in which slopes 100–400 m does the divergence implicate any evolutionary mechanism(s) as apart differ dramatically in aridity, solar radiation, and associated its cause? vegetation. Because the canyon’s width is well within flies’ dis- To address these questions, we analyzed both putatively persal capabilities, we examined genetic changes associated with neutral (microsatellites) and non-neutral (hsp70Ba, a heat shock local adaptation and incipient speciation in the absence of geo- gene) markers in D. melanogaster collected from the middle EVOLUTION graphical isolation. Here we report remarkable genetic differenti- elevation of each slope.
    [Show full text]
  • Downloads/Repeatmaskedgenomes
    Kojima Mobile DNA (2018) 9:2 DOI 10.1186/s13100-017-0107-y REVIEW Open Access Human transposable elements in Repbase: genomic footprints from fish to humans Kenji K. Kojima1,2 Abstract Repbase is a comprehensive database of eukaryotic transposable elements (TEs) and repeat sequences, containing over 1300 human repeat sequences. Recent analyses of these repeat sequences have accumulated evidences for their contribution to human evolution through becoming functional elements, such as protein-coding regions or binding sites of transcriptional regulators. However, resolving the origins of repeat sequences is a challenge, due to their age, divergence, and degradation. Ancient repeats have been continuously classified as TEs by finding similar TEs from other organisms. Here, the most comprehensive picture of human repeat sequences is presented. The human genome contains traces of 10 clades (L1, CR1, L2, Crack, RTE, RTEX, R4, Vingi, Tx1 and Penelope) of non-long terminal repeat (non-LTR) retrotransposons (long interspersed elements, LINEs), 3 types (SINE1/7SL, SINE2/tRNA, and SINE3/5S) of short interspersed elements (SINEs), 1 composite retrotransposon (SVA) family, 5 classes (ERV1, ERV2, ERV3, Gypsy and DIRS) of LTR retrotransposons, and 12 superfamilies (Crypton, Ginger1, Harbinger, hAT, Helitron, Kolobok, Mariner, Merlin, MuDR, P, piggyBac and Transib) of DNA transposons. These TE footprints demonstrate an evolutionary continuum of the human genome. Keywords: Human repeat, Transposable elements, Repbase, Non-LTR retrotransposons, LTR retrotransposons, DNA transposons, SINE, Crypton, MER, UCON Background contrast, MER4 was revealed to be comprised of LTRs of Repbase and conserved noncoding elements endogenous retroviruses (ERVs) [1]. Right now, Repbase Repbase is now one of the most comprehensive data- keeps MER1 to MER136, some of which are further bases of eukaryotic transposable elements and repeats divided into several subfamilies.
    [Show full text]