Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2964–2969, March 1999 Genetics Microsatellite instability in Drosophila spellchecker1 (MutS homolog) mutants (mismatch repairydouble-strand break repairyhomologous recombinationygene conversionyhereditary nonpolyopsis colon cancer) CARLOS FLORES AND WILLIAM ENGELS* Laboratory of Genetics, University of Wisconsin, Madison, WI 53706 Communicated by William F. Dove, University of Wisconsin, Madison, WI, January 19, 1999 (received for review September 29, 1998) ABSTRACT We have cloned a mutS homolog from Dro- This mismatch repair system has been conserved throughout sophila melanogaster called spellchecker1 (spel1) and have con- evolution. At present, MSHs have been found in 14 species of structed spel1 mutant flies. MutS proteins promote the cor- bacteria and 10 species of eukaryotes ranging from fungi to rection of DNA mismatches and serve important roles in DNA humans. In some species, e.g., Saccharomyces cerevisiae,as replication, recombination, and repair. The spel1 gene belongs many as six MSH genes have been found. In general, when to a subfamily of mutS first characterized by the MSH2 gene multiple MSH genes are found in a species, they each have a of yeast and which also includes hMSH2, one of the two major distinct function. Of the six genes in yeast, MSH1 caries out the hereditary nonpolyposis colon cancer loci of humans. Like repair of mitochondrial DNA (24), while MSH3 and MSH6 act msh2 mutants in other species, we find that flies lacking the as specificity subunits for nuclear mismatch repair. They both spel1 gene suffer a highly increased rate of instability in long form heteromers with MSH2, and as alternative partners they runs of dinucleotide repeats when analyzed after 10–12 fly determine the affinity of the complex toward base–base 1 y generations. Using a new assay, we have also discovered that mismatches (MSH2 MSH3) (25) or insertion deletion mis- 1 mutations in spel1 decrease the stability of a dinucleotide matches (MSH2 MSH6) (26). MSH4 and MSH5 are ex- repeat when it is copied into the site of a double-strand break pressed exclusively during meiosis and are required for normal during gene conversion. Contrary to the case in mammalian levels of meiotic exchange and chromosome disjunction (7). cells, spel1 deficiency does not affect tolerance of flies to a MSH4 and MSH5 form a heteromeric complex with each methylating agent nor does it affect resistance to g-irradia- other, and both are required for function. tion. The MSH2 gene limits the rate of spontaneous mutation (24). MSH2 mutants also have an increased rate of postmeiotic segregation, indicating the presence of unrepaired mismatches Escherichia coli The MutS protein of recognizes base-pair in heteroduplex DNA (24). Mutations in MSH2 as well as the mismatches in DNA as well as mismatches formed by small mutL homologs, MLH1 and PMS1, lead to a dramatic increase insertions or deletions. It binds to these structures and recruits in the instability of simple DNA repeats (3, 27). other proteins, including MutL, needed to resolve the contra- In humans, similar repeat instability is known to occur in diction. This protein complex can identify which strand to tumors from patients with hereditary nonpolyposis colon repair by sensing the methylation state of the two strands or by cancer (28). This form of cancer, as well as some sporadic the presence of single-strand breaks. A region of up to a few cancers that also show repeat instability, were found to be kilobases is removed from the ‘‘mutant’’ strand by exonuclease induced by mutations in the human mutS and mutL homologs: activity; DNA polymerase then replaces the sequence, thereby hMSH2, hMLH1, hPMS1, and hPMS2 (29–31). These muta- resolving the mismatch (reviewed in ref. 1). The fidelity of tions are inherited as if dominant, resulting in a predisposition replication is severely compromised in mutS and mutL mu- to hereditary nonpolyposis colon cancer in heterozygous in- tants, leading to an increased frequency of point mutations and dividuals, but they act recessively at the level of the cell because to instability of simple DNA repeats (2, 3). expression of the functional copy is absent in the cancers. In addition to promoting faithful replication, MutS, the Cell extracts from Drosophila have very high levels of MutS homologs (MSHs) and associated mismatch repair pro- mismatch-repair activity (32), so studying mismatch-repair teins also are involved in processing intermediates of homo- genes in flies with the powerful genetic approaches that they logous recombination, promoting meiotic crossing over and offer should illuminate the complex interactions that have double-strand break repair, and repairing oxidative and UV- been hinted at in other organisms. To begin this study, we induced DNA lesions (4–17). For example, heteroduplex DNA cloned a mutS homolog from Drosophila called spellchecker1 formed during gene conversion at the MAT locus in yeast is (spel1) and found that it is adjacent to a gene known as processed by mismatch repair at an early stage (10). Msh2 of lethal(2)35Aa. We have constructed lines of Drosophila that yeast appears to regulate the forward movement of Holliday have deletions of spel1. Although spel1-null mutants are viable junctions (4). In vitro, MutS can regulate the extent of hetero- and relatively fertile, they suffer a highly increased rate of duplex formation by blocking RecA-catalyzed branch migra- instability in dinucleotide repeats when these repeats are tion through regions with mismatches (18, 19). This may be the transmitted normally through the germ line or when copied basis for the inhibition of recombination between diverged into the site of a double-strand break during gene conversion. sequences that is absent in mismatch repair-deficient mutants However, these mutants are not significantly altered in their (6, 20–23). This activity may safeguard genome stability by sensitivity to the methylating agent methyl methanesulfonate preventing recombination between related genes within an (MMS) or to g-irradiation. organism and homologous genes between species. Abbreviations: MSH, MutS homolog; MMS, methyl methanesulfo- The publication costs of this article were defrayed in part by page charge nate; GalNAc-T, N-acetylglucosamine transferase. Data Deposition: The sequence reported in this paper has been payment. This article must therefore be hereby marked ‘‘advertisement’’ in deposited in the GenBank database (accession no. U17893). accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. e-mail: wrengels@ PNAS is available online at www.pnas.org. facstaff.wisc.edu. 2964 Downloaded by guest on September 29, 2021 Genetics: Flores and Engels Proc. Natl. Acad. Sci. USA 96 (1999) 2965 MATERIALS AND METHODS same manner using an alternative deficiency [Df(2L)A400 in place of Df(2L)GW7] to produce spel12y1 heterozygotes. All Nucleic Acid Techniques. DNA fragment isolation, ligation, of these stocks were then maintained by transferring adults to subcloning, and blotting were performed by using standard fresh vials every 21 days. This resulted in populations averag- methods (33). The sequences of the degenerate primers used ing '5–50 flies per line. for the initial PCR are ATCACNGGNCCNAAYATGGG and After 10–12 generations, DNA was prepared from one male GTCATYTCNACCATRAANGT. The enhanced chemilumi- from each line and analyzed by PCR. New alleles were nescence (ECL) direct-labeling system (Amersham Pharma- detected as novel-sized PCR fragments not present in either cia) was used to label gel-purified DNAs for screening the ancestor from the progenitor pair. cDNA library. The cDNA library was constructed in the The primers used to amplify microsatellite regions are as Thomas Schwarz laboratory (Stanford University) from a follows: acagcaacaacggagcaac (elf1-f); tctgcaacctgggagtctgg mixture of random primed and oligo(dT)-primed mRNA from (elf1-r); cgtcgatctcaagcgtctgc (mam-Dc); ggaagttggccgccgcattg Drosophila heads. Other cDNAs were obtained from the y (mam-Gc); aagatacatccgtgcgcgtat (sev-f); cccaactgaaaag- Berkeley Drosophila Genome Project HHMI EST Project caactcc (sev-r); ccaccttagggcgtggctgt (35F-f); gacatatccaaacac- (unpublished data) and from Jeff Sekelsky in the Scott Hawley caatgcac (35F-r); cttcctgtgacaatggctgg (white-f); acacacacttt- laboratory (University of California, Davis). tatactctctccgc (white-r); gggtctttctgcttcagttacc (U1a-f); ggaata- DNA Sequence Determination and Analysis. The sequence cacgaatccccctt (U1a-r); ctcttagtgcgcagggattc (tenA-f); of cloned genomic DNA and cDNA was determined by the gagtcgctcaatggcaggc (tenA-r); ttccaagtcacacggacggg (AbdB-f); dideoxy chain-termination method (34) as modified for Se- gcacaccgacaacacaagac (AbdB-r). Amplification was per- quenase 2.0 (United States Biochemical) and for fluorescent formed with one primer of each pair fluorescently labeled with DyeDeoxy terminators (Applied Biosystems). DNA sequence either 6-carboxyfluorescein (6-FAM) or 5-hexachlorofluores- was compiled using the UWGCG software (35). The DNA cein (HEX), and the products were analyzed along with DNA sequence was assigned GenBank accession no. U17893. size standards on a GeneScan gel (Applied Biosystems). Drosophila Stocks. Fly stocks were maintained on cornmeal- molasses agar at 23°C. Mutations and abbreviations not ex- plained here are described in Lindsley and Zimm (36) and in RESULTS FlyBase (37). The chromosomes used are as follows: two ethyl Isolation of spel1 cDNA and Genomic Clones. We initially SF12 methylsulfonate-induced mutants of l(2)35Aa; b l(2)35Aa amplified a 191-bp fragment of the spel1 gene from Drosophila n4 SF32 n2 Adh , and b l(2)35Aa Adh pr cn (38) and four deficien- genomic DNA by using degenerate PCR. The primers were cies, Df(2L)TE146(Z)GW7 al dp b l(2)pwn cn [abbreviated designed to hybridize to highly conserved regions of the MutS GW7 (39)], Df(2L)b84h1 [abbreviated b84h1 (40)], coding sequence based on an alignment of MutS members Df(2L)b80e3, pr bw (abbreviated b80e3), and Df(2L)A400, b from bacteria, yeast, mouse, and human. This fragment was cn bw; T(2;3;4)CA4 [abbreviated A400 (41)].