Drosophila IRBP bZIP heterodimer binds P-element DNA and affects hybrid dysgenesis Malik Joseph Francisa, Siobhan Rochea, Michael Jeffrey Choa, Eileen Bealla, Bosun Mina, Ronaldo Paolo Panganibana, and Donald C. Rioa,b,c,1 aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; bCenter for RNA Systems Biology, University of California, Berkeley, CA 94720; and cCalifornia Institute for Quantitative Biosciences, University of California, Berkeley, CA 94720 Edited by Nancy L. Craig, Johns Hopkins University School of Medicine, Baltimore, MD, and approved October 3, 2016 (received for review August 12, 2016) In Drosophila, P-element transposition causes mutagenesis and remain tightly bound by the transposase enzyme (10, 16). The genome instability during hybrid dysgenesis. The P-element flanking donor site DNA is released after P-element cleavage 31-bp terminal inverted repeats (TIRs) contain sequences essential (16) and needs to be efficiently repaired by endogenous DNA for transposase cleavage and have been implicated in DNA repair repair mechanisms. Engineered somatic mobilization of as few via protein–DNA interactions with cellular proteins. The identity and as 15–20 small nonautonomous P elements by transposase leads function of these cellular proteins were unknown. Biochemical char- to a temperature-dependent pupal lethality due to extensive acterization of proteins that bind the TIRs identified a heterodimeric DNA damage and apoptosis (17). basic leucine zipper (bZIP) complex between an uncharacterized pro- Repair of P-element–induced DNA breaks typically occurs tein that we termed “Inverted Repeat Binding Protein (IRBP) 18” and through two distinct DSB repair pathways: nonhomologous end its partner Xrp1. The reconstituted IRBP18/Xrp1 heterodimer binds joining (NHEJ) or a variant of classical homologous recombinational sequence-specifically to its dsDNA-binding site within the P-element repair, termed “Synthesis-Dependent Strand Annealing” (SDSA) TIRs. Genetic analyses implicate both proteins as critical for repair of (18–21) The choice between these two pathways is dictated by cell- DNA breaks following transposase cleavage in vivo. These results cycle location, the availability of pathway substrates, and tissue type identify a cellular protein complex that binds an active mobile ele- (22, 23). ment and plays a more general role in maintaining genome stability. In addition to containing sequences critical for transposase- BIOCHEMISTRY mediated DNA cleavage, the 31-bp TIRs of the P element have been P-transposable elements | DNA repair | IRBP18/CG6272 | Xrp1/CG17836 | postulated to be important for DNA repair (24), perhaps through IRBP complex protein–DNA interactions. To date, the identity and functional role of endogenous Drosophila proteins bound to the 31-bp TIRs in the ransposable elements contribute significantly to the organi- regulation of P-element transposition is undetermined. Previous ge- Tzation and evolution of all eukaryotic genomes. Recent es- netic and biochemical data implicated Drosophila Ku70 as a protein timates of transposon content within the Drosophila melanogaster that bound to the P-element TIRs (25). However, recombinant genome are between 5% and 10%, and in humans over half the Drosophila Ku70 alone or as a heterodimer with Ku80 did not bind genome is composed of mobile elements (1, 2). Although many the 31-bp TIRs sequence-specifically. of these elements, including the Drosophila P-element trans- In this report, we purified a multisubunit Inverted Repeat poson, are still active (3), the cellular mechanisms used to Binding Protein (IRBP) complex that binds sequence-specifically combat the genotoxic effects of DNA double-strand breaks to the outer 16 bp of the P-element 31-bp TIRs. The core DNA- (DSBs) generated by transpositional recombination are not fully binding subunits of this complex consist of a basic leucine zipper understood. The Drosophila P-transposable element provides an (bZIP) heterodimer between Xrp1 (CG17836) and a previously excellent model for understanding the ancient mechanisms used uncharacterized 18-kDa CAAT/Enhancer Binding Protein (C/EBP) by the cell to counteract newly invading parasitic mobile DNA elements (4). The P-element transposon is a mobile DNA element that Significance spread through wild populations of D. melangaster ∼100 y ago after most common laboratory strains were isolated (5, 6). P The P-element transposon is a mobile DNA that invaded the Dro- elements were identified by studying a genetic syndrome called sophila genome approximately 100 y ago. P elements were iden- “P-M hybrid dysgenesis.” It was observed that males from wild tified by studying a genetic syndrome called “hybrid dysgenesis.” populations (P strains) crossed to females from isolated labo- The elements use their encoded transposase for mobility, but rely ratory stocks (M strains) yielded progeny that had germline on host-cell factors for essential parts of their life cycle. Here we Drosophila mutations, temperature-sensitive sterility, and atypical male demonstrate biochemically that a -encoded bZIP heter- recombination (6). Reciprocal crosses yielded phenotypically odimer binds to the P-element terminal 31-bp sequences. We used normal progeny. The P element was shown to be the causative genetics to show that these proteins play a role in repairing DNA agent of these so-called P-M hybrid dysgenesis phenotypes by breaks caused by P-element transposase activity during hybrid molecular analyses showing that P elements were present in dysgenesis and other types of DNA damage. These results provide variable locations in P strains yet totally absent from most M an example of the mechanisms that the host genome uses to strains (7, 8). combat genome instability caused by foreign DNA invasion. The Drosophila P-element transposon encodes a GTP-de- Author contributions: M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. designed research; pendent site-specific DNA transposase/integrase family enzyme M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. performed research; M.J.F., S.R., and E.B. (9, 10). At each end of the P-element transposon are perfect contributed new reagents/analytic tools; M.J.F., S.R., M.J.C., E.B., B.M., R.P.P., and D.C.R. 31-bp terminal inverted repeats (TIRs), 11-bp internal inverted analyzed data; and M.J.F., S.R., E.B., and D.C.R. wrote the paper. repeats that serve as enhancers of transposition, and internal The authors declare no conflict of interest. 10-bp transposase binding sites (11–13) (Fig. 1A). The P-element This article is a PNAS Direct Submission. transposase catalyzes DNA cleavage within the 31-bp TIRs to 1To whom correspondence should be addressed. Email: [email protected]. ′ create 17-nt 3 single-strand extensions at both the donor site This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. and the transposon ends (14, 15). The cleaved P-element ends 1073/pnas.1613508113/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1613508113 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 A 31 bp IR 31 bp IR B C 5’ 31bp Inverted Repeat CATGATGAAATAACATAAGGTGGTCCCGTCG CGACGGGACCACCTTATGTTATTTCATCATG Mono S Fractions WT 1 31 2877 2907 LS 4-15 Wash FT No protein Input 5678 9101112 Mono S Fractions 11 bp IR 11 bp IR ATTAACCCTTA TAAGGGTTAAT Fr 6 Fr 7 Fr 8 Fr 9 Fr 11 126 136 2763 2773 W M W M W M W M W M 116 - Exon 1 Exon 4 - 8 bp 8 bp 97 Exon 2 Exon 3 - Repeat 66 ORF 0 ORF 1 ORF 2 ORF 3 45 - target target 31bp Inverted 5’ dup dup 1 85 442 501 1168 1222 1947 2138 2706 2907 31 - 8bp IVS1 IVS2 IVS3 TSD (Intron 1) (Intron 2) (Intron 3) 5‘ CATGATGAAATAACAT 21- IRBP18 14- 12345678 9101112 1 2345678910 D Tandem Affinity Purified E F IRBP Complex Mono S Fractions -EtBr+EtBr [KCl] InputFT 75 kDa 100 α Xrp1 80 70 . 20 kDa 60 Xrp1 α IRBP18 50 Darker Exposure 30 1 23 4 5 6 7 8 } 25 DNase I . 3XFLAG IRBP18 20 Footprinting Activity 15 123 1 2 Fig. 1. IRBP18 and Xrp1 bind the P-element inverted repeats. (A) Diagram of the organization of the P-element transposon. (B) DNase I protection assay of the 5′-end of the P element with Mono S column fractions. The sequence indicates the portion of P-element TIR bound by the IRBP complex. (C) Autora- diograph of an 8–20% gradient SDS/PAGE containing UV photochemical cross-linking reactions performed with the Mono S fractions with a wild-type (lanes 1, 3, 5, 7, and 9) or LS 4–15 mutant (lanes 2, 4, 6, 8, and 10) 32P-labeled, BrdUrd-substituted 5′ inverted repeat DNA probe. (D) DNase I protection assay of the purified IRBP complex eluted from FLAG antibody resin. (E) Silver stain SDS/PAGE analysis of the 3XFLAG-eluted complex separated by 12% SDS/PAGE. FLAG immunoaffinity chromatography was performed in the presence (+) and absence (−) of ethidium bromide (EtBr) (150 μg/mL). (F) Immunoblot analysis of MonoS column fractions for the presence of IRBP18 and Xrp1 with affinity-purified antibodies (1:2,000). family member, we termed “Inverted Repeat Binding Protein mutant inverted repeat DNA probe contained several nucleotide 18 kDa” (IRBP18/CG6272). Purified recombinant IRBP18/Xrp1 substitutions within the outer half of the 31-bp TIR (Fig. 1C)(12). heterodimer reconstitutes high-affinity and sequence-specific Following UV cross-linking and nuclease treatment, samples were dsDNA binding to TIRs. In vivo analyses indicate that the fractionated by SDS/PAGE. In protein fractions with peak IRBP IRBP complex protects cleaved donor DNA ends and facili- DNase I protection, an ∼18-kDa protein was strongly cross-linked tates efficient repair of DSBs created after transposase cleav- to the wild-type inverted repeat probe (fractions 8 and 9; Fig.